|
Originally published In Press as doi:10.1074/jbc.M009798200 on November 22, 2000
J. Biol. Chem., Vol. 276, Issue 11, 8254-8260, March 16, 2001
Determination of Residues in the Norepinephrine
Transporter That Are Critical for Tricyclic Antidepressant
Affinity*
Christine
Roubert §¶,
Peter J.
Cox§ ,
Michael
Brüss**,
Michel
Hamon§,
Heinz
Bönisch**, and
Bruno
Giros §
From INSERM U-513, Neurobiologie et Psychiatrie,
Faculté de Médecine de Créteil, 8, rue du
Général Sarrail, F-94000 Créteil, France,
§ INSERM U-288, Neuropsychopharmacologie Moléculaire,
Cellulaire et Fonctionnelle, Faculté de Médecine
Pitié-Salpêtrière, 91, Boulevard de l'Hôpital,
F-75013 Paris, France, and the ** Institute of Pharmacology and
Toxicology, University of Bonn, Reuterstraße 2 b,
D-53113 Bonn, Germany
Received for publication, October 26, 2000, and in revised form, November 20, 2000
 |
ABSTRACT |
The norepinephrine (NET) and dopamine
(DAT) transporters are highly homologous proteins, displaying many
pharmacological similarities. Both transport dopamine with higher
affinity than norepinephrine and are targets for the psychostimulants
cocaine and amphetamine. However, they strikingly contrast in their
affinities for tricyclic antidepressants (TCA). Previous studies, based
on chimeric proteins between DAT and NET suggest that domains ranging
from putative transmembrane domain (TMD) 5 to 8 are involved in the
high affinity binding of TCA to NET. We substituted 24 amino acids
within this region in the human NET with their counterparts in the
human DAT, resulting in 22 different mutants. Mutations of residues
located in extra- or intracytoplasmic loops have no effect on binding affinity of neither TCA nor cocaine. Three point mutations in TMD6
(F316C), -7 (V356S), and -8 (G400L) induced a loss of TCA binding
affinity of 8-, 5-, and 4-fold, respectively, without affecting the
affinity of cocaine. The triple mutation F316C/V356S/G400L produced a
40-fold shift in desipramine affinity. These three residues are
strongly conserved in all TCA-sensitive transporters cloned in
mammalian and nonmammalian species. A strong shift in TCA affinity
(IC50) was also observed for double mutants
F316C/D336T (35-fold) and S399P/G400L (80-fold for nortriptyline and
1000-fold for desipramine). Reverse mutations P401S/L402G in hDAT did
not elicit any gain in TCA affinities, whereas C318F and S358V resulted in a 3- and 10-fold increase in affinity, respectively. Our results clearly indicate that two residues located in TMD6 and -7 of hNET may
play an important role in TCA interaction and that a critical region in
TMD8 is likely to be involved in the tertiary structure allowing the
high affinity binding of TCA.
 |
INTRODUCTION |
The dopamine (DAT)1 and
norepinephrine (NET) transporters mediate reuptake of catecholamines
into presynaptic terminals, thus limiting the extracellular
concentration of norepinephrine and dopamine and their availability for
receptor activation (1-3). NET (4-7) and DAT (8-13) have been cloned
from different species, establishing their membership in the protein
superfamily defined as
Na+/Cl -dependent transporters.
Twelve putative transmembrane domains (TMD) characterize their common
topology with intracellular amino and carboxyl termini (14-16). DAT
and NET together with the serotonin transporter (SERT) (17-20) form
the subfamily of monoamine transporters. DAT and NET are the most
closely related members of this subfamily with about 80% similarity
(65% identity) in their amino acid sequences. These two transporters
also share several pharmacological properties, e.g. both
transport DA with a higher affinity than NE (16, 21, 22), and both are
targets for psychostimulants such as cocaine and amphetamine. On the
other hand, tricyclic antidepressants (TCA), which elicit their
antidepressant effects through blockade of NET (23, 24) and/or SERT
(25), are highly discriminative drugs between NET and DAT. For example,
the TCA desipramine and nortriptyline inhibit NET in the nanomolar
range whereas they inhibit DAT in the micromolar range (21, 26).
To investigate the structure/activity relationships of the family of
Na+/Cl -dependent transporters,
several groups have used site-directed mutagenesis and/or generation of
chimeric proteins. Experiments using mutagenesis have been designed to
investigate the role of amino acids endowed with a functional moiety
possibly involved in mechanisms such as charge transfer
(e.g. Lys, Arg, Glu, and Asp) (27, 28), amine fixation (Ser)
(27, 29), N-glycosylation (Asn) (30, 31), or tertiary
structure stabilization (Pro and Cys) (32-34).
Functional chimeras have been successfully constructed between the two
closely related monoamine transporters rat DAT and human NET (21, 35),
between human DAT and NET (26), between rat and human SERT (36), and
between the SERT and NET second extracellular loop (37). Because DAT
and NET are similar, yet with distinct pharmacological differences,
chimeras between DAT and NET were extremely informative: the loss of
TCA binding in NET is observed either for proteins that comprise TMD6
to TMD 8 of DAT (chimera M (26)), or for proteins that fuse the
NH2-terminal region of DAT to the COOH-terminal region of
NET between TMD5 and TMD9 (chimera DN5 (35)) or between TMD8 and TMD9
(chimera DN8 (35)). Thus, determinants within a region spanning TMD5-8 appear to be important for conferring TCA sensitivity. In addition, cocaine had absolutely no inhibitory effect on human chimera M. Therefore this domain may also play a crucial role in the uptake inhibition by various drugs.
To identify which functional groups may interact with TCA, we have
performed site-directed mutagenesis on TMD6-8 of NET. The cassette
from DAT that was exchanged in chimera M comprised 145 amino acids,
among which 24 are strictly different and 17 are in the same
conservative group when compared with NET (comprising Val to Ala
changes). We suspected that one of the 24 nonconserved residues could
be implicated in the high affinity for TCA. Therefore, we
systematically mutated these 24 amino acids in TMD6 to TMD8 of human
NET and substituted them with their counterparts in human DAT. The aim
of this study was to generate NET mutants that lose their affinity for
TCA and eventually to identify particular amino acids responsible for
the high affinity binding of TCA to NET.
 |
MATERIALS AND METHODS |
Chemicals--
[3H]Dopamine (42 Ci/mmol) and
[3H]norepinephrine (36 Ci/mmol) were supplied by Amersham
Pharmacia Biotech (Buckinghamshire, United Kingdom). Dopamine,
norepinephrine, nortriptyline, nomifensine, and desipramine were
obtained from RBI (Natick, MA). Cocaine was kindly provided by
Dr. M.-H. Thiebot (INSERM U288, Paris, France).
Construction of Human NET Mutants--
All the mutants
were constructed using polymerase chain reaction with primers
containing a designed mutation. For hNET mutants H296S, K303C, A330S,
D336T, I384F, H370Q/E371K/K373S/N375P, E377G, E382D, A384P, and S402A
the polymerase chain reactions (Hi-Taq, Bioprobe systems,
France) were performed with a modified NET as template, with
BstEII and ClaI sites flanking TMD6 and TMD8
(described in Ref. 26). Initially, two independent polymerase chain
reaction amplifications were performed with either Pi or Pf primers and an opposite mutated primer. Primers sequences are as follow (mutant number, orientations or as, position in the human NET nucleotide sequence (6), mutations are bold and underlined): Pi, s/724-744, ATGGTCGTCGTCATCGTCTTG; Pf, as/1408-1390, TCAAGACGTAAATTCCACC; P296, as/892-869, CGATGCTCAGGTAGGCATTGATGC;
P303, s/904-924, TTGTGCGAGGCCACGGTATGG; P330,
s/973-999, CTATTGATTGCATTTTCCAGTTACAAC; P336,
as/1011-999, GTTGGTAAATTTGTTGTAACTG; P364,
s/1077-1101, CGCCATCTTCTCCTTCCTTGGTTAC; P370,
s/1108-1138,
CAAAAACACAGCGTCCCCATTGAGGATGTGG; P377, as/1154-1122
CCAGGTCCGTCTGTGGCCACATCCCCAATGTTG; P403, as/1212-1193, CCAGGCTGTAGATCCAGACA; P420,
as/1262-1242, ATTGCGCTGTCAAGGCCCAGC. The
reactions were then mixed two by two, and reamplified with Pi and Pf.
The products were subcloned, sequenced, and individual mutants were
excised as a BstEII-ClaI cassette and subcloned
in BstEII-ClaI digested pRc/CMV (Invitrogen) containing NET (19) to reconstitute the full-length cDNA for a
mutated NET. For hNET mutants H280R, S288I/N289D/N292R, F316C, V356S,
N375P, S396A, S399P, G400L, S399P/G400L, A413T, and hDAT mutants P401S,
L402G, and P401S/L402G, we used the QuickChange site-directed
mutagenesis kit (Stratagene) with a set of complementary primers, with
the following sense sequences: P280, 851-876,
GCTCCTGGTCCATGGCGTCACGCTG; P288, 875-908,
GCCCGGAGCCATCGATGGCATCCGTGCCTACCTG; P316, 934-961, GCAACTCAGATATGTTTTTCCTTGGGGG;
P356, 1055-1079, CACCAGCTTCTCCTCTGGGTTCGCC; P375,
1114-1138, CACAAGGTCCCCATTGAGGATGTGG; P396,
1173-1199, TCCAGAGGCCATTGCTACCCTGTCTGG;
P399-400, 1182-1210,
CATTTCTACCCTGCCTCTATCTACATTCT;
P399, 1182-1209, CATTTCTACCCTGCCTGGATCTACATTC;
P400, 1182-1209, CATTTCTACCCTGTCTCTATCTACATTC;
P413: 1227-1252, CGTCATGCTCCTGACGCTGGGCCTTG. The sense sequences for hDAT mutants were: P318, 943-970,
GCCACCCAGGTGTTCTTCTCCCTGGGCG; P358, 1058-1083,
CTCCCTGACGGTCTTCTCCTCCGGC; P401, 1266-1291, CGCCACGCTCTCTCTGTCCTCAGCC; P402, 1266-1293,
CGCCACGCTCCCTGGGTCCTCAGCCTG. All clones
were sequenced on both strands before use. Plasmids were purified
either by cesium chloride gradient or Wizard maxipreps (Promega,
France) preparations before use in transfection experiments.
Immunofluorescense Staining of Stably Transfected HEK293
Cells--
HEK293 cells were transfected by the calcium-phosphate
method with wild-type or mutated NET cDNAs subcloned into the
eukaryotic expression vector pRc/CMV (Invitrogen) containing the
neomycin resistance gene. Three days after transfection, cells were
selected for stable plasmid integration with 800 µg/ml Geneticin
(G418, Life Technologies, Inc.) for 4 weeks. Stable clones were then grown in Dulbecco's modified Eagle's medium/Ham's F-12 without G418.
Immunofluorescence staining was performed as already described (38).
Briefly, stably transfected and nontransfected HEK293 cells were grown
on polyornithine-coated coverslips inserted in the wells of six-well
culture dishes. After washing with phosphate-buffered saline (PBS), the
cells were fixed with freshly prepared PBS containing 4%
paraformaldehyde for 20 min at room temperature, followed by three
washes with ice-cold PBS for 2 min each. Permeabilization of cell
membranes was performed with PBS containing 0.25% Triton X-100 and
0.12% gelatin for 20 min at 4 °C. Labeling with the primary
antibodies, directed against a COOH-terminal peptide sequence of the
human NET (C590-607 (39), 1:250 dilution), was achieved in the same
solution for 2 h at room temperature, followed by three washes
with ice-cold PBS. Immunofluorescence labeling was performed with an
fluorescein isothiocyanate-conjugated goat anti-rabbit IgG (Sigma;
1:200 dilution) in PBS for 1 h. After three washes with ice-cold
PBS, the coverslips were mounted in Vectashield (Vector,
Burlingame, CA). Immunostaining was visualized by confocal laser
microscopy (Leica TCS-NT, New York) at an excitation wavelength of 488 nm (emission at 514 nm) at 600-fold magnification.
Uptake Experiments--
We transfected either LLC-PK1 cells by
electroporation (EquiBio, St. Louis, MO) using 1 to 4 µg of
plasmid or COS-7 cells by the calcium-phosphate method using 5 to 10 µg of plasmid. No difference between the two cell lines was noticed,
either in the substrate affinities or in the inhibitory constants of
the drugs tested. The cells were cultured in 24-well tissue culture
dishes and uptake experiments were performed 72 h after
transfection, as already described (9). For the determination of
IC50 values, uptake was performed for 10 min in uptake
buffer (5 mM Tris base, 7.5 mM HEPES, 120 mM NaCl, 5.4 mM KCl, 1.2 mM
CaCl2, 1.2 mM MgSO4, 1 mM ascorbic acid, 5 mM D-glucose;
final pH 7.4) at 37 °C using 20 nM [3H]DA
with competitors added 5 min before. All experiments were carried out
in triplicate. For determination of Km and Vmax values, 20 nM
[3H]DA was used with increasing concentrations of
unlabeled DA (20 nM to 30 µM). Nonspecific
accumulation of [3H]DA was determined in the presence of
10 µM nomifensine (9). Uptake was terminated by rapid
removal of the supernatant followed by two successive washes with
ice-cold uptake buffer. Cells were lysed in 0.5 ml of 0.1 M
NaOH and the radioactivity was counted by liquid scintillation
spectrometry. Calculations of Vmax,
Km, and IC50 were performed as
previously described (9, 40) and analyzed by GraphPad Prism software.
Results were analyzed using Student's t test.
 |
RESULTS |
Functional Analysis of Transporter Mutants--
We have generated
22 mutants of the human NET, in which amino acids in TMD6 to TMD8 were
replaced with their counterparts in DAT (Fig.
1) as well as five reverse mutations in
the strategic residues of hDAT. After transient transfection in
eukaryotic cells, most of the hNET mutants were able to transport
tritiated DA (Table I) and NE (data not
shown) with kinetic parameters (Km and
Vmax) that were not significantly different from
those of the wild-type transporters. However, hNET mutations
S288I/N289D/N292R, located in the third extracellular loop (EL3)
exhibited a 7-fold increased capacity for DA. Three mutants, modified
in extra- (EL) or intracytoplasmic (IL) loops, were devoid of normal
uptake activity. Mutant H296S (EL3) and H370Q/E371K/K373S/N375P (EL4)
were completely inactive and mutant S420A (IL4) clearly exhibited less
than 10% of wild-type NET transport activity. As this uptake was
measured on whole intact cells, we wondered whether these mutants were correctly targeted and expressed at the plasma membrane in transfected cells. To address this issue all mutants were stably transfected in
eukaryotic cells (HEK293). Transporter protein expression was examined
in permeabilized cells by indirect immunofluorescence with confocal
laser scanning microscopy using primary antibodies directed against a
peptide sequence of the COOH-terminal end of NET (39). All mutants
exhibiting an uptake activity (>10% of native transporters) were
correctly expressed at the plasma membrane (not shown). Fig.
2 shows that mutant hNET-H296S was not
targeted to the plasma membrane, and that plasma membrane localization of H370Q/E371K/K373S/N375P and S420A was strongly reduced compared with
the wild-type NET. These observations suggest that these amino acids
could be implicated in plasma membrane targeting of NET. It
should also be noted that the reverse hDAT double mutant P401G/L402S
displayed a nonsignificant tendency toward NET affinity for DA with a
Km value of 870 nM, whereas all other
hDAT mutants displayed identical kinetic parameters as compared with the wild type hDAT.

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 1.
Map representation of the NET mutants.
The region encompassing TMD6 to TMD8 of human NET (6) and human DAT (9)
sequences are enlarged. Residues not conserved between NET and DAT are
indicated in a black circle. Nearly all nonconserved amino
acids between hNET and hDAT in TMD5 to TMD8 were converted to hDAT
specific amino acids. Interesting mutations of hNET were reproduced in
hDAT leading to mutation of Pro401 and Leu402.
The NET sequence presented here starts at residue Leu278,
and corresponds strictly to the BstEII-ClaI
cassette described in Ref. 26.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Kinetic parameters (Km and Vmax) of
[3H]dopamine uptake in COS-7 cells expressing wild-type hNET,
hDAT, hNET mutants or hDAT mutants
Km values are mean ± S.E. of three to six
experiments, each performed in triplicate. Vmax
value for the uptake of [3H]DA by the wild-type NET was
36 ± 15 fmol/min/105 cells and this value was considered
100% uptake. [3H]DA uptake by mutants hNET-H296S,
hNET-H370Q/E371K/K373S/N375P, and S420A was very low and similar to
background (measured in the presence of 10 µM
nomifensine).
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 2.
Cellular localization of NET and
nonfunctional hNET mutants. Cellular expression was
examined by indirect immunofluorescence with a confocal laser scanning
microscope in permanently transfected HEK293 cells expressing the
wild-type human NET (top, left panel), hNET-H296S
(top, right panel), hNET-H370Q/E371K/K373S/N375P
(bottom, left panel), or S420A (bottom, right
panel). Cells were fixed, permeabilized, and incubated with
anti-NET antiserum followed by incubation with fluorescein-conjugated
goat anti-rabbit antibody. Scale bar = 10 µ.
|
|
Inhibition of [3H]DA Uptake by Cocaine in hNET
Mutants--
Under our experimental conditions, inhibition of DA
uptake by cocaine was characterized by IC50 values of 91 and 260 nM for wild-type NET and DAT, respectively (Table
II). In most of the mutants, the cocaine
affinity remained in the range of that of the wild-type NET. Two NET
mutants, mutant F316C and mutant H370Q/E371K/K373S/E377G, showed a
slight but significant increase in their affinity for cocaine with
IC50 values of 41 and 48 nM, respectively.
Despite the fact that we have mutated almost all of the nonconserved
amino acids between TMD6 and TMD8, we could not detect any loss of
affinity in our hNET mutant collection as seen with chimera M (26).
View this table:
[in this window]
[in a new window]
|
Table II
IC50 values for inhibition of [3H]DA uptake by
desipramine, nortriptyline, and cocaine in COS-7 or LLC-PK1 cells
expressing wild-type NET, DAT, or NET mutants
Similar values were found whether wild-type transporters or NET mutants
were expressed in COS-7 or LLC-PK1 cells, and calculations were
performed on pooled values from experiments with both cell lines for
NET, DAT, and each mutant. Values are mean ± S.E. of three to six
experiments, each performed in triplicate. Statistics were performed
using Student's t test.
|
|
Inhibition of [3H]DA Uptake by Desipramine and
Nortriptyline in hNET Mutants--
Under our experimental conditions,
IC50 values for inhibition of DA uptake by NET and DAT,
respectively, were 1.2 nM and 9.2 µM for
desipramine, and 21 nM and 28.2 µM for
nortriptyline (Fig. 3 and Table II).

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 3.
Concentration-dependent
inhibition by TCA of [3H]DA uptake in COS-7 cells
expressing the wild-type NET or DAT, or the mutant
hNET-S399P/G400L. [3H]DA uptake was measured in the
presence of various concentrations of desipramine (panel A)
or nortriptyline (panel B). Each graph represents the
inhibitory dose-response curve for the hNET ( ), DAT ( ), and
hNET-S399P/G400L ( ). Each point is the mean ± S.E. of data
obtained in at least three separate experiments.
|
|
Our data clearly showed (Table II) that exchanges of amino acids
located in the intracytoplasmic or extracytoplasmic loops had no
significant effect on TCA affinities. This applies to mutants S288I/N289D/N292R and K303C within EL3, mutants A330S and D336T within
IL3, and mutants H370Q/E371K/K373S/E377G/N375P and E377G/E382D/A384P within EL4. Neither did seven mutations in TMDs had any effect on TCA
affinities, namely H280R within TMD5, F316C within TMD6 and I364F,
S396A, S399P, F403A, and A413T within TMD8.
In TMD6, a marked difference between DAT and NET was a change from Phe
to Cys. Mutant F316C, in which this change was engineered, displayed a
6-8-fold loss of affinity for both desipramine and nortriptyline
(Table II). Whereas the single mutation from Asp to Thr in IL3 (D336T)
had no effect on TCA potency, the double mutant F316C/D336T exhibited a
30-50-fold decrease in the affinities for desipramine and
nortriptyline (Table II). These results suggest a dominant role for
Phe316, which is enhanced by the loss of a charged
residue in IL3. In TMD7, the single mutation V356S induced a
significant 2-fold shift in desipramine affinity and a 10-fold shift in
nortriptyline affinity. In TMD8, we observed a significant 3-4-fold
loss in desipramine and nortriptyline affinity for the mutant
hNAT-G400L (Table II). Despite the fact that the single mutation S399P
had no effect by itself, the consequences of amino acid exchanges were
particularly impressive in the double mutant S399P/G400L. The
desipramine competition curve fitted a two-site model
(IC50(1) = 1 nM and
IC50(2) = 2690 nM), whereas the
nortriptyline competition curve did not fit adequately neither a one-
nor a two-site model (global IC50 = 1670 nM)
(Table II, Fig. 3). Therefore, as these mutations modify the classical one-site inhibition curve, it can be inferred that the different affinity states are reflecting the presence of allosteric
conformational changes in this mutant transporter. Finally, we
constructed a triple mutant combining the three individual changes that
induce an affinity shift, F316C, V356S, and G400L. This mutant
displayed a very strong shift for both desipramine (36-fold) and
nortriptyline (9-fold), thus confirming the involvement of these three
residues in the binding affinity of TCAs (Table II).
Inhibition of [3H]DA Uptake by Desipramine and
Nortriptyline in hDAT Mutants--
To determine whether these changes
in TMD6, TMD7, and TMD8 were important for TCA inhibition of hDAT, we
also mutated the corresponding amino acids in hDAT to their counterpart
in hNET. In TMD6, a change from Cys to Phe in position 318 of the hDAT triggered a significant 2-3-fold gain in affinity for TCAs (Table III). In TMD8, single mutant P401S showed
a tendency toward a better affinity for desipramine and a significant
1.5-fold better affinity for nortriptyline. However, double mutant hDAT
P401S/L402G did not exhibit any affinity increase for TCA but on the
contrary displayed a loss of affinity for both desipramine and
nortriptyline (without exhibiting a multiple site competition curve to
these compounds). Mutant hDAT-S358V was the most impressive, with an IC50 value of 940 nM for desipramine (Table
III), 10-fold better than what was observed on the wild-type hDAT.
View this table:
[in this window]
[in a new window]
|
Table III
IC50 values for inhibition of [3H]DA uptake by
desipramine and nortriptyline in COS-7 or LLC-PK1 cells expressing
wild-type hDAT or hDAT mutants
Similar values were found whether wild-type DAT or DAT-mutants were
expressed in COS-7 or LLC-PK1 cells, and calculations were performed on
pooled values from experiments with both cell lines for wild-type and
mutant DAT. Values are mean ± S.E. of four to six experiments,
each performed in triplicate. Statistics were performed using
Student's t test.
|
|
 |
DISCUSSION |
Chimeric transporters from different members of the monoamine
subfamily have already provided information about the participation of
restricted regions in drug or substrate binding (21, 26, 35-37).
However, single amino acids that may be directly involved in the
high-affinity binding of tricyclic antidepressants in NET are not yet
known. The present study was designed to determine precisely the role
of individual residues of DAT and NET in determining their
pharmacological characteristics. It seems now quite obvious that all
amine transporters cloned in nonmammalian species are sensitive to
TCA. This is the case for species as far from mammalians as
Caenorhabditis elegans (13) for ceDAT, Drosophila
melanogaster (17, 18) for dSERT, Rana catesbiana (7)
for fET, and the teleost fish Orysias latipes (medaka) for
meNET.2 Actually, the only
amine transporters not sensitive to TCA are DAT cloned from rat,
bovine, or human. This means that in the evolution process the first
amine transporters already had the ability to strongly bind TCA in a
binding pocket formed by disseminated residues, and that this ability
was lost in DAT. Thus, it was unlikely we could find a single residue
that would increase TCA affinities in DAT to what is observed in NET
and SERT. The rationale in our work on mutation from NET to DAT was to
search for a loss of function, possibly revealed by a single point
mutation. We generated 22 mutants of the hNET, in which amino acids in
TMD5 to TMD8 were replaced by their counterparts in hDAT. We chose to
target this domain because two independent studies had clearly demonstrated the involvement of the central region of the NET in high
affinity binding of TCA (21, 26). To cover as many mutations as
possible, we occasionally changed neighboring bases to include up to 4 amino acid changes (Fig. 1). Furthermore, some reversed mutations of
special interest were also performed in hDAT, and these amino acids
were replaced by their counterparts in hNET (Fig. 1). However, it
should be reminded that we have not engineered any changes in the 17 residues displaying conservative changes (Fig. 1) between DAT and NET,
which may deserve further analysis.
Efficacy of the Uptake Activity--
We directly studied the
uptake properties of our mutant collection but did not investigate
their binding properties, as this would not be informative regarding
uptake mechanisms. All mutants in TMDs displayed a measurable uptake
after transient transfection in eukaryotic cells (Table I) and were
correctly expressed at the plasma membrane (not shown). Among hNET
mutations within the loops, three displayed a severe loss of uptake
activity. These mutants were in EL3 (H296S), EL4
(H370Q/E371K/K373S/N375P), and IL4 (S420A) (Fig. 2). It is interesting
to note that hNET mutants H370Q/E371K/K373S/E377G and E375P, which
partially overlap mutations of the nonexpressed
H370Q/E371K/K373S/N375P, were able to transport DA and NE with the same
efficacy as the wild-type NET. These findings imply that the changed
amino acids in the loop of these mutants may play a role in correct
membrane processing or targeting of NET, although presently the
mechanism involved is unknown. This finding is in agreement with the
importance of this central domain of catecholamine transporters in
their functional expression at the plasma membrane. Furthermore, it was
previously shown that some chimeric proteins engineered in this region
were devoid of uptake activities (26, 35).
Interactions with Cocaine--
It was previously described that
chimeras having predominantly the NET sequence but with TMD5 to TMD8
replaced by the DAT cassette, displayed a significant loss of affinity
for cocaine (26). None of our 19 functional hNET mutants (Table II)
displayed any loss of cocaine inhibition, which indicates that this
property previously observed in DAT/NET chimeras was more the
consequence of a perturbation of inter-domain interactions, rather than
the elimination of a cocaine-binding residue. No differences relative to cocaine inhibition were observed in hNET S399P/G400L or in the
corresponding hDAT (not shown) or hNET single mutants in TMD8 (Table
II). It can be inferred that these mutations in TMD8 of hDAT are
somehow affecting the ability of cocaine to block the transporter by
inducing conformational changes and perhaps preventing access of
cocaine to its site of action. Cocaine-binding sites are thought to
involve common residues in all cocaine-sensitive transporters, that are
probably located in disparate regions of the transporters and take into
account the tertiary (37) or oligomeric structure of these
proteins (41, 42).
Interactions with TCA--
In contrast to the affinity for
cocaine, which is conserved among all monoamine transporters, the
affinities for TCA such as desipramine or nortriptyline are 3 orders of
magnitude higher for SERT and NET than for DAT (16, 22). In hNET-F316C
there was a significant loss of affinity for TCA. Structure/function analyses are often supported by studies of phylogenetic relations in a
homologous family. Involvement of Phe316 in TCA affinity is
supported by the fact that this residue is conserved among all
tricyclic-sensitive cloned transporters (Table IV), including mammalian SERT (19, 20,
43) and NET (4-6) but also in homologous transporters cloned in
nonmammalian species like in the bullfrog R. catesbiana, fET
(7), in the nematode C. elegans, ceDAT (13), in the fruit
fly D. melanogaster, dSERT (17, 18), and in the fish
O. latipes, meNET.2 In the SERT, it was also
reported that a Phe residue in TMD12, Phe586, is
responsible for the 5-10-fold difference in TCA affinity between the
rat and the human protein (25). However, this Phe residue is not
conserved in the Drosophila SERT (17, 18) or in all hitherto
cloned NETs, and thus is probably not involved in a TCA binding pocket
that would be conserved in all TCA-sensitive transporters. Both in this
SERT mutant and in hNET-F316C, this affinity shift is the consequence
of a phenylalanine substitution, suggesting that the aromatic ring may
be involved in stacking (or hydrophobic) interactions with the rings
forming the core of the TCA.
View this table:
[in this window]
[in a new window]
|
Table IV
Sequence alignment within the amine transporter family
Alignment was performed by using amino acid sequences of the cloned
medaka NET (meNET, Roubert et al., submitted), frog ET (fET (7)), human
NET (hNET (6)), rat NET (rNET (4)), bovine NET (bNET (5)), D. melanogaster SERT (dSERT (18)), human SERT (hSERT (20)), rat SERT
(rSERT (19)), bovine DAT (bDAT (12)), rat DAT (rDAT (8)), human DAT
(hDAT (9)), and C. elegans DAT (ceDAT (13)). Only a subset
of sequences in TMD6, TMD7, TMD8, and IL3 are shown. Residues that have
been mutated in this study are bold. IC50 values for
desipramine are from the studies cited above, except for hDAT and hNET,
which are from the present work.
|
|
The double mutant hNET-F316C/D336T displayed a 30-fold shift in the
IC50 value for TCA. The reason for this affinity shift, when comparing hNET-F316C to hNET-F316C-D336T, is presently not fully
understood. It can be speculated that the short IL3 (12 amino acids)
might act as a stabilizer of TCA binding in NET, possibly through a
charge-stabilizing effect of the acidic residue Asp on conformational
changes. This Asp residue is present in all mammalian and nonmammalian
NET, with the exception of ceDAT where it is substituted by an His residue.
Mutation of residue Val356 to Ser also had a significant
effect on TCA inhibition of DA uptake (Table II). This Val residue
Val356 is strictly conserved in mammalian SERTs and
meNET,2 and is changed to a conservative Ile or Leu in the
other TCA-sensitive transporters including rNET, bNET, fET, dSERT, and
ceDAT (Table IV). The Ser residue is found in the equivalent position
of TMD7 in all mammalian DAT, therefore supporting the importance of
this position for TCA inhibition sensitivity. It may be speculated that
the OH moiety of Ser could hamper the positioning of TCA in their
binding pocket.
In TMD8, the single point mutation G400L triggered a 3-6-fold shift in
desipramine and nortriptyline affinities, respectively. This Gly
residue is conserved in all mammalian NETs, fET, meNET, and dSERT, and
substituted to Ala in rSERT and hSERT (Table IV). However, in ceDAT,
which has a high affinity for TCA, a tyrosine residue replaces it. Even
though the S399P mutation had no effect, the most striking difference
arises in TMD8 with hNET mutant S399P/G400L (Table II). When we first
evaluated the inhibition efficacy of TCA on this mutant, we obtained a
dramatic shift for both desipramine (1000-fold) and nortriptyline
(80-fold). However, the dose-response curves were spread on 3-4 logs,
thereby forcing us to re-evaluate all inhibition curves with a greater
range of concentrations of inhibitors. All mutants demonstrated a
single-site kinetic for inhibition of [3H]DA uptake by
desipramine and nortriptyline, except for hNET S399P/G400L. Mutation of
these residues induced a double and multiple affinity state for
desipramine and nortriptyline, respectively (Fig. 3 and Table II).
Finally, we focused our attention on the three single-point mutations
that displayed a significant loss in TCA inhibition, F316C, V356S, and
G400L. The corresponding triple mutant in hNET displayed a strong shift
for the desipramine IC50, from 1.2 nM in the
wild-type to 43 nM (Table II). This potentiation is
probably a consequence of the combined interaction of these three
residues in TMD6, TMD7, and TMD8, with this tricyclic inhibitor.
Reverse mutations in hDAT were generated to assess the direct or
indirect involvement of these specific residues in their interaction
with the inhibitors. Reverse mutation hDAT-L402G did not induce a
better inhibition by TCA as could be expected from what was observed in
hNET-G400L. Conversely, hDAT-P401S, the reverse mutant of hNET-S399P,
was slightly but significantly more sensitive to both desipramine and
nortriptyline inhibition. However, substitution of both
Pro401 and Leu402 produced a more profound loss
of TCA affinity compared with the wild-type DAT. Although these
results, together with a careful analysis of transporter phylogeny, do
not provide a clear explanation for the observed effects, it seems
obvious that this peculiar region of TMD8 is involved in uptake
inhibitor potency. It is intriguing to consider that the two affinity
states for the mutant hNET-S399P/G400L are exactly those observed for
hNET (high affinity) and hDAT (low affinity), respectively. One
potential explanation would be that this peculiar mutant is entrenched
in a transition state conformation, which can bind low concentrations
of desipramine in the high affinity pocket and high concentrations of
desipramine in the low affinity pocket. However, once the inhibitor is
bound, it might induce conformational changes in the mutant transporter and therefore lead to a different accessibility to the inhibitor recognition site. The two single changes in TMD6 (C318F) and TMD7 (S358V) both produce a significant gain of affinity for desipramine and
nortriptyline (Table III). Introduction of a Phe residue in position
318 may allow the aromatic ring to directly interact with the tricyclic
core of the two inhibitors. The substitution of a Ser to Val residue at
position 358 induced a dramatic increase in affinity. We can
hypothesize that either the Val residue (Leu or Ile in the other
members of the NET/SERT family; Table IV) could establish hydrophobic
interactions with the TCA or the Ser residue could directly interfere
with TCA binding. In conclusion, our site-directed mutagenesis
experiments underline the complex structural equilibrium that is
achieved in the Na+/Cl -dependent
transporters. These proteins are known to exhibit a functional channel
together with a ligand-binding domain, inside the same structure (44,
45). In this respect, amino acids leading to conformational changes or
involved in the tertiary organization of these transporters are
particularly important for these complex proteins. This is supported by
the high degree of conservation observed in all
Na+/Cl -dependent transporters,
particularly among the monoamine transporters.
The most important outcome of the present study is the first evidence
that binding site(s) for TCA are presumably formed or impacted by
residues that are contained in TMD(Fig. 1), whereas no interaction
could be ascribed to residues in the putative intra- or
inter-cytoplasmic loops (Fig. 1). We clearly identified a Phe residue
in TMD6 and a Val residue in TMD7 that may directly interact with TCA,
because their loss in hNET decreases the affinity, whereas their
introduction in hDAT increases the affinity for these inhibitors. It
cannot yet be definitively inferred from our results whether TCA are
acting by inducing conformational changes in the transporter or by a
direct interaction at the precise sites where the substrate will bind
and/or translocate. Further exploration of whether these residues are
accessible to aqueous modifying reagents (e.g. MTSET or
MTS-biotin) could help to resolve this issue. However, the NET and DAT
mutants that lose their affinity for TCA still retain their property to
transport NE and DA (with unchanged apparent affinity and efficacy),
meaning that the TCA-binding residues are not involved in the substrate
translocation mechanisms.
 |
ACKNOWLEDGEMENTS |
We thank B. Lentz, F. Runkel, and J. Blümke for help in fluorescent microscopy and P. Breiden for help
in uptake experiments.
 |
FOOTNOTES |
*
This work was supported in part by grants from INSERM (to
M. H. and B. G.) and the Deutsche Forschungsgemeinschaft (to
H. B.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
Supported by a Sanofi research grant and by Fondation pour la
Recherche Médicale. Present address: Sanofi-Synthelabo,
Departement SNC, 371 rue du professeur Blayac, 34184 Montpellier Cedex
04, France.
Recipient of fellowship from INSERM ("Poste Vert") and
Fondation pour la Recherche Médicale during performance of this
work. Present address: Parke-Davis Neuroscience Research Centre,
University of Cambridge Forvie site, Robinson Way, Cambridge CB2 2QB,
United Kingdom.

To whom correspondence should be addressed. Tel.:
33-1-49-81-35-39; Fax: 33-1-49-81-36-85; E-mail:
giros@im3.inserm.fr.
Published, JBC Papers in Press, November 22, 2000, DOI 10.1074/jbc.M009798200
2
C. Roubert, C. Sagné, M. Kapsimali, P. Vernier, F. Bourrat, and B. Giros, submitted for publication.
 |
ABBREVIATIONS |
The abbreviations used are:
DAT, dopamine;
NET, norepinephrine;
SERT, serotonin transporter;
TCA, tricyclic antidepressants;
PBS, phosphate-buffered saline;
TMD, transmembrane domain;
EL, extracellular loop;
IL, intracytoplasmic
loop.
 |
REFERENCES |
| 1.
|
Axelrod, J.
(1965)
Recent Prog. Horm. Res.
21,
597-619
|
| 2.
|
Coyle, J. T.,
and Snyder, S. H.
(1969)
J. Pharmacol. Exp. Ther.
170,
221-231
|
| 3.
|
Iversen, L. L.
(1974)
Biochem. Pharmacol.
23,
1927-1935
|
| 4.
|
Brüss, M.,
Porzgen, P.,
Bryan-Lluka, L. J.,
and Bönisch, H.
(1997)
Brain Res. Mol. Brain Res.
52,
257-262
|
| 5.
|
Lingen, B.,
Brüss, M.,
and Bönisch, H.
(1994)
FEBS Lett.
342,
235-238
|
| 6.
|
Pacholczyk, T.,
Blakely, R. D.,
and Amara, S. G.
(1990)
Nature
350,
350-353
|
| 7.
|
Apparsundaram, S.,
Moore, K. R.,
Malone, M. D.,
Hartzell, H. C.,
and Blakely, R. D.
(1997)
J. Neurosci.
17,
2691-2702
|
| 8.
|
Giros, B.,
El, Mestikawy, S.,
Bertrand, L.,
and Caron, M. G.
(1991)
FEBS Lett.
295,
149-154
|
| 9.
|
Giros, B.,
El, Mestikawy, S.,
Godinot, N.,
Zheng, K.,
Han, H.,
Yang-Feng, T.,
and Caron, M. G.
(1992)
Mol. Pharmacol.
42,
383-390
|
| 10.
|
Kilty, J. E.,
Lorang, D.,
and Amara, S. G.
(1991)
Science
254,
578-579
|
| 11.
|
Shimada, S.,
Kitayama, S.,
Lin, C. L.,
Patel, A.,
Nanthakumar, E.,
Gregor, P.,
Kuhar, M.,
and Uhl, G.
(1991)
Science
254,
576-578
|
| 12.
|
Usdin, T. B.,
Mezey, E.,
Chen, C.,
Brownstein, J.,
and Hoffman, B. J.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
11168-11171
|
| 13.
|
Jayanthi, L. D.,
Apparsundaram, S.,
Malone, M. D.,
Ward, E.,
Miller, D. M.,
Eppler, M.,
and Blakely, R. D.
(1998)
Mol. Pharmacol.
54,
601-609
|
| 14.
|
Uhl, G. R.,
and Hartig, P. R.
(1992)
Trends Pharmacol. Sci.
13,
421-425
|
| 15.
|
Amara, S. G.,
and Kuhar, M. J.
(1993)
Annu. Rev. Neurosci.
16,
73-93
|
| 16.
|
Giros, B.,
and Caron, M. G.
(1993)
Trends Pharmacol. Sci.
14,
43-49
|
| 17.
|
Corey, J. L.,
Quick, M. W.,
Davidson, N.,
Lester, H. A.,
and Guastella, J.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
1188-1192
|
| 18.
|
Demchyshyn, L. L.,
Pristupa, Z. B.,
Sugamori, K. S.,
Barker, E. L.,
and Blakely, R. D.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
5158-5162
|
| 19.
|
Blakely, R. D.,
Berson, H. E.,
Fremeau, R. T.,
Caron, M. G.,
Peek, M. M.,
Prince, H. K.,
and Bradley, C. C.
(1991)
Nature
364,
66-70
|
| 20.
|
Ramamoorthy, S.,
Bauman, A. L.,
Moore, K. R.,
Han, H.,
Yang-Feng, T.,
Chang, A. S.,
Ganapathy, V.,
and Blakely, R. D.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
2542-2546
|
| 21.
|
Buck, K. J.,
and Amara, S. G.
(1995)
Mol. Pharmacol.
48,
1030-1037
|
| 22.
|
Gu, H.,
Wall, S. C.,
and Rudnick, G.
(1994)
J. Biol. Chem.
269,
7124-7130
|
| 23.
|
Glowinski, J.,
and Axelrod, J.
(1964)
Nature
204,
1318-1319
|
| 24.
|
Richelson, E.,
and Pfemming, M.
(1984)
Eur. J. Pharmacol.
104,
277-286
|
| 25.
|
Barker, E. L.,
and Blakely, R. D.
(1996)
Mol. Pharmacol.
50,
957-965
|
| 26.
|
Giros, B.,
Wang, Y. M.,
Suter, S.,
McLeskey, S. B.,
Pifl, C.,
and Caron, M. G.
(1994)
J. Biol. Chem.
269,
15985-15988
|
| 27.
|
Kitayama, S.,
Shimada, S.,
Xu, H.,
Markham, L.,
Donovan, D. M.,
and Uhl, G. R.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
7782-7785
|
| 28.
|
Lin, F.,
Lester, H. A.,
and Mager, S.
(1996)
Biophys. J.
71,
3126-3135
|
| 29.
|
Kitayama, S.,
Wang, J. B.,
and Uhl, G. R.
(1993)
Synapse
15,
58-62
|
| 30.
|
Melikian, H. E.,
Ramamoorthy, S.,
Tate, C. G.,
and Blakely, R. D.
(1996)
Mol. Pharmacol.
50,
266-276
|
| 31.
|
Nguyen, T. T.,
and Amara, S. G.
(1996)
J. Neurochem.
67,
645-655
|
| 32.
|
Sur, C.,
Schloss, P.,
and Betz, H.
(1997)
Biochem. Biophys. Res. Commun.
241,
68-72
|
| 33.
|
Wang, J. B.,
Moriwaki, A.,
and Uhl, G. R.
(1995)
J. Neurochem.
64,
1416-1419
|
| 34.
|
Chen, J. G.,
Liu-Chen, S.,
and Rudnick, G.
(1997)
Biochemistry
36,
1479-1486
|
| 35.
|
Buck, K. J.,
and Amara, S. G.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
12584-12588
|
| 36.
|
Barker, E. L.,
Kimmel, H. L.,
and Blakely, R. D.
(1994)
Mol. Pharmacol.
46,
799-807
|
| 37.
|
Stephan, M. M.,
Chen, M. A.,
Penado, K. M. Y.,
and Rudnick, G.
(1997)
Biochemistry
36,
1322-1328
|
| 38.
|
Sur, C.,
Betz, H.,
and Schloss, P.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
7639-7644
|
| 39.
|
Brüss, M.,
Hammermann, R.,
Brimijoin, S.,
and Bönisch, H.
(1995)
J. Biol. Chem.
270,
9197-9201
|
| 40.
|
Pifl, C.,
Giros, B.,
and Caron, M. G.
(1993)
J. Neurosci.
13,
4246-4253
|
| 41.
|
Milner, H. E.,
Beliveau, R.,
and Jarvis, S. M.
(1994)
Biochim. Biophys. Acta
1190,
185-187
|
| 42.
|
Berger, S. P.,
Farrell, K.,
Conant, D.,
Kempner, E. S.,
and Paul, S. M.
(1994)
Mol. Pharmacol.
46,
726-731
|
| 43.
|
Hoffman, B. J.,
Mezey, E.,
and Brownstein, M. J.
(1991)
Science
254,
579-580
|
| 44.
|
Galli, A.,
Blakely, R. D.,
and De Felice, L. J.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
22,
13260-13265
|
| 45.
|
Sonders, M. S.,
and Amara, S. G.
(1996)
Curr. Opin. Neurobiol.
6,
294-302
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J. Zhu, S. Apparsundaram, and L. P. Dwoskin
Nicotinic Receptor Activation Increases [3H]Dopamine Uptake and Cell Surface Expression of Dopamine Transporters in Rat Prefrontal Cortex
J. Pharmacol. Exp. Ther.,
March 1, 2009;
328(3):
931 - 939.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Zhou, J. Zhen, N. K. Karpowich, R. M. Goetz, C. J. Law, M. E. A. Reith, and D.-N. Wang
LeuT-Desipramine Structure Reveals How Antidepressants Block Neurotransmitter Reuptake
Science,
September 7, 2007;
317(5843):
1390 - 1393.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. A. Paczkowski, I. A. Sharpe, S. Dutertre, and R. J. Lewis
{chi}-Conotoxin and Tricyclic Antidepressant Interactions at the Norepinephrine Transporter Define a New Transporter Model
J. Biol. Chem.,
June 15, 2007;
282(24):
17837 - 17844.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Hahn, M. S. Mazei-Robison, and R. D. Blakely
Single Nucleotide Polymorphisms in the Human Norepinephrine Transporter Gene Affect Expression, Trafficking, Antidepressant Interaction, and Protein Kinase C Regulation
Mol. Pharmacol.,
August 1, 2005;
68(2):
457 - 466.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. A. Sharpe, E. Palant, C. I. Schroeder, D. M. Kaye, D. J. Adams, P. F. Alewood, and R. J. Lewis
Inhibition of the Norepinephrine Transporter by the Venom Peptide {chi}-MrIA: SITE OF ACTION, Na+ DEPENDENCE, AND STRUCTURE-ACTIVITY RELATIONSHIP
J. Biol. Chem.,
October 10, 2003;
278(41):
40317 - 40323.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. J. Bryan-Lluka, H. Bonisch, and R. J. Lewis
{chi}-Conopeptide MrIA Partially Overlaps Desipramine and Cocaine Binding Sites on the Human Norepinephrine Transporter
J. Biol. Chem.,
October 10, 2003;
278(41):
40324 - 40329.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Horishita, K. Minami, N. Yanagihara, M. Shiraishi, T. Okamoto, Y. Shiga, S. Ueno, and A. Shigematsu
Alphaxalone, a Neurosteroid Anesthetic, Inhibits Norepinephrine Transporter Function in Cultured Bovine Adrenal Medullary Cells
Anesth. Analg.,
December 1, 2002;
95(6):
1661 - 1666.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Sagata, K. Minami, N. Yanagihara, M. Shiraishi, Y. Toyohira, S. Ueno, and A. Shigematsu
Tramadol Inhibits Norepinephrine Transporter Function at Desipramine-Binding Sites in Cultured Bovine Adrenal Medullary Cells
Anesth. Analg.,
April 1, 2002;
94(4):
901 - 906.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Roubert, C. Sagne, M. Kapsimali, P. Vernier, F. Bourrat, and B. Giros
A Na+/Cl--Dependent Transporter for Catecholamines, Identified as a Norepinephrine Transporter, Is Expressed in the Brain of the Teleost Fish Medaka (Oryzias latipes)
Mol. Pharmacol.,
September 1, 2001;
60(3):
462 - 473.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|