|
Originally published In Press as doi:10.1074/jbc.M008573200 on October 17, 2000
J. Biol. Chem., Vol. 276, Issue 10, 7312-7319, March 9, 2001
Crystal Structure of the C-type Lectin-like Domain from the Human
Hematopoietic Cell Receptor CD69*
Andrea S.
Llera ,
Fernando
Viedma§,
Francisco
Sánchez-Madrid§, and
José
Tormo¶
From the Department of Macromolecular Structure, Centro Nacional de
Biotecnología, Universidad Autónoma de Madrid, 28049 Madrid, Spain, Instituto de Estudios de la Inmunidad
Humoral, Consejo Nacional de Investigaciones Científicas
y Técnicas-Universidad de Buenos Aires, Junín 956, 1113 Buenos Aires, Argentina, and § Servicio de
Inmunología, Hospital de la Princesa, Universidad
Autónoma de Madrid, 28006 Madrid, Spain
Received for publication, September 19, 2000, and in revised form, October 17, 2000
 |
ABSTRACT |
CD69, one of the earliest specific
antigens acquired during lymphoid activation, acts as a
signal-transducing receptor involved in cellular activation events,
including proliferation and induction of specific genes. CD69 belongs
to a family of receptors that modulate the immune response and whose
genes are clustered in the natural killer (NK) gene complex. The
extracellular portion of these receptors represent a subfamily of
C-type lectin-like domains (CTLDs), which are divergent from true
C-type lectins and are referred to as NK-cell domains (NKDs). We have
determined the three-dimensional structure of human CD69 NKD in two
different crystal forms. CD69 NKD adopts the canonical CTLD fold but
lacks the features involved in Ca2+ and carbohydrate
binding by C-type lectins. CD69 NKD dimerizes noncovalently, both in
solution and in crystalline state. The dimer interface consists of a
hydrophobic, loosely packed core, surrounded by polar interactions,
including an interdomain sheet. The intersubunit core shows certain
structural plasticity that may facilitate conformational rearrangements
for binding to ligands. The surface equivalent to the binding site of
other members of the CTLD superfamily reveals a hydrophobic patch
surrounded by conserved charged residues that probably constitutes the
CD69 ligand-binding site.
 |
INTRODUCTION |
The C-type lectin-like domain
(CTLD)1 is a conserved
protein module that has been found in numerous proteins with a wide
range of functions (1). This fold was initially identified in a group of C-type (Ca2+-dependent) animal lectins
(sugar-binding proteins) that mediate both pathogen recognition and
cell-cell communication by means of protein-carbohydrate
interactions (2). Based on amino acid sequence comparisons,
multidomain arrangement, and functional criteria the extensive
superfamily of CTLDs has been subdivided in a variety of groups (3, 4).
Among them, those that are predicted to bind sugars through
coordination to a conserved Ca2+ ion are also known as
carbohydrate-recognition domains (CRDs). The structure of several CRDs
has been solved, and their binding to sugars has been thoroughly
characterized (1, 5). Increasing evidence shows, however, that many of
the modules that adopt a CTLD fold lack the
Ca2+-coordinating residues that mediate the classical
C-type lectin sugar binding properties, suggesting that they may serve
functions other than saccharide recognition (1).
The CTLD fold is widely represented among proteins that mediate the
innate immune response (6). In particular, a conserved genomic region
known as natural killer (NK) gene cluster (NKC) encodes for a group of
receptors with CTLD-containing sequences that are involved in
modulation of NK-cell activity and natural host defense (6, 7). Most of
these proteins are type II transmembrane receptors, usually expressed
as disulfide-linked homo- or heterodimers. Each subunit comprises a
single extracellular CTLD, specifically named NK domain (NKD),
connected by a neck region of variable length to a single
membrane-spanning region and a short intracellular N-terminal
portion (reviewed in Refs. 8 and 9). The cytoplasmic regions are often
involved in signaling by recruitment, through specific sequence motifs,
of kinases and phosphatases. Alternatively, some activating receptors, bearing short cytoplasmic tails devoid of any specific signaling sequence, associate noncovalently with membrane-anchored signaling molecules (10). Some receptors encoded in the NKC, such as the CD94/NKG2 heterodimers and the mouse Ly49 family, have proved to bind
molecules of the major histocompatibility complex (MHC) (11, 12), but
for many other receptors ligands have not yet been identified.
CD69, one of the first described members of the NKC family of receptors
(13-15), is present at the cell surface as a disulfide-linked homodimer, with subunits of 28 and 32 kDa resulting from the
differential glycosylation at a single extracellular
N-linked glycosylation site (see Ref. 16 and reviewed in
Ref. 17). Contrary to other NKC gene products, whose expression is
restricted to NK cells, CD69 has been found in the surface of most
hematopoietic lineages (reviewed in Ref. 18). It is one of the earliest
markers induced upon activation in T and B lymphocytes, NK cells,
macrophages, neutrophils, and eosinophils. In addition, it is
constitutively expressed on monocytes, platelets, Langerhans cells, and
a small percentage of resident lymphocytes in thymus and secondary
lymphoid tissues (19). CD69 is also present on B cell precursors in the bone-marrow, and recent studies with CD69-deficient mice revealed its
modulatory role on B cell development and antibody synthesis (20).
It has been demonstrated that CD69 acts as a signal-transmitting
receptor. Its cytoplasmic portion is constitutively phosphorylated on
serine residues (21, 22). Even when the actual ligand that triggers
this receptor is not known, cross-linking of CD69 by specific
antibodies activates the extracellular signal-regulated kinase
signaling pathway (23) and has been shown to induce rise in
intracellular calcium concentration, synthesis of different cytokines
and/or proliferation (24-28), and target lysis in
interleukin-2-activated NK cells (22). In summary, CD69 wide
distribution, along with its activating signal-transducing properties,
suggest an important role of this receptor in the physiology of
leukocyte activation.
As a first step toward better understanding the structural basis for
CD69 function, we have undertaken the production and analysis of
soluble constructs of the CD69 extracellular region. We report here the
three-dimensional structure of human CD69 NKD determined in two crystal
forms. We compare it with other known CTLD structures,
specifically those present in NKC receptors, describe its
dimeric oligomerization, and suggest a putative ligand-binding site.
 |
EXPERIMENTAL PROCEDURES |
Protein Expression, Refolding, and Purification--
The
complete NKD of human CD69 (residues 82-199) was amplified from
cDNA (14) by polymerase chain reaction and subcloned into
NdeI-BamHI restriction sites of pET 26b plasmid
(Novagen) (29) by double digestion and subsequent ligation. Restriction sites and a TAA termination codon were added to the insert using the
following primers: CD695s, 5'GCGCGCGCGCATATGGTTTCTTCATGCTCTG; CD693, 5'GCGCGCGGATCCTTATTTGTAAGGTTTG. Automatic DNA sequencing (ABI PRISM, PerkinElmer Life Sciences) of the cloned 1insert
using T7 promoter primer rendered the correct sequence.
The resulting plasmid was transformed into Escherichia coli
strain BL21(DE3), and these cells were grown in LB medium at 37 °C
until the A600 reached 0.7 cm 1 and
then induced by addition of
isopropyl-1-thio- -D-galactopyranoside to 0.5 mM. After 4 h, cells were harvested and resuspended in Tris-HCl, pH 8.0, 0.2 M NaCl, 5 mM EDTA, 5 mM DTT. They were lysed by adding lysozyme to a final
concentration of 1 mg/ml, and the viscosity was reduced by sonication.
The protein was obtained as insoluble aggregates forming inclusion
bodies, which were extensively washed three times in 50 mM
Tris-HCl, pH 8.0, 0.1 M NaCl, 1 mM EDTA, 1 mM DTT, 0.5% (v/v) Triton X-100 and once in 50 mM Tris-HCl, pH 8.0, 2 M NaCl, 1 M
urea, 1 mM EDTA, 1 mM DTT. The protein was solubilized in 25 mM MES, pH 6.5, 8 M urea, 10 mM EDTA, 1 mM DTT, and insoluble material was
discarded by centrifugation. The CD69 NKD was refolded by the method of
dilution of denaturing conditions following a modification of the
protocol originally described for MHC class I molecules (30).
Urea-solubilized CD69 NKD was added by slow dilution to 1 liter of 0.1 M Tris-HCl, pH 8.5, 400 mM
L-arginine, 2 mM EDTA, 6.3 mM
cysteamine, 3.7 mM cysteamine, 0.1 mM
phenylmethylsulfonyl fluoride. Repeated pulses were added every 12 h. After 36 h, the refolding mixture was concentrated under
nitrogen to a volume of 5 ml and purified by gel filtration chromatography in 25 mM Tris-HCl, pH 7.5, 100 mM NaCl, 0.1 mM EDTA on a Superdex 200 column
(Amersham Pharmacia Biotech). In these conditions, CD69 NKD elutes as a
noncovalent dimer, although the peak shows a slight asymmetry,
consistent with an equilibrium between the monomeric and dimeric forms.
Correctly sized fractions were further purified by cation exchange
chromatography using a Mono S column (Amersham Pharmacia Biotech).
Protein was loaded in 25 mM Tris-HCl, pH 7.0 and eluted
with a linear gradient to 500 mM NaCl in the same buffer.
Crystallization and Data Collection--
For crystallization,
the protein was buffer-exchanged into 15 mM Hepes, pH 7.2, 50 mM NaCl and concentrated to 5 mg/ml. Crystals were
obtained by mixing aliquots of the protein solution with an equal
volume of the reservoir solution containing 0.1 M sodium acetate buffer, pH 4.8, 150 mM zinc sulfate or sodium
sulfate, and 15% polyethylene glycol 6000. Two different crystal forms grew in these conditions. Long and thin prisms of square section, which
belong to the tetragonal system, predominated, whereas larger irregular
crystals, occasionally with a triangular shape and that belong to the
trigonal system, appeared infrequently. The tetragonal crystals belong
to the space group P43212 with unit cell
dimensions a = b = 69.6 Å and c = 118.6 Å and contain
one dimer in the asymmetric unit. The trigonal crystals belong to the
space group P3121 with unit cell dimensions a = b = 48.4 Å, c = 119.9 Å, a = = 90°, and = 120° and contain a monomer in the asymmetric unit. For cryogenic data
collection, crystals were harvested in a modified reservoir solution,
transferred to harvest buffer containing 15% glycerol or ethylene
glycol, and flash-cooled by plunging into liquid propane. The high
resolution data sets used for the structure refinement of both crystal
forms were collected at beam line ID14-3 of the European Synchrotron
Radiation Facility in Grenoble, France, using a MarResearch
charge-coupled device, whereas the initial data set in the tetragonal
form used for the structure determination was collected at beam line
ID14-2 using an ADSC Quantum4 charge-coupled device. Data were
integrated, scaled, and merged with the HKL package (31) (see
Table I).
Structure Determination and Refinement--
The CD69 structure
was determined in the tetragonal crystal form, which became available
first. The structure was solved by molecular replacement using the
AMoRe package (32) with truncated coordinates of the CD94 dimer (33) as
the search model. Structure factors from 15.0 to 5.0 Å were used for
the rotation and translation functions. Model phases were improved and
extended from 5.0 to 2.6 Å by iterative cycles of density modification
in DM (34), which consisted of solvent flattening and 2-fold
averaging. The resulting electron density maps allowed unambiguous
building of the molecule, including extensive portions, like helix
2, not present in the initial truncated model.
Crystallographic refinement was carried out in CNS (35) using
standard procedures that included a bulk solvent correction and overall
anisotropic scaling. Automatic refinement, employing the maximum
likelihood amplitude target, was alternated with manual rebuilding in
the graphics program O (36) using both averaged and unaveraged
A-weighted (37) 2Fo Fc, Fo Fc, and omit electron density maps. Tight
noncrystallographic symmetry restrains were initially applied to all
regions except the flexible loops involved in lattice contacts. When
the high resolution data set for this crystal form became available,
the noncrystallographic symmetry restrains were gradually relaxed based
on the behavior of the Rfree. All regions of
CD69 NKD are well ordered, with the exception of the tip of the
2- 2' hairpin, one residue at the N terminus, and the last two
residues at the C terminus, which show poor density and high B factors.
The model contains residues from 83 to 199 for both subunits,
and 69 solvent atoms. The present Rcrys
is 24.8, and Rfree is 27.0 for all data
(F > 0) between 25.0 and 1.95 Å.
The trigonal crystal form was readily solved using a partially refined
model from the tetragonal crystal form and was similarly refined in
CNS. Electron density maps clearly showed two possible conformations
for residues at the carboxy end of helix 2. Therefore, residues 133 to 136 were modeled in two alternate conformations with half-occupancy.
All residues, including the 2- 2' hairpin, showed in the electron
density maps. The model contains residues from 83 to 199 for both
subunits, and 115 solvent atoms. The present Rcrys is 22.9%, and
Rfree is 24.4% for all data (F>0) between 20.0 and 1.50 Å. Refinement statistics for both crystal forms are given in
Table I.
Structure Analysis--
Structure superpositions were done with
SHP (38). Solvent-accessible surface areas were determined with
NACCESS (39) using a probe radius of 1.4 Å and default atom radii
(40), and cavity volumes were determined with SURFNET (41). Calculation
of hydrogen bonds was carried out with HBPLUS (42) using the program's
default values. Figures were produced with GRASP (43) and BOBSCRIPT (44) and rendered with RASTER3D (45).
Alignments--
The human CD69-NKD sequence was aligned to
representatives of the NKD family using ClustalW at ExPASy on the
Internet and were subsequently edited manually based on the
known structures of rat mannose-binding protein (MBP)-A (PDB
accession code 1ytt), mouse Ly49A (1qo3), and human CD94 (1b6e).
Sequences were retrieved from GenBankTM (hCD69,
NP_001772.1; hMAFA-L, AAC32200; hAICL, NP_005118; hLLT1, NP_037401;
hNKRP1A, NP_002249; hKLRF1, AAF37804; hCLEC2, AAF36777.1; hCD94,
NP_002253; hNKG2A, NP_002250.1; mLy49A, I49361) and Swiss-Prot (mCD69,
P37217; rMBP-A, P19999). The alignment figure was drawn using ESPript
(46).
 |
RESULTS AND DISCUSSION |
Structure Determination and Quality of the Models--
Human CD69
consists of a 40-residue intracellular domain, a 21-residue
transmembrane region, and an extracellular portion that comprises a
20-residue neck and an NKD of 118 amino acids. Soluble forms of CD69
NKD, comprising residues 82 to 199, were prepared by in
vitro refolding from material expressed in E. coli. Recombinant CD69 NKD retains binding to a panel of specific monoclonal antibodies recognizing four distinct epitopes (16), and it behaves as a
noncovalent dimer during gel filtration (results not shown).
The structure of CD69 NKD was determined by molecular replacement in
two different crystal forms, tetragonal and trigonal, and refined to
1.95 and 1.50 Å, respectively. The quality of the diffraction data and
refinement statistics are given in Table I. The tetragonal crystal form contains
two molecules in the asymmetric unit, related by a molecular 2-fold
axis. The electron density is continuous in the final 2Fo
Fc map from residues 83 to 199, except for the exposed 2- 2' hairpin that shows weak density and
appears to be disordered (see below for a description of secondary
structure elements). In the trigonal crystal, the CD69 NKD dimer is
crystallographic, and there is a single molecule in the asymmetric
unit. In this crystal form, all residues (83 to 199), including the
2- 2' hairpin, are in good, continuous density in the final
electron density maps. The C-terminal end of helix 2 shows static
disorder and has been modeled in two alternate conformations in the
trigonal form.
Pairwise superpositions of the three independent copies for CD69 NKD
give r.m.s. deviations from 0.27 to 0.40 Å for main chain atoms
between residues 89 and 198. The largest differences are focused in the
domain N terminus, around the turn (residues 86-89), which
precedes strand 0, and the 2- 2' hairpin. In the tetragonal
form, this flexible hairpin is exposed to the solvent, whereas in the
trigonal crystal it is better ordered because of crystal packing
interactions. Description of the structure is based on the high
resolution trigonal model unless specifically stated.
The CD69 NKD Fold--
The -carbon trace of CD69 NKD is shown
in Fig. 1A. As predicted by
its amino acid sequence, the overall structure of CD69 NKD displays the
salient features of the CTLD fold. The domain, with overall dimensions
of 44 × 32 × 30 Å, consists of two connected antiparallel
sheets and two helices, like in the CRD of C-type animal
lectins (1) and mouse Ly49A NKD (47) (Fig. 1B). Strand 2
acts as a connection between the two sheets formed by strands 0,
1, 5, 2, and 1' in the lower part of the molecule
(following the standard view for CTLD folds as shown in Fig. 1) and
strands 2', 2, 3, and 4 in the upper part. This portion of
the molecule is also characterized by a long stretch, connecting
strands 2' and 3, lacking regular secondary structure. This
region corresponds to the Ca2+-binding site of true C-type
lectins. The two helices, 1 and 2, are located one on each side
of the extended structure.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 1.
Structure of human CD69 and
comparison with other members of the NK-cell receptor family and the
CRD of rat MBP. A, stereoview of the -carbon trace
of CD69 NKD. Every tenth residue is represented as a gray
sphere and numbered according to its order in the full-length
protein. Segments are colored based on secondary structure assignments,
as calculated with program DSSP (59). The helices are shown
in red, strands are shown in blue, and the
rest of the residues are shown in yellow. Disulfide bonds
are represented by green ball-and-stick models. The N- and C
termini of the domain, which are less than 7 Å apart, are labeled.
B, fold of CD69 NKD. Comparison with other members of the
NK-cell receptor family and the CRD of rat MBP-A as a prototype of
animal lectins is shown. Ribbon diagrams of the NKDs from
human CD69, human CD94 (PDB entry 1b6e), mouse Ly49A (1qo3), and the
CRD of rat MBP-A (1ytt) are shown in a common orientation obtained by
pairwise superpositions. Ca2+ ions bound to MBP-A are shown
as light blue spheres, whereas its loop regions without
regular secondary structure, three of them involved in Ca2+
coordination, are labeled L1 to L4. Secondary
structure elements in CD69 have been labeled following the numbering
for MBP-A, prototype of the family. Therefore, the first strand,
which is absent in MBP-A and is characteristic of the long-form CTLDs,
has been labeled as 0, whereas the strand that forms a -hairpin
with strand 2 has been named 2'. Differences in the orientation
of helix 2, which is absent in CD94, are evident.
|
|
There are three intrachain disulfide bonds in CD69 NKD (Fig. 1), two of
which (Cys113-Cys194 and
Cys173-Cys186) correspond to the
characteristic invariant disulfides found in all CTLDs. The third
disulfide bond, Cys85-Cys96, connects a loop
at the N terminus, which precedes the first strand ( 0), with
strand 1 by linking two cysteines separated by 10 residues in this
segment. This disulfide is only found in long-form C-type lectins
(including lithostathine, tetranectin, and factors IX/X-binding
protein) (4) and appears to be present in most NKD domains (Fig.
2). In members of the rodent Ly49 gene family, however, these two bonded cysteines are separated by only four
residues and are located on contiguous strands (47) (Fig. 1B).

View larger version (72K):
[in this window]
[in a new window]
|
Fig. 2.
Structure-based sequence alignment of NKDs
for CD69, selected NK-cell receptors, and the rat MBP-A CRD.
NK-cell receptors have been arranged in two groups. The first group
contains human CD69, its mouse homologue, and other human C-type
lectin-like receptors encoded in the NK complex, which, based on their
amino acid sequences, do not appear to use carbohydrates as ligands.
The second group contains the mouse Ly49A receptor, also encoded in the
NK complex, whereas the third group includes the prototype animal
lectin, rat MBP-A. Residues strictly conserved are shown by white
characters on a red background. They include the four cysteines
involved in the two disulfide bridges conserved in the C-type
lectin-like superfamily and the glycine residue where strand 2
switches from one sheet to another. Residues well conserved within
the first NKD group are depicted by red letters, and the
rest are in black. A blue frame denotes
similarity across groups. The secondary structural elements and every
tenth residue for CD69 are displayed over the sequences. Helices are
represented by red squiggles, and strands are
represented by blue arrows. The paired numbers (1 to 3)
correspond to the bonded cysteines in CD69. Ly49A residues labeled as
orange boxes correspond to those involved in molecular
contacts with its ligand, the mouse MHC class I molecule
H-2Dd, as observed in the crystal structure of their
complex (47). Rat MBP-A residues enclosed in yellow boxes
indicate those whose side chains coordinate the Ca2+ ion
involved in carbohydrate binding (48).
|
|
Despite the low sequence identity between CD69 NKD and other CTLDs,
which ranges from around 20% with CRDs of animal lectins to almost
30% for other NKDs, the overall structure of the domain is highly
conserved. Superposition of CD69 with other CTLDs gives rise to r.m.s.
deviations of between 1.2 Å for 100 equivalent C atoms with Ly49A
and 1.4 Å for 95 equivalences with rat MBP (48). The major differences
among them occur at the N terminus, the position of helix 2, hairpin
2- 2', the loop connecting it to strand 3, and hairpin
3- 4 (Fig. 1B). These regions coincide with segments
displaying higher variability in length and amino acid sequence among
members of the NKD family (Fig. 2). Overall, CD69 NKD is more similar
to long-form CTLDs, like tetranectin or lithostathine, and to
other NKDs, like Ly49A. Although based on sequence identity the NKD
structure closer to CD69 is that of the CD94 subunit of the NK-cell
receptor CD94/NKG2 (around 28% identical), their superposition gives
an r.m.s. deviation of 1.4 Å for 97 equivalent C positions. This
relatively poorer match is mostly due to differences between helix 2
in CD69 and the equivalent region in CD94. In the crystal structure of
the CD94 NKD homodimer, this helix is replaced by a loop that is
involved in the dimerization interface (33). CD94 forms, with distinct members of the NKG2 family, heterodimers that are involved in the
recognition of the nonclassical MHC class I molecule HLA-E (49-51).
The unraveling of this helix in the crystal structure of CD94 NKD
could be because of the formation of the homodimer, whose physiological
role is uncertain. The amino acid sequence at this region retains a
distribution of hydrophobic residues that appears suitable for the
formation of an helix, but analysis of sequence alignments reveals
that, in CD94 and NKG2 proteins, this segment is two residues shorter
than in the majority of NKD sequences. Whether the lack in CD94 of this
helix is due to the formation of the homodimer or consequence of
the deletion at the C-terminal end of this segment would have to await
the determination of the structure of a CD94/NKG2 heterodimer.
CD69 and other NKDs differ substantially from canonical C-type lectins
in that they lack the Ca2+-binding site that is critical
for carbohydrate recognition in CRDs. The departure of the equivalent
regions in different NKDs from the canonical Ca2+-binding
site appears gradual. In Ly49A, three side chains are in a position
similar to that of Ca2+-coordinating residues, whereas in
CD94 two appear in an equivalent position. CD69 shows a deletion of
five residues that constitute loops 3 and 4 in the CRDs (Fig.
1B), both structures involved in Ca2+ and
carbohydrate binding, and only one residue (Asp171) is
located in a position roughly equivalent to any of the side chains
involved in the coordination of the Ca2+ ion in C-type
lectins. Furthermore, this aspartate is not conserved and is replaced
by a glycine in mouse CD69. The extensive alteration of the putative
binding site for carbohydrates in CD69 argues against its binding to
sugars, at least using the same mechanism as C-type lectins. This is
consistent with a recent report showing binding neither to
monosaccharides nor to various polysaccharides but only a weak binding
signal to fucoidan (52).
The CD69 NKD Dimer--
CD69, along with other receptors encoded
in the NKC, is a dimeric type II membrane protein. Most receptors in
this group appear to be covalent dimers through the formation of one or
a few interchain disulfide bridges in the neck, a region that connects
the NKD to the single membrane-spanning segment and presents high
variability among members of the family. The extracellular part of CD69
encompasses a neck of around 20 amino acids (residues 62-84), which
contains the cysteine (Cys68) involved in the interchain
disulfide bridge, and the globular NKD. The recombinant CD69 NKD used
in this work forms noncovalent dimers in both crystal forms analyzed.
Furthermore, it behaves as a dimer during size-exclusion
chromatography. In the trigonal crystal, the dimer is crystallographic,
whereas in the tetragonal form there are two CD69 copies in the
asymmetric unit related by a molecular 2-fold axis. The two dimers are
almost identical, with an r.m.s. deviation of 0.35 Å for their main
chain atoms. This difference is in the same range as that between the
two independent copies in the asymmetric unit of the tetragonal
crystal form (0.4 Å).
The dimer has overall dimensions of 30 × 35 × 70 Å and is
stabilized by both intermolecular
hydrogen bonds and hydrophobic interactions (Figs.
3 and 4).
An intermolecular sheet extending through both subunits is
formed through antiparallel pairing of their N-terminal strands
( 0). At the ends of the paired strands and over them, additional
polar interactions are established. The main-chain carbonyl of
Glu87, located in the turn preceding chain 0, forms
two hydrogen bonds with main-chain and side-chain nitrogen atoms of
Gln83 at the turn connecting strands 0 and 1.
Asp88, in the same turn as Glu87,
establishes a salt bridge with Lys127, located at the N
terminus of helix 2. At the domain N terminus, and over the
intermolecular sheet, Ser84 from both subunits
associate with each other through several hydrogen bonds. Although
these interactions, between Ser84 at the N termini of both
subunits, are seen in the two crystal forms, it cannot be excluded that
they are a consequence of the truncated domain used for these
crystallographic studies. Interestingly, in a group of recently
described receptors expressed on the surface of human macrophage and
dendritic cells, which appear to have CTLDs with a functional
Ca2+-binding site, Ser84 is replaced by a
cysteine residue (53-55). Based on the structure of CD69, where the
side chains of Ser84 are hydrogen bonded through their
hydroxyl groups, it seems probable that the equivalent cysteine in
those receptors could well be involved in an interchain disulfide
bridge.

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 3.
The CD69 dimer and its comparison to other
dimeric CTLDs. Ribbon diagrams showing two views of
dimers for CD69, CD94, Ly49A, and the tunicate lectin TC14 are
displayed. In the left view, the molecular 2-fold axes run
along the vertical. The right view is rotated 90° from the
left one around the horizontal axis, so the molecular 2-fold is
perpendicular to the plane of the figure. Secondary structure elements,
as defined by the program DSSP (59), are shown in blue for
strands and in red for helices. The disulfide
bridges are represented by green ball-and-stick models, and
the Ca2+ ions in TC14 are represented as blue
spheres. The first three dimers (CD69, CD94, and Ly49A) are all
NKDs encoded in the NK gene cluster. For CD94 and Ly49A, their left
view has been aligned to that of CD69 by superimposing only the subunit
on the right, so differences in dimerization are shown as different
orientations of their left subunits. The dimerization arrangements in
NKDs are very similar but with some significant differences. The CD94
dimer is the closest to CD69, although the segment of CD94
corresponding to helix 2 in other CTLDs does not form a helix in the
homodimer. The Ly49A dimer, which was determined in complex with the
mouse MHC class I molecule H-2Dd, does not follow strict
2-fold symmetry.
|
|

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 4.
The dimerization interface in CD69.
A, stereoview of the dimerization interface in CD69. The two
subunits of the dimer are shown as ribbon diagrams in
different colors, yellow and green. The backbone
of strand 0 and side chains involved in hydrogen bonds or
hydrophobic interactions are represented by ball-and-stick
models. Hydrogen bonds are shown as white broken lines.
B, cavity and static disorder at the dimer interface. A
close-up of the hydrophobic cluster at the dimer interface is shown.
The solvent-accessible surface and the intersubunit cavity, as
calculated with program SURFNET (41), are shown as a
semitransparent surface. For the right subunit,
the two alternate conformations for Tyr135 side chain and
the backbone atoms of surrounding residues are shown in different
colors, solid green and semitransparent green. In
the green subunit, strand 0 is shown as a coil
instead of an arrow for clarity.
|
|
Beneath the intersubunit sheet, the two subunits associate through
the juxtaposition of the C-terminal half of helix 2 (Fig. 4). A
hydrophobic core is formed by side chains projecting from helix 2
(Phe131, Tyr135) and from the bottom of the
intermolecular sheet (Val90, Tyr92). The
side chain of Arg134, also on helix 2, extends across
the dimer interface and forms a hydrogen bond with the carbonyl of
Tyr135 at the carboxy end of the same helix on the
neighboring subunit; this interaction probably stabilizes the helix
dipole. Underneath the hydrophobic core there are contacts between
Tyr138, in the loop connecting helix 2 to strand 2,
and Asn178 and Thr179, both at the turn
between strands 3 and 4. The packing at the hydrophobic core is
loose, and there is an interdomain cavity of 75.5 Å3
between the aromatic side chains of Phe131 and
Tyr135 (Fig. 4B). In the high resolution
trigonal form, there is static disorder at the C terminus of helix
2, and residues 133 to 136 show two alternate conformations (Fig.
5). This disorder appears to be triggered
by a displacement of the side chain of Tyr135 to fill the
empty cavity at the dimer interface. In one conformation, Tyr135 fills a cavity formed by residues Val90,
Tyr97, Ile99, Phe131,
Ile132, and Ile193 from its own subunit. In the
second conformation, Tyr135, together with the backbone of
neighboring residues, has been displaced to pack against residues
Phe131, Tyr135, and Arg134 of the
symmetry-related subunit. The r.m.s. difference for Tyr135
in the two conformations is 2.8 Å. This alternate conformation cannot
occur simultaneously in both subunits, because it would give rise to
steric clashes around the 2-fold axis. Although these dual
conformations are not observed in the tetragonal crystal, perhaps
because of its more limited resolution, disorder in this region is
manifested as a diffuse electron density and higher thermal factors for
the side chain of Tyr135, which are also consistent with
certain structural variability at the interface. The residues involved
in the formation of this interdomain cavity, especially the two
aromatic side chains, are conserved in other members of this family
(Figs. 2 and 3), suggesting that this feature may also be present in
other receptors. Plasticity at the dimer interface was also observed in
Ly49A when bound to its MHC class I ligand (Fig. 3). In the complex,
the Ly49A subunits are not related by a strict 2-fold axis, probably
because of packing restrictions in the simultaneous binding to
different sites on two MHC molecules (47). There is a shift in the
position of the 2-fold axis with respect to the N-terminal strand
that results in a slightly different arrangement of the subunits so
that juxtaposed helices do not run roughly parallel but are
approximately aligned. This departure from dyad symmetry is accompanied
by structural differences between several residues at the
interface.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 5.
Electron density map for helix
2. A 1.5-Å resolution electron density map
calculated with A-weighted (37)
2Fo Fc amplitudes and
model phases for residues Asn130 to Gly137 in
helix 2 is shown together with the final refined model. Static
disorder in the C-terminal half of the helix, because of rearrangements
at the dimer interface, is evident, especially for the side chain of
Tyr135. The two alternate conformations modeled for
residues 133 to 136 are shown in cyan and white,
respectively.
|
|
These packing defects and flexibility at the dimer interface of NKDs
can provide a structural mechanism to allow conformational rearrangements to facilitate the simultaneous binding of the two subunits of the dimer to oligomeric or different ligands. Protein cavities at domain interfaces have been suggested to facilitate such
movements (56). Furthermore, the flexible neck region would allow
various orientations of the NKD domains with respect to the cell
membrane, whereas the intermolecular disulfide bridge would ensure that
subunits would not dissociate.
The dimer arrangement in CD69 is very similar to that observed for the
CD94 crystallographic dimer, even though helix 2 has been replaced
by a loop in the latter. After superposition of one subunit of both
dimers, the other two can be superimposed after a rotation of only
6°. In CD69, the total buried surface area between the subunits is
1673 Å2. Atoms buried at the interface are 48% nonpolar,
and there are twelve hydrogen bonds and two salt bridges. The CD94
dimer buries a similar overall surface (1224 Å2), but the
percentage of nonpolar atoms involved is higher (61%), and there are
only 2 hydrogen bonds. Ly49A, partly because of the absence of an
N-terminal loop preceding strand 0, buries a smaller surface (930 Å), with only 3 hydrogen bonds. The dimer from the tunicate lectin
TC14, an example of a naturally dimeric C-type lectin, buries 1687 Å2 and forms 10 hydrogen bonds, very similar values to
those of CD69, but the atoms buried at the interface are more
hydrophobic (73%). The formation of dimers in TC14 also occurs between
helix 2 and the N-terminal strand. However, the arrangement of
the subunits is different, because it involves much more extensive contacts between the sides of the helices, which are arranged side by
side, and uses strand 1 instead of 0, because TC14 is a
short-form lectin. Therefore, although the overall arrangement of the
subunits in these dimeric CTLDs is similar, the detailed interactions
involved in oligomerization are different among the various receptors.
These differences could affect the structural plasticity and stability
of the dimers.
The Putative Ligand-binding Site--
In all NKD structures known
to date, the apposition of the two monomers generates a relatively
flat, continuous surface that is located opposite to the N and C
termini, and that includes the regions equivalent to the
carbohydrate-binding site of CRDs at opposite ends (Figs. 3 and
6). This is one of the most variable regions, both in structure and amino acid sequence, in the NKDs (Fig.
2), and this variability is consistent with this part of the molecule
being involved in selective binding to ligands by receptors bearing
these domains. For Ly49A, this region has indeed been shown to contain
the binding site for its ligand, MHC class I molecules (47). This same
region has been postulated to constitute the ligand-binding site of the
CD94/NKG2 heterodimers (33).

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 6.
Surface analysis of the hypothetical
ligand-binding site in CD69. A, representation of the
solvent-accessible surfaces of the ligand-binding site in Ly49A
(left) and the equivalent region in CD69 (right).
Surfaces have been colored based on the nature of the underlying atoms
(carbons and sulfurs in green, polar nitrogens and oxygens
in pink, charged nitrogens in dark blue, and
charged oxygens in red). For Ly49A, the footprinting of its
ligand, the mouse MHC class I molecule H-2Dd, has been
contoured with a black line. In CD69, relevant residues in
the putative ligand-binding site have been labeled. B,
overview of the CD69 dimer with the region highlighted in panel
A enclosed in a black box.
|
|
Analysis of the amino acid conservations between human and mouse CD69
that, at the same time, differ significantly from other CTLDs,
specially those of the NKD family, also pinpoints this region as
functionally relevant, supporting the suggestion that this region is
the potential ligand-binding site (57). In CD69, this surface is
characterized by a central hydrophobic patch (side chains of
Phe175, Met184, and Leu190 and the
aliphatic portions of Glu185 and Lys188)
surrounded by polar side chains, among which acidic residues (Glu140, Asp171, Glu180,
Glu185, and Glu187) predominate (Fig. 6). The
topology and chemical nature of this putative binding region appear
more similar to a protein-protein recognition site than to a
carbohydrate binding surface (5, 58). This observation is consistent
with recent data for recombinant CD69 that showed no binding signals to
the various monosaccharides tested (52).
In summary, this work provides the first structural insights on human
CD69 and constitutes a firm basis for future analysis of the
interactions between this receptor and its ligand(s), once they are
identified. The structure reveals that, whereas the molecule presents
the overall characteristics of the CTLD fold, it completely lacks the
structural features responsible for carbohydrate binding. Rather, the
putative binding site is more consistent with this receptor having a
proteinaceous ligand. The identification of a buried cavity at the
dimer interface and the conservation of several key residues involved
in its formation suggest the possibility that this feature, which may
confer flexibility at the dimer, could be also present in other
receptors of the family.
 |
ACKNOWLEDGEMENTS |
We thank F. Torrents for computing
facilities, J. Navaza for valuable advice, J. Colom for assistance
during purification, and the laboratories of M. Coll and I. Fita for
help and support. We are grateful to the staff at European Synchrotron
Radiation Facility (ESRF) beam lines ID14-2 and 14-3. We also thank the European Molecular Biology Laboratory Grenoble Outstation for providing support for measurements at ESRF under the European Union
`Access to Research Infrastructures' action of the Improving Human
Potential Program.
 |
FOOTNOTES |
*
This work was supported by the Spanish Dirección
General de Enseñanza Superior (PB96-0271) and Fundación
Antorchas, Argentina.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The atomic coordinates and the structure factors (code 1E87 and 1E8I) have been deposited in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ (http://www.rcsb.org/).
¶
To whom correspondence should be addressed: Centro Nacional de
Biotecnología, Campus de la Universidad Autónoma de
Madrid, Cantoblanco, 28049 Madrid, Spain. Tel.: 34-915854917; Fax:
34-915854506; E-mail: jtormo@cnb.uam.es.
Published, JBC Papers in Press, October 17, 2000, DOI 10.1074/jbc.M008573200
 |
ABBREVIATIONS |
The abbreviations used are:
CTLD(s), C-type
lectin-like domain(s);
NK, natural killer;
NKD(s), NK-cell receptor domain(s);
NKC, NK gene cluster;
CRD(s), carbohydrate-recognition domain(s);
MHC, major histocompatibility complex;
MBP, mannose-binding
protein;
r.m.s., root mean square;
DTT, dithiothreitol;
MES, 4-morpholinoethanesulfonic acid.
 |
REFERENCES |
| 1.
|
Drickamer, K.
(1999)
Curr. Opin. Struct. Biol.
9,
585-590
|
| 2.
|
Drickamer, K.,
and Taylor, M. E.
(1993)
Annu. Rev. Cell Biol.
9,
237-264
|
| 3.
|
Drickamer, K.
(1993)
Curr. Opin. Struct. Biol.
3,
393-400
|
| 4.
|
Day, A. J.
(1994)
Biochem. Soc. Trans.
22,
83-88
|
| 5.
|
Weis, W. I.,
and Drickamer, K.
(1996)
Annu. Rev. Biochem.
65,
441-473
|
| 6.
|
Weis, W. I.,
Taylor, M. E.,
and Drickamer, K.
(1998)
Immunol. Rev.
163,
19-34
|
| 7.
|
Brown, M. G.,
Scalzo, A. A.,
Matsumoto, K.,
and Yokoyama, W. M.
(1997)
Immunol. Rev.
155,
53-65
|
| 8.
|
Lanier, L. L.
(1998)
Annu. Rev. Immunol.
16,
359-393
|
| 9.
|
López-Botet, M.,
and Bellón, T.
(1999)
Curr. Opin. Immunol.
11,
301-307
|
| 10.
|
Bléry, M.,
Olcese, L.,
and Vivier, E.
(2000)
Hum. Immunol.
61,
51-64
|
| 11.
|
Ugolini, S.,
and Vivier, E.
(2000)
Curr. Opin. Immunol.
12,
295-300
|
| 12.
|
López-Botet, M.,
Llano, M.,
Navarro, F.,
and Bellón, T.
(2000)
Semin. Immunol.
12,
109-119
|
| 13.
|
Hamann, J.,
Fiebig, H.,
and Strauss, M.
(1993)
J. Immunol.
150,
4920-4927
|
| 14.
|
López-Cabrera, M.,
Santis, A. G.,
Fernández-Ruiz, E.,
Blacher, R.,
Esch, F.,
Sánchez-Mateos, P.,
and Sánchez-Madrid, F.
(1993)
J. Exp. Med.
178,
537-547
|
| 15.
|
Ziegler, S. F.,
Levin, S. D.,
Johnson, L.,
Copeland, N. G.,
Gilbert, D. J.,
Jenkins, N. A.,
Baker, E.,
Sutherland, G. R.,
Feldhaus, A. L.,
and Ramsdell, F.
(1994)
J. Immunol.
152,
1228-1236
|
| 16.
|
Sánchez-Mateos, P.,
and Sánchez-Madrid, F.
(1991)
Eur. J. Immunol.
21,
2317-2325
|
| 17.
|
Testi, R.,
D'Ambrosio, D.,
De Maria, R.,
and Santoni, A.
(1994)
Immunol. Today
15,
479-483
|
| 18.
|
Marzio, R.,
Mauel, J.,
and Betz-Corradin, S.
(1999)
Immunopharmacol. Immunotoxicol.
21,
565-582
|
| 19.
|
Sánchez-Mateos, P.,
Cebrián, M.,
Acevedo, A.,
López-Botet, M.,
De Landázuri, M. O.,
and Sánchez-Madrid, F.
(1989)
Immunology
68,
72-79
|
| 20.
|
Lauzurica, P.,
Sancho, D.,
Torres, M.,
Albella, B.,
Marazuela, M.,
Merino, T.,
Bueren, J. A.,
Martínez,-A, C.,
and Sánchez-Madrid, F.
(2000)
Blood
95,
2312-2320
|
| 21.
|
Testi, R.,
Phillips, J. H.,
and Lanier, L. L.
(1988)
J. Immunol.
141,
2557-2563
|
| 22.
|
Lanier, L. L.,
Buck, D. W.,
Rhodes, L.,
Ding, A.,
Evans, E.,
Barney, C.,
and Phillips, J. H.
(1988)
J. Exp. Med.
167,
1572-1585
|
| 23.
|
Zingoni, A.,
Palmieri, G.,
Morrone, S.,
Carretero, M.,
López-Botet, M.,
Piccoli, M.,
Frati, L.,
and Santoni, A.
(2000)
Eur. J. Immunol.
30,
644-651
|
| 24.
|
Cebrián, M.,
Yague, E.,
Rincón, M.,
López-Botet, M.,
De Landázuri, M. O.,
and Sánchez-Madrid, F.
(1988)
J. Exp. Med.
168,
1621-1637
|
| 25.
|
Nakamura, S.,
Sung, S. S.,
Bjorndahl, J. M.,
and Fu, S. M.
(1989)
J. Exp. Med.
169,
677-689
|
| 26.
|
Testi, R.,
Phillips, J. H.,
and Lanier, L. L.
(1989)
J. Immunol.
143,
1123-1128
|
| 27.
|
Santis, A. G.,
Campanero, M. R.,
Alonso, J. L.,
Tugores, A.,
Alonso, M. A.,
Yague, E.,
Pivel, J. P.,
and Sánchez-Madrid, F.
(1992)
Eur. J. Immunol.
22,
1253-1259
|
| 28.
|
De Maria, R.,
Cifone, M. G.,
Trotta, R.,
Rippo, M. R.,
Festuccia, C.,
Santoni, A.,
and Testi, R.
(1994)
J. Exp. Med.
180,
1999-2004
|
| 29.
|
Studier, F. W.,
Rosenberg, A. H.,
Dunn, J. J.,
and Dubendorff, J. W.
(1990)
Methods Enzymol.
185,
60-89
|
| 30.
|
Garboczi, D. N.,
Hung, D. T.,
and Wiley, D. C.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
3429-3433
|
| 31.
|
Otwinowski, Z.,
and Minor, W.
(1997)
Methods Enzymol.
276,
307-326
|
| 32.
|
Navaza, J.
(1994)
Acta Crystallogr. Sect. A
50,
157-163
|
| 33.
|
Boyington, J. C.,
Riaz, A. N.,
Patamawenu, A.,
Coligan, J. E.,
Brooks, A. G.,
and Sun, P. D.
(1999)
Immunity
10,
75-82
|
| 34.
|
Cowtan, K. D.
(1994)
Joint CCP4 ESF-EACMB Newslett.
31,
34
|
| 35.
|
Brünger, A. T.,
Adams, P. D.,
Clore, G. M.,
DeLano, W. L.,
Gros, P.,
Grosse-Kunstleve, R. W.,
Jiang, J.-S.,
Kuszewski, J.,
Nilges, M.,
Pannu, N. S.,
Read, R. J.,
Rice, L. M.,
Simonson, T.,
and Warren, G. L.
(1998)
Acta Crystallogr. Sect. D Biol. Crystallogr.
54,
905-921
|
| 36.
|
Jones, T. A.,
Zou, J. Y.,
Cowan, S. W.,
and Kjeldgaard, M.
(1991)
Acta Crystallogr. Sect. A
47,
110-119
|
| 37.
|
Read, R. J.
(1986)
Acta Crystallogr. Sect. A
42,
140-149
|
| 38.
|
Stuart, D. I.,
Levine, M.,
Muirhead, H.,
and Stammers, D. K.
(1979)
J. Mol. Biol.
134,
109-142
|
| 39.
|
Hubbard, S. J.,
and Thornton, J. M.
(1993)
NACCESS
, Department of Biochemistry and Molecular Biology, University College, London
|
| 40.
|
Chothia, C.
(1976)
J. Mol. Biol.
105,
1-12
|
| 41.
|
Laskowski, R. A.
(1995)
J. Mol. Graph.
13,
323-330
|
| 42.
|
McDonald, I. K.,
and Thornton, J. M.
(1994)
J. Mol. Biol.
238,
777-793
|
| 43.
|
Nicholls, A.,
Sharp, K. A.,
and Honig, B.
(1991)
Proteins
11,
281-296
|
| 44.
|
Esnouf, R. M.
(1997)
J. Mol. Graph.
15,
133-138
|
| 45.
|
Merrit, E. A.,
and Murphy, M. E. P.
(1994)
Acta Crystallogr. Sect. D Biol. Crystallogr.
50,
869-873
|
| 46.
|
Gouet, P.,
Courcelle, E.,
Stuart, D. I.,
and Metoz, F.
(1999)
Bioinformatics (Oxf.)
15,
305-308
|
| 47.
|
Tormo, J.,
Natarajan, K.,
Margulies, D. H.,
and Mariuzza, R. A.
(1999)
Nature
402,
623-631
|
| 48.
|
Weis, W. I.,
Kahn, R.,
Fourme, R.,
Drickamer, K.,
and Hendrickson, W. A.
(1991)
Science
254,
1608-1615
|
| 49.
|
Braud, V. M.,
Allan, D. S.,
O'Callaghan, C. A.,
Soderstrom, K.,
D'Andrea, A.,
Ogg, G. S.,
Lazetic, S.,
Young, N. T.,
Bell, J. I.,
Phillips, J. H.,
Lanier, L. L.,
and McMichael, A. J.
(1998)
Nature
391,
795-799
|
| 50.
|
Borrego, F.,
Ulbrecht, M.,
Weiss, E. H.,
Coligan, J. E.,
and Brooks, A. G.
(1998)
J. Exp. Med.
187,
813-818
|
| 51.
|
Lee, N.,
Llano, M.,
Carretero, M.,
Ishitani, A.,
Navarro, F.,
López-Botet, M.,
and Geraghty, D. E.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
5199-5204
|
| 52.
|
Childs, R. A.,
Galustian, C.,
Lawson, A. M.,
Dougan, G.,
Benwell, K.,
Frankel, G.,
and Feizi, T.
(1999)
Biochem. Biophys. Res. Commun.
266,
19-23
|
| 53.
|
Suzuki, N.,
Yamamoto, K.,
Toyoshima, S.,
Osawa, T.,
and Irimura, T.
(1996)
J. Immunol.
156,
128-135
|
| 54.
|
Matsumoto, M.,
Tanaka, T.,
Kaisho, T.,
Sanjo, H.,
Copeland, N. G.,
Gilbert, D. J.,
Jenkins, N. A.,
and Akira, S.
(1999)
J. Immunol.
163,
5039-5048
|
| 55.
|
Bates, E. E.,
Fournier, N.,
García, E.,
Valladeau, J.,
Durand, I.,
Pin, J. J.,
Zurawski, S. M.,
Patel, S.,
Abrams, J. S.,
Lebecque, S.,
Garrone, P.,
and Saeland, S.
(1999)
J. Immunol.
163,
1973-1983
|
| 56.
|
Hubbard, S. J.,
and Argos, P.
(1996)
J. Mol. Biol.
261,
289-300
|
| 57.
|
Bajorath, J.,
and Aruffo, A.
(1994)
J. Biol. Chem.
269,
32457-32463
|
| 58.
|
Lo Conte, L.,
Chothia, C.,
and Janin, J.
(1999)
J. Mol. Biol.
285,
2177-2198
|
| 59.
|
Kabsch, W.,
and Sander, C.
(1983)
Biopolymers
22,
2577-2637
|
| 60.
|
Laskowski, R. A.,
MacArthur, M. W.,
Moss, D. S.,
and Thornton, J. M.
(1993)
J. Appl. Crystallogr.
26,
283-291
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. A. Markiewicz, L. N. Carayannopoulos, O. V. Naidenko, K. Matsui, W. R. Burack, E. L. Wise, D. H. Fremont, P. M. Allen, W. M. Yokoyama, M. Colonna, et al.
Costimulation through NKG2D Enhances Murine CD8+ CTL Function: Similarities and Differences between NKG2D and CD28 Costimulation
J. Immunol.,
September 1, 2005;
175(5):
2825 - 2833.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.Y. Thum, S. Bhaskaran, H.I. Abdalla, B. Ford, N. Sumar, H. Shehata, and A.S. Bansal
An increase in the absolute count of CD56dimCD16+CD69+ NK cells in the peripheral blood is associated with a poorer IVF treatment and pregnancy outcome
Hum. Reprod.,
October 1, 2004;
19(10):
2395 - 2400.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Favier, E. Espinosa, J. Tabiasco, C. Dos Santos, M. Bonneville, S. Valitutti, and J.-J. Fournie
Uncoupling between Immunological Synapse Formation and Functional Outcome in Human {gamma}{delta} T Lymphocytes
J. Immunol.,
November 15, 2003;
171(10):
5027 - 5033.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. Engel, S. Oezbek, R. Engel, B. Petri, F. Lottspeich, and T. W. Holstein
Nowa, a novel protein with minicollagen Cys-rich domains, is involved in nematocyst formation in Hydra
J. Cell Sci.,
October 15, 2002;
115(20):
3923 - 3934.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Pisegna, A. Zingoni, G. Pirozzi, B. Cinque, M. G. Cifone, S. Morrone, M. Piccoli, L. Frati, G. Palmieri, and A. Santoni
Src-Dependent Syk Activation Controls CD69-Mediated Signaling and Function on Human NK Cells
J. Immunol.,
July 1, 2002;
169(1):
68 - 74.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Willment, S. Gordon, and G. D. Brown
Characterization of the Human beta -Glucan Receptor and Its Alternatively Spliced Isoforms
J. Biol. Chem.,
November 16, 2001;
276(47):
43818 - 43823.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Swaminathan, A. J. Weaver, D. A. Loegering, J. L. Checkel, D. D. Leonidas, G. J. Gleich, and K. R. Acharya
Crystal Structure of the Eosinophil Major Basic Protein at 1.8 A. AN ATYPICAL LECTIN WITH A PARADIGM SHIFT IN SPECIFICITY
J. Biol. Chem.,
July 6, 2001;
276(28):
26197 - 26203.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|