HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 276, Issue 12, 9214-9218, March 23, 2001

This Article Abstract Full Text (PDF) All Versions of this Article: 276/12/9214    most recent M008890200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Borén, J. Articles by Innerarity, T. L. Search for Related Content PubMed PubMed Citation Articles by Borén, J. Articles by Innerarity, T. L. Social Bookmarking                      What's this?

The Molecular Mechanism for the Genetic Disorder Familial Defective Apolipoprotein B100^*

Jan Borén^§, Ulf Ekström^¶, Bo Ågren, Peter Nilsson-Ehle^¶, and Thomas L. Innerarity^**

From the  Wallenberg Laboratory, Göteborg University, S-413 45 Göteborg, Sweden, the ^¶ Institute of Laboratory Medicine, Department of Clinical Chemistry, Lund University Hospital, 221 85 Lund, Sweden, the  Department of Internal Medicine, Helsingborg Hospital, 251 87 Helsingborg, Sweden, and the ^** Gladstone Institute of Cardiovascular Disease, Cardiovascular Research Institute, and Department of Pathology, University of California, San Francisco, CA 94141-9100

Received for publication, September 28, 2000, and in revised form, December 11, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Familial defective apolipoprotein B100 (FDB) is a genetic disorder in which low density lipoproteins (LDL) bind defectively to the LDL receptor, resulting in hypercholesterolemia and premature atherosclerosis. FDB is caused by a mutation (R3500Q) that changes the conformation of apolipoprotein (apo) B100 near the receptor-binding site. We previously showed that arginine, not simply a positive charge, at residue 3500 is essential for normal receptor binding and that the carboxyl terminus of apoB100 is necessary for mutations affecting arginine 3500 to disrupt LDL receptor binding. Thus, normal receptor binding involves an interaction between arginine 3500 and tryptophan 4369 in the carboxyl tail of apoB100. W4369Y LDL and R3500Q LDL isolated from transgenic mice had identically defective LDL binding and a higher affinity for the monoclonal antibody MB47, which has an epitope flanking residue 3500. We conclude that arginine 3500 interacts with tryptophan 4369 and facilitates the conformation of apoB100 required for normal receptor binding of LDL. From our findings, we developed a model that explains how the carboxyl terminus of apoB100 interacts with the backbone of apoB100 that enwraps the LDL particle. Our model also explains how all known ligand-defective mutations in apoB100, including a newly discovered R3480W mutation in apoB100, cause defective receptor binding.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The interaction between low density lipoprotein (LDL)¹ and the LDL receptor is fundamental for the regulation of plasma cholesterol in humans (1). The sole protein component of LDL is apolipoprotein (apo) B100, which serves as the ligand for the LDL receptor (2). We recently identified the sequence in apoB100 that interacts with the LDL receptor (3). However, the ability of apoB100 to interact with the LDL receptor depends not only on sequence, but also on conformation, because apoB100 binds to the LDL receptor only after the hydrolysis of triglyceride-rich very low density lipoproteins (VLDL) to smaller cholesterol-rich LDL (1).

Familial defective apoB100 (FDB) is a genetic disorder of LDL metabolism characterized by hypercholesterolemia and premature atherosclerosis (4, 5). Estimated to occur in 1/500 to 1/700 people in several Caucasian populations in North America and Europe, FDB is one of the most common single-gene defects known to cause an inherited abnormality (6, 7). Almost everyone with FDB is of European descent; in most cases, the CGG-to-CAG mutation in the codon for amino acid 3500 is on a chromosome with a rare haplotype at the apoB locus, suggesting that most probands descended from a common ancestor who lived in Europe about 6,750 years ago (8). The mutation substitutes glutamine for the normally occurring arginine at position 3500 (4). Except for a few cases in which tryptophan substitutes for arginine 3500 (9) or cysteine for arginine 3531 (10), leading to a minor decrease in LDL receptor binding, extensive searches have not revealed any other apoB100 mutations that cause defective receptor binding of LDL (10). Both of these mutations are located outside of the LDL receptor-binding site in apoB100 (residues 3359-3369).

Immunoelectronmicroscopy studies have shown that the first 89% of apoB100 enwraps the LDL particle like a belt and that the COOH-terminal 11% constitutes a bow that crosses over the belt, bringing the COOH-terminal portion of apoB100 close to amino acid 3500 (11). It is not certain where the carboxyl tail crosses over the belt, but the shortest path between the epitopes for residues 4154-4189 and 4507-4513 in the three-dimensional map of apoB100 created by Chatterton et al. (11) puts the crossover point somewhere around residues 4275-4400. This evidence is suggestive only, as no intervening epitopes on apoB were placed between residues 4154 and 4513 (11).

We recently reported that the COOH-terminal bow functions as a negative modulator of receptor binding and inhibits binding of VLDL to the LDL receptor (3). We also showed that arginine, and not simply a positive charge, at residue 3500 is critical for normal receptor binding and that the carboxyl terminus is necessary for the R3500Q mutation to disrupt LDL receptor binding (3). In this study, we sought to determine, at the molecular level, how arginine 3500 interacts with the carboxyl terminus of apoB100.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Generation of Truncated P1 Plasmids and Isolation of DNA Fragments for Mutagenesis-- The 95-kilobase apoB P1 plasmid p158 (12) was prepared and modified by RecA-assisted restriction endonuclease cleavage, as described by Borén et al. (13). A 4.7-kilobase fragment was isolated from the "apoB100 Leu-Leu" P1 plasmid with 60-mer oligonucleotides protecting the HindIII sites at positions 43,284 and 47,951.

Site-directed Mutagenesis of P1 DNA-- The 4.7-kilobase fragment was cloned into the pZErO vector (Invitrogen) and subjected to site-directed mutagenesis with the ExSite PCR System (Stratagene) with oligonucleotides "W4369Y upper" (5' ccaagtatagttggctacacagtgaaatattatg 3') and "W4369Y lower" (5' cataatatttcactgtgtagccaactatacttgg 3') to change tryptophan 4369 to tyrosine. The resulting plasmids were subjected to RecA-assisted restriction endonuclease cleavage with oligonucleotides HindIII-43284 and HindIII-47951, and the mutated 4.7-kilobase fragment was then ligated into the recipient linearized and phosphatased apoB100 Leu-Leu P1 vector (13).

Human ApoB Transgenic Mice-- P1 DNA was prepared and microinjected into fertilized mouse eggs (C57BL/6XSJL) (14). The two founders with the highest levels of plasma apoB were selected for breeding and further analysis.

Isolation of Recombinant Lipoproteins-- Recombinant LDL (d = 1.02-1.05 g/ml) were isolated by sequential ultracentrifugation and dialyzed against 150 mM NaCl and 0.01% EDTA, pH 7.4. Mouse apoE and apoB were removed by immunoaffinity chromatography with rabbit polyclonal antibodies against mouse apoB and apoE (3).

Cell Culture and Receptor Binding Assays-- Competitive receptor binding assays were performed as described by Arnold et al. (15). The amount of unlabeled lipoproteins needed to compete 50% with ¹²⁵I-labeled LDL after a 3-h incubation at 4 °C was determined from an exponential decay curve-fitting model (15).

Immunoassays of Human Recombinant R3500Q, W4369Y, and Control LDL-- Plate immunoassays were performed as described by Weisgraber et al. (16), as modified by Borén et al. (3).

Lipid Analysis of Plasma Lipoproteins-- Total cholesterol and triglyceride levels were measured in fresh plasma samples obtained after a 4-h fast.

Electrophoresis and Imunoblotting-- Electrophoresis was carried out on vertical Hoefer SE 600 3-15% polyacrylamide gradient slab gels containing sodium dodecyl sulfate (17). Each gel was run at 10 mA for 16 h at 4 °C. Separated proteins in the gels were transferred to nitrocellulose membranes at 0.3 mA/gel for 16 h at 4 °C in a Bio-Rad Trans-Blot Cell containing 25 mM Tris, 20% methanol, 192 mM glycine, pH 8.3. Western blotting was performed with the enhanced chemiluminescense Western blotting detection reagents (Amersham Pharmacia Biotech) as recommended by the manufacturer; anti-human apoB monoclonal antibody 1D1 was used as the primary antibody (18).

Patients-- The patients were recruited from the prospective Cardiovascular Risk Factors in Southern Sweden study.²

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Competitive Receptor Binding of LDL Containing Truncated Forms of ApoB-- LDL containing carboxyl-terminally truncated forms of apoB bind with an enhanced affinity to the LDL receptor (3, 19, 20). We reasoned that we could identify the COOH-terminal sequence of apoB100 that interacts with the belt of apoB100 by analyzing the receptor binding activity of LDL with different portions of the carboxyl tail truncated. The best estimate of where the carboxyl tail crosses over the backbone of apoB100 that enwraps the LDL particle puts the crossover point somewhere around residues 4275-4400 (11). Therefore, analysis of the receptor binding of LDL containing apoB-95 and apoB-97, which are truncated at residues 4330 and 4397, respectively, should indicate the sequence of the carboxyl tail that interacts with the apoB backbone. Recombinant LDL containing apoB95 and apoB97, and recombinant control LDL were isolated from human apoB transgenic mice (21), and the endogenous apoB and apoE were removed by immunoaffinity chromatography. The recombinant LDL contained nondegraded apoB without visible contamination by any other protein (Fig. 1). In a competitive receptor binding assay with ¹²⁵I-LDL, apoB-97 bound with the same affinity as normal control LDL, whereas LDL containing apoB95 bound with enhanced affinity (Fig. 2A): the ED₅₀ values were 1.4, 2.8, and 2.9 µg/ml, respectively. These results indicated that an amino acid residue between 4330 and 4397 normally interacts with arginine 3500. 

View larger version (29K): [in this window] [in a new window]   Fig. 1.   Analysis of recombinant LDL. Recombinant LDL (d = 1.02-1.05 g/ml) from five lines of human apoB transgenic mice were isolated by sequential ultracentrifugation and subjected to immunoaffinity chromatography to remove endogenous mouse apoB and apoE. A, apoB100 (5 µg) from human plasma LDL (lane 1) or recombinant LDL (lanes 2-6) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis on 3-15% gradient gels and visualized by Coomassie staining. B, unpurified LDL and purified recombinant LDL (1 µg each) were analyzed by Western blots with monoclonal antibody 1D1 against human apoB.

View larger version (22K): [in this window] [in a new window]   Fig. 2.   Competitive receptor binding assay of recombinant LDL. The abilities of recombinant control, apoB97, and apoB95 LDL (A) or recombinant control, R3500Q, and W4369Y LDL (B) to compete with 125I-labeled human plasma LDL (2 µg/ml) for binding to LDL receptors on normal human fibroblasts were determined. The recombinant lipoproteins were isolated from 23 mice, and endogenous apoE and apoB were removed by affinity chromatography. Competitor LDL were added at the indicated protein concentrations to normal human fibroblasts, and the amount of 125I-LDL bound to the fibroblasts was measured after a 3-h incubation at 4 °C. Human plasma LDL were included as control. Each data point represents the mean of two independent experiments, each performed in duplicate.

Competitive Receptor Binding of Human Recombinant R3500Q, W4369Y, and Control LDL-- We next sought to identify the residue(s) that arginine 3500 interacts with on the carboxyl terminus of apoB100. The finding that lysine could not substitute for arginine at residue 3500 (3) was revealing, because arginine, but not lysine, can bind to tryptophan through a surprisingly strong cation-pi interaction (22-24). Thus, the result suggested that arginine 3500 interacts with a tryptophan and that this interaction is critical for normal LDL receptor binding. Of the 37 tryptophans in apoB100, only one, tryptophan 4369, is located between amino acids 4330 and 4397. Moreover, tryptophan 4369, together with arginine 3500, is conserved in all species in which apoB has been sequenced (human, rat, pig, chicken, and mouse) (25).

We substituted a tyrosine for tryptophan 4369 (W4369Y) and generated transgenic mice expressing recombinant LDL. Recombinant control LDL and LDL containing the W4369Y or R3500Q mutation were isolated from human apoB transgenic mice. Western analysis confirmed that all endogenous apoB and apoE had been removed by immunoaffinity purification (data not shown). The isolated W4369Y, R3500Q, and recombinant control LDL had identical lipid compositions (data not shown) and, as shown by negative staining electron microscopy, had the same particle diameters as human plasma LDL (22.3 ± 2.5, 20.3 ± 2.0, and 21.5 ± 2.7 versus 20.9 ± 3.2 nm, respectively). However, in an in vitro competitive receptor binding assay (Fig. 2B), recombinant control LDL had receptor binding similar to that of plasma LDL (ED₅₀ 2.3 and 1.5 µg/ml, respectively), whereas recombinant LDL with the W4369Y mutation displayed defective receptor binding, as did recombinant LDL with the R3500Q mutation (3) (ED₅₀ >20 µg/ml in both cases).

Immunoassays of Human Recombinant R3500Q, W4369Y, and Control LDL-- The R3500Q mutation increases the affinity of the apoB monoclonal antibody MB47 for FDB LDL (16). This antibody has a discontinuous epitope that flanks amino acid 3500 (amino acids 3429-3453 and 3507-3523 of apoB100 (26)). To determine whether the W4369Y mutation changes the conformation of apoB100 in the vicinity of this epitope, we isolated recombinant control LDL and recombinant LDL containing apoB100 with the W4369Y or R3500Q mutation. In a solid-phase radioimmunoassay (Fig. 3), MB47 had a higher affinity for both recombinant W4369Y and R3500Q LDL (ED₅₀ 75.1 and 74.3 ng, respectively) than for recombinant control LDL (ED₅₀ 110.5 ng). Therefore, the loss of arginine 3500 or tryptophan 4369 results in a conformational change and disrupted receptor binding, two of the biochemical characteristics of FDB.

View larger version (16K): [in this window] [in a new window]   Fig. 3.   MB47 immunoassays of human recombinant LDL. The abilities of recombinant control LDL, recombinant R3500Q LDL, and recombinant W4369Y LDL to bind to MB47 monoclonal antibody were determined. The recombinant LDL were isolated from 25 mice each and analyzed in a solid-phase competitive radioimmunoassay after removal of endogenous apoE and apoB.

Competitive Receptor Binding of Heterozygous R3480W LDL-- As part of the Cardiovascular Risk Factors in Southern Sweden study, patients with hypercholesterolemia were screened for sequence variations in the LDL receptor and apoB genes that could affect cholesterol plasma concentrations. Three different types of mutations in the apoB gene were found: R3500Q, R3531C, and a previously undescribed mutation, R3480W, in which arginine 3480 is replaced with tryptophan. To determine the impact of this mutation on LDL receptor binding, heterozygous R3480W LDL were isolated from a subjectively healthy 45-year old man with mild to moderate hypercholesterolemia. When compared with control plasma LDL in competitive receptor binding assays, the R3480W LDL bound defectively to LDL receptors (Fig. 4). The ED₅₀ values for human plasma LDL and R3480W LDL were 2.2 and 8.1 µg/ml, respectively.

View larger version (17K): [in this window] [in a new window]   Fig. 4.   Competitive receptor binding assay of R3480W LDL. The ability of R3480W LDL to compete with normal 125I-labeled LDL (2 µg/ml) for binding to LDL receptors on normal human fibroblasts was determined. Competitor LDL were added at the indicated concentrations to cultures of normal human fibroblasts. After a 3-h incubation, the amount of 125I-LDL bound to the fibroblasts was measured. Human plasma LDL was included as control, and plasma LDL modified with 1,2-cyclohexadione (CHD LDL) was included as a negative control. Each data point represents the mean of two independent experiments, each performed in duplicate.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

In this study, we investigated the molecular mechanism underlying the interaction of arginine 3500 with the carboxyl terminus of apoB100. Our results showed that recombinant W4369Y LDL and R3500Q FDB LDL were equally defective in binding to LDL receptors and, perhaps more significantly, had the same conformational change around the receptor-binding domain, as detected by increased affinity for the antibody MB47. The MB47 epitope lies ~850 residues away from tryptophan 4369 (26). The observation that the W4369Y and R3500Q mutations have the same phenotype is a powerful argument for the importance of the R3500-W4369 interaction in facilitating the proper conformation of apoB100 for normal receptor binding of LDL. An interaction between arginine 3500 and tryptophan 4369 also explains why the naturally occurring R3500W mutation causes somewhat less defective LDL receptor binding than the R3500Q mutation (7). Tryptophan 3500 can interact weakly with tryptophan 4369, whereas this interaction is entirely disrupted by a glutamine at position 3500 (7).

We developed a model of how the COOH-terminal bow interacts with the backbone of apoB100 that enwraps the LDL particle (Fig. 5). Our model predicts that arginine 3500 interacts with tryptophan 4369 and that this interaction is essential for correct conformation of the COOH-terminal tail of apoB100. The disruption of this interaction results in a conformational change, disrupted receptor binding, and the clinical disorder FDB. LDL containing apoB95 lack the carboxyl tail that crosses over the belt and therefore have enhanced receptor binding; in contrast, apoB97 LDL contain tryptophan 4369 and bind normally (Fig. 5). Morphological support for the model was recently presented by Gantz et al. (27), who showed that a proportion of sodium deoxycholate-solubilized apoB100 LDL contained loops of a size that correlates with the dimensions of a COOH-terminal loop stabilized by an interaction between arginine 3500 and tryptophan 4369. 

View larger version (72K): [in this window] [in a new window]   Fig. 5.   Model of LDL receptor binding. Normal receptor binding in apoB100 depends on an interaction between arginine 3500 and tryptophan 4369 (R3500-W4369). Mutation of the arginine (FDB mutation) or the tryptophan (FDB-like mutation) disrupts receptor binding. The R3500-W4369 interaction is essential for the correct folding of the carboxyl terminus of apoB100 to permit normal interaction between LDL and its receptor, but this interaction is not as favorable for receptor binding as removing the carboxyl tail. LDL with apoB97 have normal receptor binding, whereas LDL with apoB95 lack a carboxyl tail and therefore have enhanced receptor binding. Tryptophan 4369 interacts not only with arginine 3500, but also with arginine 3480 and arginine 3531. Site B (i.e. residues 3359-3369) is the receptor-binding site.

Our model further implies that tryptophan 4369 interacts with arginines in addition to arginine 3500 in apoB100 during the conversion of VLDL to LDL. Only four naturally occurring mutations in apoB100 have been unequivocally linked to defective LDL receptor binding and hypercholesterolemia: R3500Q (28), R3500W (9), R3531C (10), and R3480W (the novel mutation characterized in this study). All four mutations are located within a stretch of 51 amino acids and result in the loss of an arginine.

How does the disrupted interaction between any of these arginines and tryptophan 4369 give rise to defective LDL receptor binding? The key observation is that FDB LDL have an altered conformation in the region around the receptor-binding domain, as demonstrated by both MB47 antibody studies and ¹³C nuclear magnetic resonance analysis (16, 29). Furthermore, the finding that FDB LDL bind normally to proteoglycans rules out the possibility that the COOH-terminal bow interferes with the LDL receptor-binding site directly, since the principal proteoglycan-binding site of apoB100 coincides with the LDL receptor-binding site (30).

We propose that arginine-tryptophan interactions are crucial during the conversion of VLDL to LDL for positioning apoB100's carboxyl tail, which functions as a modulator element that inhibits VLDL from interacting with the LDL receptor (3), to permit apoB100 on LDL to bind normally to the receptor. A disturbed refolding process gives rise to the two characteristics of FDB: a defective conformation of apoB100 and hypercholesterolemia due to ligand-binding-defective apoB100. Interestingly, Milne and co-workers (31) recently showed that two specific regions located near the carboxyl terminus of apoB100 (between residues 4342 and 4536) and close to the LDL receptor binding site undergo a major conformational change as VLDL are converted to small LDL.

The finding that tryptophan 4369 is crucial for the correct conformation of apoB100 is interesting in light of recent findings regarding the oxidation of tryptophans in apoB. Tryptophan oxidation has been assumed to be an early event, possibly an elementary reaction, in the initiation of LDL oxidation (32-38). Oxidation may affect the structure and the biological properties of the tryptophans, and it is reasonable to speculate that oxidation of tryptophan 4369 could disrupt the binding of LDL to its receptor.

	ACKNOWLEDGEMENTS

We thank Dr. Fred Cohen for pointing out the likelihood of an arginine-tryptophan interaction and Drs. Sven-Olof Olofsson and Stanley C. Rall for constructive discussions. We also thank K. Arnold and A. Lidell for excellent technical assistance and G. Howard and S. Ordway for editorial assistance.

	FOOTNOTES

^* This work was supported by the Swedish Medical Research Council (12576, 12563, and 04966); The Swedish Foundation for Strategic Research; The Swedish Heart-Lung Foundation; Gorton's Foundation; and NHLBI, National Institutes of Health Grant HL-47660.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ To whom correspondence should be addressed: Wallenberg Laboratory, Sahlgrenska University Hospital, Göteborg University, S-413 45 Göteborg, Sweden. Tel.: 46-31-3422949; Fax: 46-31-823762; E-mail: jan.boren@wlab.wall.gu.se.

Published, JBC Papers in Press, December 13, 2000, DOI 10.1074/jbc.M008890200

² U. Ekström, M. Abrahamson, L. Råstam, B. Ågren, and P. Nilsson-Ehle, submitted for publication.

	ABBREVIATIONS

The abbreviations used are: LDL, low density lipoproteins; FDB, familial defective apolipoprotein; apo, apolipoprotein; VLDL, very low density lipoproteins.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				L. A. Johnson, M. K. Altenburg, R. L. Walzem, L. T. Scanga, and N. Maeda Absence of Hyperlipidemia in LDL Receptor-Deficient Mice Having Apolipoprotein B100 Without the Putative Receptor-Binding Sequences Arterioscler. Thromb. Vasc. Biol., October 1, 2008; 28(10): 1745 - 1752. [Abstract] [Full Text] [PDF]

				K. E Liyanage, A. J Hooper, J. C Defesche, J. R Burnett, and F. M van Bockxmeer High-resolution melting analysis for detection of familial ligand-defective apolipoprotein B-100 mutations Ann Clin Biochem, March 1, 2008; 45(2): 170 - 176. [Abstract] [Full Text] [PDF]

				G. Zheng, J. Chen, H. Li, and J. D. Glickson Rerouting lipoprotein nanoparticles to selected alternate receptors for the targeted delivery of cancer diagnostic and therapeutic agents PNAS, December 6, 2005; 102(49): 17757 - 17762. [Abstract] [Full Text] [PDF]

				M. Benn, B. G. Nordestgaard, J. S. Jensen, K. Nilausen, H. Meinertz, and A. Tybjaerg-Hansen Mutation in Apolipoprotein B Associated with Hypobetalipoproteinemia Despite Decreased Binding to the Low Density Lipoprotein Receptor J. Biol. Chem., June 3, 2005; 280(22): 21052 - 21060. [Abstract] [Full Text] [PDF]

				J. Wang, M. R. Ban, and R. A. Hegele Multiplex ligation-dependent probe amplification of LDLR enhances molecular diagnosis of familial hypercholesterolemia J. Lipid Res., February 1, 2005; 46(2): 366 - 372. [Abstract] [Full Text] [PDF]

				A. J. Whitfield, P. H. R. Barrett, F. M. van Bockxmeer, and J. R. Burnett Lipid Disorders and Mutations in the APOB Gene Clin. Chem., October 1, 2004; 50(10): 1725 - 1732. [Abstract] [Full Text] [PDF]

				M. A. Austin, C. M. Hutter, R. L. Zimmern, and S. E. Humphries Genetic Causes of Monogenic Heterozygous Familial Hypercholesterolemia: A HuGE Prevalence Review Am. J. Epidemiol., September 1, 2004; 160(5): 407 - 420. [Abstract] [Full Text] [PDF]

				P. Jirholt, M. Adiels, and J. Boren How Does Mutant Proprotein Convertase Neural Apoptosis-Regulated Convertase 1 Induce Autosomal Dominant Hypercholesterolemia? Arterioscler. Thromb. Vasc. Biol., August 1, 2004; 24(8): 1334 - 1336. [Full Text] [PDF]

				M. E. Hinsdale, P. M. Sullivan, H. Mezdour, and N. Maeda ApoB-48 and apoB-100 differentially influence the expression of type-III hyperlipoproteinemia in APOE*2 mice J. Lipid Res., September 1, 2002; 43(9): 1520 - 1528. [Abstract] [Full Text] [PDF]

				C. Flood, M. Gustafsson, P. E. Richardson, S. C. Harvey, J. P. Segrest, and J. Boren Identification of the Proteoglycan Binding Site in Apolipoprotein B48 J. Biol. Chem., August 23, 2002; 277(35): 32228 - 32233. [Abstract] [Full Text] [PDF]

				B. S. Sachais, A. Kuo, T. Nassar, J. Morgan, K. Kariko, K. J. Williams, M. Feldman, M. Aviram, N. Shah, L. Jarett, et al. Platelet factor 4 binds to low-density lipoprotein receptors and disrupts the endocytic itinerary, resulting in retention of low-density lipoprotein on the cell surface Blood, May 15, 2002; 99(10): 3613 - 3622. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 276/12/9214    most recent M008890200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Borén, J. Articles by Innerarity, T. L. Search for Related Content PubMed PubMed Citation Articles by Borén, J. Articles by Innerarity, T. L. Social Bookmarking                      What's this?