![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 11, 8278-8287, March 16, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, October 11, 2000
To define the transcriptional mechanisms
contributing to stage- and tissue-specific expression of muscle genes,
we performed transgenic analysis of Drosophila paramyosin
gene regulation. This gene has two promoters, one for paramyosin and
one for miniparamyosin, which are active in partially overlapping
domains. Regions between The correct patterning and differentiation of muscles require the
coordinate execution of regulatory programs. These include the
differential expression of muscle genes and the production of specific
protein isoforms (1). Muscle genes are activated coordinately. Their
transcription is regulated by DNA sequences, promoters, and enhancers,
which permit the interaction with unique combinations of transcription
factors in each cell type. Myogenesis has a determinative stage in
which mesodermal precursors become myoblasts and a differentiation
stage involving the fusion of single myoblasts to form multinucleated
myotubes that express the contractile protein genes. In vertebrates
this occurs during embryogenesis; two families of transcriptional
factors, MyoD and MEF2, are essential to the transcription of muscle
structural genes and are critical for the stable determination of
myoblast lineages (2, 3). In skeletal muscles, MyoD and MEF2 work cooperatively in muscle gene activation (2, 4). The MyoD family is
exclusively expressed in somatic muscles, in contrast to mef2
genes that are expressed in skeletal, cardiac, and smooth muscles. This
suggests that MyoD-type proteins play important roles in activating
transcription within each myogenic lineage (5). The analysis of MEF2
functions has been facilitated by the isolation of the
Drosophila mef2 gene (6, 7). This single gene is
required for differentiation of skeletal, cardiac, and visceral muscles
(8, 9).
The Drosophila paramyosin/miniparamyosin gene
(PM1/mPM) represents a good
model system to elucidate muscle gene regulatory mechanisms. Previous
studies have suggested that the molecular pathways controlling muscle
formation are ancient and evolutionarily conserved in flies and
vertebrates (10). Interest in studying expression of PM/mPM is enhanced
by the fact that the two mRNAs arise from overlapping
transcriptional units. The mPM promoter is located inside a PM intron
that is 8 kb downstream of the PM promoter (11, 12). Whereas PM is
expressed at the two distinct stages in all muscles, as are most other
Drosophila muscle proteins, mPM is present only in the adult
musculature. The two proteins are expressed at the same stage of adult
development, suggesting that regulation of the two promoters has to be
coordinated (13).
Drosophila develops distinct sets of muscles during its life
cycle, with separate muscles at the embryonic/larval stages and in the
adult (14). Myoblast determination and differentiation occur
independently at each phase (15). During embryogenesis, mesodermal
precursors appear at gastrulation during ventral furrow formation. Body
wall muscles and some visceral muscles are derived from precursor
myoblasts expressing the twist gene (16-18). The second phase of
myogenesis occurs several days later during metamorphosis. The
specialized adult muscles, including the indirect flight muscles (IFM)
and the tergal depressor of the trochanter (TDT), form during pupation
when most larval muscles are histolyzed (19-22).
Identification of Drosophila muscle promoter/enhancer
sequences and their associated binding factors has not been nearly as extensive as in vertebrates. The majority of identified transcription factors are required for mesoderm formation. twist
and snail are involved in establishing the mesoderm germ
layer; tinman is exclusively expressed in the dorsal vessel
muscle primordia; and bagpipe is involved in the development
of visceral muscles (23-25). Nautilus, the MyoD
homologue, is expressed in some so-called founder cells, a subset of
myoblast cells of the somatic mesoderm probably involved in formation
and/or patterning of embryonic body wall muscles (26-28). However, no
targets of NAU are known. DMEF2 is expressed in all muscle
lineages, where it is required for differentiation (2, 6, 7, 17). CF2
(29) and PDP1 (30, 31) also have been described as ubiquitous factors
with important roles in muscle development. However, little is known
about how muscle gene expression is regulated in adults and how the
expression is coordinated between the embryonic/larval muscles and the
adult musculature.
In this article, we study the regulation of the PM/mPM gene by
linking the LacZ gene to putative PM/mPM regulatory sequences and
analyzing gene expression in vivo in germline transformants. Our findings define an important role for the myogenic regulatory factor MEF2 and implicate this and other factors binding to a number of
conserved elements as being required for development of the larval and
adult musculature.
Isolation of Genomic Clones, Construction of P-transformation
Plasmids, and Generation of Transformed Drosophila
Lines--
Drosophila melanogaster and Drosophila
virilis genomic clones (12) containing the 5' upstream regions
from the transcriptional initiation sites of the PM and mPM were
subcloned and sequenced as described (32). Selected fragments from
these regions were cloned into P-transformation vectors with native
orientations relative to the basal promoters. +1 bp on our map refers
to the main initiation starts of the PM and mPM (12). The P element plasmid vectors (33) were pCaspeR
Generation of germline transgenic flies using the P element-mediated
transformation technique was essentially as described (35). Between one
and eight lines from each construct were analyzed for expression.
Embryo, Larvae, and Adult Staining--
Reverse Transcriptase-Polymerase Chain Reactions and
Sequencing--
Reverse transcriptase-PCR was performed according to
standard protocols (39). Oligonucleotides spanning different sequences of the PM and mPM promoter regions and the LacZ gene were used as
primers. Sequencing was carried out by an automatic sequencer (Applied
Biosystems) as described by the manufacturer. GCG software (version
7.1) was used for sequence analysis (40).
RNA Purification and Northern Hybridization--
Total RNA from
adult flies was purified, and Northern blot analysis was performed as
described previously (41).
Nucleotide Sequence Accession Numbers--
The complete 5'
upstream regions from the initiation sites of paramyosin and
miniparamyosin from D. melanogaster and D. virilis have been submitted to GenBankTM/EBI Data Bank
under accession numbers AJ243067, AJ243068, AJ243069, and AJ243070.
Distinct Conserved Elements Are Present in the Distal 5' Regions of
the PM/mPM Genes of D. melanogaster and D. virilis--
As an initial
step in the identification of transcriptional enhancer sequences of the
PM/mPM gene in D. melanogaster, we isolated the PM/mPM
homologue from a distantly related species, D. virilis. These two Drosophilidae species diverged more than 50 million years ago, and sequence comparison is useful for detecting conserved regulatory features. Previous studies (12) revealed that regions extending 90-100 nucleotides upstream of the PM and mPM
transcriptional initiation sites are over 90% conserved, indicating
that they may correspond to RNA polymerase complex binding domains.
The alignment of the more distal sequences allowed identification
of cis elements important for muscle expression (Fig.
1). For the sequences 5' to the PM start
sites, the only homologies are the proximal region, one binding site
for MEF2 at
When the same comparison studies were performed with the mPM putative
promoter regions (Fig. 1), three conserved regions were identified.
These regions, conserved in sequence and position, are 81-91%
identical. These are the X element between nucleotides In Vivo Analysis of 5' Upstream Regions Involved in PM and mPM
Expression--
To determine the regions regulating the expression of
PM and mPM, based on the comparative analysis described above,
constructs were made and analyzed by P element-mediated transformation.
The transgenic lines transformed with constructs containing 4-kb (PM4) or 2.7-kb (mP 2.7) fragments upstream from the transcription start sites of the PM or mPM, respectively, express LacZ at high
levels with similar patterns as the endogenous proteins, except for the TDT and IFM (Figs. 2 and
3). The PM4 lines do not express the transgene in IFM muscles (Fig. 2 and Table
I). In contrast, the mP 2.7 lines showed
To more precisely define elements necessary for PM expression,
constructs containing fragments of 1.7 (PM 1.7), 1.39 (PM 1.4), 0.92 (PM 0.9), 0.55 (PM 0.5), 0.34 (PM 0.3), and 0.15 (PM 0.15) kb from the
PM initiation site were generated (Fig. 2). Analysis of the transgenic
lines revealed that 5' upstream sequences of less than 0.9 kb (PM 0.9, PM 0.5, PM 0.3, and PM 0.15) do not express significant levels of
Detailed analysis of transgenic lines with constructs containing
intermediate length fragments (PM 1.7 and PM 1.4) established the
importance of the putative regulatory sites in these constructs. In the
PM 1.7 lines, containing the MEF-E region, flies express significant
levels of LacZ in all muscles including leg and visceral muscles, but not IFMs. Except for a slightly lower level of expression, the pattern is the same as the one obtained with the PM4 construct. Surprisingly, the absence of the MEF-E region in the PM 1.4 lines yields LacZ expression in all muscles. Although the absence
of this region markedly diminished the LacZ expression (Fig.
2 and Table I), it does not abolish it completely. In fact,
A similar study was done with the sequences 5' to the mPM start site
(Fig. 3 and Table II). Transgenic lines transformed with constructs
containing fragments of 1.68 (mP 1.7), 1.2 (mP 1.2), 0.89 (mP 0.9),
0.57 (mP 0.5), 0.27 (mP 0.3), and 0.143 (mP 0.15) kb were generated. As
in the case of PM, no LacZ expression was detected in the
lines containing 5' upstream fragments of less than 0.89 kb. Reverse
transcriptase-PCRs of the mP 0.3 and mP 0.15 lines were performed (data
not shown). The results suggest that these regions, as in the PM
promoter, contain elements involved in basal transcription. The two
intermediate lines (mP 1.7 and mP 1.2) showed muscle The Role of MEF2 and the E Boxes in Regulating the Expression of
Drosophila PM--
Drosophila MEF2 is expressed in the
precursors of all muscle lineages early in development, and expression
persists as the descendants of these cells differentiate (5-7). During
the larval stages the mef2 gene is expressed in cells
that give rise to the adult somatic muscles (20, 42). Moreover, ectopic
expression of MEF2 in the epidermis induces epidermal expression of
muscle genes and abnormal muscle development (43). Our in
vivo analysis revealed that the region carrying the E boxes and
the MEF2 site of the PM promoter plays an important role in regulation
of PM expression.
To assess the functional role of the MEF2 site and the three E boxes,
we generated transgenic lines in which the MEF2 site or the E boxes
were altered (Fig. 4 and Table
III). EMSA had previously revealed
that oligonucleotides containing the mutated E boxes were unable to
compete the protein binding. We made a 4-bp mutation in the MEF2
binding site or alternatively a 2-bp mutation in one, two, or three of
the E boxes in the context of the entire distal promoter. Band shift
assays confirmed that the Drosophila MEF2 protein is unable
to bind the mutated MEF2 binding site (data not shown). Lines carrying
the 1.7-kb fragment with the mutated MEF2 binding site (MM) were
checked for Paramyosin and Miniparamyosin Expression in Adult Muscles Is Not
Coordinated--
Although the endogenous PM is expressed in IFM, our
data show that the element controlling expression of PM in IFMs is not present in regions analyzed at the 5' end of PM. Because the PM/mPM gene contains two overlapping transcriptional units, it is possible that the IFM-controlling element(s) of mPM also drives PM expression in
IFMs in a coordinated fashion.
To investigate whether PM and mPM transcription is coordinated, we
studied the coexpression of the LacZ and GFP genes under the control of
the PM and mPM promoters, respectively. The main limitation of the
previous approach is the possible influence of enhancers located close
to the insertion region in the chromosome. If the two transcriptional
units are situated in the same construct, then positional effects could
be ruled out because they would basically influence the two
transcriptional units at the same time. Three constructs were made and
analyzed by P element-mediated transformation (Fig.
5). The first construct, LG, was designed to reproduce the situation of the endogenous PM/mPM gene. The 5'
upstream region controlling PM (4 kb) drives the expression of
LacZ, and the 5' upstream region controlling mPM (2.7 kb)
drives the GFP gene. The distance between LacZ and
GFP initiation sites is similar to the PM and mPM
initiation sites in the endogenous gene. Moreover, to allow correct
splicing of the two possible transcripts, an artificial intron
(basically intron 8 without the middle region; see "Experimental
Procedures"), followed by the SV40 polyadenylation signal, was placed
downstream of the GFP gene. The generated lines should produce two
transcripts: 1) LacZ carrying at its end exons 5, 6, and 7 of the PM/mPM gene and 2) GFP. If cooperation exists
between the promoters, LacZ and GFP muscle
expression in these lines should be different compared with the PM 4 and mP 2.7 lines. In a second construct, LGD, a fragment with the
artificial intron and the polyadenylation signal, was included
downstream of the LacZ gene to make both transcriptional units
independent. In the third construct, LGI, the orientation of one of the
transcriptional units was reversed. Lines LGD and LGI may produce two
transcripts, LacZ (in this case without exons 5, 6, and 7)
and GFP. Two more constructs were made as a control, PM4i (PM) and mPGFP (mPM) in which PM and mPM promoters were
independently fused upstream of the respective reporter genes. They
also contained the fragment with the artificial intron and the
polyadenylation signal. Several transgenic lines were obtained (Fig. 5
and Table IV).
Analysis of LacZ and GFP expression showed
that both temporal and spatial expression patterns were similar to
those obtained previously in the lines transformed with constructs
containing 4-kb (PM4 and PM4i) or 2.7-kb (mP 2.7 and mPGFP) fragments.
Thus, LG, LGD, and LGI lines express
To establish whether transcription was correctly carried out, Northern
blot analyses (Fig. 6) were performed
with total RNAs from late pupae of the LG, LGD, and LGI lines. LG lines
basically present two bands, corresponding to the LacZ and
GFP transcripts with the expected size. Thus, the
LacZ transcript appears as a band of higher size,
LacZ plus exons 5, 6, and 7. In the LGD lines, besides the
expected LacZ and GFP transcripts, we
detect an additional higher band, a consequence of incorrect
functioning of the polyadenylation signal as a terminator. In LGI
lines, besides the expected LacZ and GFP
transcripts, an additional band of unknown composition appears. In any
case, we have never detected cross-hybridization between the different
bands, demonstrating that transcription and intron processing were
carried out correctly.
Transcript accumulation in these lines was carried out comparing the
relative expression of LacZ and GFP in
each one of the LG, LGD, and LGI lines via densitometric analysis of
Northern blots (Fig. 6). The introduction of a polyadenylation signal
to make both units independent in the LGD lines significantly decreases the GFP transcription when compared with the relative expression of LacZ and GFP in the LG lines (Fig.
6). The LacZ/GFP ratio is higher in the LG lines
than in the LGD lines. However, this difference is not seen when the
orientation of the two transcriptional units is changed (LG and LGI
lines). These results clearly indicate that the two
transcriptional units do not share regulatory elements and that they
are probably transcribed in an independent manner, as if they were
situated in separate loci.
Our comparative studies of the 5' upstream sequences of the two
overlapping transcriptional units of the PM/mPM genes of D. melanogaster and D. virilis, in conjunction with
in vivo analyses, have determined the location of elements
that regulate PM and mPM gene expression. The 150-bp sequences proximal
to the PM and mPM start sites drive very low levels of transgene
expression. Because no For PM, a group of E boxes and MEF2, PDP1, and CF2 sites are present in
a region important for muscle-specific expression. The E boxes and the
MEF2 site are conserved between the two Drosophilidae species.
Transgenic flies containing this region express For the mPM promoter region, we found no conserved binding sites for
known muscle transcriptional factors. Instead, three conserved regions
were detected. Based on our in vivo analysis, the AB element
(126 nucleotides) may be involved in the regulation of mPM expression
in abdominal hypodermal muscles. The BF2 (34 nucleotides) element
contributes to the regulation of mPM expression in other adult muscles.
Its deletion abolishes mPM expression in the thorax. The absence of
staining in the mP 0.9 lines carrying only the X conserved element was
surprising. This element may need flanking regions that are absent in
this construct to activate the transgene, such as the conserved BF2 region.
The inclusion of sequences upstream of The Role of MEF2 and the E Boxes in the PM
Promoter--
Cooperative activation of muscle gene expression by MEF2
and myogenic bHLH factors occurs in vertebrates. This requires direct interactions between the DNA binding domains of MEF2 and the bHLH factors, but only one of the factors needs to be bound to DNA. These
interactions allow either factor to activate transcription through the
binding site of the other factor (2).
Our findings with the paramyosin promoter define an important role for
the whole MEF2-E region, located
Substitution mutations within the MEF2-E region of the conserved
elements, the MEF2 site and the three E boxes, revealed a different
role for these sites at distinct muscle stages. This indicates that
MEF2 may carry out tissue-specific roles in myogenesis. The MEF2 site
is the main requirement for maintaining the high PM levels of
transcription in larval muscles, but it is not really important for
high expression in adult muscles (Fig. 4). When this site is
mutated, the decrease in expression is minor. No effect in the larval
musculature was observed when all E boxes were mutated (Fig.
4C). It is also clear that no synergism involving MEF2 working through the E boxes is seen in larval muscles (see larvae
in Fig. 4, B and C).
In adults, IFM misexpression (regarding PM 4 and PM 1.7 lines) appears
in the lines that have either the MEF2 site or the distinct E boxes
mutated, indicating that the distinct sites are important for a proper
PM expression in the adult muscles. The direct interaction of an MEF
regulatory complex with these sites may be needed to give specificity
to PM expression in individual muscle types. Moreover, in adults, the
reduction of transgene activity is minor in the lines carrying
mutations either in the MEF2 site or in the E boxes (MM, E2M, 1/3M, and
3EM) when compared with the lines carrying the MEF2-E region deleted
(PM 1.4). These results suggest that other cis elements are
located in the distal muscle activator enhancer and are important to
maintaining the levels of transgene expression. It is possible that
cooperative activation involving the MEF2 site and the E boxes present
in the region is important for PM gene activation in adult musculature. If the E boxes located in this region exert a role in regulation of PM
expression in adult muscles, NAU or another bHLH factor could be
involved. In vitro transcribed-translated NAU, the homologue of MyoD in Drosophila (26), binds to these E boxes. Another explanation could be that these E boxes do not play the same role as in
vertebrate muscle genes.
With respect to the exact role of the MEF2 site and the E boxes in the
regulation of the PM expression, our results lead us to hypothesize
that the absence of the MEF2 site in larvae transforms the promoter
into a weak tissue-specific promoter. Instead, in adults, the direct
interaction of an MEF2 regulatory complex with this region may be
needed not only to reach high levels of expression but also to give
specificity to the PM expression in individual muscle types.
Furthermore, the PM misexpression in IFM may be due to an incorrect
binding of the whole MEF2 regulatory complex when the MEF2 site or the
E boxes are altered. On the other hand, these findings may reveal the
presence of other proteins different from MEF2 and bHLH factors
participating in the MEF2 regulatory complex (Fig.
7B), mediating a repressive
effect in some muscles, as may happen with IFM. Supporting this idea,
an MEF2 binding repressor in Xenopus has been identified
recently (44).
LacZ activity is not completely abolished until the region
containing the PDP1 sites is eliminated. A similar effect was seen when
the MEF2 site was mutated in the muscle-specific activator region of
the Drosophila tropomyosin gene, where the activity decreased but was not abolished completely (45). A possible explanation
for our finding could be that the region containing the PDP1 sites is
responsible for the low basal level temporal- and muscle-specific
expression, the MEF2-E region regulates high levels of PM expression in
specific muscles, and the MEF-E region acts together with the
PDP1-containing region. Our results and those of others (45, 46)
suggest that the regulatory mechanism and the major organization of the
enhancers and regulatory elements contributing to stage- and
tissue-specific expression of Drosophila muscle structural
genes could be similar.
The absence of an element that enhances PM expression in IFM and the
lack of effect of the IFM element in the
mPM promoter upon PM expression leave the issue of how PM is expressed
in IFM unresolved. In the tropomyosin (37), myosin heavy chain (47), and troponin T2 genes in
Drosophila, the IFM-controlling elements are localized in
intron 1. The element responsible for IFM expression of PM is not
located in intron 1 of the PM/mPM gene (data not shown).
In Fig. 7A, we present two models of how the MEF2-E region
may participate in the regulation of PM expression. Both models call
for the presence elsewhere of an enhancer element that mediates increased levels of PM expression in IFM. The element controlling PM
expression in IFM may act either through its interaction with the MEF-E
regulatory complex or in an independent manner. Our results do not
distinguish between the two possibilities. In the latter case, as
suggested above, interaction of a regulatory protein complex with the
whole MEF2-E region would be required for proper expression in the
other specialized muscles (Fig. 7A). In larvae, only the
requirement of the MEF2 site seems to be essential for proper expression.
Interestingly, the intron 7 region that controls mPM expression does
not contain MEF2 sites or E boxes. Our in vivo studies show
that the MEF2 site in the PM promoter is not involved in spatial and
temporal control of mPM expression. Our studies clearly reveal that
expression of the adult-specific mPM protein is regulated differently
from most of the Drosophila muscle proteins that are expressed in both embryonic and adult muscles. The absence of an MEF2
site has also been seen in the Act 88F promoter region, which drives
protein expression exclusively in IFMs (49). If the MEF2 factor is
needed to control the expression of mPM, regulation has to occur
indirectly through another transcriptional complex. An important
overall conclusion of our work is that the regulation of some
Drosophila muscle genes may not follow the same rules as in vertebrates.
The Two Transcriptional Units of the PM/mPM Gene Act
Independently--
The promoters of the gene separately regulate the
expression of two transcripts. These transcripts share two exons and
are expressed in the same fibers during pupal myogenesis. This type of
genomic organization is also present in the Drosophila
tropomyosin and myosin heavy chain genes (48, 50-52). Internal
promoters in these genes produce transcripts encoding cytoplasmic
tropomyosin and the myosin rod protein, respectively (48).
The PM/mPM gene is a good model for studying the interaction, if any,
of dual promoters. Steric impediments may exist if RNA polymerases
transcribe PM and mPM RNAs at the same time during pupal myogenesis. It
is unclear how RNA polymerase solves the problem of read-through and
whether this solution provides a mechanism for regulating the level of
expression of both proteins in adults. We did investigate whether
enhancer/s required for PM expression might be located in the mPM
regulatory region or vice versa. Because the element
controlling the expression of PM in IFM is not present in its upstream
regulatory region, we investigated whether the IFM-controlling element
of mPM also drives PM expression in IFM. Our results showed that each
promoter regulates the expression of each transcript independently and
that the element controlling the expression of mPM in the IFM is not
able to drive the expression of PM in these muscles. Likewise, the PM
elements did not enhance mPM expression in the TDT muscles that lacked
this transcript in the mP 2.7 lines. Thus, although they are encoded by
overlapping units and share two exons, PM and mPM are transcriptionally
regulated as if they were in different loci.
A possible explanation of how the two promoters of the gene can
function with no influence of one on the other may be that both
promoters, in fact, do not function in the same nucleus. Muscle fibers
are a syncytium. Recently Newlands et al. (38) demonstrated in mice that individual nuclei present in the same muscle
cell do not transcribe the same genes at the same time. Genes can be
transcribed or not in a particular nucleus, but the number of nuclei
that transcribe a specific gene is constant. This may occur for the
PM/mPM gene. If so, both PM and mPM transcripts would never be
transcribed in the same nucleus, and the two transcriptional machineries would work independently. Another possible explanation may
be the presence of an insulator separating the two promoters.
We thank Dr. R. Storti for the critical
reading of the manuscript. We thank M. Calleja and M. San Roman for
technical assistance. We are grateful to Dr. H. Nguyen, Dr. R. Storti,
Dr. F. Kafatos, and Dr. S. Abmayr for the gift of the plasmids and
antibodies MEF2, PDP1, and CF2 and NAU, respectively. We thank A. Fernández and R. Uña for help with the photographs.
*
This work was supported by Grants PB94-0093, PB96-0069,
and PB97-0014 from the Spanish Ministry of Education (to R. M. and M. C.) and grants from the Muscular Dystrophy Association and the
National Science Foundation (MCB9604546) (to S. I.B).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ243067, AJ243068, AJ243069, and AJ243070.
§
Supported by a predoctoral fellowship from the Universidad
Autónoma de Madrid with funds provided by the Spanish Ministry of
Education and the European Space Agency.
¶
Current address: Institut de Biologie du
Développement du Marseille, Laboratoire de Genétique et
Physiologie de Développement, Centre National de la Recherche
Scientifique, Campus de Luminy, Case 907, 13288 Marseille Cedex 09, France.
**
Current address: Dept. of Biology, University of New Mexico,
Albuquerque, NM 87131-1091.
Published, JBC Papers in Press, November 10, 2000, DOI 10.1074/jbc.M009302200
2
J. A. Mas, P. Benoist, and M. Cervera,
unpublished data.
The abbreviations used are:
PM, paramyosin;
mPM, miniparamyosin;
kb, kilobase(s);
IFM, indirect flight
muscles;
TDT, tergal depressor of the trochanter;
bp, base pair(s);
PCR, polymerase chain reaction;
NAU, nautilus;
GFP, green fluorescent
protein;
EMSA, electrophoretic mobility shift assay.
Control of Drosophila Paramyosin/Miniparamyosin
Gene Expression
DIFFERENTIAL REGULATORY MECHANISMS FOR MUSCLE-SPECIFIC
TRANSCRIPTION*
§,
,
§¶,
**,
,
, and

Departamento de Bioquímica & Instituto Investigaciones Biomédicas, Consejo Superior de
Investigaciones Científicas, Facultad de Medicina,
Universidad Autónoma de Madrid, Arzobispo Morcillo 4, 28029 Madrid, Spain and the
Department of Biology and Molecular
Biology Institute, San Diego State University, San Diego,
California 92182-4614
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
0.9 and
1.7 kilobases upstream of
each initiation site contribute to the temporal and spatial expression
patterns. By comparing the Drosophila melanogaster and
Drosophila virilis promoters, conserved binding sites were
found for known myogenic factors, including one MEF2 site and three E
boxes. In contrast with previous data, our experiments with the
paramyosin promoter indicate that the MEF2 site is essential but not
sufficient for proper paramyosin gene transcription. Mutations in the
three E boxes, on the other hand, do not produce any effect in
embryonic/larval muscles. Thus MEF2 site- and E box-binding
proteins can play different roles in the regulation of different
muscle-specific genes. For the miniparamyosin promoters, several
conserved sequences were shown to correspond to functionally important
regions. Our data further show that the two promoters work
independently. Even when both promoters are active in the same muscle
fiber, the transcription driven by one of the promoters is not affected
by transcription driven by the other.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-gal for all constructs, with the
exception of the mP1.7 construct (pCaspeR hs40 LacZ) and the
LG, LGD, and LGI constructs (pCaspeR 4). The artificial intron
was made joining the SalI/Afllll fragment from
the 5' end of intron 8 with the ApaLI/PstI
fragment from the 3'end of intron 8. The GFP gene for the mPGFP
plasmid was obtained from the pGREEN Lantern plasmid (Life
Technologies, Inc.). Constructs LG, LGD, and LGI were made by joining
the corresponding fragments from PM4i and mPGFP in the proper
orientation. Mutations of the MEF2 site and E boxes were carried out by
PCR as described (34) with the oligonucleotides
CGGTTGCTACTCAGAAGCGAAAAT (Mef2), GTTGGCCTGAGGAGAAATGTGTG (E1),
TAGTTAGGGAAAAGTGTGTTTGT (E2), and
GTGGAGCAGAGGAGGAGGCGATC (E3). Bold letters indicate the introduced changes in the original sequence.
-galactosidase enzyme
activity was assayed in larvae and adults of transgenic lines as
described (36), with minor modifications. Third instar larvae and
1-day-old flies were microdissected, fixed, and stained as described
(37). The levels of
-galactosidase activity were used as a means of
comparing the transcriptional efficiency between different constructs.
A rough quantification of expression levels in larval and adult muscles
among different constructs was achieved by visual monitoring of the
timed appearance of the blue reaction products from the X-gal
substrate/
-galactosidase reaction. In situ hybridization
was carried out as described (38).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1488, and three E boxes at
1587,
1461, and
1436 in
D. melanogaster. The interaction between MEF2 and MyoD
regulates muscle gene expression in vertebrates (2, 4). Thus, having an
MEF2 site and several E boxes within 150 bp makes this region worth
studying in more detail. Near this region two CF2 sites (29) and two
PDP1 sites (30, 31) at
947 and
929 are found. These are not
conserved in D. virilis.

View larger version (13K):
[in a new window]
Fig. 1.
Conserved regions in the sequences upstream
of the PM/mPM gene in D. melanogaster and D. virilis. The upper part shows a schematic
representation of the D. melanogaster PM/mPM gene. Exons are
shown as black boxes and are specified by number. The
lower part shows the alignment of the sequences upstream of
the start sites of the PM and mPM transcription units in the D. melanogaster and D. virilis genes. Proximal regions of
both transcriptional units are conserved (12). In addition, one
binding site for MEF2 at
1488 and three E boxes at
1587,
1461,
and
1436 in the D. melanogaster PM promoter are conserved
in D. virilis. In the same region, two CF2 sites and two
PDP1 sites are present in D. melanogaster but not in
D. virilis. In the upstream sequences of the mPM
transcription unit, three regions are conserved in sequence and
position. These are located at
477 to
740 (X element),
1173 to
1207 (BF2 element), and
1342 to
1469 (AB element).
477 and
740, BF2 at
1207 and
1173, and AB at
1469 and
1343 of
the D. melanogaster mPM initiation site (Fig. 1).
-galactosidase staining in IFM but not in TDT muscles (Fig. 3 and
Table II). In fact, the LacZ
expression patterns in the thoracic muscles of these lines reflect an
inverse situation to the levels of endogenous protein accumulation.
These results indicate that all the regulatory elements are located in
the regions cloned in these constructs, except for those controlling the expression of PM in IFM.

View larger version (32K):
[in a new window]
Fig. 2.
Comparison of
-galactosidase gene expression driven by selected
sequences upstream from the PM transcription start site.
A, constructs inserted in the pCasper
-gal plasmid,
identified by name and size. B, X-gal staining of third
instar larvae, dissected abdomens, and thin sections of thoraces
transformed with distinct constructs containing 5' sequences of 4 kb
(PM 4), 1.69 kb (PM 1.7), 1.38 kb (PM 1.4), and 0.87 kb (PM 0.9).
White asterisk, hypodermic ventral muscles and
white arrowhead, hypodermic dorsal muscles;
black asterisk, IFM; black arrow,
TDT.

View larger version (25K):
[in a new window]
Fig. 3.
Comparison of

galactosidase gene expression driven
by selected sequences upstream from the mPM transcription start
site. A, constructs inserted in the pCasper
-gal plasmid, identified by name and size. B, X-gal
staining of third instar larvae, dissected abdomens, and thin sections
of thoraces transformed with constructs containing 5' sequences of 2.7 kb (mP 2.7), 1.68 kb (mP 1.7), 1.2 kb (mP 1.2), 0.89 kb (mP 0.9), and
0.57 kb (mP 0.5). asterisk, IFM; arrow,
TDT. The strong staining in dorsal abdomen of mP 1.7 line is
nonspecific. The specific staining is indicated with the
arrowhead.
Comparison of LacZ gene expression driven by selected sequences
upstream from the start site of the PM transcription unit
Comparison of
-galactosidase gene expression driven by selected
sequences upstream from the start site of the mPM transcription unit
-galactosidase, as measured by enzyme staining in embryos, larvae,
or adults (Fig. 2; data not shown). Reverse transcriptase-PCR assays on
the PM 0.3 and PM 0.15 lines revealed very low levels of
LacZ transcription (data not shown). The region implicated
(from
0.9 to
1.7 kb) contains the conserved MEF2 site and E boxes
and also the PDP1 sites and one of the CF2 sites described above (Figs.
1 and 2). In vitro transcribed-translated DMEF2, NAU, PDP1,
and CF2 products bind specifically to these sequences (data not shown).
No binding was detected with TWIST.
-galactosidase staining appears in all muscles including IFM.
-galactosidase
staining with a more complex pattern than that for the PM constructs.
The mP 1.7 lines present a pattern of staining similar to that of the
endogenous gene, except that expression is not detected in larvae.
Expression in dorsal hypodermal adult muscles was consistently very low
and heterogeneous among the three lines when compared with the levels observed in the mP 2.7 line (Fig. 3). Curiously, mP 1.7 lines show
staining in TDT muscles, in contrast to the mP 2.7 lines. Sequences
upstream of
1.6 kb, which are part of other exons and introns (Fig.
1), increase expression and seem to deregulate it. Thus, in mP 2.7 lines we did not detect staining in TDT muscles, whereas the IFM
staining was very strong (Fig. 3). The mP 1.2 lines gave no activity at
all in the hypodermal abdominal muscles. The region involved in the
control of mPM expression appears to be located between
0.9 and
1.6
kb upstream of the start site and is part of intron 7. Interestingly,
the region from
0.89 to
1.6 contains the AB and BF2 conserved
elements (Fig. 3). Our results suggest that the AB element may
be implicated in the expression in abdominal adult muscles and that the
BF2 element may be implicated in the other muscle types
including TDT and IFMs. Band shift analysis with overlapping
oligonucleotides corresponding to these regions and adult nuclear
extracts revealed several specific binding sites (data not shown).
-galactosidase activity. Embryos and larvae show either
low level expression or no expression. In the adults, muscle staining
showed a decrease of the LacZ expression compared with lines
that do not carry the mutation (Fig. 4B). These lines, in
adults, gave a similar pattern of expression as PM 1.7 lines, except
that in this case, IFM were stained. However, TDT, visceral, and
abdominal muscles were stained at slightly lower levels than in PM 1.7 lines. Curiously, the distinct lines that selectively carried one, two,
or three mutated E boxes (E2M, 1/3EM, and 3EM) have similar transgene
activity. There is no effect in larval muscles, whereas adult muscles
show a slight decrease compared with lines that do not contain the
mutation. These lines show IFM staining. The reduction is present in
six of the seven generated lines, whereas IFM are stained in all the
altered lines (Fig. 4 and Table III). In summary, the MEF2 site seems
to be essential for expression of PM in embryonic muscles but not in
adult muscles. Mutations in the E boxes do not produce any effect in
embryonic/larval muscles. In adult muscles, although none of these
sites seem to be essential for expression, they appear to be required
for the proper regulation of PM expression, because mutations in these sites produce IFM staining.

View larger version (36K):
[in a new window]
Fig. 4.
The absence of the E boxes or the MEF2 site
present in the MEF-E region produces
-galactosidase misexpression in adult
musculature. A, constructs inserted in the pCasper
-gal plasmid, identified by name and size. B, X-gal
staining of third instar larvae and thin sections of abdomens and
thoraces of an MM line carrying the 1.7-kb fragment with the mutated
MEF2 binding site. This line is the one with the highest expression. In
parallel, the
-galactosidase expression of the wild type PM 1.7 lines is shown. Larvae were stained for 2.5 h, and adults
were stained overnight. Asterisk, IFM; arrow,
TDT. C, X-gal staining of third instar larvae and
thin sections of abdomens and thoraces of the E2M, 3EM, and 1/3EM lines
carrying the 1.7-kb fragment with the distinct mutated E boxes.
Comparison of
-galactosidase gene expression driven by sequences
upstream from the start site of the PM transcription unit with and
without mutations in the MEF-2 site or the E boxes
means a level of staining in between + and
++.

View larger version (32K):
[in a new window]
Fig. 5.
Coexpression of the
-galactosidase and GFP genes under the control of
the PM and mPM promoters. A, constructs inserted in the
pCasper 4 plasmid. B, X-gal staining of third instar larvae
and thin sections of abdomens and thoraces of the LG and LGI lines. LGD
lines showed a similar pattern of
-galactosidase expression.
C, in situ hybridization of thin sections of
thoraces of the LGI, LGD, and mPGFP lines with a GFP riboprobe. LG
lines showed a similar pattern of GFP hybridization. yw
flies were used as a control. Asterisk, IFM;
arrow, TDT.
Comparison of
-galactosidase and GFP expression patterns under the
control of the PM (4 kb) and mPM (2.7 kb) promoters
indicate the presence or absence of
staining.
-galactosidase at high levels with the same pattern as the PM endogenous protein, except in the IFM.
On the other hand, they express GFP at high levels in all muscles as
the mPM endogenous protein, except for the TDT.

View larger version (60K):
[in a new window]
Fig. 6.
Northern blot analysis of the transgenic LG,
LGD, LGI, PM4i, and mPGFP lines. Total RNAs from late pupae of the
LG, LGD, LGI, PM4i, and mPGFP lines were purified, and Northern blot
analysis was carried out with LacZ and GFP probes
(upper panel). No cross-hybridization between the distinct
bands is observed. The lower portion of the figure depicts
the composition and size of each detected band. In the LGI lines an
additional band of unknown composition appears (4).
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-galactosidase staining was detected, it was
not possible to verify that the transcription is muscle-specific.
However, the expression detected by reverse transcriptase-PCR, along
with the evolutionarily conserved sequences present in these regions (12), suggests that they contain binding sites for the basal transcriptional machinery. Temporal and spatial transgene expression patterns in both promoters depend on regions located between
0.9 and
1.7 kb of the PM and mPM initiation sites, except for IFMs in the
case of PM and larval muscles in the case of mPM.
-galactosidase with
patterns similar to endogenous PM, indicating that these sites are
important for muscle transgene activity. Moreover, transgene expression
is not completely abolished until the region containing the PDP1 sites
is eliminated (compare PM 1.4 and PM 0.9 lines). Our results indicate
that these and/or other sites present in this region may play a role in
muscle transgene activity.
1.6 kb deregulates mPM
expression in the thorax. In mP 2.7 lines we did not detect staining in
TDT muscles, but IFM staining was very strong (Fig. 3). The fact that
these sequences contain other exons and introns of the gene may yield
an artifactual effect in the transgene.
1400 bp upstream of the start site,
for proper paramyosin expression. The MEF2-E region seems to act as a
distal muscle activator enhancer that differentially regulates PM
expression in embryonic/larval and adult muscles. The region is
essential for the high expression in larval muscles. In adults,
however, deletion results in misexpression in the IFM and a decrease of
PM expression in all muscles.

View larger version (20K):
[in a new window]
Fig. 7.
Possible models for the PM regulation by the
MEF-E region. A, two possible models of how the MEF2-E
region may participate in the regulation of the PM expression. On
top, direct interaction between an MEF2 regulatory complex
containing MEF2 and bHLH factors bound to their DNA binding sites and
an unknown DNA binding element is required to fully activate
transcription in Drosophila muscles. Alternatively, this
unknown element would independently control PM expression in IFMs. In
larvae, only the requirement of the MEF2 site seems to be essential for
proper expression. B, the absence of the MEF2 site, the E
boxes (MM and 3EM lines), or the whole MEF-E region (PM 1.4 lines)
prevents the whole activator complex from being formed. This complex is
shown on top (PM1.7 lines).
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES

To whom correspondence should be addressed. Tel.:
34-91-397-5402; Fax: 34-91-585-4587; E-mail:
margarita.cervera@uam.es.
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Bandman, E.
(1992)
Dev. Biol.
154,
273-283
2.
Black, B. L.,
and Olson, E, N.
(1998)
Annu. Rev. Cell Dev. Biol.
14,
167-196
3.
Ludolph, D. C.,
and Konieczny, S. F.
(1995)
FASEB. J.
9,
1595-1604
4.
Molkentin, J. D.,
Black, B. L.,
Martin, J. F.,
and Olson, E. N.
(1995)
Cell
83,
1125-1136
5.
Edmondson, D. G.,
Lyons, G. E.,
Martin, J. F.,
and Olson, E. N.
(1994)
Development
120,
1251-1263
6.
Lilly, B.,
Galewsky, S.,
Firulli, A. B.,
Schulz, R.,
and Olson, E. N.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
5662-5666
7.
Nguyen, H. T.,
Bodmer, R.,
Abmayr, S. M.,
McDermott, J. C.,
and Spoerel, N. A.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
7520-7524
8.
Bour, B. A.,
O'Brien, M. A.,
Lockwood, W. L.,
Goldstein, E. S.,
Bodmer, R.,
Taghert, P. H.,
Abmayr, S. M.,
and Nguyen, H. T.
(1995)
Genes Dev.
9,
730-741
9.
Lilly, B.,
Zhao, B.,
Ranganayakulu, G.,
Paterson, B. M.,
Schulz, R.,
and Olson, E. N.
(1995)
Science
267,
688-693
10.
Scott, M. P.
(1994)
Cell
79,
1121-1124
11.
Becker, K. D.,
O'Donnell, P. T.,
Heitz, J. M.,
Vito, M.,
and Bernstein, S. I.
(1992)
J. Cell Biol.
116,
669-681
12.
Maroto, M.,
Arredondo, J. J.,
San Roman, M.,
Marco, R.,
and Cervera, M.
(1995)
J. Biol. Chem.
270,
4375-4382
13.
Maroto, M.,
Arredondo, J. J.,
Goulding, D.,
Marco, R.,
Bullard, B.,
and Cervera, M.
(1996)
J. Cell Biol.
134,
81-92
14.
Bernstein, S. I,
O'Donnell, P. T.,
and Cripps, R. M.
(1993)
Int. Rev. Cytol.
143,
63-152
15.
Baylies, M. K.,
Bate, M.,
and Gomez, M.
(1998)
Cell
93,
921-927
16.
Bate, M.
(1990)
Development
110,
791-804
17.
Taylor, M. V.,
Beatty, K. E.,
Hunter, H. K.,
and Baylies, M. K.
(1995)
Mech. Dev.
50,
29-40
18.
Thisse, B.,
Stoetzel, C.,
Gorostiza-Thisse, C.,
and Perrin-Schmitt, F.
(1988)
EMBO J.
7,
2175-2183
19.
Bate, M.,
Rushton, E.,
and Currie, D. A.
(1991)
Development
110,
79-89
20.
Cripps, R. M.,
Black, B. L.,
Zhao, B.,
Lien, C.-L.,
Schulz, R. A.,
and Olson, E. N.
(1998)
Genes Dev.
12,
422-434
21.
Currie, D. A.,
and Bate, M.
(1991)
Development
113,
91-102
22.
Fernandes, J.,
Bate, M.,
and Vijayraghavan, K.
(1991)
Development
113,
67-77
23.
Azpiazu, N.,
and Frasch, M.
(1993)
Genes Dev.
7,
1325-1340
24.
Bodmer, R.
(1993)
Development
118,
719-729
25.
Borkowski, O. M.,
Brown, N. H.,
and Bate, M.
(1995)
Development
121,
4183-4193
26.
Abmayr, S. M.,
and Keller, C. A.
(1998)
Curr. Top. Dev. Biol.
38,
35-80
27.
Michelson, A. M.,
Abmayr, S. M.,
Bate, M.,
Arias, A. M.,
and Maniatis, T.
(1990)
Genes Dev.
4,
2086-2097
28.
Paterson, B.,
Walldorf, U.,
Eldridge, J.,
Dubendorfer, A.,
Frasch, M.,
and Gehring, W.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
88,
3782-3786
29.
Gogos, J. A.,
Hsu, T.,
Bolton, J.,
and Kafatos, F. C.
(1992)
Science
25,
1951-1955
30.
Lin, S. C.,
Lin, M.-H.,
Horvath, P.,
Reddy, K. L.,
and Storti, R. V.
(1997)
Development
124,
4685-4796
31.
Reddy, K. L.,
Wohlwill, A.,
Dzitoeva, S.,
Lin, M.-H.,
Holbrook, S.,
and Storti, R. V.
(2000)
Dev. Biol.
224,
401-414
32.
Sanger, F.,
Nicklen, S.,
and Coulson, A. R.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
5463-5467
33.
Thummel, C. S.,
Boulet, A. M.,
and Lipshitz, H. D.
(1988)
Gene
71,
445-456
34.
Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J.
(eds)
(1990)
PCR Protocols: A Guide to Methods and Applications
, pp. 177-183, Academic Press, San Diego, CA
35.
Spradling, A. C.,
and Rubin, G. M.
(1982)
Science
218,
341-345
36.
Ashburner, M.
(1989)
Drosophila: A Laboratory Handbook and Manual
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
37.
Meredith, J.,
and Storti, R. V.
(1993)
Dev. Biol.
159,
500-512
38.
Newlands, S.,
Levitt, L. K.,
Robinson, C. S.,
Karpf, A. B. C.,
Hodgson, R. M.,
Wade, R. P.,
and Hardeman, E. C.
(1998)
Genes Dev.
12,
2748-2758
39.
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
40.
Devereux, J.,
Haeberli, P.,
and Smithies, O.
(1984)
Nucleic Acids Res.
12,
387-395
41.
Benoist, P.,
Mas, J. A.,
Marco, R.,
and Cervera, M.
(1998)
J. Biol. Chem.
273,
7538-7546
42.
Ranganayakulu, G.,
Zhao, B.,
Dokitis, A.,
Molkentin, J. D.,
Olson, E. N.,
and Schulz, R. A.
(1995)
Dev. Biol.
171,
169-181
43.
Lin, M.-H.,
Bour, B. A.,
Abmayr, S.,
and Storti, R. V.
(1997)
Dev. Biol.
182,
240-255
44.
Sparrow, D. B.,
Miska, E. A.,
Langley, E.,
Reynaud-Deonauth, S.,
Kotecha, S.,
Towers, N.,
Spohr, G.,
Kouzarides, T.,
and Mohun, T.
(1999)
EMBO J.
18,
5085-5098
45.
Lin, M.-H.,
Nguyen, H. T.,
Dybala, C.,
and Storti, R. V.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
4623-4628
46.
Lin, S.-H.,
and Storti, R. V.
(1997)
Dev. Genet.
20,
297-306
47.
Hess, N.,
Kronert, W. A.,
and Bernstein, S. I.
(1989)
in
Cellular and Molecular Biology of Muscle Development
(Kedes, L.
, and Stockdale, F., eds)
, pp. 621-631, A. R. Liss, New York
48.
Standiford, D. M.,
Davis, M. B.,
Miedema, K.,
Franzini-Armstrong, C.,
and Emerson, C. P., Jr.
(1997)
J. Mol. Biol.
265,
40-55
49.
Geyer, P. K.,
and Fyrberg, E. A.
(1986)
Mol. Cell. Biol.
6,
3388-3396
50.
Gremke, L.,
Lord, P. C.,
Sabacan, L.,
Lin, S.,
Wohlwill, A.,
and Storti, R. V.
(1993)
Dev. Biol.
159,
513-527
51.
Hanke, P. D.,
and Storti, R. V.
(1988)
Mol. Cell. Biol.
8,
3591-3602
52.
Karlik, C. C.,
and Fyrberg, E.
(1986)
Mol. Cell. Biol.
6,
1965-1973
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
K. K. K. Tanaka, A. L. Bryantsev, and R. M. Cripps Myocyte Enhancer Factor 2 and Chorion Factor 2 Collaborate in Activation of the Myogenic Program in Drosophila Mol. Cell. Biol., March 1, 2008; 28(5): 1616 - 1629. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Junion, T. Jagla, S. Duplant, R. Tapin, J.-P. Da Ponte, and K. Jagla Mapping Dmef2-binding regulatory modules by using a ChIP-enriched in silico targets approach PNAS, December 20, 2005; 102(51): 18479 - 18484. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. W. Baker, K. K. K. Tanaka, N. Klitgord, and R. M. Cripps Adult Myogenesis in Drosophila melanogaster Can Proceed Independently of Myocyte Enhancer Factor-2 Genetics, August 1, 2005; 170(4): 1747 - 1759. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Hooper and J. B. Thuma Invertebrate Muscles: Muscle Specific Genes and Proteins Physiol Rev, July 1, 2005; 85(3): 1001 - 1060. |