JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M009718200 on December 4, 2000

J. Biol. Chem., Vol. 276, Issue 11, 8608-8615, March 16, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/11/8608    most recent
M009718200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, F. L.
Right arrow Articles by Monsma, F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, F. L.
Right arrow Articles by Monsma, F. J., Jr.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

ADP Is the Cognate Ligand for the Orphan G Protein-coupled Receptor SP1999*

Fang L. ZhangDagger §, Lin LuoDagger , Eric GustafsonDagger , Jean Lachowicz, Michelle Smith, Xudong QiaoDagger , Yan-Hui Liu||, Guodong Chen||, Birendra Pramanik||, Thomas M. LazDagger , Kyle Palmer**, Marvin BayneDagger , and Frederick J. Monsma Jr.Dagger

From Dagger  Human Genome Research,  Central Nervous System/Cardiovascular Research, || Structural Chemistry, and ** Immunology Research, Schering-Plough Research Institute, Kenilworth, New Jersey 07033

Received for publication, October 24, 2000, and in revised form, November 27, 2000



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

P2Y receptors are a class of G protein-coupled receptors activated primarily by ATP, UTP, and UDP. Five mammalian P2Y receptors have been cloned so far including P2Y1, P2Y2, P2Y4, P2Y6, and P2Y11. P2Y1, P2Y2, and P2Y6 couple to the activation of phospholipase C, whereas P2Y4 and P2Y11 couple to the activation of both phospholipase C and the adenylyl cyclase pathways. Additional ADP receptors linked to Galpha i have been described but have not yet been cloned. SP1999 is an orphan G protein-coupled receptor, which is highly expressed in brain, spinal cord, and blood platelets. In the present study, we demonstrate that SP1999 is a Galpha i-coupled receptor that is potently activated by ADP. In an effort to identify ligands for SP1999, fractionated rat spinal cord extracts were assayed for Ca2+ mobilization activity against Chinese hamster ovary cells transiently transfected with SP1999 and chimeric Galpha subunits (Galpha q/i). A substance that selectively activated SP1999-transfected cells was identified and purified through a series of chromatographic steps. Mass spectral analysis of the purified material definitively identified it as ADP. ADP was subsequently shown to inhibit forskolin-stimulated adenylyl cyclase activity through selective activation of SP1999 with an EC50 of 60 nM. Other nucleotides were able to activate SP1999 with a rank order of potency 2-MeS-ATP = 2-MeS-ADP > ADP = adenosine 5'-O-2-(thio)diphosphate > 2-Cl-ATP > adenosine 5'-O-(thiotriphosphate). Thus, SP1999 is a novel, Galpha i-linked receptor for ADP.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Purine and pyrimidine nucleotides are known to modulate a variety of physiological functions by interaction with two types of cell surface receptors: P2X and P2Y receptors (1, 2). P2X receptors are ligand-gated ion-channels, whereas P2Y receptors are G protein-coupled receptors (GPCRs).1 Five mammalian P2Y receptors have been cloned so far including P2Y1, P2Y2, P2Y4, P2Y6, and P2Y11 (2, 3). All of these receptors share high degree of sequence homology with each other. P2Y1, P2Y2, and P2Y6 couple to the activation of phospholipase C (PLC), whereas P2Y4 and P2Y11 couple to the activation of both PLC and the adenylyl cyclase pathways. P2Y1, P2Y2, and P2Y11 are selectively activated by ATP, whereas P2Y6 is selectively activated by UDP, and P2Y4 can be selectively activated by both ATP and UTP (1-3). Additionally, receptors for ADP have been identified in rat C6 glioma cells and human blood platelets, but these have not been cloned yet (4-6). In C6 cells ADP causes inhibition of adenylyl cyclase, whereas in platelets ADP appears to cause both inhibition of cAMP and activation of PLC (4-6).

SP1999 is an orphan G protein-coupled receptor cloned from a human hypothalamus cDNA library (7). Phylogenetic analysis shows that SP1999 shares homology with a group of G protein-coupled receptors, most of which are orphans as well. Its closest known receptors are the recently identified UDP-glucose receptor and the platelet-activating factor receptor (8, 9). In contrast, SP1999 shares little homology with the known P2Y receptors. Nevertheless, the present study demonstrates that SP1999 is a Galpha i-linked receptor that is potently activated by ADP. Using a Ca2+ mobilization assay, a substance was identified in fractionated rat spinal cord extracts which specifically activated SP1999 when cotransfected with the chimeric G protein (Galpha q/i) (10, 11). The substance was purified to homogeneity and identified as ADP by mass spectrometry. ADP was subsequently shown to inhibit forskolin-stimulated adenylyl cyclase activity through selective activation of SP1999 with an EC50 of 60 nM. Other nucleotides were able to activate SP1999 with a rank order of potency 2-MeS-ATP = 2-MeS-ADP > ADP = ADPbeta S > ATPgamma S > 2-Cl-ATP. Thus, SP1999 is a novel, Galpha i-linked receptor for ADP.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Reagents and Materials-- All nucleotides were obtained from either Sigma or RBI. [3H]Adenine (20-40 Ci/mmol, 1 mCi/ml) was from PerkinElmer Life Sciences. Fluo-3-AM and pluronic acid were from Molecular Probes. Cell culture media and reagents were from Life Technologies, Inc. All cloning work was performed according to standard procedures. Scintillation mixture (Ready SafeTM) for aqueous sample was obtained from Beckman Coulter. Human chimeric Galpha proteins (Galpha q/z, Galpha q/s, Galpha q/12, Galpha q/i, Galpha q/i3, Galpha q/o, Galpha q/truncated) were constructed by replacing the five C-terminal residues of human Galpha q with the five amino acid residues of the corresponding human G protein except that, for Galpha q/truncated, the C-terminal five residues of Galpha q were deleted (11). All chimeric G proteins were cloned into the mammalian expression vector pCR3.1 (Invitrogen).

Cloning and Expression of SP1999-- Full-length cDNA of SP1999 was first cloned by Human Genome Sciences Inc. from a human hypothalamus cDNA library. The sequence was disclosed as EBI-2 receptor in patent WO 98/50549. To avoid confusion with EBI-2 cloned previously (12), we have designated the clone as SP1999. The open reading frame of SP1999 was subcloned into the pcDNA3.1 expression vector (Invitrogen). SP1999 was then transfected into CHO-DHFR- or NIH3T3 cells using LipofectAMINE (Life Technologies, Inc.). Stable cell lines were established by selection under 1 mg/ml G418 (Life Technologies, Inc.) 24 h after transfection.

Dot Blot and in Situ Hybridization-- To determine the distribution of SP1999 in human tissues, vector primers (T3/T7) were used to amplify a 1.3-kilobase insert from SP1999 plasmid DNA, which was then gel-purified. The purified amplicon was random-prime labeled (Prime-It II, Stratagene) with [32P]dCTP and hybridized overnight at 65 °C with either multiple tissue Northern blots or RNA Master blots (both from CLONTECH). For the RNA Master blots, the hybridization buffer (Express-Hyb, CLONTECH) contained 0.1 mg/ml sheared salmon sperm DNA (Life Technologies, Inc.), 6 µg/ml human Cot-1 DNA, and 2 × 107 cpm of probe. Only the probe was added to the Express-Hyb for hybridization with the Northern blots. The following day, the blots were washed with increasing stringency according to the manufacturer's protocol, wrapped in Saran Wrap, and exposed to Kodak Biomax MS film for 24-72 h at-70 °C. The films were analyzed for semi-quantitative autoradiography using the M4/MCID image analysis package (Imaging Research).

RT-PCR in Human Blood Platelets-- Total RNA was isolated from washed human platelets using Qiagen RNeasy Mini Kit. First strand complementary DNA (cDNA) was synthesized utilizing a random hexamer primer using Superscript (Life Technologies, Inc.). RT-PCR with gene-specific primers was performed using Hi-Fidelity Supermix (Life Technologies, Inc.). To rule out the presence of contaminating leukocyte RNA, primers for beta 2-integrin, which is present in leukocytes but not platelets, were used. Human leukocyte cDNA from CLONTECH. Primer sets are as follows. 5'-Primer of SP1999 is ctgggcattcatgttcttactc, and 3'-primer of SP1999 is tgccagactagaccgaactct. 5'-Primer of CD2 is gctggctggacaacattgactggg, and 3'-primer of CD2 is agggagggtgggggtgtgggatt. 5'-Primer of beta 2-integrin is tggcgcacaagctggctgaaaacaa, and 3'-primer of beta 2-integrin is accggcactcacactggggaagaa. 5'- and 3'-primers of GHPDH were purchased from CLONTECH.

Cell Transfection-- For ligand purification assays, 5 µg of SP1999/pCDNA3.1 and a mixture of chimeric G proteins (0.5 µg for each chimera) were cotransfected in CHO-DHFR- cells in a 75-cm2 flask. As a negative control, the same amount of empty pCDNA3.1 plasmid and the chimeric G protein mixture were cotransfected into CHO-DHFR- cells. For pharmacological studies, CHO-DHFR- or NIH3T3 cells stably transfected with SP1999 were used in addition to transiently transfected cells as indicated.

FLIPR Assay-- The transiently transfected cells or stable cell lines were seeded into 96-well plates (black well, clear bottom) and incubated in a tissue culture incubator at 37 °C overnight. The growth medium was then aspirated and replaced with 100 µl of loading medium (Dulbecco's modified Eagle's medium containing 1% fetal bovine serum, 1 mM Fluo-3-AM plus 10% pluronic acid, and 2.5 mM probenecid) and incubated for 1 h at 37 °C. The cells were subsequently washed three times with Hank's balanced salt solution containing 20 mM HEPES, 2.5 mM probenecid, and 0.1% bovine serum albumin using a Denley cell washer (Denley Instruments). 100 µl of wash buffer was left in each well. The washed cells were placed in a fluorometric imaging plate reader (FLIPR), and changes in cellular fluorescence were recorded after the addition of 50-µl tissue extract fractions or testing compounds diluted in wash buffer.

Purification of SP1999 Ligand-- Rat spinal cords (100 g) from Pel-Freez were added to 1000 ml of boiling water with a protease inhibitor mixture (from Roche Molecular Biochemicals). The tissue was boiled for 5 min, homogenized by blender for 5 min, and then re-boiled for 15 min. Finally acetic acid was added to a final concentration of 0.5 M and allowed to incubate at 4 °C overnight with constant stirring. Insoluble material was removed by centrifugation at 15,000 × g for 30 min, and the supernatant was lyophilized. The lyophilized sample was dissolved in 30 ml of 0.1% trifluoroacetic acid and filtered through a 0.22-µm filter before loading onto a reverse phase C18 column (Vydac C18, 218TP510). Elution was at 5 ml/min with 1.5 column volume (CV) of buffer A (0.1% trifluoroacetic acid in H2O) followed by a linear gradient of buffer A to buffer B (0.1% trifluoroacetic acid in 50% acetonitrile) during a period of 6 CV. Fractions (5 ml) were collected and lyophilized, then dissolved in 1 ml of buffer A. 25 µl was used for screening by FLIPR assay in transiently transfected CHO-DHFR- cells. Two active peaks were identified in fractions 19-23 and 30-35 and pooled together. The two peaks were later shown to be identical (data not shown). The pool of fractions 30-35 was loaded onto a cation exchange column (SP8HR, Waters) pre-equilibrated with buffer C (20 mM Na3PO4, pH = 6.4). Elution was at 1 ml/min with a linear gradient of buffer C and 50% buffer D (20 mM Na3PO4, M NaCl, pH = 6.4) in 7.6 CV. 1.3-ml fractions were collected and screened by FLIPR assay in CHO-DHFR- cells. Activity was identified in flow-through fractions 5-12 and pooled. The pool was then loaded onto a pre-equilibrated Mono Q column (10/10, Waters), and eluted at 2 ml/min with a linear gradient of buffer C to 50% of buffer D in 7 CV, followed by 50% of buffer D for additional 5 min. The activity was identified in fractions 49-52 (1.3 ml/fraction) and pooled. The pool was then diluted with water to reduce the salt concentration and loaded onto DEAE column (5 × 100, Waters). Elution was at 0.5 ml/min with a linear gradient of buffer C to 50% buffer D over a period of 8 CV. Activity was identified in fractions 37-43 (0.5 ml/fraction) and pooled. The pool was then adjusted to 0.6% trifluoroacetic acid and then loaded onto a C18 column (Vydac 218TP510). Elution was at 3 ml/min with a linear gradient of buffer A to 20% buffer B over a period of 4 CV. The active fractions were identified in fractions 14-17 (1.3 ml/fraction) and pooled. The pool was then concentrated to 80 µl and loaded onto a Superdex HR10/30 column (Amersham Pharmacia Biotech) pre-equilibrated with Buffer A. Elution was at 0.5 ml/min with buffer A. The activity was located in fractions 33-36 (0.5 ml/fraction). Fractions 33-36 were then subjected to structural analysis.

Mass Spectrum-- Negative ion electrospray ionization mass spectrometry coupled with high performance liquid chromatography (HPLC) was applied to analyze the ligand of SP1999. Reverse phase HPLC was carried out on an Alliance 2690 HPLC system (Waters, Milford, MA). The sample was loaded onto a Jupiter C18 column (2.1 mm (inner diameter) × 50 mm, 5 µm, 300 Å) and eluted with an isocratic gradient of acetonitrile with 0.1% ammonium hydroxide. The entire column effluent (0.15 ml/min) was delivered to the mass spectrometer without flow split. The mass spectra were recorded on a Micromass Quattro LC triple quadruple mass spectrometer (Manchester, United Kingdom), which was operated under unit mass resolution conditions across the mass range of interest. Full-scan mass spectra covering m/z of 100-1000 were acquired with a scan time of 1.75 s. To confirm the structural information, electrospray ionization mass spectrometry/mass spectrometry experiments were also performed on selected ions. The 30-eV collision energy was applied for the fragmentation study with the collision gas cell pressure at 3 × 10-4 millibars (argon).

cAMP Assay-- CHO-DHFR- cells stably transfected with SP1999 were used for cAMP assay. The stable SP1999 cell line and wild type cells were first grown in 12-well plates to 70-80% confluence. The cells were then incubated for 2 h with 200 µl of medium containing 5 µCi/ml [3H]adenine. Subsequently 50 µl of HEPES (250 mM, pH 7.5) containing 50 µM forskolin, 200 µM isobutylmethylxanthine, and the substance to be tested was added to the cells and incubated for 10 min at 37 °C. Incubations were terminated by addition of 0.8 ml of 5% trichloroacetic acid (cold). [3H]cAMP was purified using Dowex and alumina chromatography and counted by scintillation counter as described previously (13).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cloning and Sequence Analysis-- The full-length cDNA of SP1999 was first cloned by Human Genome Science Corp. and disclosed in patent WO 98/50549 (Fig. 1A). It contains an 1029-base open reading frame encoding 343 amino acid residues. There is an in-frame stop codon in the 5'-untranslated region upstream of the ATG initiation codon. The hydrophilicity profile of the deduced peptide sequences revealed the presence of seven hydrophobic regions, consistent with a seven-transmembrane structure typical of G protein-coupled receptors (14, 15). The seven transmembrane domains are underlined in Fig. 1A. Phylogenetic analysis shows that SP1999 shares homology with a group of orphan G protein-coupled receptors (Fig. 1B). Its closest known receptors are UDP-glucose and platelet activating factor receptors (8, 9). Notably, SP1999 shares relatively little homology with known P2Y receptors (2).



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 1.   A, the cDNA sequence and deduced amino acid sequence of SP1999. Numbers to the left refer to amino acids, and numbers to the right refer to nucleotides. Underlined amino acid sequences represent predicted seven transmembrane domains. The GenBankTM accession number for this sequence is AF321815. B, phylogenetic analysis of SP1999. SP1999 is most closely related to KIAA0001 (UDP-glucose receptor), H963, and GPR34 with sequence identity of 43%, 32%, and 28%, respectively. SP1999 is more distantly related to P2Y receptors.

Expression Profile of SP1999 in Human Tissues-- To determine the distribution of SP1999 expression in human tissues, radiolabeled DNA probes from SP1999 were hybridized to multiple tissue mRNA dot blots (RNA Master Blot, CLONTECH) as shown in Fig. 2A. The RNA Master blot contains a variety of human tissues including different regions of brain, heart, spleen, lung, etc. As shown in Fig. 2A, hybridization of the SP1999 probe showed very strong signals in all brain regions and spinal cord as well as in fetal brain. The most intense signals were from substantia nigra, putamen, thalamus, and temporal cortex. In addition, weak signals can be observed in the lung, appendix, pituitary, and adrenal gland. The brain distribution of SP1999 was further demonstrated by Northern blot of mRNA from multiple regions of human brain (Fig. 2B). The Northern blot showed a predominant 3.2-kilobase band across all brain regions with a minor 2.4-kilobase band in some brain regions such as cortex and medulla. To detect the expression of SP1999 in human blood platelets, RT-PCR experiments were performed (Fig. 2C). A specific 140-base pair product for SP1999 was amplified in cDNA from human platelets but not in the cDNA from the human platelets without reverse transcriptase and from human leukocyte, indicating that SP1999 is expressed in human blood platelets. beta 2-Integrin was used as a negative control here to exclude the possibility of contaminating of human platelets by leukocytes, whereas CD2 and GHPDH were used as positive control. Therefore, SP1999 is expressed in human brain, spinal cord, and human blood platelets.



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 2.   Expression of SP1999 in human tissues. A, mRNA dot blot of SP1999. The human mRNA Master Blot from CLONTECH was hybridized to 32P-radiolabeled probe of SP1999 (see "Experimental Procedures"). The panel is the autoradiogram of the hybridized blot. B, Northern blot of SP1999. mRNA from different brain regions was analyzed by Northern blot hybridization. The numbers to the left indicate RNA size markers (in kilobases). C, expression of SP1999 in human platelets. RT-PCR were performed according to "Experimental Procedures" using specific primers for each gene of SP1999, CD-2, beta 2-integrin, and GHPDH. Primer sets are as follows: lane 1, SP1999; lane 2, CD-2; lane 3, beta 2-integrin; lane 4, GHPDH. +RT means that the cDNA was synthesized in the presence of reverse transcriptase. -RT means that the cDNA was synthesized in the absence of reverse transcriptase, which was used as a control to exclude the contamination of genomic DNA.

Identification of the Ligand for SP1999-- To understand the function of SP1999, we set out to identify its endogenous ligand; SP1999 was cotransfected with a mixture of chimeric G protein plasmids encoding Galpha q/12, Galpha 16, Galpha q/i, Galpha q/z, Galpha q/i3, Galpha q/s, Galpha qDelta 5, and Galpha q/o to CHO-DHFR-, whereas empty pCDNA-3.1 was cotransfected with chimeric G protein mixture as negative control. Each G protein chimera used here is a Galpha q subunit with its five C-terminal residues substituted by the corresponding residues of other Galpha subunits such as Galpha i except that, for Galpha qDelta 5, its five C-terminal residues was deleted (10, 11).

As SP1999 was predominantly expressed in brain tissue and spinal cord, spinal cord was used as raw material for purification. Rat spinal cords (100 g) were extracted according to "Experimental Procedures," loaded onto a C18 column (Vydac C18, 218TP510), and gradient elution was performed. The chromatogram is shown in Fig. 3A. Each fraction was screened for Ca2+ mobilization using CHO-DHFR- cells transfected with SP1999 and the chimeric G proteins using the FLIPR assay. Using different dilutions of the fractions, it was possible to identify regions exhibiting activity only in the SP1999-transfected cells (Fig. 3A). Furthermore, this SP1999 specific activity required the coexpression of chimeric G proteins. Two peaks (fractions 19-23 and fractions 30-35) were identified that activated SP1999 specifically. These two peaks were later shown to be identical (data not shown). Subsequent experiments using chimeric G proteins transfected individually with SP1999 indicated that the Galpha q/i3 chimera provided the most robust response (data not shown). The pool of fractions 30-35 was subsequently purified further by cation-exchange (SP8HR), anion exchange (Mono Q), anion exchange (DEAE), reverse phase (C18 column), and size exclusion (Superdex HR10/30). Fig. 3B shows the chromatogram of the final size exclusion column. The purified sample (peak A) was first characterized by determination of its UV spectrum and by its sensitivity to protease digestion and phosphatase digestion. The purified substance was found to have the following properties. First, it binds to an anion exchange column, indicating it has negative charges; second, it has an absorption peak at 258 nm; finally, it cannot be inactivated by protease K digestion but can be inactivated by nucleotide phosphatase digestion (data not shown). These results suggest that the purified substance is a small molecule and is likely to be a nucleotide. The purified substance was then subjected to mass spectrum analysis in negative ion mode. Three major peaks at 227.0, 249.0, and 426.1 m/z were detected (Fig. 3C). As the data were acquired in negative ion mode, the molecular weight of the substance analyzed should be 1 Da larger than that shown in the spectrum. Further fragmentation of the ions suggest that the ion at m/z 426.1 is consistent with the structure of 5'-ADP, the ion at m/z 227.0 is a dimer of trifluoroacetic acid (trifluoroacetic acid, formula weight = 114), and the m/z 249.0 peak is an adduct of the trifluoroacetic acid dimer and a sodium ion. Since the sample was purified by reverse phase HPLC in the presence of trifluoroacetic acid, it is not surprising to observe the adduct peaks at m/z 270.0 and 249.0 peaks. Trifluoroacetic acid has been shown to be inactive at SP1999 (data not shown); thus, 5'-ADP appears to be the active component in the sample. When commercially available 5'-ADP was compared with the purified sample, the activities were shown to be identical. Using the CHO cells cotransfected with SP1999 and chimeric Galpha q/i3, the dose response to ADP was examined, and an EC50 of 330 nM was observed (Fig. 4A). However, ADP also caused significant Ca2+ mobilization in pCDNA and Galpha q/i3-transfected CHO cells, with an EC50 of 14 µM (Fig. 4A). The same Ca2+ mobilization response was also observed in untransfected, wild type CHO cells (data not shown). To avoid the Ca2+ response to ADP inherent in the CHO cells, the activity of ADP was tested on several cell lines. It was found that NIH3T3 cells were devoid of endogenous ADP responses in the FLIPR assay. However, when transiently transfected with SP1999 and chimeric Galpha q/i3, ADP potently stimulated Ca2+ mobilization with an EC50 of 74 nM (Fig. 4B). The discrepancy in the EC50 values for ADP in the two cell lines is likely due to the addition of the endogenous ADP response observed in the CHO cells.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3.   Purification of endogenous ligand for SP1999. A, reverse-phase chromatography of crude extracts from rat spinal cord. Acetonitrile gradient and absorbance of eluted materials are indicated by dotted and solid lines. Fractions were assayed using CHO-DHFR- cells transfected with SP1999 and Galpha q/i3 by FLIPR (see "Experimental Procedures"); regions of specific activity are indicated by bar. B, size-exclusion chromatography. Active fractions from C18 chromatography (see "Experimental Procedures") were finally purified by size-exclusion chromatography. Fractions were assayed as described. All activity was contained in peak A. C, mass spectrum of the purfied material. The pooled fractions of peak A from size-exclusion chromatography were analyzed by electrospray ionization mass spectrometry in negative mode. The individual molecular ion was further analyzed by fragmentation using electrospray ionization mass spectrometry/mass spectrometry and the suggested structures are shown next to the ions.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4.   ADP dose response. Dose-response curves are from a representative experiment. A, ADP dose response in CHO-DHFR- cells. SP1999 or the vector pCDNA3.1 was cotransfected with chimeric Galpha q/i3 into CHO-DHFR-, and Ca2+ mobilization of transfected cells in response to increasing doses of ADP was measured by FLIPR. B, ADP dose response in NIH3T3 cells. SP1999 or the vector pCDNA3.1 was cotransfected with or without chimeric Galpha q/i3 into NIH3T3 cells, and ADP dose response was measured as described.

Intracellular Signaling Pathway of SP1999-- To confirm the G protein coupling specificity of SP1999, single chimeric G proteins were cotransfected with SP1999 into NIH3T3 cells, and the response to 300 nM ADP was then measured by FLIPR. As shown in Fig. 5A, strong Ca2+ flux signals were observed for cells transfected with SP1999 and Galpha q/i, Galpha q/i3, or Galpha q/o, while much weaker signals were observed for cells transfected with SP1999 and all other chimeric G proteins. These results suggest that SP1999 should normally couple to Galpha proteins of the Galpha i/o class (10, 11).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5.   Signal pathway of SP1999. Dose-response curves are from a representative experiment. A, G protein coupling of SP1999. SP1999 (5 µg) was transiently cotransfected to NIH3T3 cells with 0.5 µg each of human chimeric G protein Galpha q/i3, Galpha q/z, Galpha q/s, Galpha 16, Galpha q/12, Galpha q/i, Galpha q/o, and Galpha q. The response to ADP (300 nM) was then measured by FLIPR. - indicates without chimeric G protein. B, inhibition of cAMP by SP1999. SP1999 stably transfected CHO-DHFR- cells were first labeled with 5 µCi/ml [3H]adenine, then incubated with 50 µM forskolin and the indicated amount of ADP. The [3H]cAMP generated was purified using Dowex and alumina chromatography and quantitated by scintillation counter.

The coupling between SP1999 and the Galpha i/o proteins also suggests that ADP should act to inhibit the activity of adenylyl cyclase in SP1999-transfected cells (11, 15). To confirm this prediction, a cAMP assay was performed using CHO-DHFR- cells stably transfected with SP1999. To measure cAMP, the cells were first labeled with [3H]adenine, then the [3H]cAMP generated after ADP stimulation was purified by column chromatography and quantitated by scintillation spectrometry (13). As shown in Fig. 5B, ADP caused a dose-dependent decrease in forskolin-stimulated cAMP accumulation in SP1999-transfected cells, but had no effect on nontransfected cells. The EC50 of this response was 60.7 nM.

Pharmacology of SP1999-- The pharmacological profile of SP1999 was further characterized in both the FLIPR assay and the cAMP assay. Using SP1999- and Galpha q/i3-cotransfected NIH3T3 cells, a variety of nucleotides were screened by FLIPR assay. Fig. 6 shows the dose-response curves for ADP, ADPbeta S, 2-MeS-ADP, and 2-MeS-ATP for SP1999 in this assay. Table I lists the EC50 values for all the compounds tested at SP1999. The rank order of potency is 2-MeS-ATP = 2-MeS-ADP > ADP=ADPbeta S > 2-Cl-ATP > ATPgamma S. Table II lists the nucleotides that were not active at SP1999 at concentrations up to 8 µM or 1 mM. The nucleotides ATP, UTP, ITP, and Ap4A exhibited activity in wild-type NIH3T3 cells, and with EC50 value of about 15 µM. The ability of the compounds active at SP1999 to inhibit cAMP in SP1999-transfected CHO cells was also examined. With the exception of ATPgamma S, the rank order of EC50 values is comparable to those determined using the FLIPR assay. Three compounds were also identified that were able to antagonize the activity of ADP at SP1999: reactive blue-2, suramin, and 2',5'-ADP. The Ki for reactive blue-2, suramin, and 2',5'-ADP in the presence of 200 nM ADP were 1.3, 3.6, and 10 µM, respectively. Reactive blue-2 and suramin have been shown to be nonselective antagonists for P2Y receptors (2).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 6.   Dose response of ADP, ADPbeta s, 2-MeS-ADP, and 2-MeS-ATP for SP1999. Dose-response curves are from a representative experiment. SP1999 (5 µg) and Galpha q/i3 (0.5 µg) were cotransfected into NIH3T3 cells; Ca2+ mobilization in response to the increasing concentrations of compound was measured by FLIPR assay.


                              
View this table:
[in this window]
[in a new window]
 
Table I
Potency of SP1999 Ligands
The FLIPR assays were performed using SP1999- and Galpha q/i3-cotransfected NIH3T3 cells, and cAMP assays were performed using SP1999 stably transfected CHO-DHFR- cells as described under "Experimental Procedures." The dose response of each compound was fitted by Prism software, and the EC50 value was obtained. The values represent mean ± S.D. with n = 3.


                              
View this table:
[in this window]
[in a new window]
 
Table II
Nucleotides inactive at SP1999



    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The results of the present study clearly indicate that SP1999 is a high affinity receptor for ADP, despite the fact that SP1999 does not possess a particularly high degree of homology with the known purinergic receptors. It is unlikely that the results presented here are due to the unsuspected expression of a known purinergic receptor, since the profile of activity observed exhibits several properties that distinguish it from the previously cloned P2 purinergic receptors. Notably, the responses presented exhibit a unique pharmacological and second messenger profile and are only observed in conjunction with expression of transfected SP1999. Although the previously cloned P2 receptors are all capable of coupling through Galpha q to activation of phospholipase C and Ca2+ mobilization, SP1999 couples only to the Galpha i class of G proteins to inhibit adenylyl-cyclase activity. In NIH3T3 cells, Ca2+ mobilization in response to ADP is only observed when the cells are transfected with both SP1999 and a chimeric G protein of the Galpha q/i,o class (Galpha q/i, i3, or o). Pharmacologically, SP1999 differs from the P2Y2, P2Y4, P2Y6, and P2Y11 receptors in that ADP is the most potent of the naturally occurring nucleotides examined, whereas the most potent nucleotides for P2Y2, P2Y4, P2Y6, and P2Y11 receptors are ATP, UTP, or UDP (2). Although ADP is also the most potent of the naturally occurring nucleotides at the P2Y1 receptor, P2Y1 couples to Galpha q while SP1999 couples to Galpha i. Although we currently cannot rule out an interaction of ATP, UTP, ITP, or Ap4A at SP1999 (UDP was found to be inactive), these interactions must be of low affinity (EC50 > 10 µM) as their background EC50 values in NIH3T3 cells are larger than 10 µM.

Despite the overall low sequence homology with the known nucleotide receptors, SP1999 does contain several amino acid residues that are conserved in the P2Y family, and which have previously been implicated in nucleotide binding. Amino acids Phe-105, Tyr-106, Tyr-110, Phe-198, His-253, Arg-256, and Ser-288 are identical to residues highly conserved among the P2Y1, P2Y2, P2Y4, and P2Y6 receptors (16, 17). Through the use of molecular modeling and site-directed mutagenesis, these residues have been shown to be involved in the binding of purinergic ligands to the P2Y1 receptor. Although several residues found to be absolutely required for ligand interaction at the P2Y1 receptor (Arg-128 and Arg-310 in P2Y1) are not strictly conserved in SP1999, it is highly possible that ligands bind to SP1999 in an orientation different from P2Y1, allowing other residues present in SP1999 to become involved in the binding site (16, 17). Further studies involving molecular modeling and site-directed mutagenesis of SP1999 will be required to specifically define the ligand binding pocket of this receptor. Nevertheless, the conserved nature of the residues mentioned above supports the finding that ADP can act as a ligand at this receptor.

ADP receptors have been identified in both C6 glioma cell lines and blood platelets but have not been cloned (5, 6). In rat C6 glioma cells, an ADP receptor has been described to couple to Galpha i. The order of its agonist potency was 2-MeSATP > = 2-MeS-ADP > ADPbeta S > 2-Cl-ATP = ADP = ATPgamma S > ATP > UTP (6), which was very similar to that of SP1999. There are also two different G protein-coupled ADP receptors identified in blood platelets. One ADP receptor, P2TAC, couples to the inhibition of adenylyl cyclase; another ADP receptor, P2Y1, couples to mobilization of intracellular calcium stores through inositol phosphate production (5). Since SP1999 couples to the inhibition of adenylyl cyclase and the pharmacological profiles between SP1999 and P2TAC are also very similar and, moreover, SP1999 mRNA was found in platelets, SP1999 may also be a candidate for the uncloned P2TAC receptors. However, to confirm whether SP1999 is the ADP receptor identified in C6 cells or blood platelets, further experiments must be done.


    ACKNOWLEDGEMENTS

We thank Robert Henningsen, Qi Zhang, Gwen Wong, Joeseph Hedrick, Wendy Feng, and T. M. Chan for technical assistance.

Note added in Proof---While this paper was in press, G. Hollopeter et al. published a paper (Hollopeter, G., Jantzen, H.-M., Vincent, D., Li, G., England, L., Ramakrishnan, V., Yang, R.-B., Nurden, P., Julius, D., and Conley, P. B. (2001) Nature 409, 202-207). The receptor P2Y12 in the paper is identical to SP1999.


    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF321815.

§ To whom all correspondence should be addressed: K-15-1/1945, Schering-Plough Research Inst., Kenilworth, NJ 07033. Tel.: 908-740-4704; Fax: 908-740-7101; E-mail: fang.zhang@spcorp.com.

Published, JBC Papers in Press, December 4, 2000, DOI 10.1074/jbc.M009718200


    ABBREVIATIONS

The abbreviations used are: GPCR, G protein-coupled receptor; PLC, phospholipase C; FLIPR, fluorometric image plate reader; HPLC, high performance liquid chromatography; ADPbeta S, adenosine 5'-O-2-(thio)diphosphate; ATPgamma S, adenosine 5'-O-(thiotriphosphate); AMP-PCP, adenosine 5'-(beta ,gamma -methylenetriphosphate); CHO, Chinese hamster ovary; DHFR, dihydrofolate reductase; RT, reverse transcription; PCR, polymerase chain reaction; CV, column volume; GHPDH, glycerol-3-phosphate dehydrolase.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES


1. Harden, T. K., Boyer, J. L., and Nicholas, R. A. (1995) Annu. Rev. Pharmacol. Toxicol. 35, 541-579
2. Ralevic, V., and Burnstock, G. (1998) Pharmacol. Rev. 50, 413-492
3. Burnstock, G. (1997) Neuropharmacology 36, 1127-1139
4. Hechler, B., Eckly, A., Ohlmann, P., Cazenave, J. P., and Gachet, C. (1998) Br. J. Haematol. 103, 858-866
5. Daniel, J. L., Dangelmaier, C., Jin, J., Ashby, B., Smith, J. B., and Kunapuli, S. P. (1998) J. Biol. Chem. 273, 2024-2029
6. Boyer, J. L., Lazarowski, E. R., Chen, X. H., and Harden, T. K. (1993) J. Pharmacol. Exp. Ther. 267, 1140-1146
7. Wilson, S., Bergsma, D. J., Chambers, J. K., Muir, A. I., Fantom, K. G., Ellis, C., Murdock, P. R., Herrity, N. C., and Stadel, J. M. (1998) Br. J. Pharmacol. 125, 1387-1392
8. Chao, W., and Olson, M. S. (1993) Biochem. J. 292, 617-629
9. Chambers, J. K., Macdonald, L. E., Sarau, H. M., Ames, R. S., Freeman, K., Foley, J. J., Zhu, Y., McLaughlin, M. M., Murdock, P., McMillan, L., Trill, J., Swift, A., Aiyar, N., Taylor, P., Vawter, L., Naheed, S., Szekeres, P., Hervieu, G., Scott, C., Watson, J. M., Murphy, A. J., Duzic, E., Klein, C., Bergsma, D. J., Wilson, S., and Livi, G. P. (2000) J. Biol. Chem. 275, 10767-10771
10. Saito, Y., Nothacker, H. P., Wang, Z., Lin, S. H., Leslie, F., and Civelli, O. (1999) Nature 400, 265-269
11. Conklin, B. R., Farfel, Z., Lustig, K. D., Julius, D., and Bourne, H. R. (1993) Nature 363, 274-276
12. Birkenbach, M., Josefsen, K., Yalamanchili, R., Lenoir, G., and Kieff, E. (1993) J. Virol. 67, 2209-2220
13. Harden, T. K., Scheer, A. G., and Smith, M. M. (1982) Mol. Pharmacol. 21, 570-580
14. Strader, C. D., Fong, T. M., Graziano, M. P., and Tota, M. R. (1995) FASEB J. 9, 745-754
15. Gilman, A. G. (1987) Annu. Rev. Biochem. 56, 615-649
16. Jiang, Q., Guo, D., Lee, B. X., Van Rhee, A. M., Kim, Y. C., Nicholas, R. A., Schachter, J. B., Harden, T. K., and Jacobson, K. A. (1997) Mol. Pharmacol. 52, 499-507
17. Hoffmann, C., Moro, S., Nicholas, R. A., Harden, T. K., and Jacobson, K. A. (1999) J. Biol. Chem. 274, 14639-14647


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
A. I. Masyuk, S. A. Gradilone, J. M. Banales, B. Q. Huang, T. V. Masyuk, S.-O. Lee, P. L. Splinter, A. J. Stroope, and N. F. LaRusso
Cholangiocyte primary cilia are chemosensory organelles that detect biliary nucleotides via P2Y12 purinergic receptors
Am J Physiol Gastrointest Liver Physiol, October 1, 2008; 295(4): G725 - G734.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Kim, A. Garcia, S. P. Jackson, and S. P. Kunapuli
Insulin-like growth factor-1 regulates platelet activation through PI3-K{alpha} isoform
Blood, December 15, 2007; 110(13): 4206 - 4213.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
M. P. Abbracchio, G. Burnstock, J.-M. Boeynaems, E. A. Barnard, J. L. Boyer, C. Kennedy, G. E. Knight, M. Fumagalli, C. Gachet, K. A. Jacobson, et al.
International Union of Pharmacology LVIII: Update on the P2Y G Protein-Coupled Nucleotide Receptors: From Molecular Mechanisms and Pathophysiology to Therapy
Pharmacol. Rev., September 1, 2006; 58(3): 281 - 341.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
H. Z. Ruan, L. A. Birder, Z. Xiang, B. Chopra, T. Buffington, C. Tai, J. R. Roppolo, W. C. de Groat, and G. Burnstock
Expression of P2X and P2Y receptors in the intramural parasympathetic ganglia of the cat urinary bladder
Am J Physiol Renal Physiol, May 1, 2006; 290(5): F1143 - F1152.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
D. B. Arthur, S. Georgi, K. Akassoglou, and P. A. Insel
Inhibition of apoptosis by P2Y2 receptor activation: novel pathways for neuronal survival.
J. Neurosci., April 5, 2006; 26(14): 3798 - 3804.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
Z. Ding, S. Kim, and S. P. Kunapuli
Identification of a Potent Inverse Agonist at a Constitutively Active Mutant of Human P2Y12 Receptor
Mol. Pharmacol., January 1, 2006; 69(1): 338 - 345.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
H.-Z. Ruan, L. A. Birder, W. C. de Groat, C. Tai, J. Roppolo, C. A. Buffington, and G. Burnstock
Localization of P2X and P2Y Receptors in Dorsal Root Ganglia of the Cat
J. Histochem. Cytochem., October 1, 2005; 53(10): 1273 - 1282.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
A. L. Frelinger III and A. D. Michelson
Clopidogrel: Linking Evaluation of Platelet Response Variability to Mechanism of Action
J. Am. Coll. Cardiol., August 16, 2005; 46(4): 646 - 647.
[Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
Z. Ding, F. Tuluc, K. R. Bandivadekar, L. Zhang, J. Jin, and S. P. Kunapuli
Arg333 and Arg334 in the COOH terminus of the human P2Y1 receptor are crucial for Gq coupling
Am J Physiol Cell Physiol, March 1, 2005; 288(3): C559 - C567.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
C. J. Dixon, J. F. Hall, T. E. Webb, and M. R. Boarder
Regulation of Rat Hepatocyte Function by P2Y Receptors: Focus on Control of Glycogen Phosphorylase and Cyclic AMP by 2-Methylthioadenosine 5'-Diphosphate
J. Pharmacol. Exp. Ther., October 1, 2004; 311(1): 334 - 341.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A.-K. Wihlborg, L. Wang, O. O. Braun, A. Eyjolfsson, R. Gustafsson, T. Gudbjartsson, and D. Erlinge
ADP Receptor P2Y12 Is Expressed in Vascular Smooth Muscle Cells and Stimulates Contraction in Human Blood Vessels
Arterioscler. Thromb. Vasc. Biol., October 1, 2004; 24(10): 1810 - 1815.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. L. Herold, A.-D. Qi, T. K. Harden, and R. A. Nicholas
Agonist Versus Antagonist Action of ATP at the P2Y4 Receptor Is Determined by the Second Extracellular Loop
J. Biol. Chem., March 19, 2004; 279(12): 11456 - 11464.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
E. T. Bodor, G. L. Waldo, S. B. Hooks, J. Corbitt, J. L. Boyer, and T. K. Harden
Purification and Functional Reconstitution of the Human P2Y12 Receptor
Mol. Pharmacol., November 1, 2003; 64(5): 1210 - 1216.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
P. Fontana, A. Dupont, S. Gandrille, C. Bachelot-Loza, J.-L. Reny, M. Aiach, and P. Gaussem
Adenosine Diphosphate-Induced Platelet Aggregation Is Associated With P2Y12 Gene Sequence Variations in Healthy Subjects
Circulation, August 26, 2003; 108(8): 989 - 995.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Jiang, L. Luo, E. L. Gustafson, D. Yadav, M. Laverty, N. Murgolo, G. Vassileva, M. Zeng, T. M. Laz, J. Behan, et al.
Identification and Characterization of a Novel RF-amide Peptide Ligand for Orphan G-protein-coupled Receptor SP9155
J. Biol. Chem., July 18, 2003; 278(30): 27652 - 27657.
[Abstract] [Full Text] [PDF]


Home page