Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M009798200 on November 22, 2000

J. Biol. Chem., Vol. 276, Issue 11, 8254-8260, March 16, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/11/8254    most recent
M009798200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roubert, C.
Right arrow Articles by Giros, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roubert, C.
Right arrow Articles by Giros, B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Determination of Residues in the Norepinephrine Transporter That Are Critical for Tricyclic Antidepressant Affinity*

Christine RoubertDagger §, Peter J. Cox§||, Michael Brüss**, Michel Hamon§, Heinz Bönisch**, and Bruno GirosDagger §DaggerDagger

From Dagger  INSERM U-513, Neurobiologie et Psychiatrie, Faculté de Médecine de Créteil, 8, rue du Général Sarrail, F-94000 Créteil, France, § INSERM U-288, Neuropsychopharmacologie Moléculaire, Cellulaire et Fonctionnelle, Faculté de Médecine Pitié-Salpêtrière, 91, Boulevard de l'Hôpital, F-75013 Paris, France, and the ** Institute of Pharmacology and Toxicology, University of Bonn, Reuterstraße 2 b, D-53113 Bonn, Germany

Received for publication, October 26, 2000, and in revised form, November 20, 2000



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The norepinephrine (NET) and dopamine (DAT) transporters are highly homologous proteins, displaying many pharmacological similarities. Both transport dopamine with higher affinity than norepinephrine and are targets for the psychostimulants cocaine and amphetamine. However, they strikingly contrast in their affinities for tricyclic antidepressants (TCA). Previous studies, based on chimeric proteins between DAT and NET suggest that domains ranging from putative transmembrane domain (TMD) 5 to 8 are involved in the high affinity binding of TCA to NET. We substituted 24 amino acids within this region in the human NET with their counterparts in the human DAT, resulting in 22 different mutants. Mutations of residues located in extra- or intracytoplasmic loops have no effect on binding affinity of neither TCA nor cocaine. Three point mutations in TMD6 (F316C), -7 (V356S), and -8 (G400L) induced a loss of TCA binding affinity of 8-, 5-, and 4-fold, respectively, without affecting the affinity of cocaine. The triple mutation F316C/V356S/G400L produced a 40-fold shift in desipramine affinity. These three residues are strongly conserved in all TCA-sensitive transporters cloned in mammalian and nonmammalian species. A strong shift in TCA affinity (IC50) was also observed for double mutants F316C/D336T (35-fold) and S399P/G400L (80-fold for nortriptyline and 1000-fold for desipramine). Reverse mutations P401S/L402G in hDAT did not elicit any gain in TCA affinities, whereas C318F and S358V resulted in a 3- and 10-fold increase in affinity, respectively. Our results clearly indicate that two residues located in TMD6 and -7 of hNET may play an important role in TCA interaction and that a critical region in TMD8 is likely to be involved in the tertiary structure allowing the high affinity binding of TCA.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The dopamine (DAT)1 and norepinephrine (NET) transporters mediate reuptake of catecholamines into presynaptic terminals, thus limiting the extracellular concentration of norepinephrine and dopamine and their availability for receptor activation (1-3). NET (4-7) and DAT (8-13) have been cloned from different species, establishing their membership in the protein superfamily defined as Na+/Cl--dependent transporters. Twelve putative transmembrane domains (TMD) characterize their common topology with intracellular amino and carboxyl termini (14-16). DAT and NET together with the serotonin transporter (SERT) (17-20) form the subfamily of monoamine transporters. DAT and NET are the most closely related members of this subfamily with about 80% similarity (65% identity) in their amino acid sequences. These two transporters also share several pharmacological properties, e.g. both transport DA with a higher affinity than NE (16, 21, 22), and both are targets for psychostimulants such as cocaine and amphetamine. On the other hand, tricyclic antidepressants (TCA), which elicit their antidepressant effects through blockade of NET (23, 24) and/or SERT (25), are highly discriminative drugs between NET and DAT. For example, the TCA desipramine and nortriptyline inhibit NET in the nanomolar range whereas they inhibit DAT in the micromolar range (21, 26).

To investigate the structure/activity relationships of the family of Na+/Cl--dependent transporters, several groups have used site-directed mutagenesis and/or generation of chimeric proteins. Experiments using mutagenesis have been designed to investigate the role of amino acids endowed with a functional moiety possibly involved in mechanisms such as charge transfer (e.g. Lys, Arg, Glu, and Asp) (27, 28), amine fixation (Ser) (27, 29), N-glycosylation (Asn) (30, 31), or tertiary structure stabilization (Pro and Cys) (32-34).

Functional chimeras have been successfully constructed between the two closely related monoamine transporters rat DAT and human NET (21, 35), between human DAT and NET (26), between rat and human SERT (36), and between the SERT and NET second extracellular loop (37). Because DAT and NET are similar, yet with distinct pharmacological differences, chimeras between DAT and NET were extremely informative: the loss of TCA binding in NET is observed either for proteins that comprise TMD6 to TMD 8 of DAT (chimera M (26)), or for proteins that fuse the NH2-terminal region of DAT to the COOH-terminal region of NET between TMD5 and TMD9 (chimera DN5 (35)) or between TMD8 and TMD9 (chimera DN8 (35)). Thus, determinants within a region spanning TMD5-8 appear to be important for conferring TCA sensitivity. In addition, cocaine had absolutely no inhibitory effect on human chimera M. Therefore this domain may also play a crucial role in the uptake inhibition by various drugs.

To identify which functional groups may interact with TCA, we have performed site-directed mutagenesis on TMD6-8 of NET. The cassette from DAT that was exchanged in chimera M comprised 145 amino acids, among which 24 are strictly different and 17 are in the same conservative group when compared with NET (comprising Val to Ala changes). We suspected that one of the 24 nonconserved residues could be implicated in the high affinity for TCA. Therefore, we systematically mutated these 24 amino acids in TMD6 to TMD8 of human NET and substituted them with their counterparts in human DAT. The aim of this study was to generate NET mutants that lose their affinity for TCA and eventually to identify particular amino acids responsible for the high affinity binding of TCA to NET.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Chemicals-- [3H]Dopamine (42 Ci/mmol) and [3H]norepinephrine (36 Ci/mmol) were supplied by Amersham Pharmacia Biotech (Buckinghamshire, United Kingdom). Dopamine, norepinephrine, nortriptyline, nomifensine, and desipramine were obtained from RBI (Natick, MA). Cocaine was kindly provided by Dr. M.-H. Thiebot (INSERM U288, Paris, France).

Construction of Human NET Mutants-- All the mutants were constructed using polymerase chain reaction with primers containing a designed mutation. For hNET mutants H296S, K303C, A330S, D336T, I384F, H370Q/E371K/K373S/N375P, E377G, E382D, A384P, and S402A the polymerase chain reactions (Hi-Taq, Bioprobe systems, France) were performed with a modified NET as template, with BstEII and ClaI sites flanking TMD6 and TMD8 (described in Ref. 26). Initially, two independent polymerase chain reaction amplifications were performed with either Pi or Pf primers and an opposite mutated primer. Primers sequences are as follow (mutant number, orientations or as, position in the human NET nucleotide sequence (6), mutations are bold and underlined): Pi, s/724-744, ATGGTCGTCGTCATCGTCTTG; Pf, as/1408-1390, TCAAGACGTAAATTCCACC; P296, as/892-869, CGATGCTCAGGTAGGCATTGATGC; P303, s/904-924, TTGTGCGAGGCCACGGTATGG; P330, s/973-999, CTATTGATTGCATTTTCCAGTTACAAC; P336, as/1011-999, GTTGGTAAATTTGTTGTAACTG; P364, s/1077-1101, CGCCATCTTCTCCTTCCTTGGTTAC; P370, s/1108-1138, CAAAAACACAGCGTCCCCATTGAGGATGTGG; P377, as/1154-1122 CCAGGTCCGTCTGTGGCCACATCCCCAATGTTG; P403, as/1212-1193, CCAGGCTGTAGATCCAGACA; P420, as/1262-1242, ATTGCGCTGTCAAGGCCCAGC. The reactions were then mixed two by two, and reamplified with Pi and Pf. The products were subcloned, sequenced, and individual mutants were excised as a BstEII-ClaI cassette and subcloned in BstEII-ClaI digested pRc/CMV (Invitrogen) containing NET (19) to reconstitute the full-length cDNA for a mutated NET. For hNET mutants H280R, S288I/N289D/N292R, F316C, V356S, N375P, S396A, S399P, G400L, S399P/G400L, A413T, and hDAT mutants P401S, L402G, and P401S/L402G, we used the QuickChange site-directed mutagenesis kit (Stratagene) with a set of complementary primers, with the following sense sequences: P280, 851-876, GCTCCTGGTCCATGGCGTCACGCTG; P288, 875-908, GCCCGGAGCCATCGATGGCATCCGTGCCTACCTG; P316, 934-961, GCAACTCAGATATGTTTTTCCTTGGGGG; P356, 1055-1079, CACCAGCTTCTCCTCTGGGTTCGCC; P375, 1114-1138, CACAAGGTCCCCATTGAGGATGTGG; P396, 1173-1199, TCCAGAGGCCATTGCTACCCTGTCTGG; P399-400, 1182-1210, CATTTCTACCCTGCCTCTATCTACATTCT; P399, 1182-1209, CATTTCTACCCTGCCTGGATCTACATTC; P400, 1182-1209, CATTTCTACCCTGTCTCTATCTACATTC; P413: 1227-1252, CGTCATGCTCCTGACGCTGGGCCTTG. The sense sequences for hDAT mutants were: P318, 943-970, GCCACCCAGGTGTTCTTCTCCCTGGGCG; P358, 1058-1083, CTCCCTGACGGTCTTCTCCTCCGGC; P401, 1266-1291, CGCCACGCTCTCTCTGTCCTCAGCC; P402, 1266-1293, CGCCACGCTCCCTGGGTCCTCAGCCTG. All clones were sequenced on both strands before use. Plasmids were purified either by cesium chloride gradient or Wizard maxipreps (Promega, France) preparations before use in transfection experiments.

Immunofluorescense Staining of Stably Transfected HEK293 Cells-- HEK293 cells were transfected by the calcium-phosphate method with wild-type or mutated NET cDNAs subcloned into the eukaryotic expression vector pRc/CMV (Invitrogen) containing the neomycin resistance gene. Three days after transfection, cells were selected for stable plasmid integration with 800 µg/ml Geneticin (G418, Life Technologies, Inc.) for 4 weeks. Stable clones were then grown in Dulbecco's modified Eagle's medium/Ham's F-12 without G418. Immunofluorescence staining was performed as already described (38). Briefly, stably transfected and nontransfected HEK293 cells were grown on polyornithine-coated coverslips inserted in the wells of six-well culture dishes. After washing with phosphate-buffered saline (PBS), the cells were fixed with freshly prepared PBS containing 4% paraformaldehyde for 20 min at room temperature, followed by three washes with ice-cold PBS for 2 min each. Permeabilization of cell membranes was performed with PBS containing 0.25% Triton X-100 and 0.12% gelatin for 20 min at 4 °C. Labeling with the primary antibodies, directed against a COOH-terminal peptide sequence of the human NET (C590-607 (39), 1:250 dilution), was achieved in the same solution for 2 h at room temperature, followed by three washes with ice-cold PBS. Immunofluorescence labeling was performed with an fluorescein isothiocyanate-conjugated goat anti-rabbit IgG (Sigma; 1:200 dilution) in PBS for 1 h. After three washes with ice-cold PBS, the coverslips were mounted in Vectashield (Vector, Burlingame, CA). Immunostaining was visualized by confocal laser microscopy (Leica TCS-NT, New York) at an excitation wavelength of 488 nm (emission at 514 nm) at 600-fold magnification.

Uptake Experiments-- We transfected either LLC-PK1 cells by electroporation (EquiBio, St. Louis, MO) using 1 to 4 µg of plasmid or COS-7 cells by the calcium-phosphate method using 5 to 10 µg of plasmid. No difference between the two cell lines was noticed, either in the substrate affinities or in the inhibitory constants of the drugs tested. The cells were cultured in 24-well tissue culture dishes and uptake experiments were performed 72 h after transfection, as already described (9). For the determination of IC50 values, uptake was performed for 10 min in uptake buffer (5 mM Tris base, 7.5 mM HEPES, 120 mM NaCl, 5.4 mM KCl, 1.2 mM CaCl2, 1.2 mM MgSO4, 1 mM ascorbic acid, 5 mM D-glucose; final pH 7.4) at 37 °C using 20 nM [3H]DA with competitors added 5 min before. All experiments were carried out in triplicate. For determination of Km and Vmax values, 20 nM [3H]DA was used with increasing concentrations of unlabeled DA (20 nM to 30 µM). Nonspecific accumulation of [3H]DA was determined in the presence of 10 µM nomifensine (9). Uptake was terminated by rapid removal of the supernatant followed by two successive washes with ice-cold uptake buffer. Cells were lysed in 0.5 ml of 0.1 M NaOH and the radioactivity was counted by liquid scintillation spectrometry. Calculations of Vmax, Km, and IC50 were performed as previously described (9, 40) and analyzed by GraphPad Prism software. Results were analyzed using Student's t test.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Functional Analysis of Transporter Mutants-- We have generated 22 mutants of the human NET, in which amino acids in TMD6 to TMD8 were replaced with their counterparts in DAT (Fig. 1) as well as five reverse mutations in the strategic residues of hDAT. After transient transfection in eukaryotic cells, most of the hNET mutants were able to transport tritiated DA (Table I) and NE (data not shown) with kinetic parameters (Km and Vmax) that were not significantly different from those of the wild-type transporters. However, hNET mutations S288I/N289D/N292R, located in the third extracellular loop (EL3) exhibited a 7-fold increased capacity for DA. Three mutants, modified in extra- (EL) or intracytoplasmic (IL) loops, were devoid of normal uptake activity. Mutant H296S (EL3) and H370Q/E371K/K373S/N375P (EL4) were completely inactive and mutant S420A (IL4) clearly exhibited less than 10% of wild-type NET transport activity. As this uptake was measured on whole intact cells, we wondered whether these mutants were correctly targeted and expressed at the plasma membrane in transfected cells. To address this issue all mutants were stably transfected in eukaryotic cells (HEK293). Transporter protein expression was examined in permeabilized cells by indirect immunofluorescence with confocal laser scanning microscopy using primary antibodies directed against a peptide sequence of the COOH-terminal end of NET (39). All mutants exhibiting an uptake activity (>10% of native transporters) were correctly expressed at the plasma membrane (not shown). Fig. 2 shows that mutant hNET-H296S was not targeted to the plasma membrane, and that plasma membrane localization of H370Q/E371K/K373S/N375P and S420A was strongly reduced compared with the wild-type NET. These observations suggest that these amino acids could be implicated in plasma membrane targeting of NET. It should also be noted that the reverse hDAT double mutant P401G/L402S displayed a nonsignificant tendency toward NET affinity for DA with a Km value of 870 nM, whereas all other hDAT mutants displayed identical kinetic parameters as compared with the wild type hDAT.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 1.   Map representation of the NET mutants. The region encompassing TMD6 to TMD8 of human NET (6) and human DAT (9) sequences are enlarged. Residues not conserved between NET and DAT are indicated in a black circle. Nearly all nonconserved amino acids between hNET and hDAT in TMD5 to TMD8 were converted to hDAT specific amino acids. Interesting mutations of hNET were reproduced in hDAT leading to mutation of Pro401 and Leu402. The NET sequence presented here starts at residue Leu278, and corresponds strictly to the BstEII-ClaI cassette described in Ref. 26.


                              
View this table:
[in this window]
[in a new window]
 
Table I
Kinetic parameters (Km and Vmax) of [3H]dopamine uptake in COS-7 cells expressing wild-type hNET, hDAT, hNET mutants or hDAT mutants
Km values are mean ± S.E. of three to six experiments, each performed in triplicate. Vmax value for the uptake of [3H]DA by the wild-type NET was 36 ± 15 fmol/min/105 cells and this value was considered 100% uptake. [3H]DA uptake by mutants hNET-H296S, hNET-H370Q/E371K/K373S/N375P, and S420A was very low and similar to background (measured in the presence of 10 µM nomifensine).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2.   Cellular localization of NET and nonfunctional hNET mutants. Cellular expression was examined by indirect immunofluorescence with a confocal laser scanning microscope in permanently transfected HEK293 cells expressing the wild-type human NET (top, left panel), hNET-H296S (top, right panel), hNET-H370Q/E371K/K373S/N375P (bottom, left panel), or S420A (bottom, right panel). Cells were fixed, permeabilized, and incubated with anti-NET antiserum followed by incubation with fluorescein-conjugated goat anti-rabbit antibody. Scale bar = 10 µ.

Inhibition of [3H]DA Uptake by Cocaine in hNET Mutants-- Under our experimental conditions, inhibition of DA uptake by cocaine was characterized by IC50 values of 91 and 260 nM for wild-type NET and DAT, respectively (Table II). In most of the mutants, the cocaine affinity remained in the range of that of the wild-type NET. Two NET mutants, mutant F316C and mutant H370Q/E371K/K373S/E377G, showed a slight but significant increase in their affinity for cocaine with IC50 values of 41 and 48 nM, respectively. Despite the fact that we have mutated almost all of the nonconserved amino acids between TMD6 and TMD8, we could not detect any loss of affinity in our hNET mutant collection as seen with chimera M (26).


                              
View this table:
[in this window]
[in a new window]
 
Table II
IC50 values for inhibition of [3H]DA uptake by desipramine, nortriptyline, and cocaine in COS-7 or LLC-PK1 cells expressing wild-type NET, DAT, or NET mutants
Similar values were found whether wild-type transporters or NET mutants were expressed in COS-7 or LLC-PK1 cells, and calculations were performed on pooled values from experiments with both cell lines for NET, DAT, and each mutant. Values are mean ± S.E. of three to six experiments, each performed in triplicate. Statistics were performed using Student's t test.

Inhibition of [3H]DA Uptake by Desipramine and Nortriptyline in hNET Mutants-- Under our experimental conditions, IC50 values for inhibition of DA uptake by NET and DAT, respectively, were 1.2 nM and 9.2 µM for desipramine, and 21 nM and 28.2 µM for nortriptyline (Fig. 3 and Table II).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3.   Concentration-dependent inhibition by TCA of [3H]DA uptake in COS-7 cells expressing the wild-type NET or DAT, or the mutant hNET-S399P/G400L. [3H]DA uptake was measured in the presence of various concentrations of desipramine (panel A) or nortriptyline (panel B). Each graph represents the inhibitory dose-response curve for the hNET (), DAT (open circle ), and hNET-S399P/G400L (triangle ). Each point is the mean ± S.E. of data obtained in at least three separate experiments.

Our data clearly showed (Table II) that exchanges of amino acids located in the intracytoplasmic or extracytoplasmic loops had no significant effect on TCA affinities. This applies to mutants S288I/N289D/N292R and K303C within EL3, mutants A330S and D336T within IL3, and mutants H370Q/E371K/K373S/E377G/N375P and E377G/E382D/A384P within EL4. Neither did seven mutations in TMDs had any effect on TCA affinities, namely H280R within TMD5, F316C within TMD6 and I364F, S396A, S399P, F403A, and A413T within TMD8.

In TMD6, a marked difference between DAT and NET was a change from Phe to Cys. Mutant F316C, in which this change was engineered, displayed a 6-8-fold loss of affinity for both desipramine and nortriptyline (Table II). Whereas the single mutation from Asp to Thr in IL3 (D336T) had no effect on TCA potency, the double mutant F316C/D336T exhibited a 30-50-fold decrease in the affinities for desipramine and nortriptyline (Table II). These results suggest a dominant role for Phe316, which is enhanced by the loss of a charged residue in IL3. In TMD7, the single mutation V356S induced a significant 2-fold shift in desipramine affinity and a 10-fold shift in nortriptyline affinity. In TMD8, we observed a significant 3-4-fold loss in desipramine and nortriptyline affinity for the mutant hNAT-G400L (Table II). Despite the fact that the single mutation S399P had no effect by itself, the consequences of amino acid exchanges were particularly impressive in the double mutant S399P/G400L. The desipramine competition curve fitted a two-site model (IC50(1) = 1 nM and IC50(2) = 2690 nM), whereas the nortriptyline competition curve did not fit adequately neither a one- nor a two-site model (global IC50 = 1670 nM) (Table II, Fig. 3). Therefore, as these mutations modify the classical one-site inhibition curve, it can be inferred that the different affinity states are reflecting the presence of allosteric conformational changes in this mutant transporter. Finally, we constructed a triple mutant combining the three individual changes that induce an affinity shift, F316C, V356S, and G400L. This mutant displayed a very strong shift for both desipramine (36-fold) and nortriptyline (9-fold), thus confirming the involvement of these three residues in the binding affinity of TCAs (Table II).

Inhibition of [3H]DA Uptake by Desipramine and Nortriptyline in hDAT Mutants-- To determine whether these changes in TMD6, TMD7, and TMD8 were important for TCA inhibition of hDAT, we also mutated the corresponding amino acids in hDAT to their counterpart in hNET. In TMD6, a change from Cys to Phe in position 318 of the hDAT triggered a significant 2-3-fold gain in affinity for TCAs (Table III). In TMD8, single mutant P401S showed a tendency toward a better affinity for desipramine and a significant 1.5-fold better affinity for nortriptyline. However, double mutant hDAT P401S/L402G did not exhibit any affinity increase for TCA but on the contrary displayed a loss of affinity for both desipramine and nortriptyline (without exhibiting a multiple site competition curve to these compounds). Mutant hDAT-S358V was the most impressive, with an IC50 value of 940 nM for desipramine (Table III), 10-fold better than what was observed on the wild-type hDAT.


                              
View this table:
[in this window]
[in a new window]
 
Table III
IC50 values for inhibition of [3H]DA uptake by desipramine and nortriptyline in COS-7 or LLC-PK1 cells expressing wild-type hDAT or hDAT mutants
Similar values were found whether wild-type DAT or DAT-mutants were expressed in COS-7 or LLC-PK1 cells, and calculations were performed on pooled values from experiments with both cell lines for wild-type and mutant DAT. Values are mean ± S.E. of four to six experiments, each performed in triplicate. Statistics were performed using Student's t test.



    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Chimeric transporters from different members of the monoamine subfamily have already provided information about the participation of restricted regions in drug or substrate binding (21, 26, 35-37). However, single amino acids that may be directly involved in the high-affinity binding of tricyclic antidepressants in NET are not yet known. The present study was designed to determine precisely the role of individual residues of DAT and NET in determining their pharmacological characteristics. It seems now quite obvious that all amine transporters cloned in nonmammalian species are sensitive to TCA. This is the case for species as far from mammalians as Caenorhabditis elegans (13) for ceDAT, Drosophila melanogaster (17, 18) for dSERT, Rana catesbiana (7) for fET, and the teleost fish Orysias latipes (medaka) for meNET.2 Actually, the only amine transporters not sensitive to TCA are DAT cloned from rat, bovine, or human. This means that in the evolution process the first amine transporters already had the ability to strongly bind TCA in a binding pocket formed by disseminated residues, and that this ability was lost in DAT. Thus, it was unlikely we could find a single residue that would increase TCA affinities in DAT to what is observed in NET and SERT. The rationale in our work on mutation from NET to DAT was to search for a loss of function, possibly revealed by a single point mutation. We generated 22 mutants of the hNET, in which amino acids in TMD5 to TMD8 were replaced by their counterparts in hDAT. We chose to target this domain because two independent studies had clearly demonstrated the involvement of the central region of the NET in high affinity binding of TCA (21, 26). To cover as many mutations as possible, we occasionally changed neighboring bases to include up to 4 amino acid changes (Fig. 1). Furthermore, some reversed mutations of special interest were also performed in hDAT, and these amino acids were replaced by their counterparts in hNET (Fig. 1). However, it should be reminded that we have not engineered any changes in the 17 residues displaying conservative changes (Fig. 1) between DAT and NET, which may deserve further analysis.

Efficacy of the Uptake Activity-- We directly studied the uptake properties of our mutant collection but did not investigate their binding properties, as this would not be informative regarding uptake mechanisms. All mutants in TMDs displayed a measurable uptake after transient transfection in eukaryotic cells (Table I) and were correctly expressed at the plasma membrane (not shown). Among hNET mutations within the loops, three displayed a severe loss of uptake activity. These mutants were in EL3 (H296S), EL4 (H370Q/E371K/K373S/N375P), and IL4 (S420A) (Fig. 2). It is interesting to note that hNET mutants H370Q/E371K/K373S/E377G and E375P, which partially overlap mutations of the nonexpressed H370Q/E371K/K373S/N375P, were able to transport DA and NE with the same efficacy as the wild-type NET. These findings imply that the changed amino acids in the loop of these mutants may play a role in correct membrane processing or targeting of NET, although presently the mechanism involved is unknown. This finding is in agreement with the importance of this central domain of catecholamine transporters in their functional expression at the plasma membrane. Furthermore, it was previously shown that some chimeric proteins engineered in this region were devoid of uptake activities (26, 35).

Interactions with Cocaine-- It was previously described that chimeras having predominantly the NET sequence but with TMD5 to TMD8 replaced by the DAT cassette, displayed a significant loss of affinity for cocaine (26). None of our 19 functional hNET mutants (Table II) displayed any loss of cocaine inhibition, which indicates that this property previously observed in DAT/NET chimeras was more the consequence of a perturbation of inter-domain interactions, rather than the elimination of a cocaine-binding residue. No differences relative to cocaine inhibition were observed in hNET S399P/G400L or in the corresponding hDAT (not shown) or hNET single mutants in TMD8 (Table II). It can be inferred that these mutations in TMD8 of hDAT are somehow affecting the ability of cocaine to block the transporter by inducing conformational changes and perhaps preventing access of cocaine to its site of action. Cocaine-binding sites are thought to involve common residues in all cocaine-sensitive transporters, that are probably located in disparate regions of the transporters and take into account the tertiary (37) or oligomeric structure of these proteins (41, 42).

Interactions with TCA-- In contrast to the affinity for cocaine, which is conserved among all monoamine transporters, the affinities for TCA such as desipramine or nortriptyline are 3 orders of magnitude higher for SERT and NET than for DAT (16, 22). In hNET-F316C there was a significant loss of affinity for TCA. Structure/function analyses are often supported by studies of phylogenetic relations in a homologous family. Involvement of Phe316 in TCA affinity is supported by the fact that this residue is conserved among all tricyclic-sensitive cloned transporters (Table IV), including mammalian SERT (19, 20, 43) and NET (4-6) but also in homologous transporters cloned in nonmammalian species like in the bullfrog R. catesbiana, fET (7), in the nematode C. elegans, ceDAT (13), in the fruit fly D. melanogaster, dSERT (17, 18), and in the fish O. latipes, meNET.2 In the SERT, it was also reported that a Phe residue in TMD12, Phe586, is responsible for the 5-10-fold difference in TCA affinity between the rat and the human protein (25). However, this Phe residue is not conserved in the Drosophila SERT (17, 18) or in all hitherto cloned NETs, and thus is probably not involved in a TCA binding pocket that would be conserved in all TCA-sensitive transporters. Both in this SERT mutant and in hNET-F316C, this affinity shift is the consequence of a phenylalanine substitution, suggesting that the aromatic ring may be involved in stacking (or hydrophobic) interactions with the rings forming the core of the TCA.


                              
View this table:
[in this window]
[in a new window]
 
Table IV
Sequence alignment within the amine transporter family
Alignment was performed by using amino acid sequences of the cloned medaka NET (meNET, Roubert et al., submitted), frog ET (fET (7)), human NET (hNET (6)), rat NET (rNET (4)), bovine NET (bNET (5)), D. melanogaster SERT (dSERT (18)), human SERT (hSERT (20)), rat SERT (rSERT (19)), bovine DAT (bDAT (12)), rat DAT (rDAT (8)), human DAT (hDAT (9)), and C. elegans DAT (ceDAT (13)). Only a subset of sequences in TMD6, TMD7, TMD8, and IL3 are shown. Residues that have been mutated in this study are bold. IC50 values for desipramine are from the studies cited above, except for hDAT and hNET, which are from the present work.

The double mutant hNET-F316C/D336T displayed a 30-fold shift in the IC50 value for TCA. The reason for this affinity shift, when comparing hNET-F316C to hNET-F316C-D336T, is presently not fully understood. It can be speculated that the short IL3 (12 amino acids) might act as a stabilizer of TCA binding in NET, possibly through a charge-stabilizing effect of the acidic residue Asp on conformational changes. This Asp residue is present in all mammalian and nonmammalian NET, with the exception of ceDAT where it is substituted by an His residue.

Mutation of residue Val356 to Ser also had a significant effect on TCA inhibition of DA uptake (Table II). This Val residue Val356 is strictly conserved in mammalian SERTs and meNET,2 and is changed to a conservative Ile or Leu in the other TCA-sensitive transporters including rNET, bNET, fET, dSERT, and ceDAT (Table IV). The Ser residue is found in the equivalent position of TMD7 in all mammalian DAT, therefore supporting the importance of this position for TCA inhibition sensitivity. It may be speculated that the OH moiety of Ser could hamper the positioning of TCA in their binding pocket.

In TMD8, the single point mutation G400L triggered a 3-6-fold shift in desipramine and nortriptyline affinities, respectively. This Gly residue is conserved in all mammalian NETs, fET, meNET, and dSERT, and substituted to Ala in rSERT and hSERT (Table IV). However, in ceDAT, which has a high affinity for TCA, a tyrosine residue replaces it. Even though the S399P mutation had no effect, the most striking difference arises in TMD8 with hNET mutant S399P/G400L (Table II). When we first evaluated the inhibition efficacy of TCA on this mutant, we obtained a dramatic shift for both desipramine (1000-fold) and nortriptyline (80-fold). However, the dose-response curves were spread on 3-4 logs, thereby forcing us to re-evaluate all inhibition curves with a greater range of concentrations of inhibitors. All mutants demonstrated a single-site kinetic for inhibition of [3H]DA uptake by desipramine and nortriptyline, except for hNET S399P/G400L. Mutation of these residues induced a double and multiple affinity state for desipramine and nortriptyline, respectively (Fig. 3 and Table II). Finally, we focused our attention on the three single-point mutations that displayed a significant loss in TCA inhibition, F316C, V356S, and G400L. The corresponding triple mutant in hNET displayed a strong shift for the desipramine IC50, from 1.2 nM in the wild-type to 43 nM (Table II). This potentiation is probably a consequence of the combined interaction of these three residues in TMD6, TMD7, and TMD8, with this tricyclic inhibitor.

Reverse mutations in hDAT were generated to assess the direct or indirect involvement of these specific residues in their interaction with the inhibitors. Reverse mutation hDAT-L402G did not induce a better inhibition by TCA as could be expected from what was observed in hNET-G400L. Conversely, hDAT-P401S, the reverse mutant of hNET-S399P, was slightly but significantly more sensitive to both desipramine and nortriptyline inhibition. However, substitution of both Pro401 and Leu402 produced a more profound loss of TCA affinity compared with the wild-type DAT. Although these results, together with a careful analysis of transporter phylogeny, do not provide a clear explanation for the observed effects, it seems obvious that this peculiar region of TMD8 is involved in uptake inhibitor potency. It is intriguing to consider that the two affinity states for the mutant hNET-S399P/G400L are exactly those observed for hNET (high affinity) and hDAT (low affinity), respectively. One potential explanation would be that this peculiar mutant is entrenched in a transition state conformation, which can bind low concentrations of desipramine in the high affinity pocket and high concentrations of desipramine in the low affinity pocket. However, once the inhibitor is bound, it might induce conformational changes in the mutant transporter and therefore lead to a different accessibility to the inhibitor recognition site. The two single changes in TMD6 (C318F) and TMD7 (S358V) both produce a significant gain of affinity for desipramine and nortriptyline (Table III). Introduction of a Phe residue in position 318 may allow the aromatic ring to directly interact with the tricyclic core of the two inhibitors. The substitution of a Ser to Val residue at position 358 induced a dramatic increase in affinity. We can hypothesize that either the Val residue (Leu or Ile in the other members of the NET/SERT family; Table IV) could establish hydrophobic interactions with the TCA or the Ser residue could directly interfere with TCA binding. In conclusion, our site-directed mutagenesis experiments underline the complex structural equilibrium that is achieved in the Na+/Cl--dependent transporters. These proteins are known to exhibit a functional channel together with a ligand-binding domain, inside the same structure (44, 45). In this respect, amino acids leading to conformational changes or involved in the tertiary organization of these transporters are particularly important for these complex proteins. This is supported by the high degree of conservation observed in all Na+/Cl--dependent transporters, particularly among the monoamine transporters.

The most important outcome of the present study is the first evidence that binding site(s) for TCA are presumably formed or impacted by residues that are contained in TMD(Fig. 1), whereas no interaction could be ascribed to residues in the putative intra- or inter-cytoplasmic loops (Fig. 1). We clearly identified a Phe residue in TMD6 and a Val residue in TMD7 that may directly interact with TCA, because their loss in hNET decreases the affinity, whereas their introduction in hDAT increases the affinity for these inhibitors. It cannot yet be definitively inferred from our results whether TCA are acting by inducing conformational changes in the transporter or by a direct interaction at the precise sites where the substrate will bind and/or translocate. Further exploration of whether these residues are accessible to aqueous modifying reagents (e.g. MTSET or MTS-biotin) could help to resolve this issue. However, the NET and DAT mutants that lose their affinity for TCA still retain their property to transport NE and DA (with unchanged apparent affinity and efficacy), meaning that the TCA-binding residues are not involved in the substrate translocation mechanisms.


    ACKNOWLEDGEMENTS

We thank B. Lentz, F. Runkel, and J. Blümke for help in fluorescent microscopy and P. Breiden for help in uptake experiments.


    FOOTNOTES

* This work was supported in part by grants from INSERM (to M. H. and B. G.) and the Deutsche Forschungsgemeinschaft (to H. B.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Supported by a Sanofi research grant and by Fondation pour la Recherche Médicale. Present address: Sanofi-Synthelabo, Departement SNC, 371 rue du professeur Blayac, 34184 Montpellier Cedex 04, France.

|| Recipient of fellowship from INSERM ("Poste Vert") and Fondation pour la Recherche Médicale during performance of this work. Present address: Parke-Davis Neuroscience Research Centre, University of Cambridge Forvie site, Robinson Way, Cambridge CB2 2QB, United Kingdom.

Dagger Dagger To whom correspondence should be addressed. Tel.: 33-1-49-81-35-39; Fax: 33-1-49-81-36-85; E-mail: giros@im3.inserm.fr.

Published, JBC Papers in Press, November 22, 2000, DOI 10.1074/jbc.M009798200

2 C. Roubert, C. Sagné, M. Kapsimali, P. Vernier, F. Bourrat, and B. Giros, submitted for publication.


    ABBREVIATIONS

The abbreviations used are: DAT, dopamine; NET, norepinephrine; SERT, serotonin transporter; TCA, tricyclic antidepressants; PBS, phosphate-buffered saline; TMD, transmembrane domain; EL, extracellular loop; IL, intracytoplasmic loop.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES


1. Axelrod, J. (1965) Recent Prog. Horm. Res. 21, 597-619
2. Coyle, J. T., and Snyder, S. H. (1969) J. Pharmacol. Exp. Ther. 170, 221-231
3. Iversen, L. L. (1974) Biochem. Pharmacol. 23, 1927-1935
4. Brüss, M., Porzgen, P., Bryan-Lluka, L. J., and Bönisch, H. (1997) Brain Res. Mol. Brain Res. 52, 257-262
5. Lingen, B., Brüss, M., and Bönisch, H. (1994) FEBS Lett. 342, 235-238
6. Pacholczyk, T., Blakely, R. D., and Amara, S. G. (1990) Nature 350, 350-353
7. Apparsundaram, S., Moore, K. R., Malone, M. D., Hartzell, H. C., and Blakely, R. D. (1997) J. Neurosci. 17, 2691-2702
8. Giros, B., El, Mestikawy, S., Bertrand, L., and Caron, M. G. (1991) FEBS Lett. 295, 149-154
9. Giros, B., El, Mestikawy, S., Godinot, N., Zheng, K., Han, H., Yang-Feng, T., and Caron, M. G. (1992) Mol. Pharmacol. 42, 383-390
10. Kilty, J. E., Lorang, D., and Amara, S. G. (1991) Science 254, 578-579
11. Shimada, S., Kitayama, S., Lin, C. L., Patel, A., Nanthakumar, E., Gregor, P., Kuhar, M., and Uhl, G. (1991) Science 254, 576-578
12. Usdin, T. B., Mezey, E., Chen, C., Brownstein, J., and Hoffman, B. J. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 11168-11171
13. Jayanthi, L. D., Apparsundaram, S., Malone, M. D., Ward, E., Miller, D. M., Eppler, M., and Blakely, R. D. (1998) Mol. Pharmacol. 54, 601-609
14. Uhl, G. R., and Hartig, P. R. (1992) Trends Pharmacol. Sci. 13, 421-425
15. Amara, S. G., and Kuhar, M. J. (1993) Annu. Rev. Neurosci. 16, 73-93
16. Giros, B., and Caron, M. G. (1993) Trends Pharmacol. Sci. 14, 43-49
17. Corey, J. L., Quick, M. W., Davidson, N., Lester, H. A., and Guastella, J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 1188-1192
18. Demchyshyn, L. L., Pristupa, Z. B., Sugamori, K. S., Barker, E. L., and Blakely, R. D. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 5158-5162
19. Blakely, R. D., Berson, H. E., Fremeau, R. T., Caron, M. G., Peek, M. M., Prince, H. K., and Bradley, C. C. (1991) Nature 364, 66-70
20. Ramamoorthy, S., Bauman, A. L., Moore, K. R., Han, H., Yang-Feng, T., Chang, A. S., Ganapathy, V., and Blakely, R. D. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2542-2546
21. Buck, K. J., and Amara, S. G. (1995) Mol. Pharmacol. 48, 1030-1037
22. Gu, H., Wall, S. C., and Rudnick, G. (1994) J. Biol. Chem. 269, 7124-7130
23. Glowinski, J., and Axelrod, J. (1964) Nature 204, 1318-1319
24. Richelson, E., and Pfemming, M. (1984) Eur. J. Pharmacol. 104, 277-286
25. Barker, E. L., and Blakely, R. D. (1996) Mol. Pharmacol. 50, 957-965
26. Giros, B., Wang, Y. M., Suter, S., McLeskey, S. B., Pifl, C., and Caron, M. G. (1994) J. Biol. Chem. 269, 15985-15988
27. Kitayama, S., Shimada, S., Xu, H., Markham, L., Donovan, D. M., and Uhl, G. R. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7782-7785
28. Lin, F., Lester, H. A., and Mager, S. (1996) Biophys. J. 71, 3126-3135
29. Kitayama, S., Wang, J. B., and Uhl, G. R. (1993) Synapse 15, 58-62
30. Melikian, H. E., Ramamoorthy, S., Tate, C. G., and Blakely, R. D. (1996) Mol. Pharmacol. 50, 266-276
31. Nguyen, T. T., and Amara, S. G. (1996) J. Neurochem. 67, 645-655
32. Sur, C., Schloss, P., and Betz, H. (1997) Biochem. Biophys. Res. Commun. 241, 68-72
33. Wang, J. B., Moriwaki, A., and Uhl, G. R. (1995) J. Neurochem. 64, 1416-1419
34. Chen, J. G., Liu-Chen, S., and Rudnick, G. (1997) Biochemistry 36, 1479-1486
35. Buck, K. J., and Amara, S. G. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 12584-12588
36. Barker, E. L., Kimmel, H. L., and Blakely, R. D. (1994) Mol. Pharmacol. 46, 799-807
37. Stephan, M. M., Chen, M. A., Penado, K. M. Y., and Rudnick, G. (1997) Biochemistry 36, 1322-1328
38. Sur, C., Betz, H., and Schloss, P. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 7639-7644
39. Brüss, M., Hammermann, R., Brimijoin, S., and Bönisch, H. (1995) J. Biol. Chem. 270, 9197-9201
40. Pifl, C., Giros, B., and Caron, M. G. (1993) J. Neurosci. 13, 4246-4253
41. Milner, H. E., Beliveau, R., and Jarvis, S. M. (1994) Biochim. Biophys. Acta 1190, 185-187
42. Berger, S. P., Farrell, K., Conant, D., Kempner, E. S., and Paul, S. M. (1994) Mol. Pharmacol. 46, 726-731
43. Hoffman, B. J., Mezey, E., and Brownstein, M. J. (1991) Science 254, 579-580
44. Galli, A., Blakely, R. D., and De Felice, L. J. (1998) Proc. Natl. Acad. Sci. U. S. A. 22, 13260-13265
45. Sonders, M. S., and Amara, S. G. (1996) Curr. Opin. Neurobiol. 6, 294-302


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
J. Zhu, S. Apparsundaram, and L. P. Dwoskin
Nicotinic Receptor Activation Increases [3H]Dopamine Uptake and Cell Surface Expression of Dopamine Transporters in Rat Prefrontal Cortex
J. Pharmacol. Exp. Ther., March 1, 2009; 328(3): 931 - 939.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
Z. Zhou, J. Zhen, N. K. Karpowich, R. M. Goetz, C. J. Law, M. E. A. Reith, and D.-N. Wang
LeuT-Desipramine Structure Reveals How Antidepressants Block Neurotransmitter Reuptake
Science, September 7, 2007; 317(5843): 1390 - 1393.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. A. Paczkowski, I. A. Sharpe, S. Dutertre, and R. J. Lewis
{chi}-Conotoxin and Tricyclic Antidepressant Interactions at the Norepinephrine Transporter Define a New Transporter Model
J. Biol. Chem., June 15, 2007; 282(24): 17837 - 17844.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. K. Hahn, M. S. Mazei-Robison, and R. D. Blakely
Single Nucleotide Polymorphisms in the Human Norepinephrine Transporter Gene Affect Expression, Trafficking, Antidepressant Interaction, and Protein Kinase C Regulation
Mol. Pharmacol., August 1, 2005; 68(2): 457 - 466.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. A. Sharpe, E. Palant, C. I. Schroeder, D. M. Kaye, D. J. Adams, P. F. Alewood, and R. J. Lewis
Inhibition of the Norepinephrine Transporter by the Venom Peptide {chi}-MrIA: SITE OF ACTION, Na+ DEPENDENCE, AND STRUCTURE-ACTIVITY RELATIONSHIP
J. Biol. Chem., October 10, 2003; 278(41): 40317 - 40323.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. J. Bryan-Lluka, H. Bonisch, and R. J. Lewis
{chi}-Conopeptide MrIA Partially Overlaps Desipramine and Cocaine Binding Sites on the Human Norepinephrine Transporter
J. Biol. Chem., October 10, 2003; 278(41): 40324 - 40329.
[Abstract] [Full Text] [PDF]


Home page
Anesth. Analg.Home page
T. Horishita, K. Minami, N. Yanagihara, M. Shiraishi, T. Okamoto, Y. Shiga, S. Ueno, and A. Shigematsu
Alphaxalone, a Neurosteroid Anesthetic, Inhibits Norepinephrine Transporter Function in Cultured Bovine Adrenal Medullary Cells
Anesth. Analg., December 1, 2002; 95(6): 1661 - 1666.
[Abstract] [Full Text] [PDF]


Home page
Anesth. Analg.Home page
K. Sagata, K. Minami, N. Yanagihara, M. Shiraishi, Y. Toyohira, S. Ueno, and A. Shigematsu
Tramadol Inhibits Norepinephrine Transporter Function at Desipramine-Binding Sites in Cultured Bovine Adrenal Medullary Cells
Anesth. Analg., April 1, 2002; 94(4): 901 - 906.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
C. Roubert, C. Sagne, M. Kapsimali, P. Vernier, F. Bourrat, and B. Giros
A Na+/Cl--Dependent Transporter for Catecholamines, Identified as a Norepinephrine Transporter, Is Expressed in the Brain of the Teleost Fish Medaka (Oryzias latipes)
Mol. Pharmacol., September 1, 2001; 60(3): 462 - 473.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/11/8254    most recent
M009798200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roubert, C.
Right arrow Articles by Giros, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roubert, C.
Right arrow Articles by Giros, B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement