JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.C000899200 on January 5, 2001

J. Biol. Chem., Vol. 276, Issue 11, 7693-7696, March 16, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/11/7693    most recent
C000899200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhuo, L.
Right arrow Articles by Kimata, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhuo, L.
Right arrow Articles by Kimata, K.

ACCELERATED PUBLICATION
Defect in SHAP-Hyaluronan Complex Causes Severe Female Infertility

A STUDY BY INACTIVATION OF THE BIKUNIN GENE IN MICE*

Lisheng ZhuoDagger , Masahiko YonedaDagger §, Ming ZhaoDagger , Wannarat YingsungDagger , Naoko Yoshida||, Yasuo Kitagawa||, Kumiko Kawamura**, Toshiro Suzuki**, and Koji KimataDagger DaggerDagger

From the Dagger  Institute for Molecular Science of Medicine, Aichi Medical University, Nagakute, Aichi, 480-1195, the || Graduate Program for Regulation of Biological Signals, Graduate School of Bioagriculture Sciences, Nagoya University, Chikusa, Nagoya 464-8601, and ** Japan SLC Inc., Aoi-higashi, Hamamatsu 433-8114, Japan

Received for publication, December 20, 2000



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Hyaluronan (HA) associates with proteins and proteoglycans to form the extracellular HA-rich matrices that significantly affect cellular behaviors. So far, only the heavy chains of the plasma inter-alpha -trypsin inhibitor (ITI) family, designated as SHAPs (serum-derived hyaluronan-associated proteins), have been shown to bind covalently to HA. The physiological significance of such a unique covalent complex has been unknown but is of great interest, because HA and the ITI family are abundant in tissues and in plasma, respectively, and the SHAP-HA complex is formed wherever HA meets plasma. We abolished the formation of the SHAP-HA complex in mice by targeting the gene of bikunin, the light chain of the ITI family members, which is essential for their biosynthesis. As a consequence, the cumulus oophorus, an investing structure unique to the oocyte of higher mammals, had a defect in forming the extracellular HA-rich matrix during expansion. The ovulated oocytes were completely devoid of matrix and were unfertilized, leading to severe female infertility. Intraperitoneal administration of ITI, accompanied by the formation of the SHAP-HA complex, fully rescued the defects. We conclude that the SHAP-HA complex is a major component of the HA-rich matrix of the cumulus oophorus and is essential for fertilization in vivo.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Most cells undergoing active proliferation, differentiation, and locomotion in vitro and in vivo form extracellular hyaluronan (HA)1-rich matrices, which have been shown to play significant roles in many biological processes, such as tissue organization, morphogenesis, inflammation, and cancer metastasis (1-3). We previously identified the covalent SHAP (serum-derived hyaluronan-associated protein)-HA complex in the extracellular HA-rich matrix of cultured mouse dermal fibroblasts and found that the SHAPs are the heavy chains of the inter-alpha -trypsin inihibitor (ITI) family in serum supplemented to culture medium (4-6).

The ITI family members are synthesized and assembled in liver and secreted into blood at high concentrations (0.15-0.5 mg/ml of plasma) (7). The members are composed of a common light chain, bikunin (Bik), and one or two of the three genetically different heavy chains (HC1, HC2, and HC3) (8). Free bikunin in circulation is excreted rapidly into the urine (9) where it is present as the urinary trypsin inhibitor (UTI) (10). The serine residue at position 10 of bikunin contains an O-glycosidically linked chondroitin-4-sulfate (CS) chain (11), to which the C terminal aspartate of a heavy chain is covalently bound via a unique ester bond (12). The SHAPs link to HA via an equivalent ester bond, suggesting that the formation of the SHAP-HA complex is a substitution reaction, namely HA replaces the CS of bikunin to link to a heavy chain (Fig. 1) (6). Plasma includes an enzyme activity that catalyzes the reaction (13). Therefore, we might expect that the SHAP-HA complex would be formed once plasma meets HA, thereby contributing to some physiological and pathological processes.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 1.   Schematic representation of the synthesis of the SHAP-HA complex.

This paper attempts to clarify not only the physiological function of the SHAP-HA complex but also that of the ITI family by eliminating their formation in mice in which the bikunin gene has been inactivated.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Construction of Targeting Vector and Generation of Bikunin-deficient Mice-- To delete the CS attachment site encoded by exon 7 of the alpha -1-microglobulin (alpha 1M)/bikunin precursor gene (14), we created an Eco47III site by site-directed mutagenesis of the codon for the serine residue at position 7 in bikunin from AGT to CGCT (QuikchangeTM kit; Stratagene). After the Eco47III digestion, the 5' part of exon 7 was linked to an SV 40-derived sequence between a HpaI site (position 2474) and a BamHI site (position 2605) in pMAMneo-s vector (CLONTECH, Palo Alto, CA), followed by a neomycin-resistant gene (Fig. 2, neo). The 6-kb-long sequence between the ClaI site in exon 3 and the mutated site was used as the long arm of the targeting construct, and the 1.6-kb-long sequence flanked by an EcoRI site in intron 8 and a downstream PvuII site was used as the short arm. The whole fragment was cloned into a vector containing the thymidine kinase (tk) gene. The linearlized vector was electroporated into E14 embryonic stem (ES) cells. After positive and negative selection, about 2% of the resistant colonies were confirmed to have undergone homologous recombination by nested PCR analysis with the primers GACATTGGGTGGAAACATTCCAGG and TGGGGTACTGTGTGGATGCAGTTAG for the first PCR, and CGAAGCTTGGCTGGACGTAAACTCC and ATTCTCCAGGGCATGGGCATAGGCC for the nested PCR (Fig. 2A, arrows) and then further by Southern blot analysis. Four ~100% chimera mice were obtained from an ES clone by aggregating ES cells with the 8-cell embryos from C57BL/6 female mice. All of them gave F1 offspring carrying the mutation in a heterozygous state when mated to C57BL/6 females. Homozygous mutants were obtained by sibling intercross. Animals at generation F2 to F4 were used for analysis.



View larger version (60K):
[in this window]
[in a new window]
 
Fig. 2.   Generation of bikunin-deficient mice. A, bikunin gene-targeting strategy. Among the ten exons, exon 1 to 6 encodes for alpha 1M, and the others encode for Bik. The restriction sites are as follows: C, ClaI; E, EcoRI; K, KpnI; and P, PvuII. pA, polyadenylation signal sequences. B, modification of exon 7 (capital letters in bold). RARR is the conserved proteolytic cleavage site for separating alpha 1M and Bik. Bik is truncated immediately before the serine residue at position 7, which is followed by the conserved chondroitin sulfate chain attachment site, EGSG, at position 8 to 11. An SV40-derived sequence provides the new stop codon (*) and pA sequences (lowercase letters in bold) for the alpha 1M gene. C, Southern blot analysis. KpnI digestion, the outer probe. D, RT-PCR analysis of liver total RNA. E, Northern blot analysis of liver total RNA. The alpha 1M cDNA probe reveals a short transcript from the truncated precursor gene. F, immunoblot analysis of mice serum using anti-alpha 1M antibody under a nonreducing condition and anti-Bik or anti-ITI antibodies under a reducing condition. The new 110-kDa HC-related protein in Bik-/- mice is presumably the unprocessed HCs with intact C-terminal extensions. G, test tube assay for the formation of SHAP-HA complex. ITI in Bik+/- mice forms the SHAP-HA complex with exogeneous HA, but the unprocessed HC in Bik-/- mice does not. The serum of Bik-/- mice includes the activity to catalyze the reaction between exogeneous ITI and HA (see Fig. 1).

RT-PCR-- Total RNA was purified from liver with TRIzol® reagent (Life Technologies, Inc.). The primers used for RT-PCR were as follows: (a) CAAGAATTCAGGGCAACCTG and TTCTCGAGCACAGCCTGGTCCCTCC for HC1, (b) ACGGATCCTCTCAGCTCAAGAAAT and CCCTCGAGTTTCCAAGATGA for HC2, (c) CCAAGAGAGTGAGGGGTCAGGGACT and GGGTCCAGATCATCTAAGCTGGACT for Bik, (d) GCTGATCATGCGTCAACACTGC and CGTGATCATCTGGCAATTGACGTGGGC for alpha 1M and (e) CCTGGAATGTTTCCACCCAATGTCG and CCATGATATTCGGCAAGCAGGCATC for neo.

Immunostaining Analysis-- ITI family molecules were detected by rabbit antibody against human ITI (DAKO, Glostrup, Denmark) or rabbit antiserum against human bikunin (Yanaihara, Kenkyuasho, shizuoka, Japan) followed by peroxidase-conjugated goat antibody against rabbit Ig (DAKO) or Alexa 594-labeled goat anti-rabbit IgG antibodies (highly cross-adsorbed; Molecular Probes, Inc., Eugene, OR). The antigen, bikunin, was purified from Miraclid® (Mochida Pharmaceutical Co., Tokyo, Japan) by elution on a DEAE-Sepharose column (15). The alpha 1M was detected with sheep antibody against human alpha 1M (The Binding Site, Birmingham, UK) followed by peroxidase-conjugated rabbit antibody against sheep Ig (DAKO). Hyaluronan was detected by biotinylated hyaluronan-binding protein (Seikagaku Corp., Tokyo, Japan) followed by Alexa 488-labeled streptavidin (Molecular Probes). The peroxidase-conjugated second antibodies were visualized with Renaissance® chemiluminescence reagent plus (PerkinElmer Life Sciences) and exposed to Hyperfilm ECL film (Amersham Pharmacia Biotech).

Purification of Mouse ITI-- Mouse ITI was purified from the pooled serum of wild type or Bik+/- mice by Q-Sepharose chromatography and ammonium sulfate precipitation (16).

Test Tube Reaction for the Formation of SHAP-HA Complex-- The reaction mixture (2.75 ml) including 0.5 ml of serum, 0.1 ml of HA (5 mg/ml; Seikagaku, Japan), and 5 mM MgCl2 in Hank's medium was incubated overnight at 37 °C; 0.2 mg of mouse ITI was added if necessary. After incubation, a 4 M guanidine HCl solution was prepared and adjusted to a density of 1.37 g/ml with solid CsCl. After centrifugation at 40,000 rpm for 48 h, the SHAP-HA complex in the bottom fraction (p >=  1.45 g/ml) was precipitated with ethanol, digested with Streptomyces hyaluronidase (Seikagaku Corp., Tokyo, Japan) at 60 °C for 2 h, and subjected to immunoblot analysis (4-6).

Superovulation-- Three- to four-week-old female mice were injected intraperitoneally with 5 IU of pregnant mare's serum (Sigma) at noon and 5 IU of human chorionic gonadotropin (hCG) (Sigma) 48 h later. If necessary, purified mouse ITI (0.35 mg/mouse) or human UTI (67 µg/mouse, prepared as above) was mixed with hCG and injected in the same way. Then the Bik-/- females were caged overnight with males, and their oocytes were examined at 0.5 and 1.5 days post coitus (dpc).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Gene Targeting of Bikunin Abolished the Formation of the ITI Family and the SHAP-HA Complex-- Bikunin is synthesized as a fusion protein with another plasma protein, alpha 1M, and is separated from alpha 1M by post-translational proteolysis (17, 18). We successfully truncated the alpha 1M/bikunin precursor gene to abolish bikunin gene expression while retaining normal alpha 1M gene expression (Fig. 2, A-E). The Bik-/- mice have a normal plasma level of alpha 1M protein, which forms complexes with other plasma proteins normally (Fig. 2F) (19). On the other hand, as predicted, ITI (230 kDa) and Palpha I (130 kDa) were absent in Bik-/- mice (Fig. 2F). The Bik+/- mice, with less bikunin transcripts (Fig. 2E), showed normal plasma levels of ITI and Palpha I (Fig. 2F).

A new heavy chain-related protein appeared in the serum of Bik-/- mice (Fig. 2F). During the assembly of members of the ITI family, the propeptides of heavy chains have their C-terminal extensions (240-280 amino acid residues) proteolytically removed while linking to bikunin (20). The molecular mass (110 kDa) of the new protein is consistent with that expected for the unprocessed heavy chain. The new protein was not altered by chondroitinase ABC digestion (data not shown), which indicates that the heavy chains do not link to other chondroitin sulfate proteoglycans in the absence of bikunin.

Incubation of the serum of Bik-/- mice with exogenous HA resulted in no formation of the SHAP-HA complex, indicating that the unprocessed heavy chains have no ability to form the SHAP-HA complex with HA (Fig. 2G). Therefore, the ester bond between a heavy chain and the CS chain of bikunin is essential for the substitution reaction to form the SHAP-HA complex. Thus, we have succeeded in developing an in vivo system where there is no biosynthesis of the ITI family and consequently no formation of the SHAP-HA complex.

Bik-/- Female Mice Are Infertile-- Bikunin deficiency did not significantly affect ontogenesis. Segregation of bikunin alleles followed Mendel's law (data not shown). Gross inspection failed to discriminate between the mutant and wild type animals. Adult Bik-/- mice showed normal copulating behaviors. However, in contrast to the full fertility of males, the females showed severe infertility (Table I). Although the vaginal plug was documented many times, more than half of the Bik-/- females were not pregnant. The others had only small litters (1.6 in average) and were indifferent to their pups. The neonatal pups usually died within 2 days, but the ones that were fostered by Bik+/- mothers survived.


                              
View this table:
[in this window]
[in a new window]
 
Table I
Impaired fertility in Bikunin-deficient female mice

We examined the gestation processes in Bik-/- females. The ovaries appeared normal, because those of 4-week-old females responded normally to gonadotropin treatment, and those of the adults included follicles at all maturation stages, as well as the well defined corpus luteum (data not shown). Vaginal cytological examination revealed normal menstrual cycles (data not shown). In contrast, when examining the uteri at 5.5-7.5 dpc, only one implanted embryo was found in seven uteri. These results, together with the rare but complete success in gestation, indicated normal uterine and ovarian functions and suggested impairment at fertilization or implantation in Bik-/- females.



View larger version (73K):
[in this window]
[in a new window]
 
Fig. 3.   Impaired cumulus expansion and oocyte fertilization in Bik-/- female mice. A, all oocytes in the oviducts of Bik-/- mice at 0.5 dpc are devoid of cumulus masses. The naked oocytes are not fertilized and remain at the single-cell stage at 1.5 dpc. B, paraffin section of ovaries after hCG induction. In Bik-/- mice, the cumulus cells are released during expansion of cumulus oophorus because of a defect of cumulus matrix formation. Hematoxylin-eosin staining was employed.

We then collected the naturally ovulated oocytes from oviducts at 0.5 dpc. The number of oocytes of Bik-/- females (3.5 ± 1.8, n = 13) were significantly less than that observed in Bik+/- females (8.1 ± 2.3, n = 11). More strikingly, all oocytes of Bik-/- females were completely devoid of a cumulus oophorus, in sharp contrast to the cumulus-oocyte complexes collected from Bik+/- females (Fig. 3A). The naked oocytes had intact zona pellucida. They remained at the single-cell stage at 1.5 dpc, when those of Bik+/- females had already cleaved into two-cell oocytes (Fig. 3A). Therefore, the infertility of Bik-/- females was due to the impaired fertilization of the cumulus oophorus-free oocytes.

Absence of the SHAP-HA Complex Caused the Defect of the HA-rich Matrix of the Cumulus Oophorus-- Ovarian histology revealed the presence of normal cumulus oophori in the graffian follicles of Bik-/- females. However, after a gonadotropin surge in Bik-/- females, the cumulus oophorus matrix fails to form, and the cumulus cells were dispersed in the antral cavity (Fig. 3B).

During cumulus expansion, the blood-follicle barrier opens and allows the influx of members of the ITI family, as well as the enzymatic factor required to form the SHAP-HA complex when the cumulus cells initiate extensive HA synthesis (21, 22). A granulosa cell-derived factor with similar enzyme activity has also been reported (23). Such a follicle environment would be very suitable for the formation of the SHAP-HA complexes. Thus, the defect of the SHAP-HA complex formation in Bik-/- females most likely impairs the construction of the cumulus HA-rich matrix with subsequent detachment of the cumulus cells from the oocyte. To verify this, we immunolocalized HA and SHAP in the cumulus-oocyte complex and found that the SHAP colocalized with HA perfectly throughout the matrix network (Fig. 4A). This finding indicates that the SHAP-HA complex is a major component of the cumulus matrix. Bikunin was not detectable in the cumulus-oocyte complex (Fig. 4A). An immunoblot result also showed that all SHAP-related immunoreactivities in the cumulus-oocyte complex were from the SHAP-HA complex, and no intact ITI family molecules were present in the cumulus matrix (Fig. 4B). Therefore, the infertility of the bikunin-deficient female mice was due to the absence of the cumulus SHAP-HA complex but not because of the absence of bikunin per se.



View larger version (87K):
[in this window]
[in a new window]
 
Fig. 4.   The SHAP-HA complex is the major component of the cumulus matrix. A, immunofluorescent localization of SHAP and HA in the COC. The SHAP colocalizes well with HA throughout the matrix network. The COCs show no bikunin immunoreactivity. 4',6-Diamidino-2-phenylindole (DAPI) stains the nuclei of the cumulus cells. B, 10 COCs from Bik+/- females or 10 naked oocytes from Bik-/- females were digested with Streptomyces hyaluronidase (HAase), and the supernatants were subjected to immunoblot analysis with anti-ITI antibody. Only the heavy chain in the form of the SHAP-HA complex is detected. As a control, the heavy chains were released from ITI and Palpha I by NaOH treatment. C, ITI administration rescues the cumulus matrix and oocyte fertilization in Bik-/- females. proHC, the unprocessed heavy chain.

ITI Administration Fully Rescued the Defect of Cumulus Expansion and Oocyte Fertilization-- We further explored the possibility of rescuing the infertility of Bik-/- females by ITI administration. When injected intraperitoneally, the purified mouse ITI appeared in blood within 1 h and remained detectable for more than 10 h (Fig. 4C). This ensured the availability of plasma ITI during the process of induced ovulation (24). Oocyte examination revealed that ITI administration resulted in a full recovery of cumulus expansion and oocyte fertilization. The oocytes in oviducts regained the cumulus oophori at 0.5 dpc (3 mice) and were successfully fertilized and cleaved into 2- or 4-cell oocytes at 1.5 dpc (3 mice) (Fig. 4C). In contrast, administration of human UTI resulted in no improvement of the naked oocytes (5 mice), although the rapid clearance of UTI from blood should not be overlooked (9). The recovery could be explained by the formation of the SHAP-HA complex between the exogenous ITI and the endogenous cumulus HA in accordance with the test tube assay (Fig. 2G).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The present results assign a definite physiological function to the SHAP-HA complex, as well as the ITI family, in the process of ovulation and fertilization. It is now clear that the blood has roles in fertilization not only indirectly by transporting hormones and nutrients but also directly by participating in the construction of the expanded cumulus oophorus. The results also provide a new insight into the structure of the cumulus matrix and show directly the importance of the expanded cumulus oophorus in fertilization in vivo.

The protease inhibitory activity of bikunin has drawn most of the research attention to the ITI family. A successful example is the clinical application of UTI to the treatment of acute pancreatitis and shock. The inhibitory activities of UTI to cancer metastasis (25) and nephrolithiasis (15) have also been reported. Here, we showed that bikunin is necessary for the formation of the SHAP-HA complex that is essential for fertilization. The finding identifies an important "SHAP-presenting" role for bikunin, i.e. activating (esterifying), transporting, and presenting the heavy chains to suitable recipients under suitable conditions, such as the newly synthesized HA in the expanding cumulus oophorus. Such a role is physiologically most important, because bikunin deficiency itself did not significantly impair ontogenesis. The fact that most bikunin in plasma is linked with the heavy chains (ITI and Palpha I) (8), and the released bikunin in circulation is rapidly excreted into urine (9), supports this notion.

The influx of plasma into preovulatory follicles and the local formation of the SHAP-HA complex recalls similar situations in inflammatory sites, where cytokines stimulate local HA synthesis and induce capillary hyperpermeability to allow the efflux of plasma components. The SHAP-HA complex may also play roles in such inflammatory responses. Indeed, the SHAP-HA complex was found to accumulate significantly in the synovial fluid of patients suffering from rheumatoid arthritis (6, 26). Studies of the SHAP-HA complex will help us to understand the pathogenesis of such diseases.

The molecular mechanism for the construction and metabolism of the HA-rich cumulus matrix is still largely unknown. Its HA-rich nature has been manifested by many studies (22, 27-30). Here we demonstrate that the cumulus matrix contains the SHAP-HA complex as an essential component. Previous studies with scanning electron microscopy revealed many trypsin-sensitive granules along with the hyaluronan filament in the cumulus matrix (28). The N-terminal regions of the heavy chains of ITI have granule appearances (31). Therefore, it is very likely that the granule-filament structure represents the SHAP-HA complex. Our findings also help explain the previous observations, which showed that ITI and Palpha I stabilized the HA-rich matrix of cultured cells (32, 33) and in vitro cumulus expansion (34), and that HA oligomers interfered with ovulation in vivo (35). The cumulus matrix might include other components, such as proteoglycans (36, 37), TSG-6 (38), and the link protein (39). The characterization of their interaction with the SHAP-HA complex is necessary for the completely delineation of the structure of cumulus matrix, for example the possible interaction between the SHAP and PG-M/versican (40). The complete shedding of the cumulus cells in Bik-/- mice raised an interesting question about the role of SHAP in the anchoring of the cumulus oophorus matrix on the protein surface of the zona pellucida.

We have clarified a molecular mechanism underlying a form of female infertility. It encourages us to survey spontaneous genetic mutations in the infertile women population to identify possible defects in ITI. So far no such case has been reported. However, a heritable null allele of the HC1 gene resulting from a deletion/frameshift has previously been identified (41).


    ACKNOWLEDGEMENTS

We thank M. Hooper for the E14 ES cell line, H. Kondo for the STO/NHL feeder cell line, F. Azumi and M. Matsumoto for technical assistance in animal experiments, and A. Iida for technical assistance in histology; also, we thank A. Salustri and V. C. Hascall for kind advice and Drs. H. Watanabe and H. Suzuki for critical reading of this manuscript.


    FOOTNOTES

* This work was supported by a preparatory grant for the research at the Division of Matrix Glycoconjugates, Research Center for Infectious Disease, Aichi Medical University, by grants-in-aid from the Ministry of Education, Science, Sport, and Culture of Japan, and by a special research fund from Seikagaku Corp.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Present address: Biochemistry and Molecular Biology Laboratory, Aichi Prefectural College of Nursing and Health, Moriyama, Nagoya 463-8502, Japan.

Present address: Laboratory of Cellular and Developmental Biology, NIH, Bethesda, MD 20892.

Dagger Dagger To whom correspondence should be addressed: Inst. for Molecular Science of Medicine, Aichi Medical University, Nagakute, Aichi, 480-1195, Japan. Tel.: 81-52-2644811 (ext. 2088); Fax: 81-561-633-532; E-mail: kimata@amugw.aichi-med-u.ac.jp.

Published, JBC Papers in Press, January 5, 2001, DOI 10.1074/jbc.C000899200


    ABBREVIATIONS

The abbreviations used are: HA, hyaluronan; alpha 1M, alpha -1-microglobulin; Bik, bikunin; dpc, days post coitus; HC, heavy chain; hCG, human chrionic gonadotropin; ITI, inter-alpha -trypsin inhibitor; Palpha I, pre-alpha -inhibitor; UTI, urinary trypsin inhibitor; kb, kilobase; ES, embryonic cell; PCR, polymerase chain reaction; COC, cumulus-oocyte complex; CS, chondroitin-4-sulfate.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES


1. Toole, B. P. (1991) in Cell Biology of Extracellular Matrix (Hay, E. D., ed), 2nd Ed. , pp. 305-341, Plenum Press, New York
2. Laurent, T. C., and Fraser, J. R. (1992) FASEB J. 6, 2397-2404
3. Knudson, C. B., and Knudson, W. (1993) FASEB J. 7, 1233-1241
4. Yoneda, M., Suzuki, S., and Kimata, K. (1990) J. Biol. Chem. 265, 5247-5257
5. Huang, L., Yoneda, M., and Kimata, K. (1993) J. Biol. Chem. 268, 26725-26730
6. Zhao, M., Yoneda, M., Ohashi, Y., Kurono, S., Iwata, H., Ohnuki, Y., and Kimata, K. (1995) J. Biol. Chem. 270, 26657-26663
7. Mizon, C., Balduyck, M., Albani, D., Michalski, C., Burnouf, T., and Mizon, J. (1996) J. Immunol. Methods 190, 61-70
8. Salier, J. P., Rouet, P., Raguenez, G., and Daveau, M. (1996) Biochem. J. 315, 1-9
9. Sugiki, M., Sumi, H., Maruyama, M., Yoshida, E., and Mihara, H. (1989) Enzyme 42, 31-38
10. Proksch, G. J., Lane, J., and Nordschow, C. D. (1973) Clin. Biochem. 6, 200-206
11. Hochstrasser, K., Schonberger, O. L., Rossmanith, I., and Wachter, E. (1981) Hoppe-Seyler's Z. Physiol. Chem. 362, 1357-1362
12. Enghild, J. J., Salvesen, G., Hefta, S. A., Thogersen, I. B., Rutherfurd, S., and Pizzo, S. V. (1991) J. Biol. Chem. 266, 747-751
13. Yoneda, M., Kida, D., Iwata, H., Zhao, M., and Kimata, K. (1998) Connective Tissue 30, 69-73
14. Lindqvist, A., Rouet, P., Salier, J. P., and Akerstrom, B. (1999) Gene 234, 329-336
15. Atmani, F., Lacour, B., Drueke, T., and Daudon, M. (1993) Urol. Res. 21, 61-66
16. Yamamoto, T., Yamamoto, K., and Sinohara, H. (1996) J. Biochem. (Tokyo) 120, 145-152
17. Kaumeyer, J. F., Polazzi, J. O., and Kotick, M. (1986) Nucleic Acids Res. 14, 7839-7850
18. Thuveson, M., and Fries, E. (1999) J. Biol. Chem. 274, 6741-6746
19. Berggard, T., Thelin, N., Falkenberg, C., Enghild, J. J., and Akerstrom, B. (1997) Eur. J. Biochem. 245, 676-683
20. Chan, P., Risler, J. L., Raguenez, G., and Salier, J. P. (1995) Biochem. J. 306, 505-512
21. Powers, R. W., Chen, L., Russell, P. T., and Larsen, W. J. (1995) Am. J. Physiol. 269, (Endocrinol. Metab. 32), E290-E298
22. Salustri, A., Yanagishita, M., and Hascall, V. C. (1989) J. Biol. Chem. 264, 13840-13847
23. Chen, L., Zhang, H., Powers, R. W., Russell, P. T., and Larsen, W. J. (1996) J. Biol. Chem. 271, 19409-19414
24. Larsen, W. J., Wert, S. E., and Brunner, G. D. (1986) Dev. Biol. 113, 517-521
25. Kobayashi, H., Shinohara, H., Fujie, M., Gotoh, J., Itoh, M., Takeuchi, K., and Terao, T. (1995) Int. J. Cancer 63, 455-462
26. Kida, D., Yoneda, M., Miyaura, S., Ishimaru, T., Yoshida, Y., Ito, T., Ishiguro, N., Iwata, H., and Kimata, K. (1999) J. Rheumatol. 26, 1230-1238
27. Chen, L., Russell, P. T., and Larsen, W. J. (1993) Mol. Reprod. Dev. 34, 87-93
28. Talbot, P., and DiCarlantonio, G. (1984) Dev. Biol. 103, 159-167
29. Camaioni, A., Hascall, V. C., Yanagishita, M., and Salustri, A. (1993) J. Biol. Chem. 268, 20473-20481
30. Fulop, C., Salustri, A., and Hascall, V. C. (1997) Arch. Biochem. Biophys. 337, 261-266
31. Blom, A. M., Mörgelin, M., Oyen, M., Jarvet, J., and Fries, E. (1999) J. Biol. Chem. 274, 298-304
32. Castillo, G. M., and Templeton, D. M. (1993) FEBS Lett. 318, 292-296
33. Blom, A., Pertoft, H., and Fries, E. (1995) J. Biol. Chem. 270, 9698-9701
34. Chen, L., Mao, S. J. T., and Larsen, W. J. (1992) J. Biol. Chem. 267, 12380-12386
35. Hess, K. A., Chen, L., and Larsen, W. J. (1999) Biol. Reprod. 61, 436-443
36. Camaioni, A., Salustri, A., Yanagishita, M., and Hascall, V. C. (1996) Arch. Biochem. Biophys. 325, 190-198
37. Eriksen, G. V., Carlstedt, I., Mörgelin, M., Uldbjerg, N., and Malmström, A. Y. (1999) Biochem. J. 340, 613-620
38. Fulop, C., Kamath, R. V., Li, Y., Otto, J. M., Salustri, A., Olsen, B. R., Glant, T. T., and Hascall, V. C. (1997) Gene 202, 95-102
39. Kobayashi, H., Sun, G. W., Hirashima, Y., and Terao, T. (1999) Endocrinology 140, 3835-3842
40. Yoneda, M., Zhao, M., Zhuo, L., Watanabe, H., Yamada, Y., Huang, L., Nagasawa, S., Nishimura, H., Shinomura, T., Isogai, Z., and Kimata, K. (2000) in New Frontiers in Medical Sciences: Redefining Hyaluronan (Abatangelo, G. , and Weigel, P. H., eds) , pp. 21-30, Elsevier Science Publishers B.V., Amsterdam
41. Nakayashiki, N., Ding, M., Umetsu, K., Yuasa, I., Suzuki, T., and Aoki, Y. (1997) Jpn. J. Hum. Genet. 42, 363-368


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.


This article has been cited by other articles:


Home page
Biol. Reprod.Home page
E. Nagyova, A. Camaioni, R. Prochazka, A. J. Day, and A. Salustri
Synthesis of Tumor Necrosis Factor Alpha-Induced Protein 6 in Porcine Preovulatory Follicles: A Study with A38 Antibody
Biol Reprod, May 1, 2008; 78(5): 903 - 909.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Y.-J. Yi, E. Nagyova, G. Manandhar, R. Prochazka, M. Sutovsky, C.-S. Park, and P. Sutovsky
Proteolytic Activity of the 26S Proteasome Is Required for the Meiotic Resumption, Germinal Vesicle Breakdown, and Cumulus Expansion of Porcine Cumulus-Oocyte Complexes Matured In Vitro
Biol Reprod, January 1, 2008; 78(1): 115 - 126.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. L. Mahaffey and M. E. Mummert
Hyaluronan Synthesis Is Required for IL-2-Mediated T Cell Proliferation
J. Immunol., December 15, 2007; 179(12): 8191 - 8199.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
K. R. Dunning, M. Lane, H. M. Brown, C. Yeo, R. L. Robker, and D. L. Russell
Altered composition of the cumulus-oocyte complex matrix during in vitro maturation of oocytes
Hum. Reprod., November 1, 2007; 22(11): 2842 - 2850.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Scarchilli, A. Camaioni, B. Bottazzi, V. Negri, A. Doni, L. Deban, A. Bastone, G. Salvatori, A. Mantovani, G. Siracusa, et al.
PTX3 Interacts with Inter-{alpha}-trypsin Inhibitor: IMPLICATIONS FOR HYALURONAN ORGANIZATION AND CUMULUS OOPHORUS EXPANSION
J. Biol. Chem., October 12, 2007; 282(41): 30161 - 30170.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Garantziotis, J. W. Hollingsworth, R. B. Ghanayem, S. Timberlake, L. Zhuo, K. Kimata, and D. A. Schwartz
Inter-{alpha}-Trypsin Inhibitor Attenuates Complement Activation and Complement-Induced Lung Injury
J. Immunol., September 15, 2007; 179(6): 4187 - 4192.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
D. L. Russell and R. L. Robker
Molecular mechanisms of ovulation: co-ordination through the cumulus complex
Hum. Reprod. Update, May 1, 2007; 13(3): 289 - 312.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. C. N. Chiu, M.-K. Chung, R. Koistinen, H. Koistinen, M. Seppala, P.-C. Ho, E. H. Y. Ng, K.-F. Lee, and W. S. B. Yeung
Cumulus Oophorus-associated Glycodelin-C Displaces Sperm-bound Glycodelin-A and -F and Stimulates Spermatozoa-Zona Pellucida Binding
J. Biol. Chem., February 23, 2007; 282(8): 5378 - 5388.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Takahashi, J. D. Morrow, H. Wang, and S. K. Dey
Cyclooxygenase-2-derived Prostaglandin E2 Directs Oocyte Maturation by Differentially Influencing Multiple Signaling Pathways
J. Biol. Chem., December 1, 2006; 281(48): 37117 - 37129.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Zhuo, A. Kanamori, R. Kannagi, N. Itano, J. Wu, M. Hamaguchi, N. Ishiguro, and K. Kimata
SHAP Potentiates the CD44-mediated Leukocyte Adhesion to the Hyaluronan Substratum
J. Biol. Chem., July 21, 2006; 281(29): 20303 - 20314.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
I. Hernandez-Gonzalez, I. Gonzalez-Robayna, M. Shimada, C. M. Wayne, S. A. Ochsner, L. White, and J. S. Richards
Gene Expression Profiles of Cumulus Cell Oocyte Complexes during Ovulation Reveal Cumulus Cells Express Neuronal and Immune-Related Genes: Does this Expand Their Role in the Ovulation Process?
Mol. Endocrinol., June 1, 2006; 20(6): 1300 - 1321.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
W. Selbi, A. J. Day, M. S. Rugg, C. Fulop, C. A. de la Motte, T. Bowen, V. C. Hascall, and A. O. Phillips
Overexpression of Hyaluronan Synthase 2 Alters Hyaluronan Distribution and Function in Proximal Tubular Epithelial Cells
J. Am. Soc. Nephrol., June 1, 2006; 17(6): 1553 - 1567.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
K. R. Taylor and R. L. Gallo
Glycosaminoglycans and their proteoglycans: host-associated molecular patterns for initiation and modulation of inflammation
FASEB J, January 1, 2006; 20(1): 9 - 22.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. A. Kuznetsova, A. J. Day, D. J. Mahoney, M. S. Rugg, D. F. Mosher, and D. D. Roberts
The N-terminal Module of Thrombospondin-1 Interacts with the Link Domain of TSG-6 and Enhances Its Covalent Association with the Heavy Chains of Inter-{alpha}-trypsin Inhibitor
J. Biol. Chem., September 2, 2005; 280(35): 30899 - 30908.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. J. Mahoney, B. Mulloy, M. J. Forster, C. D. Blundell, E. Fries, C. M Milner, and A. J. Day
Characterization of the Interaction between Tumor Necrosis Factor-stimulated Gene-6 and Heparin: IMPLICATIONS FOR THE INHIBITION OF PLASMIN IN EXTRACELLULAR MATRIX MICROENVIRONMENTS
J. Biol. Chem., July 22, 2005; 280(29): 27044 - 27055.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. S. Rugg, A. C. Willis, D. Mukhopadhyay, V. C. Hascall, E. Fries, C. Fulop, C. M. Milner, and A. J. Day
Characterization of Complexes Formed between TSG-6 and Inter-{alpha}-inhibitor That Act as Intermediates in the Covalent Transfer of Heavy Chains onto Hyaluronan
J. Biol. Chem., July 8, 2005; 280(27): 25674 - 25686.
[Abstract] [Full Text] [PDF]


Home page
Behav Cogn Neurosci RevHome page
S. C. Gammie
Current Models and Future Directions for Understanding the Neural Circuitries of Maternal Behaviors in Rodents
Behav Cogn Neurosci Rev, June 1, 2005; 4(2): 119 - 135.
[Abstract] [PDF]


Home page
Biol. Reprod.Home page
J. S. Richards, I. Hernandez-Gonzalez, I. Gonzalez-Robayna, E. Teuling, Y. Lo, D. Boerboom, A. E. Falender, K. H. Doyle, R. G. LeBaron, V. Thompson, et al.
Regulated Expression of ADAMTS Family Members in Follicles and Cumulus Oocyte Complexes: Evidence for Specific and Redundant Patterns During Ovulation
Biol Reprod, May 1, 2005; 72(5): 1241 - 1255.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-G. Wisniewski, E. S. Snitkin, C. Mindrescu, M. H. Sweet, and J. Vilcek
TSG-6 Protein Binding to Glycosaminoglycans: FORMATION OF STABLE COMPLEXES WITH HYALURONAN AND BINDING TO CHONDROITIN SULFATES
J. Biol. Chem., April 15, 2005; 280(15): 14476 - 14484.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. W. Sanggaard, H. Karring, Z. Valnickova, I. B. Thogersen, and J. J. Enghild
The TSG-6 and I{alpha}I Interaction Promotes a Transesterification Cleaving the Protein-Glycosaminoglycan-Protein (PGP) Cross-link
J. Biol. Chem., March 25, 2005; 280(12): 11936 - 11942.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. A. Sommers, S. Sharma, K. M. Doherty, P. Karmakar, Q. Yang, M. K. Kenny, C. C. Harris, and R. M. Brosh Jr.
p53 Modulates RPA-Dependent and RPA-Independent WRN Helicase Activity
Cancer Res., February 15, 2005; 65(4): 1223 - 1233.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
K. J. Straach, J. M. Shelton, J. A. Richardson, V. C. Hascall, and M. S. Mahendroo
Regulation of hyaluronan expression during cervical ripening
Glycobiology, January 1, 2005; 15(1): 55 - 65.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
E. Nagyova, A. Camaioni, R. Prochazka, and A. Salustri
Covalent Transfer of Heavy Chains of Inter-{alpha}-Trypsin Inhibitor Family Proteins to Hyaluronan in In Vivo and In Vitro Expanded Porcine Oocyte-Cumulus Complexes
Biol Reprod, December 1, 2004; 71(6): 1838 - 1843.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M. Suzuki, H. Kobayashi, Y. Tanaka, N. Kanayama, and T. Terao
Reproductive failure in mice lacking inter-alpha-trypsin inhibitor (ITI) - ITI target genes in mouse ovary identified by microarray analysis
J. Endocrinol., October 1, 2004; 183(1): 29 - 38.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Zhuo, V. C. Hascall, and K. Kimata
Inter-{alpha}-trypsin Inhibitor, a Covalent Protein-Glycosaminoglycan-Protein Complex
J. Biol. Chem., September 10, 2004; 279(37): 38079 - 38082.
[Full Text] [PDF]


Home page