![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 11, 8608-8615, March 16, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From
Received for publication, October 24, 2000, and in revised form, November 27, 2000
P2Y receptors are a class of G protein-coupled
receptors activated primarily by ATP, UTP, and UDP. Five
mammalian P2Y receptors have been cloned so far including P2Y1, P2Y2,
P2Y4, P2Y6, and P2Y11. P2Y1, P2Y2, and P2Y6 couple to the activation of
phospholipase C, whereas P2Y4 and P2Y11 couple to the activation of
both phospholipase C and the adenylyl cyclase pathways. Additional ADP
receptors linked to G Purine and pyrimidine nucleotides are known to modulate a variety
of physiological functions by interaction with two types of cell
surface receptors: P2X and P2Y receptors (1, 2). P2X receptors are
ligand-gated ion-channels, whereas P2Y receptors are G protein-coupled
receptors (GPCRs).1 Five
mammalian P2Y receptors have been cloned so far including P2Y1, P2Y2,
P2Y4, P2Y6, and P2Y11 (2, 3). All of these receptors share high degree
of sequence homology with each other. P2Y1, P2Y2, and P2Y6 couple to
the activation of phospholipase C (PLC), whereas P2Y4 and P2Y11 couple
to the activation of both PLC and the adenylyl cyclase pathways. P2Y1,
P2Y2, and P2Y11 are selectively activated by ATP, whereas P2Y6 is
selectively activated by UDP, and P2Y4 can be selectively activated by
both ATP and UTP (1-3). Additionally, receptors for ADP have been
identified in rat C6 glioma cells and human blood platelets, but these
have not been cloned yet (4-6). In C6 cells ADP causes inhibition of
adenylyl cyclase, whereas in platelets ADP appears to cause both
inhibition of cAMP and activation of PLC (4-6).
SP1999 is an orphan G protein-coupled receptor cloned from a human
hypothalamus cDNA library (7). Phylogenetic analysis shows that
SP1999 shares homology with a group of G protein-coupled receptors,
most of which are orphans as well. Its closest known receptors are the
recently identified UDP-glucose receptor and the platelet-activating
factor receptor (8, 9). In contrast, SP1999 shares little
homology with the known P2Y receptors. Nevertheless, the present study
demonstrates that SP1999 is a G Reagents and Materials--
All nucleotides were obtained from
either Sigma or RBI. [3H]Adenine (20-40 Ci/mmol, 1 mCi/ml) was from PerkinElmer Life Sciences. Fluo-3-AM and
pluronic acid were from Molecular Probes. Cell culture media and
reagents were from Life Technologies, Inc. All cloning work was
performed according to standard procedures. Scintillation mixture
(Ready SafeTM) for aqueous sample was obtained from Beckman
Coulter. Human chimeric G Cloning and Expression of SP1999--
Full-length cDNA of
SP1999 was first cloned by Human Genome Sciences Inc. from a human
hypothalamus cDNA library. The sequence was disclosed as EBI-2
receptor in patent WO 98/50549. To avoid confusion with EBI-2 cloned
previously (12), we have designated the clone as SP1999. The open
reading frame of SP1999 was subcloned into the pcDNA3.1 expression
vector (Invitrogen). SP1999 was then transfected into
CHO-DHFR Dot Blot and in Situ Hybridization--
To determine the
distribution of SP1999 in human tissues, vector primers (T3/T7) were
used to amplify a 1.3-kilobase insert from SP1999 plasmid DNA, which
was then gel-purified. The purified amplicon was random-prime labeled
(Prime-It II, Stratagene) with [32P]dCTP and hybridized
overnight at 65 °C with either multiple tissue Northern blots or RNA
Master blots (both from CLONTECH). For the RNA
Master blots, the hybridization buffer (Express-Hyb, CLONTECH) contained 0.1 mg/ml sheared salmon sperm
DNA (Life Technologies, Inc.), 6 µg/ml human Cot-1 DNA,
and 2 × 107 cpm of probe. Only the probe was added to
the Express-Hyb for hybridization with the Northern blots. The
following day, the blots were washed with increasing stringency
according to the manufacturer's protocol, wrapped in Saran Wrap, and
exposed to Kodak Biomax MS film for 24-72 h at-70 °C. The films
were analyzed for semi-quantitative autoradiography using the M4/MCID
image analysis package (Imaging Research).
RT-PCR in Human Blood Platelets--
Total RNA was isolated from
washed human platelets using Qiagen RNeasy Mini Kit. First strand
complementary DNA (cDNA) was synthesized utilizing a random hexamer
primer using Superscript (Life Technologies, Inc.). RT-PCR with
gene-specific primers was performed using Hi-Fidelity Supermix (Life
Technologies, Inc.). To rule out the presence of contaminating
leukocyte RNA, primers for Cell Transfection--
For ligand purification assays, 5 µg of
SP1999/pCDNA3.1 and a mixture of chimeric G proteins (0.5 µg for
each chimera) were cotransfected in CHO-DHFR FLIPR Assay--
The transiently transfected cells or stable
cell lines were seeded into 96-well plates (black well, clear bottom)
and incubated in a tissue culture incubator at 37 °C overnight. The
growth medium was then aspirated and replaced with 100 µl of loading
medium (Dulbecco's modified Eagle's medium containing 1% fetal
bovine serum, 1 mM Fluo-3-AM plus 10% pluronic acid, and
2.5 mM probenecid) and incubated for 1 h at 37 °C.
The cells were subsequently washed three times with Hank's balanced
salt solution containing 20 mM HEPES, 2.5 mM
probenecid, and 0.1% bovine serum albumin using a Denley cell washer
(Denley Instruments). 100 µl of wash buffer was left in each well.
The washed cells were placed in a fluorometric imaging plate reader
(FLIPR), and changes in cellular fluorescence were recorded after the
addition of 50-µl tissue extract fractions or testing compounds
diluted in wash buffer.
Purification of SP1999 Ligand--
Rat spinal cords (100 g) from
Pel-Freez were added to 1000 ml of boiling water with a protease
inhibitor mixture (from Roche Molecular Biochemicals). The
tissue was boiled for 5 min, homogenized by blender for 5 min, and then
re-boiled for 15 min. Finally acetic acid was added to a final
concentration of 0.5 M and allowed to incubate at 4 °C
overnight with constant stirring. Insoluble material was removed by
centrifugation at 15,000 × g for 30 min, and the supernatant was lyophilized. The lyophilized sample was dissolved in 30 ml of 0.1% trifluoroacetic acid and filtered through a
0.22-µm filter before loading onto a reverse phase C18 column (Vydac
C18, 218TP510). Elution was at 5 ml/min with 1.5 column volume (CV) of
buffer A (0.1% trifluoroacetic acid in H2O) followed by a
linear gradient of buffer A to buffer B (0.1% trifluoroacetic acid in 50% acetonitrile) during a period of 6 CV. Fractions (5 ml) were collected and lyophilized, then dissolved in 1 ml of buffer A. 25 µl
was used for screening by FLIPR assay in transiently transfected CHO-DHFR Mass Spectrum--
Negative ion electrospray ionization mass
spectrometry coupled with high performance liquid chromatography (HPLC)
was applied to analyze the ligand of SP1999. Reverse phase HPLC was
carried out on an Alliance 2690 HPLC system (Waters, Milford, MA). The sample was loaded onto a Jupiter C18 column (2.1 mm (inner
diameter) × 50 mm, 5 µm, 300 Å) and eluted with an isocratic
gradient of acetonitrile with 0.1% ammonium hydroxide. The entire
column effluent (0.15 ml/min) was delivered to the mass spectrometer
without flow split. The mass spectra were recorded on a Micromass
Quattro LC triple quadruple mass spectrometer (Manchester, United
Kingdom), which was operated under unit mass resolution conditions
across the mass range of interest. Full-scan mass spectra covering
m/z of 100-1000 were acquired with a scan time of 1.75 s. To confirm the structural information, electrospray ionization mass
spectrometry/mass spectrometry experiments were also performed on
selected ions. The 30-eV collision energy was applied for the
fragmentation study with the collision gas cell pressure at 3 × 10 cAMP Assay--
CHO-DHFR Cloning and Sequence Analysis--
The full-length cDNA of
SP1999 was first cloned by Human Genome Science Corp. and
disclosed in patent WO 98/50549 (Fig.
1A). It contains an 1029-base
open reading frame encoding 343 amino acid residues. There is an
in-frame stop codon in the 5'-untranslated region upstream of the ATG
initiation codon. The hydrophilicity profile of the deduced peptide
sequences revealed the presence of seven hydrophobic regions,
consistent with a seven-transmembrane structure typical of G
protein-coupled receptors (14, 15). The seven transmembrane domains are
underlined in Fig. 1A. Phylogenetic analysis
shows that SP1999 shares homology with a group of orphan G
protein-coupled receptors (Fig. 1B). Its closest known
receptors are UDP-glucose and platelet activating factor
receptors (8, 9). Notably, SP1999 shares relatively little homology
with known P2Y receptors (2).
Expression Profile of SP1999 in Human Tissues--
To determine
the distribution of SP1999 expression in human tissues, radiolabeled
DNA probes from SP1999 were hybridized to multiple tissue mRNA dot
blots (RNA Master Blot, CLONTECH) as shown in Fig.
2A. The RNA Master blot
contains a variety of human tissues including different regions of
brain, heart, spleen, lung, etc. As shown in Fig. 2A,
hybridization of the SP1999 probe showed very strong signals in all
brain regions and spinal cord as well as in fetal brain. The most
intense signals were from substantia nigra, putamen, thalamus, and
temporal cortex. In addition, weak signals can be observed in the lung,
appendix, pituitary, and adrenal gland. The brain distribution of
SP1999 was further demonstrated by Northern blot of mRNA from
multiple regions of human brain (Fig. 2B). The Northern blot
showed a predominant 3.2-kilobase band across all brain regions with a
minor 2.4-kilobase band in some brain regions such as cortex and
medulla. To detect the expression of SP1999 in human blood platelets,
RT-PCR experiments were performed (Fig. 2C). A specific
140-base pair product for SP1999 was amplified in cDNA from human
platelets but not in the cDNA from the human platelets without
reverse transcriptase and from human leukocyte, indicating that SP1999
is expressed in human blood platelets. Identification of the Ligand for SP1999--
To understand the
function of SP1999, we set out to identify its endogenous ligand;
SP1999 was cotransfected with a mixture of chimeric G protein plasmids
encoding G
As SP1999 was predominantly expressed in brain tissue and spinal
cord, spinal cord was used as raw material for purification. Rat spinal
cords (100 g) were extracted according to "Experimental Procedures," loaded onto a C18 column (Vydac C18, 218TP510), and gradient elution was performed. The chromatogram is shown in Fig. 3A. Each fraction was screened
for Ca2+ mobilization using CHO-DHFR Intracellular Signaling Pathway of SP1999--
To confirm the G
protein coupling specificity of SP1999, single chimeric G proteins were
cotransfected with SP1999 into NIH3T3 cells, and the response to 300 nM ADP was then measured by FLIPR. As shown in Fig.
5A, strong Ca2+
flux signals were observed for cells transfected with SP1999 and
G
The coupling between SP1999 and the G Pharmacology of SP1999--
The pharmacological profile of SP1999
was further characterized in both the FLIPR assay and the cAMP assay.
Using SP1999- and G The results of the present study clearly indicate that SP1999 is a
high affinity receptor for ADP, despite the fact that SP1999 does not
possess a particularly high degree of homology with the known
purinergic receptors. It is unlikely that the results presented here
are due to the unsuspected expression of a known purinergic receptor,
since the profile of activity observed exhibits several properties that
distinguish it from the previously cloned P2 purinergic receptors.
Notably, the responses presented exhibit a unique pharmacological and
second messenger profile and are only observed in conjunction with
expression of transfected SP1999. Although the previously cloned P2
receptors are all capable of coupling through G Despite the overall low sequence homology with the known nucleotide
receptors, SP1999 does contain several amino acid residues that are
conserved in the P2Y family, and which have previously been implicated
in nucleotide binding. Amino acids Phe-105, Tyr-106, Tyr-110, Phe-198,
His-253, Arg-256, and Ser-288 are identical to residues highly
conserved among the P2Y1, P2Y2, P2Y4, and P2Y6 receptors (16, 17).
Through the use of molecular modeling and site-directed mutagenesis,
these residues have been shown to be involved in the binding of
purinergic ligands to the P2Y1 receptor. Although several residues
found to be absolutely required for ligand interaction at the P2Y1
receptor (Arg-128 and Arg-310 in P2Y1) are not strictly conserved in
SP1999, it is highly possible that ligands bind to SP1999 in an
orientation different from P2Y1, allowing other residues present in
SP1999 to become involved in the binding site (16, 17). Further studies
involving molecular modeling and site-directed mutagenesis of SP1999
will be required to specifically define the ligand binding pocket of
this receptor. Nevertheless, the conserved nature of the residues
mentioned above supports the finding that ADP can act as a ligand at
this receptor.
ADP receptors have been identified in both C6 glioma cell lines and
blood platelets but have not been cloned (5, 6). In rat C6 glioma
cells, an ADP receptor has been described to couple to
G We thank Robert Henningsen, Qi Zhang, Gwen
Wong, Joeseph Hedrick, Wendy Feng, and T. M. Chan for technical assistance.
Note added in Proof *
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF321815.
§
To whom all correspondence should be addressed: K-15-1/1945,
Schering-Plough Research Inst., Kenilworth, NJ 07033. Tel.:
908-740-4704; Fax: 908-740-7101; E-mail:
fang.zhang@spcorp.com.
Published, JBC Papers in Press, December 4, 2000, DOI 10.1074/jbc.M009718200
The abbreviations used are:
GPCR, G
protein-coupled receptor;
PLC, phospholipase C;
FLIPR, fluorometric
image plate reader;
HPLC, high performance liquid chromatography;
ADP
ADP Is the Cognate Ligand for the Orphan G Protein-coupled
Receptor SP1999*
§,
,
,
,
,
,
,
,
, and
Human Genome Research, ¶ Central Nervous
System/Cardiovascular Research,
Structural Chemistry, and
** Immunology Research, Schering-Plough Research Institute,
Kenilworth, New Jersey 07033
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
i have been described but
have not yet been cloned. SP1999 is an orphan G protein-coupled
receptor, which is highly expressed in brain, spinal cord, and blood
platelets. In the present study, we demonstrate that SP1999 is a
G
i-coupled receptor that is potently activated by ADP.
In an effort to identify ligands for SP1999, fractionated rat spinal
cord extracts were assayed for Ca2+ mobilization activity
against Chinese hamster ovary cells transiently transfected with SP1999
and chimeric G
subunits (G
q/i). A substance that
selectively activated SP1999-transfected cells was identified and
purified through a series of chromatographic steps. Mass spectral analysis of the purified material definitively identified it as ADP.
ADP was subsequently shown to inhibit forskolin-stimulated adenylyl
cyclase activity through selective activation of SP1999 with an
EC50 of 60 nM. Other nucleotides were able to
activate SP1999 with a rank order of potency 2-MeS-ATP = 2-MeS-ADP > ADP = adenosine
5'-O-2-(thio)diphosphate > 2-Cl-ATP > adenosine
5'-O-(thiotriphosphate). Thus, SP1999 is a novel,
G
i-linked receptor for ADP.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
i-linked receptor that is
potently activated by ADP. Using a Ca2+ mobilization assay,
a substance was identified in fractionated rat spinal cord extracts
which specifically activated SP1999 when cotransfected with the
chimeric G protein (G
q/i) (10, 11). The substance was
purified to homogeneity and identified as ADP by mass spectrometry. ADP
was subsequently shown to inhibit forskolin-stimulated adenylyl cyclase
activity through selective activation of SP1999 with an
EC50 of 60 nM. Other nucleotides were able to
activate SP1999 with a rank order of potency 2-MeS-ATP = 2-MeS-ADP > ADP = ADP
S > ATP
S > 2-Cl-ATP.
Thus, SP1999 is a novel, G
i-linked receptor for ADP.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
proteins (G
q/z,
G
q/s, G
q/12, G
q/i,
G
q/i3, G
q/o, G
q/truncated)
were constructed by replacing the five C-terminal residues of human
G
q with the five amino acid residues of the corresponding human G protein except that, for
G
q/truncated, the C-terminal five residues of
G
q were deleted (11). All chimeric G proteins were
cloned into the mammalian expression vector pCR3.1 (Invitrogen).
or NIH3T3 cells using LipofectAMINE (Life
Technologies, Inc.). Stable cell lines were established by selection
under 1 mg/ml G418 (Life Technologies, Inc.) 24 h after transfection.
2-integrin, which is present
in leukocytes but not platelets, were used. Human leukocyte cDNA
from CLONTECH. Primer sets are as follows.
5'-Primer of SP1999 is ctgggcattcatgttcttactc, and 3'-primer of SP1999
is tgccagactagaccgaactct. 5'-Primer of CD2 is gctggctggacaacattgactggg,
and 3'-primer of CD2 is agggagggtgggggtgtgggatt. 5'-Primer of
2-integrin is tggcgcacaagctggctgaaaacaa, and 3'-primer of
2-integrin is accggcactcacactggggaagaa. 5'-
and 3'-primers of GHPDH were purchased from
CLONTECH.
cells in a
75-cm2 flask. As a negative control, the same amount of
empty pCDNA3.1 plasmid and the chimeric G protein mixture were
cotransfected into CHO-DHFR
cells. For pharmacological
studies, CHO-DHFR
or NIH3T3 cells stably transfected with
SP1999 were used in addition to transiently transfected cells as indicated.
cells. Two active peaks were identified in
fractions 19-23 and 30-35 and pooled together. The two peaks were
later shown to be identical (data not shown). The pool of fractions
30-35 was loaded onto a cation exchange column (SP8HR, Waters)
pre-equilibrated with buffer C (20 mM
Na3PO4, pH = 6.4). Elution was at 1 ml/min with a linear gradient of buffer C and 50% buffer D (20 mM
Na3PO4, 1 M NaCl, pH = 6.4) in
7.6 CV. 1.3-ml fractions were collected and screened by FLIPR assay in
CHO-DHFR
cells. Activity was identified in flow-through
fractions 5-12 and pooled. The pool was then loaded onto a
pre-equilibrated Mono Q column (10/10, Waters), and eluted at 2 ml/min
with a linear gradient of buffer C to 50% of buffer D in 7 CV,
followed by 50% of buffer D for additional 5 min. The activity was
identified in fractions 49-52 (1.3 ml/fraction) and pooled. The pool
was then diluted with water to reduce the salt concentration and loaded onto DEAE column (5 × 100, Waters). Elution was at 0.5 ml/min with a linear gradient of buffer C to 50% buffer D over a period of 8 CV. Activity was identified in fractions 37-43 (0.5 ml/fraction) and
pooled. The pool was then adjusted to 0.6% trifluoroacetic acid and
then loaded onto a C18 column (Vydac 218TP510). Elution was at 3 ml/min
with a linear gradient of buffer A to 20% buffer B over a period of 4 CV. The active fractions were identified in fractions 14-17 (1.3 ml/fraction) and pooled. The pool was then concentrated to 80 µl and
loaded onto a Superdex HR10/30 column (Amersham Pharmacia Biotech)
pre-equilibrated with Buffer A. Elution was at 0.5 ml/min with buffer
A. The activity was located in fractions 33-36 (0.5 ml/fraction).
Fractions 33-36 were then subjected to structural analysis.
4 millibars (argon).
cells stably transfected
with SP1999 were used for cAMP assay. The stable SP1999 cell line and
wild type cells were first grown in 12-well plates to 70-80%
confluence. The cells were then incubated for 2 h with 200 µl of
medium containing 5 µCi/ml [3H]adenine. Subsequently 50 µl of HEPES (250 mM, pH 7.5) containing 50 µM forskolin, 200 µM
isobutylmethylxanthine, and the substance to be tested was added to the
cells and incubated for 10 min at 37 °C. Incubations were terminated
by addition of 0.8 ml of 5% trichloroacetic acid (cold).
[3H]cAMP was purified using Dowex and alumina
chromatography and counted by scintillation counter as described
previously (13).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (38K):
[in a new window]
Fig. 1.
A, the cDNA sequence and deduced
amino acid sequence of SP1999. Numbers to the
left refer to amino acids, and numbers to the
right refer to nucleotides. Underlined amino acid
sequences represent predicted seven transmembrane domains. The
GenBankTM accession number for this sequence is AF321815.
B, phylogenetic analysis of SP1999. SP1999 is most closely
related to KIAA0001 (UDP-glucose receptor), H963, and GPR34 with
sequence identity of 43%, 32%, and 28%, respectively. SP1999 is more
distantly related to P2Y receptors.
2-Integrin was
used as a negative control here to exclude the possibility of
contaminating of human platelets by leukocytes, whereas CD2 and GHPDH
were used as positive control. Therefore, SP1999 is expressed in human
brain, spinal cord, and human blood platelets.

View larger version (59K):
[in a new window]
Fig. 2.
Expression of SP1999 in human tissues.
A, mRNA dot blot of SP1999. The human mRNA Master
Blot from CLONTECH was hybridized to
32P-radiolabeled probe of SP1999 (see "Experimental
Procedures"). The panel is the autoradiogram of the hybridized blot.
B, Northern blot of SP1999. mRNA from different brain
regions was analyzed by Northern blot hybridization. The
numbers to the left indicate RNA size markers (in
kilobases). C, expression of SP1999 in human platelets.
RT-PCR were performed according to "Experimental Procedures" using
specific primers for each gene of SP1999, CD-2,
2-integrin, and GHPDH. Primer sets are as follows:
lane 1, SP1999; lane 2, CD-2;
lane 3,
2-integrin;
lane 4, GHPDH. +RT means that the
cDNA was synthesized in the presence of reverse transcriptase.
RT means that the cDNA was synthesized in the absence
of reverse transcriptase, which was used as a control to exclude the
contamination of genomic DNA.
q/12, G
16, G
q/i,
G
q/z, G
q/i3, G
q/s,
G
q
5, and G
q/o to
CHO-DHFR
, whereas empty pCDNA-3.1 was cotransfected
with chimeric G protein mixture as negative control. Each G protein
chimera used here is a G
q subunit with its five
C-terminal residues substituted by the corresponding residues of other
G
subunits such as G
i except that, for
G
q
5, its five C-terminal residues was
deleted (10, 11).
cells
transfected with SP1999 and the chimeric G proteins using the FLIPR
assay. Using different dilutions of the fractions, it was possible to
identify regions exhibiting activity only in the SP1999-transfected
cells (Fig. 3A). Furthermore, this SP1999 specific activity
required the coexpression of chimeric G proteins. Two peaks (fractions
19-23 and fractions 30-35) were identified that activated SP1999
specifically. These two peaks were later shown to be identical (data
not shown). Subsequent experiments using chimeric G proteins
transfected individually with SP1999 indicated that the
G
q/i3 chimera provided the most robust response (data
not shown). The pool of fractions 30-35 was subsequently purified
further by cation-exchange (SP8HR), anion exchange (Mono Q), anion
exchange (DEAE), reverse phase (C18 column), and size exclusion
(Superdex HR10/30). Fig. 3B shows the chromatogram of the
final size exclusion column. The purified sample (peak A) was first characterized by determination of its UV spectrum and by its
sensitivity to protease digestion and phosphatase digestion. The
purified substance was found to have the following properties. First,
it binds to an anion exchange column, indicating it has negative
charges; second, it has an absorption peak at 258 nm; finally, it
cannot be inactivated by protease K digestion but can be inactivated by
nucleotide phosphatase digestion (data not shown). These results
suggest that the purified substance is a small molecule and is likely
to be a nucleotide. The purified substance was then subjected to mass
spectrum analysis in negative ion mode. Three major peaks at 227.0, 249.0, and 426.1 m/z were detected (Fig. 3C). As
the data were acquired in negative ion mode, the molecular weight of
the substance analyzed should be 1 Da larger than that shown in the
spectrum. Further fragmentation of the ions suggest that the ion at
m/z 426.1 is consistent with the structure of 5'-ADP, the
ion at m/z 227.0 is a dimer of trifluoroacetic acid
(trifluoroacetic acid, formula weight = 114), and the
m/z 249.0 peak is an adduct of the trifluoroacetic acid
dimer and a sodium ion. Since the sample was purified by reverse phase
HPLC in the presence of trifluoroacetic acid, it is not surprising to
observe the adduct peaks at m/z 270.0 and 249.0 peaks.
Trifluoroacetic acid has been shown to be inactive at SP1999 (data not
shown); thus, 5'-ADP appears to be the active component in the sample. When commercially available 5'-ADP was compared with the purified sample, the activities were shown to be identical. Using the CHO cells
cotransfected with SP1999 and chimeric G
q/i3, the dose response to ADP was examined, and an EC50 of 330 nM was observed (Fig.
4A). However, ADP also caused
significant Ca2+ mobilization in pCDNA and
G
q/i3-transfected CHO cells, with an EC50 of
14 µM (Fig. 4A). The same Ca2+
mobilization response was also observed in untransfected, wild type CHO
cells (data not shown). To avoid the Ca2+ response to ADP
inherent in the CHO cells, the activity of ADP was tested on several
cell lines. It was found that NIH3T3 cells were devoid of endogenous
ADP responses in the FLIPR assay. However, when transiently transfected
with SP1999 and chimeric G
q/i3, ADP potently stimulated
Ca2+ mobilization with an EC50 of 74 nM (Fig. 4B). The discrepancy in the
EC50 values for ADP in the two cell lines is likely due to
the addition of the endogenous ADP response observed in the CHO
cells.

View larger version (17K):
[in a new window]
Fig. 3.
Purification of endogenous ligand for
SP1999. A, reverse-phase chromatography of crude
extracts from rat spinal cord. Acetonitrile gradient and absorbance of
eluted materials are indicated by dotted and
solid lines. Fractions were assayed using
CHO-DHFR
cells transfected with SP1999 and
G
q/i3 by FLIPR (see "Experimental Procedures");
regions of specific activity are indicated by bar.
B, size-exclusion chromatography. Active fractions from C18
chromatography (see "Experimental Procedures") were finally
purified by size-exclusion chromatography. Fractions were assayed as
described. All activity was contained in peak A. C, mass spectrum of the purfied material. The pooled
fractions of peak A from size-exclusion
chromatography were analyzed by electrospray ionization mass
spectrometry in negative mode. The individual molecular ion was further
analyzed by fragmentation using electrospray ionization mass
spectrometry/mass spectrometry and the suggested structures are shown
next to the ions.

View larger version (20K):
[in a new window]
Fig. 4.
ADP dose response. Dose-response curves
are from a representative experiment. A, ADP dose response
in CHO-DHFR
cells. SP1999 or the vector pCDNA3.1 was
cotransfected with chimeric G
q/i3 into
CHO-DHFR
, and Ca2+ mobilization of
transfected cells in response to increasing doses of ADP was measured
by FLIPR. B, ADP dose response in NIH3T3 cells. SP1999 or
the vector pCDNA3.1 was cotransfected with or without chimeric
G
q/i3 into NIH3T3 cells, and ADP dose response was
measured as described.
q/i, G
q/i3, or G
q/o,
while much weaker signals were observed for cells transfected with
SP1999 and all other chimeric G proteins. These results suggest that
SP1999 should normally couple to G
proteins of the
G
i/o class (10, 11).

View larger version (27K):
[in a new window]
Fig. 5.
Signal pathway of SP1999. Dose-response
curves are from a representative experiment. A, G protein
coupling of SP1999. SP1999 (5 µg) was transiently cotransfected to
NIH3T3 cells with 0.5 µg each of human chimeric G protein
G
q/i3, G
q/z, G
q/s,
G
16, G
q/12, G
q/i,
G
q/o, and G
q. The response to ADP (300 nM) was then measured by FLIPR.
indicates without
chimeric G protein. B, inhibition of cAMP by SP1999. SP1999
stably transfected CHO-DHFR
cells were first labeled with
5 µCi/ml [3H]adenine, then incubated with 50 µM forskolin and the indicated amount of ADP. The
[3H]cAMP generated was purified using Dowex and alumina
chromatography and quantitated by scintillation counter.
i/o proteins also
suggests that ADP should act to inhibit the activity of adenylyl
cyclase in SP1999-transfected cells (11, 15). To confirm this
prediction, a cAMP assay was performed using CHO-DHFR
cells stably transfected with SP1999. To measure cAMP, the cells were
first labeled with [3H]adenine, then the
[3H]cAMP generated after ADP stimulation was purified by
column chromatography and quantitated by scintillation spectrometry
(13). As shown in Fig. 5B, ADP caused a
dose-dependent decrease in forskolin-stimulated cAMP
accumulation in SP1999-transfected cells, but had no effect on
nontransfected cells. The EC50 of this response was 60.7 nM.
q/i3-cotransfected NIH3T3 cells, a
variety of nucleotides were screened by FLIPR assay. Fig.
6 shows the dose-response curves for ADP,
ADP
S, 2-MeS-ADP, and 2-MeS-ATP for SP1999 in this assay. Table
I lists the EC50 values for
all the compounds tested at SP1999. The rank order of potency is
2-MeS-ATP = 2-MeS-ADP > ADP=ADP
S > 2-Cl-ATP > ATP
S. Table II lists the nucleotides
that were not active at SP1999 at concentrations up to 8 µM or 1 mM. The nucleotides ATP, UTP, ITP,
and Ap4A exhibited activity in wild-type NIH3T3 cells, and with
EC50 value of about 15 µM. The ability of the compounds active at SP1999 to inhibit cAMP in SP1999-transfected CHO
cells was also examined. With the exception of ATP
S, the rank order
of EC50 values is comparable to those determined using the
FLIPR assay. Three compounds were also identified that were able to
antagonize the activity of ADP at SP1999: reactive blue-2, suramin, and
2',5'-ADP. The Ki for reactive blue-2, suramin, and
2',5'-ADP in the presence of 200 nM ADP were 1.3, 3.6, and 10 µM, respectively. Reactive blue-2 and suramin have
been shown to be nonselective antagonists for P2Y receptors (2).

View larger version (18K):
[in a new window]
Fig. 6.
Dose response of ADP,
ADP
s, 2-MeS-ADP, and 2-MeS-ATP for
SP1999. Dose-response curves are from a representative experiment.
SP1999 (5 µg) and G
q/i3 (0.5 µg) were cotransfected
into NIH3T3 cells; Ca2+ mobilization in response to the
increasing concentrations of compound was measured by FLIPR
assay.
Potency of SP1999 Ligands
q/i3-cotransfected NIH3T3 cells, and cAMP assays were
performed using SP1999 stably transfected CHO-DHFR
cells as
described under "Experimental Procedures." The dose response of
each compound was fitted by Prism software, and the EC50 value
was obtained. The values represent mean ± S.D. with
n = 3.
Nucleotides inactive at SP1999
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
q to activation of phospholipase C and Ca2+ mobilization, SP1999
couples only to the G
i class of G proteins to inhibit
adenylyl-cyclase activity. In NIH3T3 cells, Ca2+
mobilization in response to ADP is only observed when the cells are
transfected with both SP1999 and a chimeric G protein of the G
q/i,o class (G
q/i,
i3, or o). Pharmacologically, SP1999 differs from the P2Y2, P2Y4, P2Y6, and P2Y11 receptors in that ADP is the most
potent of the naturally occurring nucleotides examined, whereas the
most potent nucleotides for P2Y2, P2Y4, P2Y6, and P2Y11 receptors are
ATP, UTP, or UDP (2). Although ADP is also the most potent of the
naturally occurring nucleotides at the P2Y1 receptor, P2Y1 couples to
G
q while SP1999 couples to G
i. Although
we currently cannot rule out an interaction of ATP, UTP, ITP, or Ap4A
at SP1999 (UDP was found to be inactive), these interactions must be of
low affinity (EC50 > 10 µM) as their
background EC50 values in NIH3T3 cells are larger than 10 µM.
i. The order of its agonist potency was 2-MeSATP > = 2-MeS-ADP > ADP
S > 2-Cl-ATP = ADP = ATP
S > ATP > UTP (6), which was very similar to that of
SP1999. There are also two different G protein-coupled ADP receptors
identified in blood platelets. One ADP receptor, P2TAC,
couples to the inhibition of adenylyl cyclase; another ADP receptor,
P2Y1, couples to mobilization of intracellular calcium stores through
inositol phosphate production (5). Since SP1999 couples to the
inhibition of adenylyl cyclase and the pharmacological profiles between
SP1999 and P2TAC are also very similar and, moreover,
SP1999 mRNA was found in platelets, SP1999 may also be a candidate
for the uncloned P2TAC receptors. However, to confirm
whether SP1999 is the ADP receptor identified in C6 cells or blood
platelets, further experiments must be done.
![]()
ACKNOWLEDGEMENTS
While this paper was in press, G. Hollopeter et al. published a paper (Hollopeter, G.,
Jantzen, H.-M., Vincent, D., Li, G., England, L., Ramakrishnan, V.,
Yang, R.-B., Nurden, P., Julius, D., and Conley, P. B. (2001)
Nature 409, 202-207). The receptor P2Y12 in the
paper is identical to SP1999.
![]()
FOOTNOTES
![]()
ABBREVIATIONS
S, adenosine 5'-O-2-(thio)diphosphate;
ATP
S, adenosine 5'-O-(thiotriphosphate);
AMP-PCP, adenosine
5'-(
,
-methylenetriphosphate);
CHO, Chinese hamster ovary;
DHFR, dihydrofolate reductase;
RT, reverse transcription;
PCR, polymerase
chain reaction;
CV, column volume;
GHPDH, glycerol-3-phosphate
dehydrolase.
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Harden, T. K.,
Boyer, J. L.,
and Nicholas, R. A.
(1995)
Annu. Rev. Pharmacol. Toxicol.
35,
541-579
2.
Ralevic, V.,
and Burnstock, G.
(1998)
Pharmacol. Rev.
50,
413-492
3.
Burnstock, G.
(1997)
Neuropharmacology
36,
1127-1139
4.
Hechler, B.,
Eckly, A.,
Ohlmann, P.,
Cazenave, J. P.,
and Gachet, C.
(1998)
Br. J. Haematol.
103,
858-866
5.
Daniel, J. L.,
Dangelmaier, C.,
Jin, J.,
Ashby, B.,
Smith, J. B.,
and Kunapuli, S. P.
(1998)
J. Biol. Chem.
273,
2024-2029
6.
Boyer, J. L.,
Lazarowski, E. R.,
Chen, X. H.,
and Harden, T. K.
(1993)
J. Pharmacol. Exp. Ther.
267,
1140-1146
7.
Wilson, S.,
Bergsma, D. J.,
Chambers, J. K.,
Muir, A. I.,
Fantom, K. G.,
Ellis, C.,
Murdock, P. R.,
Herrity, N. C.,
and Stadel, J. M.
(1998)
Br. J. Pharmacol.
125,
1387-1392
8.
Chao, W.,
and Olson, M. S.
(1993)
Biochem. J.
292,
617-629
9.
Chambers, J. K.,
Macdonald, L. E.,
Sarau, H. M.,
Ames, R. S.,
Freeman, K.,
Foley, J. J.,
Zhu, Y.,
McLaughlin, M. M.,
Murdock, P.,
McMillan, L.,
Trill, J.,
Swift, A.,
Aiyar, N.,
Taylor, P.,
Vawter, L.,
Naheed, S.,
Szekeres, P.,
Hervieu, G.,
Scott, C.,
Watson, J. M.,
Murphy, A. J.,
Duzic, E.,
Klein, C.,
Bergsma, D. J.,
Wilson, S.,
and Livi, G. P.
(2000)
J. Biol. Chem.
275,
10767-10771
10.
Saito, Y.,
Nothacker, H. P.,
Wang, Z.,
Lin, S. H.,
Leslie, F.,
and Civelli, O.
(1999)
Nature
400,
265-269
11.
Conklin, B. R.,
Farfel, Z.,
Lustig, K. D.,
Julius, D.,
and Bourne, H. R.
(1993)
Nature
363,
274-276
12.
Birkenbach, M.,
Josefsen, K.,
Yalamanchili, R.,
Lenoir, G.,
and Kieff, E.
(1993)
J. Virol.
67,
2209-2220
13.
Harden, T. K.,
Scheer, A. G.,
and Smith, M. M.
(1982)
Mol. Pharmacol.
21,
570-580
14.
Strader, C. D.,
Fong, T. M.,
Graziano, M. P.,
and Tota, M. R.
(1995)
FASEB J.
9,
745-754
15.
Gilman, A. G.
(1987)
Annu. Rev. Biochem.
56,
615-649
16.
Jiang, Q.,
Guo, D.,
Lee, B. X.,
Van Rhee, A. M.,
Kim, Y. C.,
Nicholas, R. A.,
Schachter, J. B.,
Harden, T. K.,
and Jacobson, K. A.
(1997)
Mol. Pharmacol.
52,
499-507
17.
Hoffmann, C.,
Moro, S.,
Nicholas, R. A.,
Harden, T. K.,
and Jacobson, K. A.
(1999)
J. Biol. Chem.
274,
14639-14647
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
A. I. Masyuk, S. A. Gradilone, J. M. Banales, B. Q. Huang, T. V. Masyuk, S.-O. Lee, P. L. Splinter, A. J. Stroope, and N. F. LaRusso Cholangiocyte primary cilia are chemosensory organelles that detect biliary nucleotides via P2Y12 purinergic receptors Am J Physiol Gastrointest Liver Physiol, October 1, 2008; 295(4): G725 - G734. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kim, A. Garcia, S. P. Jackson, and S. P. Kunapuli Insulin-like growth factor-1 regulates platelet activation through PI3-K{alpha} isoform Blood, December 15, 2007; 110(13): 4206 - 4213. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Abbracchio, G. Burnstock, J.-M. Boeynaems, E. A. Barnard, J. L. Boyer, C. Kennedy, G. E. Knight, M. Fumagalli, C. Gachet, K. A. Jacobson, et al. International Union of Pharmacology LVIII: Update on the P2Y G Protein-Coupled Nucleotide Receptors: From Molecular Mechanisms and Pathophysiology to Therapy Pharmacol. Rev., September 1, 2006; 58(3): 281 - 341. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Z. Ruan, L. A. Birder, Z. Xiang, B. Chopra, T. Buffington, C. Tai, J. R. Roppolo, W. C. de Groat, and G. Burnstock Expression of P2X and P2Y receptors in the intramural parasympathetic ganglia of the cat urinary bladder Am J Physiol Renal Physiol, May 1, 2006; 290(5): F1143 - F1152. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Arthur, S. Georgi, K. Akassoglou, and P. A. Insel Inhibition of apoptosis by P2Y2 receptor activation: novel pathways for neuronal survival. J. Neurosci., April 5, 2006; 26(14): 3798 - 3804. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Ding, S. Kim, and S. P. Kunapuli Identification of a Potent Inverse Agonist at a Constitutively Active Mutant of Human P2Y12 Receptor Mol. Pharmacol., January 1, 2006; 69(1): 338 - 345. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-Z. Ruan, L. A. Birder, W. C. de Groat, C. Tai, J. Roppolo, C. A. Buffington, and G. Burnstock Localization of P2X and P2Y Receptors in Dorsal Root Ganglia of the Cat J. Histochem. Cytochem., October 1, 2005; 53(10): 1273 - 1282. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Frelinger III and A. D. Michelson Clopidogrel: Linking Evaluation of Platelet Response Variability to Mechanism of Action J. Am. Coll. Cardiol., August 16, 2005; 46(4): 646 - 647. [Full Text] [PDF] |
||||
![]() |
Z. Ding, F. Tuluc, K. R. Bandivadekar, L. Zhang, J. Jin, and S. P. Kunapuli Arg333 and Arg334 in the COOH terminus of the human P2Y1 receptor are crucial for Gq coupling Am J Physiol Cell Physiol, March 1, 2005; 288(3): C559 - C567. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Dixon, J. F. Hall, T. E. Webb, and M. R. Boarder Regulation of Rat Hepatocyte Function by P2Y Receptors: Focus on Control of Glycogen Phosphorylase and Cyclic AMP by 2-Methylthioadenosine 5'-Diphosphate J. Pharmacol. Exp. Ther., October 1, 2004; 311(1): 334 - 341. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-K. Wihlborg, L. Wang, O. O. Braun, A. Eyjolfsson, R. Gustafsson, T. Gudbjartsson, and D. Erlinge ADP Receptor P2Y12 Is Expressed in Vascular Smooth Muscle Cells and Stimulates Contraction in Human Blood Vessels Arterioscler. Thromb. Vasc. Biol., October 1, 2004; 24(10): 1810 - 1815. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Herold, A.-D. Qi, T. K. Harden, and R. A. Nicholas Agonist Versus Antagonist Action of ATP at the P2Y4 Receptor Is Determined by the Second Extracellular Loop J. Biol. Chem., March 19, 2004; 279(12): 11456 - 11464. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. T. Bodor, G. L. Waldo, S. B. Hooks, J. Corbitt, J. L. Boyer, and T. K. Harden Purification and Functional Reconstitution of the Human P2Y12 Receptor Mol. Pharmacol., November 1, 2003; 64(5): 1210 - 1216. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Fontana, A. Dupont, S. Gandrille, C. Bachelot-Loza, J.-L. Reny, M. Aiach, and P. Gaussem Adenosine Diphosphate-Induced Platelet Aggregation Is Associated With P2Y12 Gene Sequence Variations in Healthy Subjects Circulation, August 26, 2003; 108(8): 989 - 995. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Jiang, L. Luo, E. L. Gustafson, D. Yadav, M. Laverty, N. Murgolo, G. Vassileva, M. Zeng, T. M. Laz, J. Behan, et al. Identification and Characterization of a Novel RF-amide Peptide Ligand for Orphan G-protein-coupled Receptor SP9155 J. Biol. Chem., July 18, 2003; 278(30): 27652 - 27657. [Abstract] [Full Text] [PDF] |
||||
![]() |
|