![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 11, 7693-7696, March 16, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,
§,
¶,
,
,
,

From the
Institute for Molecular Science
of Medicine, Aichi Medical University, Nagakute, Aichi,
480-1195, the
Graduate Program for Regulation of Biological
Signals, Graduate School of Bioagriculture Sciences, Nagoya University,
Chikusa, Nagoya 464-8601, and ** Japan SLC Inc., Aoi-higashi, Hamamatsu
433-8114, Japan
Received for publication, December 20, 2000
| |
ABSTRACT |
|---|
|
|
|---|
Hyaluronan (HA) associates
with proteins and proteoglycans to form the extracellular HA-rich
matrices that significantly affect cellular behaviors. So far, only the
heavy chains of the plasma inter- Most cells undergoing active proliferation, differentiation, and
locomotion in vitro and in vivo form
extracellular hyaluronan (HA)1-rich matrices, which
have been shown to play significant roles in many biological processes,
such as tissue organization, morphogenesis, inflammation, and
cancer metastasis (1-3). We previously identified the covalent SHAP
(serum-derived
hyaluronan-associated protein)-HA complex in the extracellular HA-rich matrix of cultured mouse dermal
fibroblasts and found that the SHAPs are the heavy chains of the
inter- The ITI family members are synthesized and assembled in liver and
secreted into blood at high concentrations (0.15-0.5 mg/ml of plasma)
(7). The members are composed of a common light chain, bikunin (Bik),
and one or two of the three genetically different heavy chains (HC1,
HC2, and HC3) (8). Free bikunin in circulation is excreted rapidly into
the urine (9) where it is present as the urinary trypsin inhibitor
(UTI) (10). The serine residue at position 10 of bikunin contains an
O-glycosidically linked chondroitin-4-sulfate (CS) chain
(11), to which the C terminal aspartate of a heavy chain is
covalently bound via a unique ester bond (12). The SHAPs link to HA via
an equivalent ester bond, suggesting that the formation of the
SHAP-HA complex is a substitution reaction, namely HA replaces the CS
of bikunin to link to a heavy chain (Fig.
1) (6). Plasma includes an enzyme activity that catalyzes the reaction (13). Therefore, we might expect
that the SHAP-HA complex would be formed once plasma meets HA, thereby
contributing to some physiological and pathological processes.
-trypsin inhibitor (ITI) family,
designated as SHAPs (serum-derived hyaluronan-associated proteins),
have been shown to bind covalently to HA. The physiological
significance of such a unique covalent complex has been unknown but is
of great interest, because HA and the ITI family are abundant in
tissues and in plasma, respectively, and the SHAP-HA complex is formed
wherever HA meets plasma. We abolished the formation of the SHAP-HA
complex in mice by targeting the gene of bikunin, the light chain of
the ITI family members, which is essential for their biosynthesis. As a
consequence, the cumulus oophorus, an investing structure unique to the
oocyte of higher mammals, had a defect in forming the extracellular
HA-rich matrix during expansion. The ovulated oocytes were completely devoid of matrix and were unfertilized, leading to severe female infertility. Intraperitoneal administration of ITI, accompanied by the
formation of the SHAP-HA complex, fully rescued the defects. We
conclude that the SHAP-HA complex is a major component of the HA-rich
matrix of the cumulus oophorus and is essential for fertilization in vivo.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-trypsin inihibitor (ITI) family in serum supplemented to culture medium (4-6).

View larger version (14K):
[in a new window]
Fig. 1.
Schematic representation of the synthesis of
the SHAP-HA complex.
This paper attempts to clarify not only the physiological function of
the SHAP-HA complex but also that of the ITI family by eliminating
their formation in mice in which the bikunin gene has been inactivated.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Construction of Targeting Vector and Generation of
Bikunin-deficient Mice--
To delete the CS attachment site encoded
by exon 7 of the
-1-microglobulin (
1M)/bikunin precursor gene
(14), we created an Eco47III site by site-directed
mutagenesis of the codon for the serine residue at position 7 in
bikunin from AGT to CGCT (QuikchangeTM kit; Stratagene). After the
Eco47III digestion, the 5' part of exon 7 was linked to an
SV 40-derived sequence between a HpaI site (position 2474)
and a BamHI site (position 2605) in pMAMneo-s vector
(CLONTECH, Palo Alto, CA),
followed by a neomycin-resistant gene
(Fig. 2, neo). The 6-kb-long sequence between the
ClaI site in exon 3 and the mutated site was used as the
long arm of the targeting construct, and the 1.6-kb-long sequence
flanked by an EcoRI site in intron 8 and a downstream
PvuII site was used as the short arm. The whole fragment was
cloned into a vector containing the thymidine kinase (tk)
gene. The linearlized vector was electroporated into E14 embryonic stem
(ES) cells. After positive and negative selection, about 2% of the
resistant colonies were confirmed to have undergone homologous
recombination by nested PCR analysis with the primers
GACATTGGGTGGAAACATTCCAGG and TGGGGTACTGTGTGGATGCAGTTAG for the first
PCR, and CGAAGCTTGGCTGGACGTAAACTCC and ATTCTCCAGGGCATGGGCATAGGCC for the nested PCR (Fig. 2A, arrows) and
then further by Southern blot analysis. Four ~100% chimera mice were
obtained from an ES clone by aggregating ES cells with the 8-cell
embryos from C57BL/6 female mice. All of them gave F1 offspring
carrying the mutation in a heterozygous state when mated to C57BL/6
females. Homozygous mutants were obtained by sibling intercross.
Animals at generation F2 to F4 were used for analysis.
|
RT-PCR--
Total RNA was purified from liver with
TRIzol® reagent (Life Technologies, Inc.). The primers
used for RT-PCR were as follows: (a)
CAAGAATTCAGGGCAACCTG and TTCTCGAGCACAGCCTGGTCCCTCC for HC1, (b) ACGGATCCTCTCAGCTCAAGAAAT and CCCTCGAGTTTCCAAGATGA for
HC2, (c) CCAAGAGAGTGAGGGGTCAGGGACT and
GGGTCCAGATCATCTAAGCTGGACT for Bik, (d)
GCTGATCATGCGTCAACACTGC and CGTGATCATCTGGCAATTGACGTGGGC for
1M and
(e) CCTGGAATGTTTCCACCCAATGTCG and CCATGATATTCGGCAAGCAGGCATC for neo.
Immunostaining Analysis--
ITI family molecules were detected
by rabbit antibody against human ITI (DAKO, Glostrup, Denmark)
or rabbit antiserum against human bikunin (Yanaihara, Kenkyuasho,
shizuoka, Japan) followed by peroxidase-conjugated goat antibody
against rabbit Ig (DAKO) or Alexa 594-labeled goat anti-rabbit IgG
antibodies (highly cross-adsorbed; Molecular Probes, Inc., Eugene, OR).
The antigen, bikunin, was purified from Miraclid® (Mochida
Pharmaceutical Co., Tokyo, Japan) by elution on a DEAE-Sepharose column
(15). The
1M was detected with sheep antibody against human
1M
(The Binding Site, Birmingham, UK) followed by peroxidase-conjugated rabbit antibody against sheep Ig (DAKO). Hyaluronan was detected by
biotinylated hyaluronan-binding protein (Seikagaku Corp., Tokyo, Japan) followed by Alexa 488-labeled streptavidin (Molecular
Probes). The peroxidase-conjugated second antibodies were visualized
with Renaissance® chemiluminescence reagent plus
(PerkinElmer Life Sciences) and exposed to Hyperfilm ECL film
(Amersham Pharmacia Biotech).
Purification of Mouse ITI--
Mouse ITI was purified from the
pooled serum of wild type or Bik+/
mice by Q-Sepharose
chromatography and ammonium sulfate precipitation (16).
Test Tube Reaction for the Formation of SHAP-HA Complex--
The
reaction mixture (2.75 ml) including 0.5 ml of serum, 0.1 ml of HA (5 mg/ml; Seikagaku, Japan), and 5 mM MgCl2 in
Hank's medium was incubated overnight at 37 °C; 0.2 mg of mouse ITI
was added if necessary. After incubation, a 4 M guanidine
HCl solution was prepared and adjusted to a density of 1.37 g/ml with
solid CsCl. After centrifugation at 40,000 rpm for 48 h, the
SHAP-HA complex in the bottom fraction (p
1.45 g/ml) was
precipitated with ethanol, digested with Streptomyces
hyaluronidase (Seikagaku Corp., Tokyo, Japan) at 60 °C for 2 h,
and subjected to immunoblot analysis (4-6).
Superovulation--
Three- to four-week-old female mice were
injected intraperitoneally with 5 IU of pregnant mare's serum (Sigma)
at noon and 5 IU of human chorionic gonadotropin (hCG) (Sigma) 48 h later. If necessary, purified mouse ITI (0.35 mg/mouse) or human UTI (67 µg/mouse, prepared as above) was mixed with hCG and injected in
the same way. Then the Bik
/
females were caged
overnight with males, and their oocytes were examined at 0.5 and 1.5 days post coitus (dpc).
| |
RESULTS |
|---|
|
|
|---|
Gene Targeting of Bikunin Abolished the Formation of the ITI Family
and the SHAP-HA Complex--
Bikunin is synthesized as a fusion
protein with another plasma protein,
1M, and is separated from
1M
by post-translational proteolysis (17, 18). We successfully truncated
the
1M/bikunin precursor gene to abolish bikunin gene
expression while retaining normal
1M gene expression (Fig. 2,
A-E). The Bik
/
mice have a normal plasma
level of
1M protein, which forms complexes with other plasma
proteins normally (Fig. 2F) (19). On the other hand, as
predicted, ITI (230 kDa) and P
I (130 kDa) were absent in
Bik
/
mice (Fig. 2F). The Bik+/
mice, with less bikunin transcripts (Fig. 2E), showed normal plasma levels of ITI and P
I (Fig. 2F).
A new heavy chain-related protein appeared in the serum of
Bik
/
mice (Fig. 2F). During the assembly of
members of the ITI family, the propeptides of heavy chains have their
C-terminal extensions (240-280 amino acid residues) proteolytically
removed while linking to bikunin (20). The molecular mass (110 kDa) of the new protein is consistent with that expected for the
unprocessed heavy chain. The new protein was not altered by
chondroitinase ABC digestion (data not shown), which indicates that the
heavy chains do not link to other chondroitin sulfate proteoglycans in
the absence of bikunin.
Incubation of the serum of Bik
/
mice with exogenous HA
resulted in no formation of the SHAP-HA complex, indicating that the unprocessed heavy chains have no ability to form the SHAP-HA complex with HA (Fig. 2G). Therefore, the ester bond between a heavy
chain and the CS chain of bikunin is essential for the substitution reaction to form the SHAP-HA complex. Thus, we have succeeded in
developing an in vivo system where there is no biosynthesis of the ITI family and consequently no formation of the SHAP-HA complex.
Bik
/
Female Mice Are Infertile--
Bikunin
deficiency did not significantly affect ontogenesis. Segregation of
bikunin alleles followed Mendel's law (data not shown). Gross
inspection failed to discriminate between the mutant and wild type
animals. Adult Bik
/
mice showed normal copulating
behaviors. However, in contrast to the full fertility of males,
the females showed severe infertility (Table
I). Although the vaginal plug was
documented many times, more than half of the Bik
/
females were not pregnant. The others had only small litters (1.6 in
average) and were indifferent to their pups. The neonatal pups usually
died within 2 days, but the ones that were fostered by
Bik+/
mothers survived.
|
We examined the gestation processes in Bik
/
females. The ovaries appeared normal, because those of 4-week-old
females responded normally to gonadotropin treatment, and those of the
adults included follicles at all maturation stages, as well as the well
defined corpus luteum (data not shown). Vaginal cytological examination revealed normal menstrual cycles (data not shown). In contrast, when
examining the uteri at 5.5-7.5 dpc, only one implanted embryo was
found in seven uteri. These results,
together with the rare but complete success in gestation, indicated
normal uterine and ovarian functions and suggested impairment at
fertilization or implantation in Bik
/
females.
|
We then collected the naturally ovulated oocytes from oviducts at 0.5 dpc. The number of oocytes of Bik
/
females (3.5 ± 1.8, n = 13) were significantly less than that observed
in Bik+/
females (8.1 ± 2.3, n = 11). More strikingly, all oocytes of Bik
/
females were
completely devoid of a cumulus oophorus, in sharp contrast to the
cumulus-oocyte complexes collected from Bik+/
females
(Fig. 3A). The naked oocytes had intact zona pellucida. They
remained at the single-cell stage at 1.5 dpc, when those of
Bik+/
females had already cleaved into two-cell oocytes
(Fig. 3A). Therefore, the infertility of
Bik
/
females was due to the impaired fertilization of
the cumulus oophorus-free oocytes.
Absence of the SHAP-HA Complex Caused the Defect of the
HA-rich Matrix of the Cumulus Oophorus--
Ovarian histology revealed
the presence of normal cumulus oophori in the graffian follicles of
Bik
/
females. However, after a gonadotropin surge in
Bik
/
females, the cumulus oophorus matrix fails to
form, and the cumulus cells were dispersed in the antral cavity
(Fig. 3B).
During cumulus expansion, the blood-follicle barrier opens and allows
the influx of members of the ITI family, as well as the enzymatic
factor required to form the SHAP-HA complex when the cumulus cells
initiate extensive HA synthesis (21, 22). A granulosa cell-derived
factor with similar enzyme activity has also been reported (23). Such a
follicle environment would be very suitable for the formation of the
SHAP-HA complexes. Thus, the defect of the SHAP-HA complex formation in
Bik
/
females most likely impairs the construction of
the cumulus HA-rich matrix with subsequent detachment of the cumulus
cells from the oocyte. To verify this, we immunolocalized HA and SHAP
in the cumulus-oocyte complex and found that the SHAP colocalized with HA perfectly throughout the matrix network (Fig.
4A). This finding indicates
that the SHAP-HA complex is a major component of the cumulus matrix.
Bikunin was not detectable in the cumulus-oocyte complex (Fig.
4A). An immunoblot result also showed that all SHAP-related immunoreactivities in the cumulus-oocyte complex were from the SHAP-HA
complex, and no intact ITI family molecules were present in the cumulus
matrix (Fig. 4B). Therefore, the infertility of the
bikunin-deficient female mice was due to the absence of the cumulus
SHAP-HA complex but not because of the absence of bikunin per
se.
|
ITI Administration Fully Rescued the Defect of Cumulus Expansion
and Oocyte Fertilization--
We further explored the possibility of
rescuing the infertility of Bik
/
females by ITI
administration. When injected intraperitoneally, the purified mouse ITI
appeared in blood within 1 h and remained detectable for more than
10 h (Fig. 4C). This ensured the availability of plasma
ITI during the process of induced ovulation (24). Oocyte examination
revealed that ITI administration resulted in a full recovery of cumulus
expansion and oocyte fertilization. The oocytes in oviducts regained
the cumulus oophori at 0.5 dpc (3 mice) and were successfully
fertilized and cleaved into 2- or 4-cell oocytes at 1.5 dpc (3 mice)
(Fig. 4C). In contrast, administration of human UTI resulted
in no improvement of the naked oocytes (5 mice), although the rapid
clearance of UTI from blood should not be overlooked (9). The recovery
could be explained by the formation of the SHAP-HA complex between the
exogenous ITI and the endogenous cumulus HA in accordance with the test tube assay (Fig. 2G).
| |
DISCUSSION |
|---|
|
|
|---|
The present results assign a definite physiological function to the SHAP-HA complex, as well as the ITI family, in the process of ovulation and fertilization. It is now clear that the blood has roles in fertilization not only indirectly by transporting hormones and nutrients but also directly by participating in the construction of the expanded cumulus oophorus. The results also provide a new insight into the structure of the cumulus matrix and show directly the importance of the expanded cumulus oophorus in fertilization in vivo.
The protease inhibitory activity of bikunin has drawn most of the
research attention to the ITI family. A successful example is the
clinical application of UTI to the treatment of acute pancreatitis and
shock. The inhibitory activities of UTI to cancer metastasis (25) and
nephrolithiasis (15) have also been reported. Here, we showed that
bikunin is necessary for the formation of the SHAP-HA complex that is
essential for fertilization. The finding identifies an important
"SHAP-presenting" role for bikunin, i.e.
activating (esterifying), transporting, and presenting the heavy chains
to suitable recipients under suitable conditions, such as the newly synthesized HA in the expanding cumulus oophorus. Such a role is
physiologically most important, because bikunin deficiency itself did
not significantly impair ontogenesis. The fact that most bikunin in
plasma is linked with the heavy chains (ITI and P
I) (8), and the
released bikunin in circulation is rapidly excreted into urine (9),
supports this notion.
The influx of plasma into preovulatory follicles and the local formation of the SHAP-HA complex recalls similar situations in inflammatory sites, where cytokines stimulate local HA synthesis and induce capillary hyperpermeability to allow the efflux of plasma components. The SHAP-HA complex may also play roles in such inflammatory responses. Indeed, the SHAP-HA complex was found to accumulate significantly in the synovial fluid of patients suffering from rheumatoid arthritis (6, 26). Studies of the SHAP-HA complex will help us to understand the pathogenesis of such diseases.
The molecular mechanism for the construction and metabolism of
the HA-rich cumulus matrix is still largely unknown. Its HA-rich nature
has been manifested by many studies (22, 27-30). Here we demonstrate
that the cumulus matrix contains the SHAP-HA complex as an essential
component. Previous studies with scanning electron microscopy revealed
many trypsin-sensitive granules along with the hyaluronan filament in
the cumulus matrix (28). The N-terminal regions of the heavy
chains of ITI have granule appearances (31). Therefore, it is very
likely that the granule-filament structure represents the SHAP-HA
complex. Our findings also help explain the previous observations,
which showed that ITI and P
I stabilized the HA-rich matrix of
cultured cells (32, 33) and in vitro cumulus expansion (34),
and that HA oligomers interfered with ovulation in vivo
(35). The cumulus matrix might include other components, such as
proteoglycans (36, 37), TSG-6 (38), and the link protein (39). The
characterization of their interaction with the SHAP-HA complex is
necessary for the completely delineation of the structure of cumulus
matrix, for example the possible interaction between the SHAP and
PG-M/versican (40). The complete shedding of the cumulus cells in
Bik
/
mice raised an interesting question about the role
of SHAP in the anchoring of the cumulus oophorus matrix on the protein
surface of the zona pellucida.
We have clarified a molecular mechanism underlying a form of female
infertility. It encourages us to survey spontaneous genetic mutations
in the infertile women population to identify possible defects in ITI.
So far no such case has been reported. However, a heritable null allele
of the HC1 gene resulting from a deletion/frameshift has previously
been identified (41).
| |
ACKNOWLEDGEMENTS |
|---|
We thank M. Hooper for the E14 ES cell line, H. Kondo for the STO/NHL feeder cell line, F. Azumi and M. Matsumoto for technical assistance in animal experiments, and A. Iida for technical assistance in histology; also, we thank A. Salustri and V. C. Hascall for kind advice and Drs. H. Watanabe and H. Suzuki for critical reading of this manuscript.
| |
FOOTNOTES |
|---|
* This work was supported by a preparatory grant for the research at the Division of Matrix Glycoconjugates, Research Center for Infectious Disease, Aichi Medical University, by grants-in-aid from the Ministry of Education, Science, Sport, and Culture of Japan, and by a special research fund from Seikagaku Corp.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Present address: Biochemistry and Molecular Biology Laboratory, Aichi Prefectural College of Nursing and Health, Moriyama, Nagoya 463-8502, Japan.
¶ Present address: Laboratory of Cellular and Developmental Biology, NIH, Bethesda, MD 20892.

To whom correspondence should be addressed: Inst. for Molecular
Science of Medicine, Aichi Medical University, Nagakute, Aichi, 480-1195, Japan. Tel.: 81-52-2644811 (ext. 2088); Fax: 81-561-633-532; E-mail: kimata@amugw.aichi-med-u.ac.jp.
Published, JBC Papers in Press, January 5, 2001, DOI 10.1074/jbc.C000899200
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
HA, hyaluronan;
1M,
-1-microglobulin;
Bik, bikunin;
dpc, days post
coitus;
HC, heavy chain;
hCG, human chrionic gonadotropin;
ITI, inter-
-trypsin inhibitor;
P
I, pre-
-inhibitor;
UTI, urinary
trypsin inhibitor;
kb, kilobase;
ES, embryonic cell;
PCR, polymerase
chain reaction;
COC, cumulus-oocyte complex;
CS, chondroitin-4-sulfate.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Toole, B. P. (1991) in Cell Biology of Extracellular Matrix (Hay, E. D., ed), 2nd Ed. , pp. 305-341, Plenum Press, New York |
| 2. | Laurent, T. C., and Fraser, J. R. (1992) FASEB J. 6, 2397-2404 |
| 3. | Knudson, C. B., and Knudson, W. (1993) FASEB J. 7, 1233-1241 |
| 4. | Yoneda, M., Suzuki, S., and Kimata, K. (1990) J. Biol. Chem. 265, 5247-5257 |
| 5. | Huang, L., Yoneda, M., and Kimata, K. (1993) J. Biol. Chem. 268, 26725-26730 |
| 6. | Zhao, M., Yoneda, M., Ohashi, Y., Kurono, S., Iwata, H., Ohnuki, Y., and Kimata, K. (1995) J. Biol. Chem. 270, 26657-26663 |
| 7. | Mizon, C., Balduyck, M., Albani, D., Michalski, C., Burnouf, T., and Mizon, J. (1996) J. Immunol. Methods 190, 61-70 |
| 8. | Salier, J. P., Rouet, P., Raguenez, G., and Daveau, M. (1996) Biochem. J. 315, 1-9 |
| 9. | Sugiki, M., Sumi, H., Maruyama, M., Yoshida, E., and Mihara, H. (1989) Enzyme 42, 31-38 |
| 10. | Proksch, G. J., Lane, J., and Nordschow, C. D. (1973) Clin. Biochem. 6, 200-206 |
| 11. | Hochstrasser, K., Schonberger, O. L., Rossmanith, I., and Wachter, E. (1981) Hoppe-Seyler's Z. Physiol. Chem. 362, 1357-1362 |
| 12. | Enghild, J. J., Salvesen, G., Hefta, S. A., Thogersen, I. B., Rutherfurd, S., and Pizzo, S. V. (1991) J. Biol. Chem. 266, 747-751 |
| 13. | Yoneda, M., Kida, D., Iwata, H., Zhao, M., and Kimata, K. (1998) Connective Tissue 30, 69-73 |
| 14. | Lindqvist, A., Rouet, P., Salier, J. P., and Akerstrom, B. (1999) Gene 234, 329-336 |
| 15. | Atmani, F., Lacour, B., Drueke, T., and Daudon, M. (1993) Urol. Res. 21, 61-66 |
| 16. | Yamamoto, T., Yamamoto, K., and Sinohara, H. (1996) J. Biochem. (Tokyo) 120, 145-152 |
| 17. | Kaumeyer, J. F., Polazzi, J. O., and Kotick, M. (1986) Nucleic Acids Res. 14, 7839-7850 |
| 18. | Thuveson, M., and Fries, E. (1999) J. Biol. Chem. 274, 6741-6746 |
| 19. | Berggard, T., Thelin, N., Falkenberg, C., Enghild, J. J., and Akerstrom, B. (1997) Eur. J. Biochem. 245, 676-683 |
| 20. | Chan, P., Risler, J. L., Raguenez, G., and Salier, J. P. (1995) Biochem. J. 306, 505-512 |
| 21. | Powers, R. W., Chen, L., Russell, P. T., and Larsen, W. J. (1995) Am. J. Physiol. 269, (Endocrinol. Metab. 32), E290-E298 |
| 22. | Salustri, A., Yanagishita, M., and Hascall, V. C. (1989) J. Biol. Chem. 264, 13840-13847 |
| 23. | Chen, L., Zhang, H., Powers, R. W., Russell, P. T., and Larsen, W. J. (1996) J. Biol. Chem. 271, 19409-19414 |
| 24. | Larsen, W. J., Wert, S. E., and Brunner, G. D. (1986) Dev. Biol. 113, 517-521 |
| 25. | Kobayashi, H., Shinohara, H., Fujie, M., Gotoh, J., Itoh, M., Takeuchi, K., and Terao, T. (1995) Int. J. Cancer 63, 455-462 |
| 26. | Kida, D., Yoneda, M., Miyaura, S., Ishimaru, T., Yoshida, Y., Ito, T., Ishiguro, N., Iwata, H., and Kimata, K. (1999) J. Rheumatol. 26, 1230-1238 |
| 27. | Chen, L., Russell, P. T., and Larsen, W. J. (1993) Mol. Reprod. Dev. 34, 87-93 |
| 28. | Talbot, P., and DiCarlantonio, G. (1984) Dev. Biol. 103, 159-167 |
| 29. | Camaioni, A., Hascall, V. C., Yanagishita, M., and Salustri, A. (1993) J. Biol. Chem. 268, 20473-20481 |
| 30. | Fulop, C., Salustri, A., and Hascall, V. C. (1997) Arch. Biochem. Biophys. 337, 261-266 |
| 31. | Blom, A. M., Mörgelin, M., Oyen, M., Jarvet, J., and Fries, E. (1999) J. Biol. Chem. 274, 298-304 |
| 32. | Castillo, G. M., and Templeton, D. M. (1993) FEBS Lett. 318, 292-296 |
| 33. | Blom, A., Pertoft, H., and Fries, E. (1995) J. Biol. Chem. 270, 9698-9701 |
| 34. | Chen, L., Mao, S. J. T., and Larsen, W. J. (1992) J. Biol. Chem. 267, 12380-12386 |
| 35. | Hess, K. A., Chen, L., and Larsen, W. J. (1999) Biol. Reprod. 61, 436-443 |
| 36. | Camaioni, A., Salustri, A., Yanagishita, M., and Hascall, V. C. (1996) Arch. Biochem. Biophys. 325, 190-198 |
| 37. | Eriksen, G. V., Carlstedt, I., Mörgelin, M., Uldbjerg, N., and Malmström, A. Y. (1999) Biochem. J. 340, 613-620 |
| 38. | Fulop, C., Kamath, R. V., Li, Y., Otto, J. M., Salustri, A., Olsen, B. R., Glant, T. T., and Hascall, V. C. (1997) Gene 202, 95-102 |
| 39. | Kobayashi, H., Sun, G. W., Hirashima, Y., and Terao, T. (1999) Endocrinology 140, 3835-3842 |
| 40. | Yoneda, M., Zhao, M., Zhuo, L., Watanabe, H., Yamada, Y., Huang, L., Nagasawa, S., Nishimura, H., Shinomura, T., Isogai, Z., and Kimata, K. (2000) in New Frontiers in Medical Sciences: Redefining Hyaluronan (Abatangelo, G. , and Weigel, P. H., eds) , pp. 21-30, Elsevier Science Publishers B.V., Amsterdam |
| 41. | Nakayashiki, N., Ding, M., Umetsu, K., Yuasa, I., Suzuki, T., and Aoki, Y. (1997) Jpn. J. Hum. Genet. 42, 363-368 |
This article has been cited by other articles:
![]() |
E. Nagyova, A. Camaioni, R. Prochazka, A. J. Day, and A. Salustri Synthesis of Tumor Necrosis Factor Alpha-Induced Protein 6 in Porcine Preovulatory Follicles: A Study with A38 Antibody Biol Reprod, May 1, 2008; 78(5): 903 - 909. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-J. Yi, E. Nagyova, G. Manandhar, R. Prochazka, M. Sutovsky, C.-S. Park, and P. Sutovsky Proteolytic Activity of the 26S Proteasome Is Required for the Meiotic Resumption, Germinal Vesicle Breakdown, and Cumulus Expansion of Porcine Cumulus-Oocyte Complexes Matured In Vitro Biol Reprod, January 1, 2008; 78(1): 115 - 126. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Mahaffey and M. E. Mummert Hyaluronan Synthesis Is Required for IL-2-Mediated T Cell Proliferation J. Immunol., December 15, 2007; 179(12): 8191 - 8199. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Dunning, M. Lane, H. M. Brown, C. Yeo, R. L. Robker, and D. L. Russell Altered composition of the cumulus-oocyte complex matrix during in vitro maturation of oocytes Hum. Reprod., November 1, 2007; 22(11): 2842 - 2850. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Scarchilli, A. Camaioni, B. Bottazzi, V. Negri, A. Doni, L. Deban, A. Bastone, G. Salvatori, A. Mantovani, G. Siracusa, et al. PTX3 Interacts with Inter-{alpha}-trypsin Inhibitor: IMPLICATIONS FOR HYALURONAN ORGANIZATION AND CUMULUS OOPHORUS EXPANSION J. Biol. Chem., October 12, 2007; 282(41): 30161 - 30170. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Garantziotis, J. W. Hollingsworth, R. B. Ghanayem, S. Timberlake, L. Zhuo, K. Kimata, and D. A. Schwartz Inter-{alpha}-Trypsin Inhibitor Attenuates Complement Activation and Complement-Induced Lung Injury J. Immunol., September 15, 2007; 179(6): 4187 - 4192. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Russell and R. L. Robker Molecular mechanisms of ovulation: co-ordination through the cumulus complex Hum. Reprod. Update, May 1, 2007; 13(3): 289 - 312. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. C. N. Chiu, M.-K. Chung, R. Koistinen, H. Koistinen, M. Seppala, P.-C. Ho, E. H. Y. Ng, K.-F. Lee, and W. S. B. Yeung Cumulus Oophorus-associated Glycodelin-C Displaces Sperm-bound Glycodelin-A and -F and Stimulates Spermatozoa-Zona Pellucida Binding J. Biol. Chem., February 23, 2007; 282(8): 5378 - 5388. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Takahashi, J. D. Morrow, H. Wang, and S. K. Dey Cyclooxygenase-2-derived Prostaglandin E2 Directs Oocyte Maturation by Differentially Influencing Multiple Signaling Pathways J. Biol. Chem., December 1, 2006; 281(48): 37117 - 37129. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhuo, A. Kanamori, R. Kannagi, N. Itano, J. Wu, M. Hamaguchi, N. Ishiguro, and K. Kimata SHAP Potentiates the CD44-mediated Leukocyte Adhesion to the Hyaluronan Substratum J. Biol. Chem., July 21, 2006; 281(29): 20303 - 20314. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Hernandez-Gonzalez, I. Gonzalez-Robayna, M. Shimada, C. M. Wayne, S. A. Ochsner, L. White, and J. S. Richards Gene Expression Profiles of Cumulus Cell Oocyte Complexes during Ovulation Reveal Cumulus Cells Express Neuronal and Immune-Related Genes: Does this Expand Their Role in the Ovulation Process? Mol. Endocrinol., June 1, 2006; 20(6): 1300 - 1321. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Selbi, A. J. Day, M. S. Rugg, C. Fulop, C. A. de la Motte, T. Bowen, V. C. Hascall, and A. O. Phillips Overexpression of Hyaluronan Synthase 2 Alters Hyaluronan Distribution and Function in Proximal Tubular Epithelial Cells J. Am. Soc. Nephrol., June 1, 2006; 17(6): 1553 - 1567. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Taylor and R. L. Gallo Glycosaminoglycans and their proteoglycans: host-associated molecular patterns for initiation and modulation of inflammation FASEB J, January 1, 2006; 20(1): 9 - 22. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Kuznetsova, A. J. Day, D. J. Mahoney, M. S. Rugg, D. F. Mosher, and D. D. Roberts The N-terminal Module of Thrombospondin-1 Interacts with the Link Domain of TSG-6 and Enhances Its Covalent Association with the Heavy Chains of Inter-{alpha}-trypsin Inhibitor J. Biol. Chem., September 2, 2005; 280(35): 30899 - 30908. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Mahoney, B. Mulloy, M. J. Forster, C. D. Blundell, E. Fries, C. M Milner, and A. J. Day Characterization of the Interaction between Tumor Necrosis Factor-stimulated Gene-6 and Heparin: IMPLICATIONS FOR THE INHIBITION OF PLASMIN IN EXTRACELLULAR MATRIX MICROENVIRONMENTS J. Biol. Chem., July 22, 2005; 280(29): 27044 - 27055. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Rugg, A. C. Willis, D. Mukhopadhyay, V. C. Hascall, E. Fries, C. Fulop, C. M. Milner, and A. J. Day Characterization of Complexes Formed between TSG-6 and Inter-{alpha}-inhibitor That Act as Intermediates in the Covalent Transfer of Heavy Chains onto Hyaluronan J. Biol. Chem., July 8, 2005; 280(27): 25674 - 25686. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Gammie Current Models and Future Directions for Understanding the Neural Circuitries of Maternal Behaviors in Rodents Behav Cogn Neurosci Rev, June 1, 2005; 4(2): 119 - 135. [Abstract] [PDF] |
||||
![]() |
J. S. Richards, I. Hernandez-Gonzalez, I. Gonzalez-Robayna, E. Teuling, Y. Lo, D. Boerboom, A. E. Falender, K. H. Doyle, R. G. LeBaron, V. Thompson, et al. Regulated Expression of ADAMTS Family Members in Follicles and Cumulus Oocyte Complexes: Evidence for Specific and Redundant Patterns During Ovulation Biol Reprod, May 1, 2005; 72(5): 1241 - 1255. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-G. Wisniewski, E. S. Snitkin, C. Mindrescu, M. H. Sweet, and J. Vilcek TSG-6 Protein Binding to Glycosaminoglycans: FORMATION OF STABLE COMPLEXES WITH HYALURONAN AND BINDING TO CHONDROITIN SULFATES J. Biol. Chem., April 15, 2005; 280(15): 14476 - 14484. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. W. Sanggaard, H. Karring, Z. Valnickova, I. B. Thogersen, and J. J. Enghild The TSG-6 and I{alpha}I Interaction Promotes a Transesterification Cleaving the Protein-Glycosaminoglycan-Protein (PGP) Cross-link J. Biol. Chem., March 25, 2005; 280(12): 11936 - 11942. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Sommers, S. Sharma, K. M. Doherty, P. Karmakar, Q. Yang, M. K. Kenny, C. C. Harris, and R. M. Brosh Jr. p53 Modulates RPA-Dependent and RPA-Independent WRN Helicase Activity Cancer Res., February 15, 2005; 65(4): 1223 - 1233. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Straach, J. M. Shelton, J. A. Richardson, V. C. Hascall, and M. S. Mahendroo Regulation of hyaluronan expression during cervical ripening Glycobiology, January 1, 2005; 15(1): 55 - 65. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Nagyova, A. Camaioni, R. Prochazka, and A. Salustri Covalent Transfer of Heavy Chains of Inter-{alpha}-Trypsin Inhibitor Family Proteins to Hyaluronan in In Vivo and In Vitro Expanded Porcine Oocyte-Cumulus Complexes Biol Reprod, December 1, 2004; 71(6): 1838 - 1843. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Suzuki, H. Kobayashi, Y. Tanaka, N. Kanayama, and T. Terao Reproductive failure in mice lacking inter-alpha-trypsin inhibitor (ITI) - ITI target genes in mouse ovary identified by microarray analysis J. Endocrinol., October 1, 2004; 183(1): 29 - 38. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhuo, V. C. Hascall, and K. Kimata Inter-{alpha}-trypsin Inhibitor, a Covalent Protein-Glycosaminoglycan-Protein Complex J. Biol. Chem., September 10, 2004; 279(37): 38079 - 38082. [Full Text] [PDF] |
||||
![]() |
|