Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M008083200 on December 27, 2000

J. Biol. Chem., Vol. 276, Issue 12, 9059-9065, March 23, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/12/9059    most recent
M008083200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Suzuki, Y.
Right arrow Articles by Sugiura, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Suzuki, Y.
Right arrow Articles by Sugiura, W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Molecular Cloning and Characterization of the Gene Coding for Azoreductase from Bacillus sp. OY1-2 Isolated from Soil*

Yasuhiko SuzukiDagger §, Tomoko Yoda, Amin RuhulDagger , and Wataru Sugiura||

From the Departments of Dagger  Pathology,  Food Microbiology, and || Environmental Sanitation, Osaka Prefectural Institute of Public Health, 1-3-69, Nakamichi, Higashinari-ku, Osaka 537-0025, Japan

Received for publication, September 5, 2000, and in revised form, November 30, 2000


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Azo dyes are regarded as pollutants because they are not readily reduced under aerobic conditions. Bacillus sp. OY1-2 transforms azo dyes into colorless compounds, and this reduction is mediated by a reductase activity for the azo group in the presence of NADPH. A 1.2-kbp EcoRI fragment containing the gene that encodes azoreductase was cloned by screening the genomic library of Bacillus sp. OY1-2 with digoxigenin-labeled probe designed from the N-terminal amino acid sequence of the purified enzyme. An open reading frame encoding the azoreductase, consisting of 178 amino acids, was predicted from the nucleotide sequence. In addition, because only a Bacillus subtillis hypothetical protein was discovered in the public databases (with an amino acid identity of 52.8%), the gene encoding the azoreductase cloned in this study was predicted to be a member of a novel family of reductases. Southern blot analysis revealed that the azoreductase gene exists as a single copy gene on a chromosome. Escherichia coli-expressing recombinant azoreductase gave a ten times greater reducing activity toward azo dyes than the original Bacillus sp. OY1-2. In addition, the expressed azoreductase purified from the recombinant E. coli lysate by Red-Sepharose affinity chromatography showed a similar activity and specificity as the native enzyme. This is the first report describing the sequencing and characterization of a gene encoding the azo dye-reducing enzyme, azoreductase, from aerobic bacteria and its expression in E. coli.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Azo dyes are synthetic organic colorants that are characterized by great structural variety. Synthetic azo dyes are extensively used in the textile, food, and cosmetics industries. More than 7 × 105 tons of these dyes are produced annually worldwide (1). Most azo dyes are released into the environment as waste from the textile, food, cosmetic, and dyestuff manufacturing industries (2). They are frequently found in a chemically unchanged form even after waste-water treatment (3-5), so they are regarded as pollutants. The treatment system of colored waste-water, based on physical or chemical procedures, is effective but suffers from such shortcomings as high cost, formation of hazardous byproducts, and intensive energy requirements. In contrast, biological degradation of these dyes does not have similar problems. An uncharged azo dye can be transformed into colorless compounds by reductive cleavage of the azo bond in anoxic sediment environments (6-8). To establish biological waste-water treatment of azo dye, it is essential to discover the microorganisms that carry the azo dye-degrading enzymes.

To accomplish this, we have isolated three bacterial strains that reduce azo dyes from soil and sewage samples. These strains were identified as Bacillus sp. OY1-2, Xanthomonas sp. NR25-2 and Pseudomonas sp. PR41-1. The enzymes produced by these bacteria catalyze the reduction of Methyl Red and produce dimethyl p-phenylenediamine and o-aminobenzoic acid (Fig. 1 and Ref. 9). Among them, an enzyme from Bacillus sp. OY1-2, which was able to reduce azo dyes such as Methyl Red, Rocceline, and Sumifix Red B in the presence of beta -NADPH, was purified from bacterial cell extracts by means of column chromatography and subsequently characterized.1


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1.   Reduction of Methyl Red by azoreductase. Methyl Red was treated with crude azoreductase solution in the presence of beta -NADPH. Products were analyzed by gas chromatography and identified as dimethyl p-phenylenediamine and o-aminobenzoic acid (9).

Molecular cloning of the gene encoding this enzyme is essential for further characterization as well as for technological applications of this enzyme. In this report, we show the molecular cloning and characterization of the gene encoding the azoreductase from Bacillus sp. OY1-2 and present the characteristics of recombinant azoreductase expressed in E. coli.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Bacterial Strains, Plasmids, and Culture Conditions-- Azo dye-degrading bacteria isolated from soil near a waste-water plant from a textile factory were identified as Bacillus sp. OY1-2 based on biological characterization (9). This strain can grow in brain-heart infusion broth (Difco). E. coli strains C600hfl and XLI-Blue were cultured in Luria broth consisting of 10 g of bactotryptone (Difco), 5 g of yeast extract (Difco), and 10 g of NaCl per liter. The E. coli strains GI724 and GI618 were cultured in RMG medium consisting of 40 g of cazamino acids (Difco), 5 g of glycerol, 1 mM MgCl2, 6 g of Na2HPO4, 3 g of KH2PO4, 0.5 g of NaCl, 1 g of NH4Cl per liter. Recombinant proteins were expressed by E. coli strains GI724 or GI618 in ID medium consisting of 0.4 g of cazamino acid, 5 g of glucose, 1 mM MgCl2, 6 g of Na2HPO4, 3 g of KH2PO4, 0.5 g of NaCl, 1 g of NH4Cl per liter. A phage vector lambda gt10 was used for the construction of the genomic library. The plasmid pT7Blue(R)T (Novagen, Inc.) and pUC18 were used for the subcloning of genes. The plasmids pTrx-Fus (Invitrogen Co.) and pTrcNd (reconstructed from pQE30 (Qiagen Inc.) were used for expression of recombinant azoreductase.

N-terminal Amino Acid Sequence of Native and Recombinant Azoreductase-- Samples of native and recombinant azoreductase were separated on SDS-PAGE2 and transferred to polyvinylidene difluoride membranes (Bio-Rad). The blotted protein strips were used for amino acid sequencing on a PE Biosystems 470/120A protein sequencer.

Construction of Bacillus sp. OY1-2 Genomic DNA Library-- Bacillus sp. OY1-2 genomic DNA was prepared by mechanical disruption as described previously (11). Briefly, bacterial pellet from 5 ml of liquid culture was suspended in 0.5 ml of lysis buffer consisting of 0.3 M Tris-HCl, pH 8.0, 0.1 M NaCl, and 6 mM EDTA. The cell suspension was transferred into a conical 2-ml screw-cap vial, which is one-fourth filled with 0.17-mm acid-washed sterile glass beads. Cells were disrupted by vigorous shaking with 0.5 ml of chloroform on a Mini-Bead Beater cell disrupter (Biospec Products, Bartlesville, UK) for 5 min. DNA in the upper layer after centrifugation was further purified by phenol/chloroform extraction, concentrated by ethanol precipitation, and dissolved in 300 µl of TE buffer consisting of 10 mM Tris-HCl, pH 8.0 and 1 mM EDTA. The purified genomic DNA was completely digested with EcoRI and ligated into the EcoRI site of lambda gt10. Genomic library constructs were introduced into E. coli strain C600hfl by means of in vitro packaging using gigapack plus (Stratagene).

Generation of Probe for Screening-- The N-terminal amino acid sequence was used to design oligonucleotide primers for amplifying the DNA fragment encoding the N-terminal of azoreductase (Fig. 2A). The reaction mixture (50 µl) consisted of long and accurate (LA) PCR buffer II (Mg2+-free); 2.5 mM MgCl2; 200 mM each dATP, dCTP, dGTP, and dTTP; 10 ng of DNA from Bacillus sp. OY2-1; 1.25 units of Takara LA Taq DNA polymerase (Takara Shuzo Co., Ltd., Japan); and 0.5 mM each primer AZR-1 and AZR-2 (Fig. 2A). PCR was carried out for 30 cycles in a Takara Thermal Cycler Personal (Takara Shuzo Co., Ltd.), with each cycle consisting of denaturation for 30 s at 94 °C, annealing for 30 s at 55 °C, and extension for 1 min at 72 °C. The PCR product was extracted from the gel after separation on a 1% agarose gel and was directly subcloned into the pT7Blue(R)T vector. The subclones were sequenced by the dideoxy chain termination method (12) with a Model 310 genetic analyzer (PE Biochemicals Inc). A hybridization probe was synthesized by PCR using a PCR DIG labeling kit (Roche Diagnostics Co., Germany). The reaction mixture (50 µl) consisted of 10 mM Tris-HCl, pH 8.3; 50 mM KCl; 1.5 mM MgCl2; 200 mM each dATP, dCTP, and dGTP and 130 mM dTTP; 70 mM digoxigenin-11-dUTP; 1.25 units of Taq DNA polymerase; a 1 µM concentration of primers M13 M1 & M13 RV (Takara Shuzo Co., Ltd.); and 10 ng of plasmid carrying the PCR product encoding the N-terminal of azoreductase. PCR was performed under the same conditions as described above.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2.   Strategy of amplification of the probe for library screening. A, degenerate primers of AZR-1 and AZR-2 are designated from the N-terminal amino acid sequence of purified azoreductase. B, nucleotide sequence of the amplified DNA fragment.

Cloning and DNA Sequencing of the Azoreductase Gene-- A phage library was screened essentially as previously described (13). Approximately 1 × 105 plaques from the genomic library were plated with E. coli C600hfl and incubated at 37 °C for 6 h. Nylon filters (Nytran 13N, Schleicher & Schuell Co.) were processed for hybridization. The filters were prehybridized in ExpressHyb hybridization solution (CLONTECH Laboratories, Inc.) at 68 °C for 30 min and then hybridized for 1 h at 48 °C with a 10 ng/ml concentration of digoxigenin-labeled probe described above in the same buffer as used for prehybridization. The filters were washed for 5 min in 2× SSC and 0.1% SDS at room temperature followed by washing for 15 min in 0.2× SSC and 0.1% SDS at 48 °C. The hybridized probe was detected after 30 min of incubation at room temperature with alkaline phosphatase-conjugated anti-digoxigenin antibody (Fab; Roche Diagnostics Co.) diluted 1:5000. The enzyme-catalyzed color reaction was carried out using a nitro blue tetrazolium salt (NBT)/5-bromo-4-chloro-3-indolyl phosphate (BCIP) system (Wako Pure Chemical Industries, Japan) in Buffer 3 consisting of 100 mM Tris-HCl, pH 9.5, 100 mM NaCl, and 50 mM MgCl2. The DNA inserts in the positive clones were subcloned into the EcoRI site of pUC18 for further characterization. The EcoRI fragment in the subclone was digested by SphI, NlaIV, or HincII; further subcloned in pUC18; and sequenced as shown in Fig. 2 by the dideoxy chain termination method with a Model 310 genetic analyzer.

Database Search-- Protein and DNA sequences with homology to the deduced amino acid sequence of the azoreductase ORF were searched using TBLASTN from the National Center for Biological Information.

Southern Blot Hybridization-- Detection of the restriction DNA fragment carrying the azoreductase gene was performed according to Southern (14). One µg of genomic DNA was completely digested with restriction enzymes, separated on a 0.7% agarose gel, and vacuum-transferred to Nytran 13N nylon filters. The filters were prehybridized in ExpressHyb hybridization solution at 68 °C for 30 min followed by hybridization with the same solution containing a 10 ng/ml Dig-labeled 1.2-kbp EcoRI DNA fragment carrying the whole coding region of azoreductase. After hybridization, the filters were washed for 5 min with 2× SSC and 0.1% SDS at room temperature followed by washing twice with 2× SSC/0.1% SDS for 15 min at 68 °C. The hybridized Dig-labeled probe on the filters were detected by alkaline phosphatase-conjugated anti-digoxigenin antibody, followed by color development using NBT/BCIP as substrates in Buffer 3.

Expression of Azoreductase in E. coli-- The entire open reading frame of azoreductase was amplified by PCR. Briefly, the reaction mixture (50 µl) consisted of LA-PCR buffer II (Mg2+-free); 2.5 mM MgCl2; 200 mM each dATP, dCTP, dGTP, and dTTP; 10 ng plasmid pT7B-AZR5-8; 1.25 units of Takara LA Taq DNA polymerase, and 0.5 mM each of primers AZR-rec-S-Nde (CATATGAAACTAGTCGTTATTAAC) and AZR-rec-E-Xba (TCTAGAGCAGATAGACTATTGGCTCC). PCR was carried out for 30 cycles in a Takara Thermal Cycler Personal, with each cycle consisting of denaturation for 30 s at 94 °C, annealing for 30 s at 55 °C, and extension for 1 min at 72 °C. The PCR product was extracted from the gel after separation on 1% agarose gel electrophoresis and subcloned into pT7Blue(R)T for confirmation of the nucleotide sequence and then transferred into expression vectors pTrx-Fus or pTrcNd after digestion by NdeI and XbaI. Expression of reductase in pTrx-Fus system was performed by adding tryptophan at a concentration of 0.1 mg/ml in ID medium. Expression in pTrcNd was performed by adding isopropyl-beta -D-thio-galactopyranoside (IPTG) at a concentration of 1 mM in Luria-Bertani medium. Cells from 10 ml of induced culture were suspended in 0.5 ml of 20 mM sodium phosphate buffer, pH 7.0, lysed by two cycles of freezing at -80 °C and thawed at 37 °C followed by sonication (15 s, 70% output, 10×). The supernatants from a 9000 × g, 30 min centrifugation were used directly for enzyme assay or SDS-PAGE analysis.

Purification of Recombinant Azoreductase by Red-Sepharose CL-6B-- The cells from 200 ml of culture were suspended in 20 ml of 20 mM sodium-phosphate buffer, pH 7.0 and lysed by freezing and thawing followed by sonication (15 s, 70% output, 10×). After centrifugation at 9000 × g for 30 min, the supernatant was applied to a Red-Sepharose CL-6B column (Amersham Pharmacia Biotech) followed by washing with 20 mM sodium phosphate buffer, pH 7.0. The recombinant azoreductase was eluted from the column with 10 mM beta -NADH. The eluate was dialyzed against two changes of 1000 volumes of 20 mM sodium phosphate buffer, pH 7.0 and used for enzyme assay.

Enzyme Assays-- Azo dye-reducing activity was analyzed by measuring the decrease in optical density at suitable wavelengths with a Hitachi U 3300 spectrophotometer at various temperatures basically according to Pasti-Grigsby et al. (15). The reaction mixture in a total volume of 1.0 ml consisted of various concentrations of azo dyes (Roccelin, Solar Orange, Sumifix Black B; shown in Fig. 3) in 20 mM sodium phosphate buffer, pH 7.0, and bacterial lysates or purified enzyme. The reaction mixture was preincubated for 5 min at the assay temperature, and the reaction was started by the addition of 25 µl of various concentrations of beta -NADPH. The enzymatic activities were measured by the decrease in optical density at optimal wavelengths. The enzyme activity was expressed as the amount of reduced dye per min with 1 mg of enzyme. Kinetic parameters for the reduction of each dye by native and recombinant azoreductases were estimated by nonlinear regression analysis according to Shimada et al. (16).


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3.   Structure of azo dyes used for reduction assay. A, Rocceline; C.I., color index name. B, Solar Orange. C, Sumifix Black B.


    RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

We have been interested in biological reduction of azo dyes under aerobic conditions. The utilization of azo dye-degrading microorganisms is very important for generating an efficient bioreactor for waste-water treatment plants in industries that use azo dyes. In addition, these enzymes can be applied for white discharge printing of cloths. In the course of our study, we have isolated three bacterial strains that can reduce azo dyes under aerobic conditions. A constitutively expressed enzyme in Bacillus sp. OY1-2 (one of the isolated strains) was purified from bacterial cell lysates and characterized with respect to reduction of different kinds of azo dyes in the presence of beta -NADPH (10). Subsequently, we cloned and characterized the gene encoding this protein activity.

Cloning of the Gene Encoding the Azoreductase-- To clone the azoreductase gene of Bacillus sp. OY1-2, the N-terminal amino acid sequence of purified azoreductase was determined. Because there was neither significant amino acid nor nucleotide homology to the N-terminal amino acid sequence in the databases, this protein was determined to be novel. We attempted to clone the gene encoding this enzyme by means of screening the genomic library of Bacillus sp. OY1-2 with digoxigenin-labeled probe amplified by PCR using primers designed from the N-terminal amino acid sequence of azoreductase (Fig. 2A). A 0.1-kbp DNA fragment was amplified by PCR using primers AZR-1 and AZR-2. The PCR product carrying the DNA fragment encoding the N-terminal part of azoreductase was extracted from the agarose gel, directly subcloned into the pT7Blue(R)T vector, and sequenced (Fig. 2B). A Dig-labeled hybridization probe was synthesized by PCR using the plasmid carrying the azoreductase N-terminal part as a template. A genomic library of Bacillus sp. OY1-2 was constructed with the EcoRI-digested phage vector lambda gt10 by ligation with the completely EcoRI-digested fragments of total genomic DNA. Transfection of the host E. coli C600hfl by the in vitro packaged library gave independent clones from 1.1 × 106 plaques. By using Dig-labeled probe, seven clones with inserts of the same length were isolated from the 2 × 105 plaques. Inserts in these seven clones were amplified by PCR and sequenced. One of the clones (lambda gt10-AZR5) was then subcloned into the E. coli vector pUC18 (pUC18-AZR5-8) for further analysis. The entire sequence of the 1.2-kbp insert was determined according to the sequencing strategy shown in Fig. 4, and an ORF was found in this fragment (Fig. 5) using the specific nucleotide sequence as a probe. An inframe initiation codon (ATG) was located at nucleotide 32, as indicated in Fig. 5 (boxed), and a putative Shaine-Dalgarno sequence GGAG (17) (Fig. 5, double underline) was found in its upstream region. The deduced amino acid sequence from this initiation codon showed good agreement with the N-terminal amino acid sequence determined from the purified native azoreductase (Fig. 5, underline). In addition, the molecular mass of the azoreductase product calculated from the gene encoding azoreductase was 19,423 Da, which exhibited good agreement with the molecular mass of 20 kDa of the purified azoreductase (10). Thus we concluded that the ORF found in this 1.2-kbp EcoRI DNA fragment coded for the azoreductase. However, as the upstream region of this clone was only 31 bp, the sequence of the putative promoter region could not be identified. When we searched for homologs from other organisms in the DNA and protein databases, an ORF of Bacillus subtillis (function unknown) was obtained with an amino acid sequence homology of 52.8% (GenBankTM/EBI database, accession no. Y14079), although it was not present in the protein databases. Thus, the azoreductase gene cloned and characterized in this study was a member of a novel family of enzymes. The deduced amino acid sequences from the azoreductase gene and the B. subtillis ORF are aligned in Fig. 6. Although the overall homology between them was 52.8%, only 2 of 17 C-terminal amino acids were identical, suggesting that the 17 C-terminal amino acid sequence may not be essential for azoreductase activity. This should be further investigated by examining the activities of truncated recombinant proteins. The NADH binding motif (GXGXXG) found in NADH-dependent enzymes such as lactate dehydrogenase (18), alcohol dehydrogenase (19), and hydrotransferase (20) was found in the deduced amino acid sequences of these two genes (Fig. 6, underlined).


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4.   Sequence strategy of the 1.2-kbp EcoRI DNA fragment containing the open reading frame that encodes azoreductase. Restriction sites of the azoreductase gene are shown. The 1.2-kbp EcoRI fragment was digested with SphI, NlaIV, and HincII; subcloned into pUC18; and sequenced.


View larger version (70K):
[in this window]
[in a new window]
 
Fig. 5.   Nucleotide and deduced amino acid sequence of the azoreductase from Bacillus sp. OY1-2. The deduced amino acid sequence is presented below the nucleotide sequence. The putative Shaine-Dalgarno sequence is indicated by a double underline. The N-terminal amino acid sequence that was determined from the purified azoreductase sample is indicated by a single underline.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 6.   Alignment of the deduced amino acid sequence of azoreductase (B. sp. azr) and B. subtillis (B. sub ORF). Asterisks, identical amino acids; (-), deleted amino acids. Dashes indicate gaps.

Southern Blot Hybridization-- Fragments of genomic DNA generated by digestion with restriction enzymes were separated on a 0.7% agarose gel, transferred onto the nylon filter, and hybridized with the 1.2-kbp EcoRI fragment of genomic DNA carrying the entire open reading frame of azoreductase. The probe hybridized to DNA fragments of length 8.0, 20, 25, 6.6, 5.0, 1.2, and 11 kbp cut by restriction enzymes BamHI, EcoRI, HindIII, PstI, SalI, SmaI and XbaI, respectively (Fig. 7). The probe hybridized to only one band for each restriction enzyme tested, indicating that the azoreductase gene exists as a single copy gene on the chromosome.


View larger version (95K):
[in this window]
[in a new window]
 
Fig. 7.   Hybridization pattern of the Dig-labeled 1.2-kbp EcoRI fragment encoding azoreductase to the Bacillus sp. OY1-2 genomic DNA fragment. The restriction enzymes are: lane 1, XbaI; lane 2, SmaI; lane 3, SalI; lane 4, PstI; lane 5, HindIII; lane 6, EcoRI; lane 7, BamHI.

Expression of the Azoreductase in E. coli-- The entire open reading frame of the azoreductase gene was amplified by PCR using pUC18-AZR5-8 as a template, was inserted into expression vectors pTrx-Fus and pTrcNd, and was transformed into E. coli to express recombinant azoreductase (Fig. 8A). The expression of azoreductase was observed not in pTrcNd but in pTrx-Fus (data not shown). The reason that the azoreductase was expressed only by the pTrx-Fus system is not clear although it might be attributed to the different promoters as follows: the PL-Trp promoter used in pTrx-Fus can be controlled strictly by lambda cI repressor and tryptophan starvation, whereas the control of the trc promoter (fusion promoter of T5 phage promoter and lactose operator, inducible by addition of IPTG) used in pTrcNd is more leaky than the PL-Trp promoter. The expressed azoreductase may have a negative effect on the growth or survival of E. coli and inhibit the colony formation of transformed E. coli in the pTrcNd system.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 8.   Expression of azoreductase in E. coli. A, construction of recombinant azoreductase-expressing plasmid. The entire open reading frame of azoreductase was amplified by PCR and cloned into a TA cloning vector pT7Blue(R)T. After sequence confirmation, the DNA fragment excised by NdeI and XbaI was ligated with pTrx-Fus to make pTrx-AZR. B, E. coli GI618 was transformed with pTrx-Fus (lanes 1 and 2) or pTrx-AZR (lanes 3 and 4). Protein expression was induced by tryptophan. Arrow and arrowhead denote the recombinant azoreductase and thioredoxin, respectively. The positions of coelectrophoresed standards of known molecular mass are indicated.

The expressed azoreductase in plasmid (pTrx-Fus) in E. coli GI724 and GI618 was analyzed by SDS-PAGE to identify the protein with a molecular mass of 20 kDa (Fig. 8B). The 20-kDa protein on SDS-PAGE was then transferred onto a polyvinylidene membrane and subjected to N-terminal amino acid sequence determination. The resulting N-terminal amino acid sequence corresponds to the N-terminal amino acid sequence of native azoreductase. These results indicate that the recombinant protein obtained in this study was the same as the native azoreductase obtained from Bacillus sp. OY1-2.

Azo Dye-degrading Activity of Crude Recombinant Azoreductase-- The E. coli GI724 and GI618 expressing recombinant azoreductase were lysed by freezing and thawing followed by sonication. Recovery of supernatant fractions following centrifugation and SDS-PAGE analysis revealed larger amounts of recombinant azoreductase in the GI618 supernatant than the GI724 samples (data not shown). The activity of azoreductase in 5 µl of the sonic supernatant (containing 0.1 mg of protein) of GI618 was compared with that of original Bacillus sp. OY1-2. The azo dyes Roccelin, Solar Orange, and Sumifix Black B were used as substrates for this assay. These compounds were reduced into a colorless mixture by the azoreductase in the sonic supernatants. The reaction mixture consisted of 20 µM substrate, 20 mM sodium phosphate buffer, pH 7.0, 250 µM beta -NADPH. The azoreductase activity in the GI618 supernatant was ten times or more greater than that of Bacillus sp. OY1-2 (Fig. 9). These results indicate that the recombinant azoreductase expressed in E. coli contains a large amount of azoreductase activity.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 9.   Reduction of various azo dyes by cell extracts from Bacillus sp. OY2-1 and recombinant E. coli. The azoreductase activity was measured by reduction of optical density at suitable wave lengths for each dye. A, Rocceline; B, Sumifix Black B; C, Solar Orange. Filled circles and open squares represent the azo dye-degrading activity of recombinant and native azoreductases, respectively.

Purification of Recombinant Azoreductase from E. coli Lysate-- The recombinant azoreductase was purified from the supernatant of GI618 bacterial lysate by means of affinity purification by Red-Sepharose column chromatography. The recombinant azoreductase was eluted with 10 mM beta -NADH (Fig. 10A) and was purified in one step of column chromatography (Fig. 10B). In contrast, our standard protocol for purifying the azoreductase from the lysate of Bacillus sp. OY1-2 required four steps of column chromatography (DEAE-cellurofine, Blue-cellurofine, and Red-Sepharose followed by gel filtration, Ref. 10). However, as the amount of expressed recombinant azoreductase in E. coli in this system was very large, only the Red-Sepharose column chromatography was necessary to obtain purified azoreductase of the same quality. Thus, the azoreductase expression system designed in this study may make it possible to obtain large amounts of purified azoreductase in a very simple manner.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 10.   Purification of recombinant azoreductase. Experimental details are described under "Experimental Procedures." A, elution profile of azoreductase by Red-Sepharose CL-6B. L, loading lysate; W, washing by 20 mM sodium phosphate buffer, pH7.2; E, elution of proteins by 20 mM sodium phosphate buffer, pH 7.2, containing 10 mM beta -NADPH. B, SDS-PAGE analysis: lane 1, E. coli cell; lane 2, beta -NADPH eluate; and lane 3; purified native azoreductase.

Azo Dye-reducing Activity of Recombinant Azoreductase-- The eluate obtained by NADH elution from Red-Sepharose was then dialyzed against 20 mM sodium phosphate buffer, pH 7.0 and used in the azoreductase enzyme assay. The enzyme assay was performed at different reaction temperatures from 20 to 85 °C in a reaction mixture containing 20 µM Roccelin and 250 µM beta -NADPH. The maximum specific activity of recombinant azoreductase (7.60 µmoles/min/mg protein) was achieved at 50 °C whereas that of native enzyme (11.7 µmoles/min/mg protein) was achieved at 70 °C (Fig. 11). The maximal specific activity of recombinant azoreductase was 1.54 times lower and the optimal temperature was 20 °C lower than that of the native form. These results indicate that the temperature stability of recombinant azoreductase was lower than that of the native enzyme. The reason why the temperature stability of recombinant enzyme declined was not defined in this study, but will be elucidated in future studies.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 11.   Comparison of the activities of purified native and recombinant azoreductase at different temperatures. Experimental details are described under "Experimental Procedures." Filled circles and open squares represent the azo dye-degrading activity of recombinant and native azoreductase, respectively.

Kinetic analysis was performed with different concentrations of substrates at 25 °C in a reaction mixture consisting of 20 mM sodium phosphate buffer, pH 7.0, 20 mM beta -NADPH, and native and recombinant enzymes. The value of Vmax and Km for three dyes were estimated by nonlinear regression analysis (Fig. 12). The Vmax/Km value of recombinant azoreductase for Rocceline was 3.03, which is very close to 2.78 of the native enzyme. Similar observations were found with other substrates (Sumifix Black B, 0.15 and 0.14; Solar Orange, 0.013 and 0.014; by native and recombinant azoreductase, respectively). The efficiency (Vmax/Km) for Rocceline was about 20- and 200-fold greater than for Sumifix Black B and Solar Orange, respectively, indicating that the former substrate was better than the others. Considering the structure of dyes used in this study (Fig. 3), the compounds with paired naphthalene groups coupled with the azo group may serve as good substrates. This should be clarified in future studies.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 12.   Kinetic analysis of native and recombinant azoreductase for three azo dyes. The kinetic analysis was performed with different concentrations of substrates at 25 °C. The values of Vmax and Km for three dyes were estimated by nonlinear regression analysis using the KaleidaGraph program. A, Rocceline was used as a substrate. B, Sumifix Black B was used as a substrate. C, Solar Orange was used as a substrate. Kinetic curves of recombinant and native azoreductase are shown with filled circles in dotted lines and open squares in solid lines, respectively.

Heiss et al. (21) described the cloning of DNA from a Rhodococcus strain that confers the ability of decolorizing azo dyes. However, no characterization of the gene was presented in his study. Recently, the azoreductase gene was cloned from an anaerobic bacteria Clostridium perfringens (lambda gt11 genomic library) by means of screening with an antibody raised against purified azoreductase (10). Rafii and Coleman (10) observed azoreductase activity in cell lysates of lytic and lysogenic E. coli cultures infected with recombinant phage. In addition, they have demonstrated the existence of a similar gene in some anaerobic bacteria with Southern hybridization techniques. As the nucleotide sequence of the azoreductase of C. perfringens was not presented in the study, it is not clear whether the enzyme involved in the reduction of azo dye in C. perfringens has some homology with the azoreductase gene cloned in this study. This should be investigated in the future. However, with regard to waste-water treatment plant construction using azoreductases, reduction of azo dyes under the aerobic conditions reported in this study is more practical. Thus, the azoreductase gene cloned and characterized in this study may be a good candidate for construction of a bioreactor for the treatment of azo dye-containing waste-water.

    ACKNOWLEDGEMENTS

We thank Dr. Tsutomu Shimada for his kind discussions on the kinetic studies.

    FOOTNOTES

* This work was supported by a cooperative research project of Osaka Prefectural Government on Advanced Technology.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the DDBJ GenBankTM/EBI Data Bank With accession number(s) AB002631.

§ To whom correspondence should be addressed. Tel.: 81-6-6972-1321(ext. 268); Fax: 81-6-6972-0772; E-mail: suzuki@iph.pref.osaka.jp.

Published, JBC Papers in Press, December 27, 2000, DOI 10.1074/jbc.M008083200

1 W. Sugiura, T. Mamashita, T. Yokoyama, and M. Arai, manuscript in preparation.

    ABBREVIATIONS

The abbreviations used are: PAGE, polyacrylamide gel electrophoresis; kbp, kilobase pairs; ORF, open reading frame; PCR, polymerase chain reaction; Dig, digoxigenin.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

1. Zollinger, H. (1987) Color Chemistry-Synthesis, Properties and Applications for Organic Dyes and Pigments , pp. 92-102, VCH Publishers, Inc., NY
2. Meyer, U. (1981) FEMS symp. 12, 371-385
3. Schultze-Rettmer, R. (1996) Texiliveredlung 31, 13-18
4. Levine, W. G. (1991) Drug Metab. Rev. 23, 253-309
5. Kulla, H. G. (1981) in Microbial Degradation of Xenobiotics and Recalcitrant Compounds (Leisinger, T. , Cook, A. M. , Hutter, R. , and Nuesch, R., eds) , pp. 387-399, Academic Press Ltd., London, United Kingdom
6. Haug, W., Schmidt, A., Nortemann, B., Hempel, D. C., Stolz, A., and Knackmuss, H. J. (1991) Appl. Environ. Microbiol. 57, 3144-3149
7. Paszczynski, A., Pasti-Grigsby, M. B., Goszczynski, S., Crawford, R. L., and Crawford, D. L. (1992) Appl. Environ. Microbiol. 58, 3598-3604
8. Tan, N. C., Prenafeta-Boldu, F. X., Opsteeg, J. L., Lettinga, G., and Field, J. A. (1999) Appl. Microbiol. Biotechnol. 51, 865-871
9. Sugiura, W., Mamashita, T, Yokoyama, T., and Arai, M. J (1999) Biosci. Bioeng. 88, 577-581
10. Rafii, F., and Coleman, T. (1999) J. Basic Microbiol. 39, 29-35
11. Suzuki, Y., Katsukawa, C., Inoue, K., Yin, Y. P., Tasaka, H., Ueba, N., and Makino, M. (1995) J. Japan. Assoc. Infect. Dis. 69, 413-419
12. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467
13. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1987) Current Protocols in Molecular Biology , John Wiley & Sons, Inc., New York
14. Southern, E. M. (1975) J. Mol. Biol. 98, 503-517
15. Pasti-Grigsby, M. B., Paszczynski, A., Goszczynski, S., Crawford, D. L., and Crawford, R. L (1992) Appl. Environ. Microbiol. 58, 3605-3613
16. Shimada, T., Tsumura, F., Gillam, E. M., Guengerich, F. P., and Inoue, K. (2000) Protein Expr. Purif. 20, 73-80
17. Shine, J., and Dalgarno, L. (1974) Proc. Natl. Acad. Sci. U. S. A. 71, 1342-1346
18. Kim, S. F., Baek, S. J., and Pack, M. Y. (1991) Appl. Environ. Microbiol. 57, 2413-2417
19. McKie, J. H., Jaouhari, R., Douglas, K. T., Goffner, D., Feuillet, C., Grima-Pettenati, J., Boudet, A. M., Baltas, M., and Gorrichon, L. (1993) Biochim. Biophys. Acta 1202, 61-69
20. Bragg, P. D., Glavas, N. A., and Hou, C. (1997) Arch. Biochem. Biophys. 338, 57-66
21. Heiss, G. S., Gowan, B., and Dabbs, E. R. (1992) FEMS Microbiol. Lett. 78, 221-226


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
K. Ito, M. Nakanishi, W.-C. Lee, Y. Zhi, H. Sasaki, S. Zenno, K. Saigo, Y. Kitade, and M. Tanokura
Expansion of Substrate Specificity and Catalytic Mechanism of Azoreductase by X-ray Crystallography and Site-directed Mutagenesis
J. Biol. Chem., May 16, 2008; 283(20): 13889 - 13896.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
S. L. A. Andrade, E. V. Patridge, J. G. Ferry, and O. Einsle
Crystal Structure of the NADH:Quinone Oxidoreductase WrbA from Escherichia coli
J. Bacteriol., December 15, 2007; 189(24): 9101 - 9107.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
Y. Hong, M. Xu, J. Guo, Z. Xu, X. Chen, and G. Sun
Respiration and Growth of Shewanella decolorationis S12 with an Azo Compound as the Sole Electron Acceptor
Appl. Envir. Microbiol., January 1, 2007; 73(1): 64 - 72.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Ito, M. Nakanishi, W.-C. Lee, H. Sasaki, S. Zenno, K. Saigo, Y. Kitade, and M. Tanokura
Three-dimensional Structure of AzoR from Escherichia coli: AN OXIDEREDUCTASE CONSERVED IN MICROORGANISMS
J. Biol. Chem., July 21, 2006; 281(29): 20567 - 20576.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
M.-S. Jang, Y.-M. Lee, C.-H. Kim, J.-H. Lee, D.-W. Kang, S.-J. Kim, and Y.-C. Lee
Triphenylmethane Reductase from Citrobacter sp. Strain KCTC 18061P: Purification, Characterization, Gene Cloning, and Overexpression of a Functional Protein in Escherichia coli
Appl. Envir. Microbiol., December 1, 2005; 71(12): 7955 - 7960.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
H. Chen, S. L. Hopper, and C. E. Cerniglia
Biochemical and molecular characterization of an azoreductase from Staphylococcus aureus, a tetrameric NADPH-dependent flavoprotein
Microbiology, May 1, 2005; 151(5): 1433 - 1441.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Liger, M. Graille, C.-Z. Zhou, N. Leulliot, S. Quevillon-Cheruel, K. Blondeau, J. Janin, and H. van Tilbeurgh
Crystal Structure and Functional Characterization of Yeast YLR011wp, an Enzyme with NAD(P)H-FMN and Ferric Iron Reductase Activities
J. Biol. Chem., August 13, 2004; 279(33): 34890 - 34897.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
J. Maier, A. Kandelbauer, A. Erlacher, A. Cavaco-Paulo, and G. M. Gubitz
A New Alkali-Thermostable Azoreductase from Bacillus sp. Strain SF
Appl. Envir. Microbiol., February 1, 2004; 70(2): 837 - 844.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
S. Blumel, H.-J. Knackmuss, and A. Stolz
Molecular Cloning and Characterization of the Gene Coding for the Aerobic Azoreductase from Xenophilus azovorans KF46F
Appl. Envir. Microbiol., August 1, 2002; 68(8): 3948 - 3955.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Nakanishi, C. Yatome, N. Ishida, and Y. Kitade
Putative ACP Phosphodiesterase Gene (acpD) Encodes an Azoreductase
J. Biol. Chem., November 30, 2001; 276(49): 46394 - 46399.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/12/9059    most recent
M008083200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Suzuki, Y.
Right arrow Articles by Sugiura, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Suzuki, Y.
Right arrow Articles by Sugiura, W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement