|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 276, Issue 10, 7518-7525, March 9, 2001
From the
Received for publication, September 28, 2000, and in revised form, November 14, 2000
CtpA, which is classified as a novel type of
serine protease with a Ser/Lys catalytic dyad, is responsible for the
C-terminal processing of precursor D1 protein (pD1) of the photosystem
II reaction center, a process that is indispensable for the integration of water-splitting machinery in photosynthesis. In this study, overexpression in Escherichia coli and one-step
purification of spinach CtpA were carried out to analyze the
characteristics of this new type of protease and to elucidate the
molecular interactions in the C-terminal processing of pD1 on the
thylakoid membrane. The successful accumulation of functional CtpA in
E. coli may argue against the possibility, based on
homology to E. coli Tsp, that the enzyme is involved in the
degradation of incomplete proteins in chloroplasts, e.g. by
utilizing the ssrA-tagging system. Analysis using a
synthetic pD1 oligopeptide demonstrated that the enzymatic properties
(including substrate recognition) of overexpressed CtpA with an extra
sequence of GSHMLE at the N terminus were indistinguishable from those
of the native enzyme. CtpA was insensitive to penem, which has
been shown to inhibit some Ser/Lys-type proteases, suggesting that the
catalytic center of CtpA is quite unique. By using the substrate in
different molecular environments (i.e.
synthetic pD1 oligopeptide in solution and pD1 in photosystem
II-enriched thylakoid membrane), we observed a dramatic difference in
the pH profile and affinity for the substrate, suggesting the presence of a specific interaction of CtpA with a factor(s) that modulates the
pH dependence of proteolytic action in response to physiological conditions.
The D1 protein is a membrane-spanning subunit constituting
the core part of the photosystem II
(PSII)1 reaction center (1,
2). In the predicted secondary structure, the D1 protein consists of
five transmembrane On the other hand, a protease involved in the C-terminal
processing of precursor D1 protein (pD1) has been purified from spinach (18) and Scenedesmus (10, 19), and a gene coding for the protein named ctpA has been identified and sequenced
(7-10). Based on recent site-directed mutational analysis of the
catalytic center of the
enzyme,2 given the fact that
the proteolytic activity is resistant to any conventional protease
inhibitor (8, 10, 19), CtpA has been classified as a novel type of
serine protease that utilizes the Ser/Lys catalytic dyad instead of the
Ser/His/Asp triad (20), characteristic of the thylakoidal processing
peptidase (21), the leader peptidase (22), and the tail-specific
protease (Tsp) of Escherichia coli (23, 24). Thus, the
elucidation of the catalytic mechanism of this novel type of protease
is receiving a lot of attention from enzymologists.
One of the unique features of CtpA is that the substrate specificity
recognizing the sequence around the C terminus is very strict (25),
although the site of cleavage by itself is rather simpler,
i.e. the linkage between Ala In previous studies, we analyzed the mechanism of the C-terminal
processing of pD1 by utilizing partially purified protease from spinach
chloroplasts and two types of substrate in solution: 1) synthetic
oligopeptides corresponding to the C-terminal sequence of pD1 (25, 28)
and 2) in vitro transcribed/translated full-length pD1 (18).
An unexpected finding from these studies was that the proteolytic
activity exhibited a strong pH dependence, with an optimum in the pH
range of 7.5-8.0.3 Activity
was quite low on the acidic side at pH 5.0-6.0, conditions that mimic
the pH of the luminal space in the illuminated thylakoid, where the
rate of C-terminal processing is expected to be extremely high under
physiological conditions. In addition, the affinity of the protease for
the substrate seemed to be too low to account for the expectedly high
turnover rate (reviewed in Ref. 29).
This study was intended to further characterize the enzyme and to
resolve these inconsistencies in pH dependence and affinity between the
in vitro and in vivo systems, with the
overall aim of understanding the mechanism of proteolytic
processing of pD1 under physiological conditions. For the analysis, we
utilized pD1 in the PSII complex embedded in the thylakoid membrane of chloroplasts obtained from the LF-1 mutant of Scenedesmus
obliquus (12-14). For the purpose of enzymatic analysis, we have
successfully developed an overexpression system for spinach CtpA in
E. coli. By adjusting the temperature of IPTG induction, we
have been able to obtain substantial amounts of processing enzyme in
its active state. The results of analyses using these materials
demonstrate that the mode of enzyme-substrate interaction in the
C-terminal processing is largely modified by integrating the substrate
into the thylakoid membrane. This suggests the presence of a specific molecular interaction(s) between a component(s) on the membrane surface and the soluble enzyme in the luminal space.
Experimental Organisms--
The competent BL21(DE3) strain of
E. coli was purchased from Novagen (Madison, WI). The wild
strain and the LF-1 mutant (12) of S. obliquus were
gifts from Dr. N. I. Bishop (Oregon State University).
Scenedesmus cells were heterotrophically grown at 25 °C
in the dark in NGY liquid medium (30).
Construction of Expression Plasmids for CtpA--
A pair of
polymerase chain reaction primers whose sequences are
GTCTCTCGAGCTTTCTGAGGAGAATCGAAT (forward primer) and
ATCGCTCGAGTCATCTTGAAAAGAGTTGTACGCC (reverse primer) were
synthesized with a DNA synthesizer (Model 394, Applied Biosystems,
Foster City, CA). These primers were designed for amplification of a
gene fragment encoding the mature part of spinach CtpA protease,
corresponding to the segment from Leu151 to the stop
codon at position 540 (8). They have an external XhoI site
at each 5' terminus for ligation into the expression vector pET-15b(+)
(Novagen), which is underlined in the sequences above. In our
expression strategy, the initiation codon, the N-terminal hexahistidine
tag, and the subsequent epitope for thrombin cleavage encoded on
pET-15b(+) were utilized (Fig. 1).
Therefore, the XhoI site on the forward primer was arranged
such that the desired reading frame was in accord with the strategy.
The polymerase chain reaction products of ~1,200 base pairs were
digested by XhoI and ligated into the XhoI site
of pET-15b(+). These plasmids were then introduced into competent
E. coli BL21(DE3) cells. Transformants suited to our
strategy with regard to the direction of insertion, which had been
assessed by mapping of the restriction sites, were sent to the next
selection. Finally, a clone, pET-CTPA, whose insert had no error during
the polymerase chain reaction amplification as confirmed by
conventional sequencing, was isolated and used in this work.
Overexpression of the ctpA Gene in E. coli--
The BL21(DE3)
strain of E. coli carrying the expression plasmids for
mature spinach CtpA was grown in LB medium containing 50 µg/ml
ampicillin at the desired temperature. Growth was monitored by
measuring the turbidity of culture at 600 nm
(A600). When A600 reached
0.4, the expression of the ctpA gene was induced by the addition of IPTG at 1 mM. The culture was further incubated
until A600 reached ~0.8. Cells were collected
by centrifugation at 5,000 × g for 5 min and suspended
in 0.1 culture volume of lysate buffer consisting of 50 mM
Tris-HCl (pH 8.0) and 2 mM EDTA. After the addition of 0.01 volume of 10 mg/ml lysozyme and 0.1 volume of 1% Triton X-100, the
cell suspension was incubated for 15 min at 30 °C and sonicated at
high output (Model 250 sonifier, Branson Ultrasonics Corp., Danbury,
CT) for 20 s at 4 °C. The soluble and insoluble fractions of
the extracts were separated by centrifugation at 30,000 × g for 30 min at 4 °C.
Purification of CtpA--
The purification of
overexpressed CtpA from E. coli was achieved by
nickel-chelating affinity chromatography utilizing the His tag at its N
terminus. In a typical experiment, 50 ml of soluble fraction from
E. coli cells grown at 20 °C was used as the starting material. To remove EDTA, which strips Ni2+ from the
chelating column, the soluble fraction was dialyzed against starting
buffer (20 mM Tris-HCl (pH 7.9), 5 mM
imidazole, and 0.5 M NaCl) prior to adsorption onto the
column. After passing through a filter (0.45-µm pore size), the
solution was loaded onto an AF-chelate TOYOPEARL 650M column (1 (inner
diameter) × 6.5 cm; Tosoh, Tokyo, Japan) that was
nickel-immobilized and equilibrated with starting buffer. The column
was washed with 10 column volumes of starting buffer and 6 column
volumes of wash buffer (20 mM Tris-HCl (pH 7.9), 60 mM imidazole, and 0.5 M NaCl). CtpA was eluted
from the column with elution buffer (20 mM Tris-HCl (pH 7.9), 1 M imidazole, and 0.5 M NaCl). Purified
CtpA was dialyzed against an appropriate buffer and stored at
Assay of Proteolytic Activity Using a Synthetic Oligopeptide as
the Substrate--
In a typical experiment, the reaction mixture (33 µl) contained 300 µM synthetic oligopeptide
corresponding to the C-terminal 19-amino acid sequence of spinach pD1
(S-19), 0.75 µg of purified CtpA, and 25 mM Hepes-KOH
buffer (pH 7.7 at 25 °C). After incubation for 1.5 h at
25 °C, the reaction was terminated by the addition of 6 µl of 18%
(w/v) trichloroacetic acid, and then the mixture was kept at room
temperature for 20 min, followed by centrifugation at 20,000 × g for 20 min to remove denatured proteins. To 35 µl of the
resultant supernatant was added 145 µl of 0.1% (v/v) trifluoroacetic acid, and then the mixture was passed through a filter (0.45-µm pore
size). Peptides in 170 µl of filtrate were analyzed by reverse-phase HPLC as described previously (25).
Assay of Proteolytic Activity Using the PSII-enriched Membrane
from the LF-1 Mutant of S. obliquus--
PSII-enriched membrane was
prepared from logarithmic growth phase cells of the LF-1 mutant of
Scenedesmus, in which CtpA activity is deficient (10),
according to the modified method of Kuwabara and Murata (41) as
described by Metz and Seibert (31). The PSII-enriched membrane
containing pD1 was utilized as the substrate for CtpA. The processing
activity was visualized by detecting the molecular mass shift of pD1 to
mature D1 protein (mD1) by Western blot analysis using antisera raised
against the AB-loop sequence of spinach D1 protein.
The standard reaction mixture (100 µl) contained 10 µg of
chlorophyll from PSII-enriched membrane from LF-1, overexpressed CtpA
(1.25 µg of protein), and 40 mM sodium/potassium
phosphate buffer (pH 6.9). The proteolytic reaction was carried out at
25 °C for 20 min. After collecting the PSII-enriched membrane by centrifugation at 15,000 × g for 3 min at 0 °C, the
membrane was solubilized with the sample buffer for electrophoresis
(125 mM Tris-HCl (pH 6.8 at 25 °C), 5% (w/v) SDS, 20%
(w/v) glycerol, and 10% (v/v) 2-mercaptoethanol), and then an aliquot
of the extracts corresponding to 2.5 µg of chlorophyll from
PSII-enriched membrane was subjected to SDS-PAGE with 15% acrylamide
gel containing 6 M urea (32). Proteins separated on the
acrylamide gel were electrophoretically transferred to nitrocellulose
membrane. Western blot analysis was carried out using an enhanced
chemiluminescence system (ECL, Amersham Pharmacia Biotech,
Buckinghamshire, United Kingdom) according to the manufacturer's
protocol. Each D1 protein band on x-ray film was quantified with a
densitometer (Personal Scanning Imager PD110, Molecular Dynamics, Inc.,
Sunnyvale, CA), and the processing activity was expressed as the ratio
of processed D1 to total D1.
Amino Acid Sequencing--
The amino acid sequences of peptides
separated by SDS-PAGE or HPLC were determined with a pulse liquid-phase
automatic peptide sequencer (Model 476A, Applied Biosystems). The
sequencing of peptide bands separated by SDS-PAGE was as described in
detail by Inagaki et al. (8).
Chemicals--
Lysyl endopeptidase and thrombin were
purchased from Wako (Tokyo) and Novagen, respectively. Penem
(allyl-(5S,6S,1'R)-6-(1'-acetoxyethyl)penem-3-carboxylate, SB214357) was a gift of SmithKline Beecham Pharmaceuticals (Harlow, Essex, United Kingdom).
Expression of Spinach CtpA in E. coli
The expression of the spinach ctpA gene in E. coli was attempted in this study to obtain the C-terminal
processing protease for pD1 in its active state. The expression plasmid
(termed pET-CTPA) carrying a fragment of the ctpA gene
encoding the mature part under a promoter for T7 phage RNA
polymerase was constructed with pET-15b(+) and then transferred into
the BL21(DE3) strain of E. coli, which contains a gene for
T7 RNA polymerase under the control of the lacUV5 promoter,
as described under "Experimental Procedures." Expression was
induced by the addition of IPTG at 37, 30, or 20 °C (Fig.
2). SDS-PAGE analysis of whole cell
proteins after the IPTG induction revealed distinct accumulation over
time of a polypeptide with a mobility corresponding to ~47 kDa at
each temperature. Edman degradation analysis demonstrated that the
47-kDa protein has a GSSHHHHHHSSG sequence at the N terminus,
indicating that an N-terminal fMet was removed (data not shown). Thus,
judging from both the sequence and the estimated molecular mass, we
concluded that the mature form of CtpA was expressed in E. coli, as designed. At 37 °C, a temperature commonly used for
cultivating E. coli cells, practically all of the 47-kDa
protein was recovered in the insoluble fraction after high speed
centrifugation of cell extracts, and the supernatant fraction was thus
totally inactive with respect to the C-terminal cleavage of pD1. (A
polypeptide of 47 kDa observed in the SDS-PAGE profile for the soluble
fraction was shown not to be CtpA by N-terminal amino acid sequencing.) On the other hand, at 30 and 20 °C, we detected a polypeptide band
of ~47 kDa with a His tag at the N terminus in the soluble fraction.
By lowering the temperature of IPTG induction, the proportion of CtpA
in the soluble fraction increased, whereas the overall amount of
overexpressed CtpA in E. coli cells decreased on a protein basis. At 20 °C, CtpA in the soluble state was estimated by
Coomassie Brilliant Blue staining to correspond to 10-20% of
that in the bacterial cells. CtpA in the soluble fraction was active
with respect to the C-terminal cleavage of the synthetic pD1
oligopeptide at the correct site, as demonstrated by amino acid
sequence analysis of the cleavage products, despite the presence of an
additional 22-amino acid sequence at the N terminus.
The purification of CtpA was achieved from the soluble fraction
of cell extracts from E. coli grown at 20 °C by
nickel-chelating affinity chromatography utilizing the His tag at the N
terminus as described under "Experimental Procedures." In the
purification process, most of the impurities were removed from the
column with starting buffer or wash buffer (60 mM
imidazole). CtpA was recovered almost at homogeneity in the fraction
eluted by elution buffer (1 M imidazole) (Fig.
3A). After purification, the
His tag at the N terminus was removed from CtpA by thrombin treatment
(Fig. 3B), although the presence of the His tag at the N
terminus has no apparent effect on the enzymatic activity of CtpA, at
least under the conditions examined, as mentioned above. In a typical experiment, we obtained ~1 mg of CtpA from 50 ml of the soluble cell
extract from E. coli. Purified CtpA was dialyzed against an
appropriate buffer and stored at Cleavage of C-terminal Oligopeptides by CtpA Expressed in E. coli Recognition of Substrate--
The properties of proteolytic action
of purified CtpA expressed in E. coli for the C-terminal
cleavage of pD1 were analyzed using a synthetic oligopeptide
corresponding to the C-terminal 19 amino acids of spinach pD1,
i.e. from Asn-335 to Gly-353 in pD1, as the substrate, which
has been studied in detail (25, 28). When the oligopeptide was
incubated with the purified enzyme, two products with the sequences
AIEAPSTNG and NAHNFPLDLA, corresponding to the C-terminal extension and
the C terminus of mD1, respectively, were eluted from the reverse-phase
HPLC column (Fig. 4, Ala
trace), demonstrating that
thrombin-treated spinach CtpA expressed in E. coli with an
extra N-terminal 6 amino acids (i.e. GSHMLE) recognizes the
substrate and cleaves it at the correct site, i.e. between Ala-344 and Ala-345. However, a relatively high Km
value of ~0.3 mM was estimated from the Lineweaver-Burk
plot of the kinetic traces for overexpressed CtpA (Fig. 4,
inset), as is the case for the native enzyme isolated from
spinach chloroplasts (25).
The efficiency of C-terminal cleavage of several synthetic oligopeptides with a substitution at the cleavage site was also examined using the enzyme overexpressed in E. coli for comparison with and verification of the results obtained from the analysis using native spinach enzyme for the recognition mechanism (25). Fig. 4 shows the HPLC elution profiles for a series of oligopeptides with a substitution at the cleavage site (position +1, Ala-345). The replacement of Ala by Gly, Val, or Pro served to reduce the rate of proteolysis to ~50, 30, and 0% of the control, respectively (Fig. 4), whereas replacement of Ala by Cys, Phe, or Ser did not affect the rate of cleavage (data not shown). This is consistent with the observation for the native enzyme in a previous analysis (25). Judging from the retention time of reaction products on the chromatogram, we concluded that CtpA expressed in E. coli cleaves the substituted oligopeptides at the normal site, i.e. after Ala-344. Thus, we also concluded that CtpA overexpressed in E. coli with an extra N-terminal GSHMLE sequence recognizes and cleaves the substrate, at least in vitro, in exactly the same manner as the native enzyme. This, on the other hand, suggests that the presence of an extra sequence with a positive charge at the N terminus has no serious effect on the enzyme-substrate interaction, although there is significant homology in the N-terminal sequence of CtpA among different organisms. pH Dependence--
An unexpected finding for the C-terminal
cleavage of pD1 analyzed in vitro is that the proteolytic
reaction proceeds more slowly in the acidic region compared with that
in the neutral or alkaline pH region,3 although the
enzyme actually is demonstrated to be present in the thylakoidal
luminal space, where the pH is estimated to be acidic under the
functional conditions of illumination, as described in the
Introduction. In this study, the pH profile for C-terminal cleavage of
the synthetic oligopeptide was investigated in detail using CtpA
overexpressed in E. coli. As shown in Fig.
5, this again demonstrated that the
proteolytic activity of C-terminal cleavage of pD1 exhibits a strong pH
dependence with a maximum around pH 7.5-8.0 and that the activity is
quite low in the acidic region of pH 5.0-6.0. A similar pH profile has
been obtained using in vitro translated full-length pD1 as
the substrate in separate experiments (data not shown).
Inhibitor Specificity-- Thus far, no specific inhibitor has been reported for the C-terminal processing protease for pD1. Therefore, by taking advantage of the quantity of enzyme overexpressed in E. coli, we systematically examined a wide variety of protease inhibitors (including serine, cysteine, and aspartic protease and metalloprotease inhibitors) at different concentrations for the C-terminal cleavage of the synthetic oligopeptide by thrombin-treated CtpA overexpressed in E. coli. This included penem, which is unique in that it specifically inhibits some of the novel serine proteases possessing the Ser/Lys catalytic dyad (33, 34). However, as summarized in Table I, despite thorough investigation, the CtpA activity proved to be resistant to all of the protease inhibitors tested, including penem.
Processing of pD1 Integrated into the PSII Complex in the Thylakoid Membrane To analyze the molecular mechanism of enzyme-substrate
interactions in the C-terminal processing of pD1 integrated into the thylakoid membrane and to resolve the discrepancies between in vitro and in vivo results on pH dependence and
affinity, we developed an assay system that mimics the in
vivo system. It uses PSII-enriched membranes from the LF-1 mutant
of S. obliquus lacking C-terminal processing activity in
combination with spinach CtpA overexpressed in E. coli. The
PSII-enriched membrane containing pD1 was utilized as the substrate for
analysis. In this case, the processing activity was visualized by
detecting the molecular mass shift from pD1 (34 kDa) to mD1 (32 kDa) by
Western blot analysis using antiserum raised against the AB-loop
sequence of spinach D1 protein as described under "Experimental
Procedures." Fig. 6 shows the time
course of C-terminal processing of pD1 by CtpA. pD1 of the
Scenedesmus LF-1 mutant with a molecular mass of 34 kDa was
converted to a smaller form with the same mobility as mD1 in the wild
strain, but no further degradation could be observed, suggesting
that spinach CtpA overexpressed in E. coli cleaved pD1
integrated into the thylakoid membrane of Scenedesmus at the
correct site (Fig. 6). To confirm this, protease mapping analysis was
conducted with lysyl endopeptidase by taking advantage of the fact that
the D1 protein in Scenedesmus contains a single lysine
residue at position 238.4 The
PSII-enriched membrane from the LF-1 mutant of Scenedesmus was subjected to lysyl endopeptidase digestion before and after proteolysis by CtpA. The proteolytic products were detected by two
kinds of anti-peptide antibodies that specifically recognize the
AB-loop and C-terminal regions of D1,
respectively.5 Comparison of
the mapping patterns showed that the removal of a short peptide with a
molecular mass of ~2 kDa from pD1 occurred at its C terminus, but not
its N terminus, proving the validity of the above interpretation. The
processing of pD1 by CtpA proceeded almost linearly with time up to 20 min.
The relative affinity of CtpA for pD1 integrated into the thylakoid
membrane was approximated by analyzing the competitive inhibitory
effect of the synthetic oligopeptide on the processing of pD1 in the
PSII-enriched membrane of Scenedesmus. By assuming 250 of
chlorophyll molecules/PSII reaction center, the substrate concentration
in the reaction mixture was estimated such that 0.1 mg/ml chlorophyll
is equivalent to 0.4 µM pD1. The synthetic oligopeptide
was added to the reaction mixture at concentrations ranging from 1- to
1,500-fold over pD1 integrated into the thylakoid membrane at a molar
ratio (Fig. 7). The addition of
oligopeptide at the 1-, 10-, and 100-fold concentrations exhibited no
inhibitory effect on the proteolysis of pD1 by CtpA on the membrane.
The concentration of oligopeptide required to inhibit the proteolytic processing of membrane-embedded pD1 was nearly 1,000 times higher than
that of substrate pD1 in the membrane. From this, we infer that the
affinity of the enzyme for pD1 is enhanced by the incorporation of the
substrate into the thylakoid membrane.
In the experiment shown in Fig. 8, the pH
profile for C-terminal processing of pD1 integrated into the thylakoid
membrane of Scenedesmus by spinach CtpA overexpressed in
E. coli was investigated. In contrast to the in
vitro system using synthetic oligopeptide or in vitro
translated full-length pD1 as described above, CtpA was remarkably
active in this system in the acidic region, exhibiting an optimal
processing activity at pH ~6.0, which is fairly consistent with the
pH of the thylakoidal lumen under the functional conditions of
illumination. However, under basic conditions, the proteolytic activity
was quite low, in contrast to the results obtained with the in
vitro system using synthetic oligopeptide or in vitro
translated full-length pD1 as the substrate with native CtpA or CtpA
expressed in E. coli.
Under conventional conditions of growth at 37 °C, E. coli cells expressed spinach CtpA and accumulated it in large quantities in the insoluble fraction. However, upon lowering the temperature of cell growth to 20 °C, a substantial proportion of the protease was recovered in its active state in the soluble fraction of cell extracts. This probably is due to a decrease in misfolding of the induced protein as a result of the slower rate of synthesis at 20 °C, as generally anticipated. The success in fractionating CtpA into the supernatant fraction of cell extracts enabled us to establish a simple purification procedure based on the strategy of nickel-chelating affinity chromatography utilizing the His tag constructed at the N terminus. E. coli has a tail-specific protease called Tsp in the
periplasm and its counterpart in the cytoplasm (23). These proteases are reported to recognize nonpolar regions at the C terminus of proteins (23) or an ssrA-encoded peptide tag added to the
C-terminal portion of nascent polypeptides translated from mRNA
without a stop codon (35) and to degrade them at the site of a small
residue, e.g. Ala By taking advantage of the great quantity of protease overexpressed in
E. coli, we thoroughly investigated the effect of different types of protease inhibitors on the catalytic activity of C-terminal processing of pD1 using synthetic C-terminal oligopeptide as the substrate. However, the proteolytic activity proved to be totally resistant to any of the standard inhibitors tested. This fact strongly
supports the proposal, based on homology to Tsp, that CtpA should be
classified as a novel type of serine protease. In fact, a recent study
by our group, using site-directed mutagenesis of the ctpA
gene in Synechocystis sp. PCC 6803, has revealed that Ser-282 and Lys-307, which correspond to Ser-291 and Lys-316, respectively, in the spinach enzyme (numbered from the N terminus of
the mature protein), are possibly involved in the catalytic function of
CtpA.2 This supports the view that this enzyme ought to be
assigned to a novel type of protease group in which a hydroxyl/amine
dyad is located in the catalytic center, which has been substantiated more clearly by a recent structural analysis (38). An important fact,
however, is that the catalytic function of CtpA was not inhibited by
penem, which has been shown to be a potent inhibitor of two kinds of
serine protease with a Ser/Lys catalytic dyad, i.e. the
E. coli leader peptidase (22, 33) and the thylakoidal processing peptidases from cyanobacteria and higher plants (34). This
inhibitory effect of penem is reported to be due to covalent binding of
the Purified spinach CtpA overexpressed in E. coli was demonstrated to recognize the C-terminal sequence of pD1 in a manner similar to that of the native protease purified from spinach chloroplasts (25), as shown by its selectivity for the +1 substituted C-terminal oligopeptides as the substrate, i.e. the replacement of Ala by Gly, Val, or Pro served to reduce the proteolysis, whereas replacement by Cys, Phe, or Ser did not affect the rate of cleavage. However, the analysis using overexpressed CtpA and pD1 oligopeptides confirmed the abnormalities in pH dependence and affinity, i.e. proteolysis revealed a pH optimum between 7.5 and 8.0 (but not between 5.0 and 6.0), and the affinity of the enzyme for the substrate was relatively weak (Km = 0.3 mM), despite its expected rapid rate of turnover in vivo in the damage repair cycle. Therefore, we had a suspicion that the processing of pD1 in vivo may not proceed by the mechanism elucidated by in vitro analyses using synthetic oligopeptides or artificially translated full-length pD1 as the substrate (39). However, a recent mixed-culture growth experiment using Chlamydomonas mutants strongly suggested that the recognition mechanism studied by using substituted synthetic oligopeptides in vitro also operates in the in vivo system (40). This convinced us of the existence of the additional interaction(s), between CtpA and pD1 in vivo integrated into the thylakoid membrane, that largely influences its pH dependence and its affinity for the C-terminal processing of pD1. Therefore, we developed an assay system that mimics the in vivo system, using PSII-enriched membranes from the LF-1 mutant of S. obliquus lacking a C-terminal processing protease due to early termination in the expression of the ctpA gene (10), to analyze the abnormalities mentioned above. As shown in Fig. 7, the concentration of oligopeptide required to inhibit the proteolytic processing of membrane-embedded pD1 in the assay system was ~1,000 times greater than that of substrate pD1 in the membrane, putting the estimate for the Km value at ~0.3 µM for pD1 in the membrane. This can be taken to mean that the affinity of the protease for the substrate is greatly enhanced when the substrate is embedded in the thylakoid membrane. In other words, some other components on the membrane or in another region of the D1 protein (e.g. the AB- and/or CD-loop(s) protruding into the thylakoidal luminal space) greatly influence the interaction with the protease. On the other hand, as shown in Fig. 8, the proteolytic processing of membrane-embedded pD1 in the assay system exhibited a pH optimum in the range of 5.5-6.0 (not 7.5-8.0), in accordance with the pH values of the functional site of this enzyme in vivo, i.e. the luminal space of illuminated thylakoids. This finding may also be explained by the presence of an additional component(s) on the membrane that influences the enzyme-substrate interaction. Trost et al. (10) analyzed the pH profile for purified Scenedesmus CtpA by enzyme-linked immunosorbent assay using the PSII core complex isolated from the LF-1 mutant as the substrate. They demonstrated a pH optimum of ~6.5, fairly consistent with our result using PSII-enriched membrane from the LF-1 mutant as the substrate. However, the pH profile they reported is unusual and greatly differs from ours, which exhibits an appreciably higher activity in the region of alkaline pH. Although this discrepancy may simply reflect differences in the respective assay systems, it may be explained by the presence of additional interactions between a component(s) on the membrane and the enzyme as discussed above. In our preliminary analysis, the PSII-enriched membrane of LF-1 was treated with reagents (e.g. lysyl endopeptidase and Triton X-100 at 4%) that could influence the structure of the thylakoid membrane. However, in any cases, the pH profile was not altered to a great extent, although a slight shift to the alkaline direction was detected. This may suggest the situation that several components contribute to the alteration of enzyme-substrate interactions observed in our study and that the crucial interaction(s) with the enzyme is provided by components in the PSII reaction center. In the catalytic mechanism of this novel serine protease, which
is proposed to employ Ser and Lys as the nucleophile and general base,
respectively, the pertinent question is how the protease enables the
We thank Dr. Norman I. Bishop for providing the wild strain and the LF-1 mutant of Scenedesmus and SmithKline Beecham Pharmaceuticals for the gift of the penem inhibitor. We are also grateful to Dr. Tatsuya Tomo (RIKEN) for his technical support in determining the amino acid sequence of polypeptides.
* This work was supported by Grant-in-aid for Scientific Research (B) No. 09440268 from the Ministry of Education, Science, Sports, and Culture and by a grant from the Okayama Foundation for Science and Technology.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ Present address: Lab. of Photosynthesis, National Inst. of Agrobiological Resources, Tsukuba 305-8602, Japan.
Published, JBC Papers in Press, November 30, 2000, DOI 10.1074/jbc.M008877200
2 N. Inagaki, R. Maitra, K. Satoh, and H. B. Pakrasi, manuscript in preparation.
3 Y. Yamamoto and K. Satoh, unpublished data.
4 J. R. Bowyer, personal communication.
5 Y. Yamamoto and K. Satoh, manuscript in preparation.
The abbreviations used are:
PSII, photosystem
II;
pD1, precursor D1 protein;
mD1, mature D1 protein;
IPTG, isopropyl-
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc. This article has been cited by other articles:
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||