 |
INTRODUCTION |
DNA replication is carried out by the replisome, a multiprotein
complex able to carry on strand separation, primer synthesis, and a
rapid, accurate, and concerted synthesis of the continuous and
discontinuous strands. At the onset of replication, replisome assembly
is generally orchestrated by a protein or a multiprotein complex called
initiator. The initiator recognizes and binds specific or preferential
sites in DNA molecules (the origin), melts these regions by causing a
structural distortion of the DNA, and initiates the loading of the
replisome through protein-protein interactions.
The most thoroughly characterized initiator is the Escherichia
coli DnaA protein, which possesses conserved homologues in all
known bacteria (see for review Ref. 1). Various properties have been
attributed to DnaA, such as sequence-specific DNA binding, oligomerization, protein-protein interactions, membrane binding, ATP
and ADP binding, and ATPase activity (1, 2). At the onset of chromosome
replication, the ATP-bound form of DnaA binds as a monomer to the
chromosomal origin at five
9-bp1 repeated sequences
called DnaA boxes. It then oligomerizes to form a large nucleoprotein
structure containing 20-40 DnaA molecules. The structure confers
single-stranded character to a flanking AT-rich region (13-mer),
forming an intermediate termed the open complex (3). The process
requires negative supercoiling, either IHF or HU, and is
activated by transcription and possibly by a direct interaction between
DnaA and the AT-rich region (4). DnaA, with the help of DnaC, then
recruits the host DNA helicase DnaB to the exposed single-stranded
region. DnaB enlarges the unwound region and subsequently loads alone
or together with DnaA the primase DnaG and the DNA polymerase III (3,
5-7).
Initiators of plasmid and viral
replicons, form, like DnaA, an open
complex at their cognate origins to recruit the replisome (8-10). Open
complex formation occurs via specific binding of the initiator to
repeated sequences (the iterons), oligomerization of the initiator, and
eventually local DNA distortions such as bending, untwisting, or
wrapping. However, this formation generally also requires DnaA and the
help of cofactors including structural proteins (IHF, Fis, HU,
SSB) or structural DNA determinants (intrinsically bent DNAs,
AT-rich regions, sequences of natural instability such as DNA unwinding
elements, or supercoiling of the DNA; reviewed in Refs. 11 and 12).
Aside from the apparent consensual role of the initiators in origin
binding and denaturation, variations occur in their ability to
participate in steps after open complex formation. Some initiators (but
not all) act similarly to DnaA, as a "landing pad" for replisome
assembly. For instance, the UL9 initiator of herpes simplex virus-1
interacts with the cellular DNA polymerase-
primase, the
helicase-primase complex, and the processivity polymerase factor (13).
Likewise, the plasmid initiators
of R6K and RepA of pSC101 are
known or supposed to interact with DnaA, the replicative helicase DnaB,
the primase DnaG, and the
subunit of DNA polymerase III (14-16).
Initiators can also be helicases (T-antigen of simian virus 40 (17),
UL9 of herpes simplex virus-1 (18), or E1 protein of papillomavirus
(19)), whereas others are primases (Rep of ColE2 (20)) or seem to have no extra activities apart from origin binding, bending, and melting (TrfA of RK2 (21)).
replicons that do not code for any initiator protein are a
noticeable exception to this general scheme. They still initiate DNA
replication at preferential sites, but these origins do not carry the
relevant features usually found in the initiator-dependent replicons (see above). The initiation mechanism of these systems, such
as the E. coli plasmid ColE1, phages T4, or T7 and the
mitochondrial DNA of metazoans, mainly relies on the RNA polymerase
(RNA pol), which provides the initial primer for DNA synthesis (22). In phage T7, RNA pol stops at the origin by an unknown mechanism, and the
arrested transcript serves as a primer to initiate DNA synthesis. In
ColE1, phage T4, and mitochondrial DNA replication, although RNA pol
transcribes the origin, an R-loop is formed. The RNA strand of the
R-loop is then processed by a RNaseH activity into the primer used to
initiate leading strand synthesis. In ColE1, the primer is extended by
Pol I, which unwinds the downstream region, leading to formation of
D-loop structures, allowing, successively, recruitment of PriA or
DnaABC primosomes and of full replisome (23, 24).
Another exception to the general scheme of initiation is plasmids of
the pAM
1 family from Gram-positive bacteria. Although they encode an
initiator protein, they require for replication a small unstructured
origin and a transcription step through the origin by the host RNA pol
(25, 26). Furthermore, they are dependent on Pol I and independent of
DnaA (25, 27, 28). The small origin (44 bp) does not possess some of
the features found in other initiator-dependent plasmids,
such as iterons, to allow binding of more than one monomer. However, it
contains a 16-bp-long AT-rich region (88% AT against 68% for the
whole origin). This AT-rich region is located immediately downstream from the initiation site of replication, itself located in the middle
of the origin (29). The functions of both the transcription step and
the initiator are unknown. The initiator, RepE, is a basic protein of
496 amino acids with no homologues in the data bases and no specific
recognizable features (such as ATPase or helicase motives) other than a
DNA binding motif (71% probability for a helix-turn-helix motif,
according to the Dodd and Egan algorithm (30)) in the C-terminal
region. The initial phase of pAM
1 replication has been characterized
to a certain extent. First, DNA replication is unidirectional. Second,
mRNA originating upstream from the origin and synthesized
codirectionally to DNA replication terminates at the initiation site of
DNA replication, forming possible primers for leading strand synthesis
(26). Third, the leading strand primer is used by Pol I to generate
D-loop structures (~200 bp long) that are used as a signal for entry
of the host PriA-dependent primosome
(31-33).2 It is thought that
the primosome directs replisome assembly through the general mechanism
of replication fork rescue (34). These observations provide some
indirect information on RepE functions as follows. (i) RepE might
recognize the origin and play a role in mRNA maturation, since
mRNA ending at the initiation site requires the intact origin and
an active RepE and (ii) RepE is an unlikely landing pad for replisome
assembly, as this task seems to be ensured by the
PriA-dependent primosome.
As a first step in unraveling how RepE functions, we purified it to
near homogeneity and analyzed its interactions with different nucleic
acids. Results show that RepE binding to ori-containing supercoiled molecules leads to formation of an open complex in which
the 20-30 nt encompassing the initiation site of DNA replication and
downstream sequences are melted. An unexpected strong and nonspecific
ssDNA binding activity allows RepE to bind to the melted region of the
open complex. These results, which describe for the first time an open
complex at the origin of a
-replicating plasmid from a Gram-positive
bacterium, are discussed in terms of possible mode of action of RepE in
pAM
1 initiation mechanism.
 |
EXPERIMENTAL PROCEDURES |
Strains and Plasmids--
The strains used were E. coli MC1061 (F
araD139
(ara-leu)7696 galE15 galK16
(lac)X74 rpsL
(Strr) hsdR (rK
mK+) mcrA mcrB1) and Bacillus
subtilis 168, 1A224, and its isogenic polA5 mutant,
1A226, which have been described previously (25). Plasmids
pIL253, pHV1455, and pHV1455Rep* were described elsewhere (31, 33,
35).
To express and purify RepE, we constructed pCYB1repE using
the pCYB1 vector (IMPACT I system from New England Biolabs), which allows the expression under the control of the Ptac promoter of a
fusion between the C terminus of a target protein and the N terminus of
a self-cleavable intein/chitin binding domain (CBD) tag. The
repE open reading frame was amplified by PCR using pIL253 as
substrate and the following primers:
5'-gagggaattccatATGAATATCCCTTTTGTTGT-3' (containing an
NdeI site, underlined) and
5'-ggaattcgctcttccgcaGCCTGTATCATAGCTAAACAAATCG-3' (containing a SapI site). The PCR product was cloned into
the NdeI and SapI sites of pCYB1, allowing a
precise fusion between the last Gly codon of RepE gene and the N
terminus of the removable intein tag.
pBend2ori derives from pBend2 (36) by insertion of the
minimal 44-bp pAM
1 ori in the SalI site of the
polylinker, such as pAM
1 replication would proceed in the direction
of the ampicillin gene.
pGEMori mainly derives from pGEM-3Zf+ (Promega) by insertion
of a pAM
1 49-bp ori segment in the EcoRI site
of the polylinker, such as transcription from T7 promoter through the
origin would proceed in the direction of pAM
1 replication.
pMTL500E-ori corresponds to the construct 2 previously
described in Bruand and Ehrlich (26). pMTL500E-ori
1 and
-ori
2 correspond to pMTL500E-ori, except that
the 44-bp ori sequence has been replaced by deleted forms
truncated from the 3' end: the 36-bp ori
1 and 27-bp
ori
2, which sequences are shown in Fig.
7B.
Purification of the pAM
1 RepE Protein--
The
RepE-Intein-CBD fusion protein was cloned under the control of the
isopropyl-B-D-thiogalactoside-inducible Ptac
promoter, and the construct was introduced in E. coli cells.
Upon isopropyl-B-D-thiogalactoside induction, this
RepE-Intein-CBD fusion was overproduced to about 2.5% of total protein
and was mainly soluble. Typically, MC1061 cells newly transformed with
pCYBrepE were grown to mid log at 30 °C into 1 liter of
LB medium supplemented with 100 µg/ml ampicillin. At
A650 = 0.6, the culture was shifted to
25 °C, and RepE-Intein-CBD fusion expression was induced by the
addition of 1 mM isopropyl-B-D-thiogalactoside for 4 h. All the following operations were carried out at 0 to 4 °C. The cell pellet was resuspended in 25 ml of TENG (20 mM Tris-HCl, pH 8, 0.1 mM EDTA, 1000 mM NaCl, 10% glycerol), sonicated, and centrifuged to
yield a clear lysate. The lysate was loaded onto a 5-ml chitin resin
column (New England Biolabs), and unbound proteins were washed with 150 ml of TENG in which the NaCl concentration was increased to 2000 mM NaCl. To induce intein-mediated self-cleavage, the
immobilized fusion protein was incubated overnight with 100 mM DTT in TENG, resulting in the release of a wild type
RepE protein about 80% pure, whereas the intein-CBD fusion remained
bound to the column. Ammonium sulfate was added to RepE-containing
fractions in TENG to 50% saturation, and the precipitate was dissolved
in 1 ml of TENG. The solution was diluted with 20 mM
Tris-HCl, pH 8, 0.1 mM EDTA, 10% glycerol to a final
concentration corresponding to 200 mM NaCl immediately
before loading onto a 1-ml cation exchange Hi-Trap SP column (Amersham
Pharmacia Biotech) pre-equilibrated in TENG in which the NaCl
concentration was decreased to 200 mM NaCl. The column was
washed with the same buffer, and the absorbed proteins were eluted with
a step gradient at 640 mM NaCl (in a linear gradient, RepE
elutes at about 400 mM NaCl). This step allowed eliminating
the main contaminants and the DNA. Ammonium sulfate was added to the
pooled fractions to 50% saturation. The precipitate was dissolved in
0.22 ml of TENG and applied at 0.1 ml/min on a 25-ml gel filtration
Superdex 75 column (Amersham Pharmacia Biotech) equilibrated in 20 mM Tris-HCl, pH 8, 0.1 mM EDTA, 1000 mM NaCl. This chromatographic step allowed discarding traces of shorter contaminants and of some contaminating fusion protein. For storage, glycerol and NaCl were added to RepE fractions >95% pure to a final concentration of 20% and 1 M,
respectively. The protein was then stored in aliquots at
80 °C. No
loss of activity was observed after at least 1 year. Protein
concentrations were quantified using the Coomassie protein assay
reagent kit (Pierce) using BSA as a standard. Purity was estimated by
SDS-PAGE and SYPRO® red (Molecular Probes) staining
(sensitivity similar to that of silver staining).
To avoid aggregation and irreversible inactivation, RepE required
throughout the whole purification procedure the presence of 1 M NaCl in Tris-HCl buffer, pH 8, or in phosphate buffers at
or above pH 7.5 (insoluble aggregates are formed in phosphate buffers
below pH 7.5 and in HEPES or Bicine buffer at pH 8, whatever the salt
concentration used). However, temporary dilution at 200 mM
NaCl was tolerated. To determine the oligomerization state of RepE, gel
filtration chromatography on fast protein liquid chromatography system
(Amersham Pharmacia Biotech) was performed as indicated above (in 1 M NaCl), and only one peak corresponding to the monomer was
detected. The same chromatographic step performed at 50 mM
NaCl allowed us to detect both large aggregates and the monomeric form
of RepE.
DNA Substrates for Mobility Shift Assay--
The following
oligonucleotides were used to make substrates for the binding reaction
(uppercase letters indicate sequences from the minimal 44-bp pAM
1
ori; letters in bold in the 61-mer osmg28 series emphasize
the sequences that do not pair to the 61-mer osmg27). 75-mer
ori-W,
5'-gggcgaatcgcgtctgaaAATAAAACCCGCACTATGCCATTACATTTATATCTATGATACGTacgcgaattcgag-3'; 75-mer ori-W5',
5'-gggcgaatcgcgttgtttagctatgatacaggctgaaAATAAAACCCGCACTATGCCATTACAcgcgaattcgag-3'; 75-mer ori-W3',
5'-gggcgaatcgcgtATTTATATCTATGATACGTgtttgttttttctttgctgtttagcgaatgacgcgaattcgag-3'; 56-mer ori-W5',
5'-gggcgaatcgcgtctgaaAATAAAACCCGCACTATGCCATTACAcgcgaattcgag-3'; 45-mer
ori-W3',
5'-gggcgaatcgcgtATTTATATCTATGATACGTacgcgaattcgag-3'; 48-mer
ori-W,
5'-ctgaaAATAAAACCCGCACTATGCCATTACATTTATATCTATGATACG-3'; 75-mer
ori-C, 75-mer ori-C5', 75-mer ori-C3',
56-mer ori-C5', 45-mer ori-C3', 48-mer
ori-C, which are reverse complementary to 75-mer
ori-W, 75-mer ori-W5', 75-mer ori-W3'
56-mer ori-W5', 45-mer ori-W3' and 48-mer
ori-W, respectively. 61-mer osmg27, 5'-
gacgctgccgaattctaccagtgccttgctaggacatctttgcccacctgcaggttcaccc-3'; 61-mer osmg28-21,
5'-gggtgaacctgcaggtgggcggctgctcatcgtaggttagttggtagaattcggcagcgtc-3'; 61-mer osmg28-15,
5'-gggtgaacctgcaggtgggcaaatgctcatcgtaggttcactggtagaattcggcagcgtc -3'; 61-mer osmg28-9,
5'-gggtgaacctgcaggtgggcaaagattcatcgtagaggcactggtagaattcggcagcgtc -3'; 45-mer map121,
5'-ctatgagtcgcttttgtaaatttggcaggtactgccatatgctct-3'; 30-mer sda37:
5'-ctaatcaggagaattcgtaatcatggtcat-3'.
For the permutation assay, a set of DNA fragments of similar
length (179 to 183 bp) but with the origin located at various positions
relative to the fragment ends were isolated from pBend2ori either by digestion with different restriction enzymes (filled-in when
required by Klenow enzyme) or by PCR using pBend
(5'-tcaagaattcacgcg-3') and oriL4
(5'-AATAAAACCCGCACTATGCC-3') as primers.
The other double-stranded ori used were obtained by PCR
using either the 75-mer ori-W or 75-mer ori-C
oligonucleotide series as substrates and both 5'-gggcgaatcgcgt-3' and
5'-ctcgaattcgcgt-3' as primers or by annealing of the two complementary
oligonucleotides. The other non-ori dsDNAs used were the
76-bp fragment of pBR322 digested by MspI and filled-in by
Klenow enzyme or a 61-bp DNA obtained by annealing of 61-mer osmg27 and
its reverse complementary strand. The n-nt eye
substrates were obtained by annealing the 61-mer osmg27 oligonucleotide
with the 61-mer osmg28-n. All DNAs used were labeled using
either T4 polynucleotide kinase in the presence of
[
-32P]ATP (3000 Ci/mmol) or Klenow enzyme in the
presence of [
-32P]dATP (3000 Ci/mmol) and cold dCTP,
dGTP, and dTTP, as recommended by the suppliers.
Labeled 75-mer RNA ori-W, the perfect RNA counterpart of
75-mer ori-W, was obtained from pGEMori
linearized by EcoRI by in vitro transcription
from the T7 promoter using [32P]UTP. 75-bp RNA/DNA
ori was obtained by mixing labeled 75-mer RNA
ori-W and cold 75-mer ori-C in 50 mM
NaCl. The mixture was heated for 5 min at 85 °C and allow to cool
slowly to room temperature. The complete formation of the RNA/DNA
hybrid was verified during the gel retardation experiment, since 75-mer
RNA ori-W and 75-bp RNA/DNA ori clearly have
different mobilities.
Mobility Shift Assay--
Binding reactions were carried out in
10 µl of 10 mM Tris-HCl, pH 7.5, 70 mM NaCl,
2.5 mM MgCl2, 1 mM DTT, 5%
saccharose, 0.005% xylene cyanol, 0.3 mg/ml BSA, 10 µg/ml
poly(dI-dC), and 0.1-1 nM labeled DNA substrates unless
otherwise specified. Reaction mixtures were incubated at 20-25 °C
for 15 min and applied to a running 6% polyacrylamide gel (with either
a 1/29 or 1/80 ratio of bisacrylamide/acrylamide) in 25 mM
Tris base, 190 mM glycine, 1 mM EDTA. After
electrophoresis at 8 V/cm, the gel was dried and exposed to storage
phosphor screen. DNA was visualized on a Storm PhosphorImager
and quantified using ImageQuant software (Molecular Dynamics). The
equilibrium dissociation constants Kd for the
RepE-DNA interaction were determined by the method of Carey (37). For
this analysis we used a fixed input DNA concentration and various RepE
protein concentrations spanning 4 orders of magnitude. Because the DNA
concentration in the reaction mixture was much lower than the protein
concentration, Kd was approximated as the RepE
concentration needed for half-maximal binding of the DNA.
To measure the association rate, complex formation (between 2 nM radiolabeled 75-bp ori duplex containing the
44-bp minimal ori and 250 nM RepE) was quenched
at various times by the addition of 1 µM of unlabeled DNA
substrate. For the dissociation rate we let complexes between RepE and
labeled 75-bp ori form for 10 min, then 1 µM
of unlabeled DNA substrate was added, and the amount of complex
remaining in the reaction was measured as a function of time.
Preparation of 3' End Singly Labeled DNA Fragments--
To
obtain fragments labeled at only one end, pIl253 plasmid DNA was
digested with a first restriction enzyme (AseI for the top
strand and NheI for the bottom strand), filled in by the
Klenow enzyme (in the presence of [
-32P]dATP (3000 Ci/mmol), [
-32P]dCTP (3000 Ci/mmol), cold dGTP and
dTTP), and finally digested with a second restriction enzyme
(HaeII for the top strand and AseI for the bottom
strand). The labeled fragments of interest (220-bp
AseI-HaeII for the top strand and 167-bp
NheI-AseI for the bottom strand) were then
purified using nondenaturing PAGE.
DNaseI Footprinting on 3' End Singly Labeled DNA
Fragments--
RepE protein (10-1000 nM) was allowed to
bind to its 3' end singly labeled substrate (0.1-1 nM;
~50,000 cpm) in 50 µl of DNaseI footprint buffer (10 mM
Tris-HCl, pH 7.5, 100 mM NaCl, 2.5 mM MgCl2, 1 mM CaCl2, 2 mM
DTT, 50 µg/ml BSA, 10 µg/ml poly(dI-dC)) for at least 10 min at
room temperature. RepE·DNA complexes were digested with DNaseI
(3-6 ng) for exactly 2 min at room temperature, and the digestion was
stopped by the addition of EDTA (final concentration of 25 mM). After ethanol precipitation, samples were resuspended in 5 µl of denaturing loading buffer (95% formamide, 20 mM EDTA, 0.05% bromphenol blue, 0.05% xylene cyanol),
heated at 80 °C for 5 min before loading on 6% acrylamide-urea
sequencing gels, and run in TBE buffer (90 mM Tris borate,
2 mM EDTA, pH 8.3) for 2 h at 60 W. Bands were
visualized by direct exposure of the dried gels to storage phosphor
screens and analyzed on a Storm (Molecular Dynamics) PhosphorImager.
DNaseI Footprinting on Supercoiled and Linear Plasmid--
RepE
protein (50-500 nM) was allowed to bind to plasmid pIL253
(0.1-1 µg) either supercoiled or linearized in 50 µl of DNaseI footprint buffer (see above) for at least 10 min at room temperature. RepE·DNA complexes were digested with DNaseI (6-12 ng) for exactly 2 min at room temperature, and the digestion was stopped by the addition
of EDTA (final concentration of 25 mM). Cleavage sites were
mapped by primer extension as described below.
Orthophenanthroline-Copper (OP-Cu) Footprinting on Supercoiled
and Linear Plasmid--
RepE protein (50-500 nM) was
allowed to bind to plasmid pIL253 (0.1-0.5 µg) either supercoiled or
linearized in 20 µl of OP-Cu footprint buffer (10 mM
Tris-HCl, pH 7.5, 100 mM NaCl, 2.5 mM MgCl2, 300 µg/ml BSA, 10 µg/ml poly(dI-dC)) for at
least 10 min at room temperature. Footprinting reactions were then
performed essentially as described by Sigman et al. (38).
Briefly, reactions were started by adding 2 µl of 1,10-phenanthroline
(1 mM), CuSO4 (0.23 mM) and 2 µl
of 3-mercaptopropionic acid (58 mM) to the RepE·DNA
complexes and incubated for 1 min at room temperature. Digestions were
stopped by adding 2 µl of 2,9-dimethyl-1,10-phenanthroline (Neocuproine, 28 mM) and ethanol-precipitated. The four
reaction components were from Sigma. Cleavage sites were mapped by
primer extension as described below.
Dimethyl Sulfate (DMS) Footprinting on Supercoiled and Linear
Plasmid--
RepE protein (50-500 nM) was allowed to bind
to plasmid pIL253 (0.1-0.2 µg) either supercoiled or linearized in
20 µl of DMS footprint buffer (20 mM Tris-HCl, pH 8, 100 mM NaCl, 2.5 mM MgCl2, 300 µg/ml
BSA) for at least 10 min at room temperature. Then, DMS footprinting
reactions were performed essentially as described by Sasse-Dwight and
Gralla (39). Briefly, reactions were started by adding precisely 0.1 µl of pure DMS (Sigma) for exactly 3 min at room temperature (final
concentration 50 mM). Reactions were stopped by adding 40 µl of stop solution (1 M
-mercaptoethanol, 3 M ammonium acetate, 20 mM EDTA), and DMS was
carefully eliminated by ethanol precipitation. Methylated nucleotides
were mapped by primer extension as described below.
In Vitro KMnO4 Footprinting on Supercoiled
and Linear Plasmid--
RepE protein (50-500 nM) was
allowed to bind to plasmid pIL253 (0.1-1 µg) either supercoiled or
linearized in 45 µl of KMnO4 footprint buffer (20 mM Tris-HCl, pH 8, 100 mM NaCl, 2.5 mM MgCl2, 300 µg/ml BSA) for at least 10 min
at room temperature. Then, KMnO4 footprinting reactions
were performed essentially as described by Sasse-Dwight and Gralla
(39). Briefly, reactions were started by adding 5 µl of
KMnO4 (50-100 mM) for 2 min at room
temperature. Reactions were stopped by adding 50 µl of stop solution
(3 M
-mercaptoethanol, 40 mM EDTA, 0.6 M sodium acetate, pH 4.8) and ethanol-precipitated. Modified nucleotides were mapped by primer extension as described below.
In Vivo KMnO4 Footprinting--
1A226
(pol+) or the isogenic polA5 (pol
)
strain 1A226 carrying either pHV1455 or pHV1455Rep* was grown at
37 °C in MCD medium (K2HPO4 62 mM, KH2PO4 44 mM,
C6H5Na3O7 3.4 mM, K2SO4 11 mM,
MgSO4 0.8 mM, glutamine 0.2%, glucose 0.2%,
casamino acid 0.5%, tryptophan 0.01%, histidin 0.005%, phenylalanine
0.005%, and ammonium-iron (III) citrate 11 µg/ml) containing
erythromycin 0.6 µg/ml. At A650 = 0.5-0.8 and
exposed to 10 mM KMnO4 for 2 min essentially as
described by Sasse-Dwight and Gralla (39). The reaction was stopped by
the addition of 5 mM DTT, the cells were harvested, and
plasmid DNA was prepared using either standard alkaline lysis technique
or a total DNA extraction procedure (40). Modified nucleotides were
mapped by primer extension as described below.
Primer Extension--
First, modified plasmids DNAs from DNaseI,
OP-Cu, DMS, or KMnO4 footprinting experiments were purified
using Qiaquick PCR purification kit spin columns (Qiagen). DNAs were
recovered in 30-50 µl of 10 mM Tris-HCl, pH 8.5, and
10-20 µl were used for the primer extension reactions.
Then primer extension reactions were done either using Sequenase or by
linear PCR, as described by Sasse-Dwight and Gralla (39). In both
cases, primers elc9 (5'-GAGCATACATTCATTCAAGAGAC-3') and elc17
(5'-CTACTCTCTCCTTCTCCCCC-3') were used unless otherwise specified. The
primers were 5' end-labeled with [
-32P]ATP (3000 Ci/mmol) and T4 polynucleotide kinase.
When Sequenase was used, about 150 fmol of supercoiled or
linear-modified plasmid (~ 0.5 µg) were denatured with 0.2 M NaOH, neutralized, annealed with 100 fmol of 5' labeled
primer, and incubated for 10 min at 43 °C in 10 µl containing 3 units of Sequenase (Amersham Pharmacia Biotech), 200 µM
each dNTP, 20 mM Tris-HCl, pH 7.5, 25 mM NaCl,
10 mM MgCl2, and 10 mM DTT.
Reactions were stopped by adding 6 µl of loading buffer (95%
formamide, 20 mM EDTA, 0.05% bromphenol blue, 0.05%
xylene cyanol).
When linear PCR was used, about 30 fmol of supercoiled or linear
modified plasmid (~0.1 µg) were first digested with restriction enzymes to yield fragments ~500 bp long. Samples were then dialyzed on micromembranes (Millipore VS 0.025 µM) for 20 min against Tris-HCl pH8 10 mM and incubated with 100 fmol
of 5'-labeled primer in 25 µl containing 1.25 units of Taq
polymerase (Roche Molecular Biochemicals), 200 µM each
dNTP, 10 mM Tris-HCl, pH 8.3, 50 mM KCl, and
2.5 mM MgCl2. Linear amplification was done
through 10 cycles of denaturation (94 °C, 30 s), annealing
(45 °C, 30 s), and polymerization (72 °C, 30 s). Then
12.5 µl of loading buffer (see above) was added. In both cases
(Sequenase or Taq polymerase), 8 µl of the mix were heated
at 80-90 °C for 5 min before loading on 6% acrylamide-urea
sequencing gels and run in TBE buffer (90 mM Tris borate, 2 mM EDTA, pH 8.3) for ~2 h at 60 W.
The regions modified by KMnO4, DNaseI, OP-Cu, or DMS were
precisely localized by comparison with dideoxy-sequencing ladders obtained using end-labeled primers on pIL253-unmodified plasmid and run
side by side with the footprints. Bands were visualized by direct
exposure of the dried gels to storage phosphor screens and analyzed on
a Storm PhosphorImager using ImageQuant software (Molecular Dynamics).
 |
RESULTS |
Purification of the RepE Protein--
Wild type RepE was purified
using a C-terminal fusion of the entire protein with a modified intein
protein carrying a chitin binding domain (see "Experimental
Procedures" and Fig. 1). Purification on a chitin column followed by self-cleavage of the fusion protein resulted in the release of a wild type RepE protein of the expected size (57 kDa). Two further steps of purification led to a protein >95% pure as judged by SDS-PAGE and SYPRO® red staining (Fig. 1B, lane 5). Gel filtration chromatography allowed us to
determine that RepE is monomeric in solution (data not shown; see
"Experimental Procedures").

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 1.
Expression and purification of the
pAM 1 RepE protein. A, 20 µg
total E. coli proteins from cells uninduced (lane
0) or induced by isopropyl-B-D-thiogalactoside
(lane 1) for the expression of the gene encoding the
RepE-Intein-CBD fusion were loaded on a 8% SDS-PAGE and stained with
SYPRO® red. B, protein fractions of the various steps
during RepE purification were loaded on a 10% SDS-PAGE: lane
1, crude extract from induced cells containing the RepE-Intein-CBD
fusion; lane 2, insoluble protein fraction; lane
3, clarified crude extract; lane 4, RepE eluted after
DTT-induced self-cleavage; lane 5, 2 µg of RepE after gel
filtration chromatography; lane M, protein size marker. The
black and white triangles indicate the positions
of RepE and RepE-Intein-CBD protein fusion, respectively.
|
|
RepE Specifically Binds to pAM
1 Double-stranded Origin Upstream
of the Initiation Site of DNA Replication--
All known initiator
proteins bind to their cognate origin to initiate DNA replication.
Despite the absence of known iterons in the minimal 44-bp pAM
1
origin, we tested whether RepE specifically recognizes and binds
ori. Binding properties of purified RepE protein were
investigated with various ori and non-ori dsDNA
using a gel retardation assay. RepE binds a 75-bp dsDNA carrying the 44-bp minimal ori (75-bp ori) with a dissociation
constant Kd of 18 nM (see Fig.
2A and Table
I). The DNA sequence recognized by RepE
lies in the 5' end of the minimal ori since the
Kd of the 56-bp ori5' is in the same
range (27 nM) and much lower than that of a 3' end fragment
(>1 µM for the 45-bp ori3'). The differences
in affinity between the 5' and 3' end of ori were not due
primarily to the different size of the fragments, since similar
differences were obtained with the 75-bp ori5' and
ori3' (Fig. 2, B and C, Table I).
Finally, RepE does not show any measurable affinity for
non-ori dsDNA substrates (61- and 76-bp fragments were
tested; see Table I and Fig.
3E). Therefore RepE binds
specifically to the 24-bp part of the origin located 5' to the
initiation site, with an affinity at least 50-fold higher than for
non-ori dsDNA or the 3'-end of ori.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 2.
Gel retardation analysis of RepE binding to
various origin substrates. Gel retardation assays were carried out
in 10 µl as described under "Experimental Procedures" using
0.1-1 nM either dsDNA (A, B, and
C), ssDNA (D and E), RNA corresponding
to the transcript through ori (top strand; F) or
RNA/DNA ori duplex (G), 100 ng of poly(dI-dC),
and the indicated concentrations of RepE protein. Scheme and nucleotide
sequences of the substrates are presented in Table I and under
"Experimental Procedures," respectively.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Equilibrium dissociation constants (Kd) of RepE on various
nucleic acid substrates
The affinity of RepE for various nucleic acids was determined using gel
retardation assays as described under "Experimental Procedures." A
scheme of the various ori nucleic acids used is given
indicating the initiation site of the leading strand (bent arrow), the
parts of the minimal ori located either 5' (24-nt long, gray
rectangle), or 3' (20-nt long, hatched rectangle) from the initiation
site, the non-specific DNA from the top strand (-W, black line) or the
bottom strand (-C, dotted line), and non-specific RNA from the top
strand (broken line). The drawings are made on scale.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 3.
Gel retardation analysis of RepE binding to
various non-origin substrates. Gel retardation assays were carried
out as described under "Experimental Procedures" and in the legend
of Fig. 2. Non-origin substrates of 61 nucleotides were used, present
either in a single-stranded (A) or double-stranded
(E) form or as partial double-stranded substrates with a
central single-stranded bubble of 21, 15, and 9 nt (B,
C, and D). All substrates were made using the
labeled 61-mer osmg27 oligonucleotide alone (A) or annealed
with fully (E) or partially (B-D) complementary
oligonucleotides. The white and black triangles
indicate the migration position of the 61-mer and the various bubbles
in the free form, respectively.
|
|
To determine the association and dissociation rates between RepE and
the 75-bp ori, gel retardation assay was used. Both rate constants could not be determined precisely by this technique, since
all complexes were already formed at the shortest time tested (5 s;
Fig. 4A), and no significant
dissociation of the complexes was observed even 30 min after the
addition of unlabeled ori (Fig. 4B). RepE thus
recognizes and binds ori dsDNA very quickly, the complexes
formed being extremely stable.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 4.
Association and dissociation rates of 75-bp
ori·RepE complexes. Complex formation between 2 nM radiolabeled 75-bp ori duplex containing the
44-bp minimal ori and 250 nM RepE was quenched
at various time with a 500-fold excess of unlabeled 75-mer
ori-W either immediately (association rate) or 10 min after
RepE addition (to let the complex reach an equilibrium; dissociation
rate). The ratio of dsDNA ori bound to RepE at different
times was quantified after gel electrophoresis using a Storm
PhosphorImager. The data were used to plot the time courses for
association (A) and dissociation (B) between RepE
and 75-bp ori.
|
|
To confirm and define more precisely the RepE binding site, we carried
out DNaseI protection assays on end-labeled pAM
1 restriction fragments containing minimal ori flanked on either side by
at least 60 bp of plasmid sequences. A region of 19 nt was protected from DNaseI digestion upon RepE binding on both strands (Fig. 5). The protected areas were situated 5'
to the initiation site, the protected area on the top strand being
shifted by 5 nt relative to the protected area on the bottom strand. A
site of enhanced sensitivity at a G residue, which reveals a distortion
of the double helix, was located in the middle of the protected region on the bottom strand. These results fit the gel retardation data, which
define the RepE binding site to a 24-bp region in the 5' end of the
minimal 44-bp ori. The Kd estimated from
the DNaseI protection assays was in the same range as that measured by
gel retardation assays (15-30 nM).

View larger version (63K):
[in this window]
[in a new window]
|
Fig. 5.
DNaseI footprint of RepE bound on
ori fragments. Top, sequencing gel
displaying DNaseI protection pattern of each ori strand in
the absence and in the presence of RepE. ori-containing
pAM 1 restriction fragments were labeled at one end of the top
(left panel) or the bottom strand (right panel)
and incubated with 0, 200, and 800 nM RepE. Treatment with
DNaseI and subsequent separation through a 6% polyacrylamide-urea
denaturing gel were as described under "Experimental Procedures."
The region protected from cleavage is indicated by double-headed
arrows, and the initiation site of the leading strand synthesis is
represented by a bent arrow. The black oval
indicates a site of increased sensitivity on the bottom strand at a G
residue. Numbers refer to the nucleotide sequence of pAM 1
(GenBankTM access number AF007787). Lanes
ACGT correspond to a ladder of M13mp18 dideoxy sequence with
M13/pUC sequencing primer 40. This control sequence allowed
determination of the size of the protected DNA fragments and the
position of the footprints relative to the ori sequence.
Bottom, schematic representation of the ori
region with the DNaseI footprints of RepE data relative to the
initiation site (bent arrow), the repE gene
(open boxed arrow), and the 5' and 3' parts of the minimal
44-bp ori (gray and hatched boxes,
respectively).
|
|
RepE Binds with High Affinity to ssDNA and Does Not Bind to
RNA-containing Substrates--
A prerequisite for initiation of DNA
synthesis is the opening of the origin, which results in the appearance
of ssDNA. We therefore tested the affinity of RepE for ssDNA in a gel
retardation assay using various ori and non-ori
oligonucleotides (Fig. 2 and 3 and Table I). RepE bound to ssDNA
containing a complete ori (75-mer ori-W and
ori-C) with an affinity about 5-fold higher than comparable
dsDNA (Fig. 2, compare panels A, D, and
E). This affinity decreased only slightly (2-fold) when
either truncated origins or non-origin ssDNAs were used, provided that
their size was longer than about 60 nt (see Table I). The affinity
decreased greatly for shorter segments, the DNA/RepE interaction being
too weak to withstand electrophoretic analysis, which led to a smear of
the DNA during the gel-shift assay (data not shown). As observed for
the dsDNA ori substrate, the association of RepE to 75-mer ssDNA ori was very quick (kass < 5 s), and the complexes formed were extremely stable
(kdiss
30 min; data not shown).
Opening of the origin should lead to the formation of a ssDNA bubble
within a dsDNA region. We therefore tested RepE affinity for such
structures in a gel retardation assay using segments of 61 bp with
central bubbles of 9, 15, or 21 nt. A very high affinity similar to
that obtained with the 75-mer ssDNA ori was found with the
21-mer bubble (Kd = 5 nM, Fig.
3B). Furthermore, a second retarded complex as well as
traces of other uncharacterized complexes that may reflect the binding
of additional Rep molecules appeared at higher RepE concentrations. The
affinity of RepE for bubble substrates decreased about 2.5- and 40-fold
when the size of the bubble decreased to 15 and 9 nt, respectively
(Fig. 3, C and D). We conclude from these results
that RepE has a high affinity for bubble structures provided that the
ssDNA region is at least 15 nt long.
Initiation of pAM
1 replication requires transcription of the origin.
We therefore investigated RepE binding to different ori
ribonucleotide substrates. A 75-mer transcript corresponding to the
leading strand of the origin and, thus, mimicking a putative initiator transcript, was synthesized in vitro, and its
affinity for RepE was tested either in the RNA form (75-mer RNA
ori-W) or as RNA/DNA duplex (75-bp RNA/DNA ori).
We did not detect a measurable affinity between RepE and the
RNA-containing substrates (Fig. 2, F-G, Table I).
RepE Binding Moderately Bends the Double-stranded Origin Upstream
of the Initiation Site--
Sequence-specific DNA-binding proteins
frequently contort DNA by bending at the site of interaction (41). In
the case of replication origin-binding proteins, this bending may
facilitate open complex formation. To test whether RepE bends the
double-stranded origin, we employed the gel retardation analysis of
permuted fragments (42). A set of fragments of identical size, with the
origin at variable positions relative to the fragment ends, was
generated from plasmid pBend2ori, which contains the 44-bp
minimal ori inserted between two tandemly repeated
multicloning sites. As seen by gel retardation, free DNA ori
segments migrate homogeneously, indicating that they do not possess any
natural bend, whereas the complexed fragments show a characteristic
bell-shaped curve (Fig. 6). This demonstrates that binding of RepE to the origin introduces a curvature in the DNA. However, the bending angle was very modest, only 31.3° (±0.6°, four independent experiments). The bent zone, identified as
the center of the most retarded segments, is located just upstream from
the initiation site of DNA replication in the region protected against
DNaseI action upon RepE binding.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 6.
Gel retardation analysis of permuted
fragments containing the minimal origin. Inset, gel
retardation assay carried out as described under "Experimental
Procedures" using a set of DNA fragments of similar length (179 to
183 bp) but with the origin located at various positions relative to
the fragment ends followed by separation through 6% polyacrylamide
gel. The fragments used were generated from pBend2ori either
by PCR using as primers pBend and oriL4 (lane 1)
or by restriction with the enzymes BglII (lane
2), SfaNI (lane 3), XhoI
(lane 4), DraI (lane 5),
PvuII (lane 6), SmaI (lane
7), SspI (lane 8), TfiI
(lane 9), or BamHI (lane 10).
Graph: for each lane, the relative mobility µ of DNA was calculated (µ = mobility of the retarded DNA/mobility
of free DNA) and plotted against the position of the binding site. The
result obtained with one out of the four independent experiments
carried out is shown. The bending angle , obtained by using the
empirical formula cos /2 = µ min/µ
max (73), is indicated. Bottom, the minimal
44-bp ori is schematized as in Fig. 5. The position of the
maximum of bending induced by RepE is indicated by a hatched
rectangle.
|
|
RepE Distorts the AT-rich Sequences Downstream from the Initiation
Site in Vivo and in Vitro--
To test whether RepE destabilizes the
DNA pairing at the origin, potassium permanganate (KMnO4)
footprinting was used. This drug oxidizes thymines (and to a lesser
extent cytosines) at unwound or sharply distorted DNA sites (43-45).
The modified nucleotides are easily detected on supercoiled DNA by
primer extension, since DNA polymerases are unable to copy oxidized
residues (46). Since KMnO4 efficiently enters bacterial
cells, it can be used conveniently for both in vivo and
in vitro distortion mapping (39).
In vivo, KMnO4 footprints were carried out using
B. subtilis cells harboring plasmid pHV1455, a hybrid of a
functional pAM
1 replicon (pIL253) and a pTB19 replicon.
Exponentially growing cells were submitted to KMnO4
treatment as described under "Experimental Procedures." Little
modification of ori top strand was observed in
vivo when repE was inactivated by a frameshift mutation
(Fig. 7, A, RepE
). In the presence of RepE, specific sites were hyper-reactive, covering about 20 nt on the top strand, immediately downstream from
RepE binding site. The reactivity was independent from DNA synthesis,
since similar patterns were obtained in polA
and polA+ contexts. The band of strong intensity
at the initiation site, detected in the polA+
context but not in the polA
context,
originated from primer extension occurring on the newly synthesized
leading strand extruded during DNA preparation from D-loop replication
intermediates. RepE-dependent and Pol I-independent modifications of the bottom strand were also observed, but in a much
narrower region (4-7 nt), encompassing the initiation site (Fig.
7A). We conclude that RepE-dependent distortion
of the AT-rich region of the origin is revealed by KMnO4
oxidation in vivo.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 7.
In vivo and in vitro
KMnO4 sensitivity of pAM 1
ori. A, KMnO4 oxidation patterns of
pAM 1 derivatives in vivo and in vitro. In
vivo, exponentially growing B. subtilis cells of either
wild type (polA+) or deficient in Pol I (polA5)
carrying plasmid pHV1455 or a derivative inactivated for RepE synthesis
(pHV1455*) were submitted to 10 mM KMnO4
treatment for 2 min as described under "Experimental Proce- dures." In vitro, 1 µg of pIL253 plasmid either
supercoiled (sc) or linear (lin) was incubated 10 min at room temperature with or without (+ or ) 120 nM
RepE and treated with KMnO4 (0 and 5 mM).
Modification of the top and bottom strands were mapped by primer
extension, using labeled primers elc17 and elc9, respectively. The same
primers and unmodified pIL253 DNA were used for the control sequencing
ladders (lanes ACGT). A schematic representation of the
minimal 44-bp ori is positioned on the left of each
panel (schematized as in Fig. 5). At the bottom of the
panel, a comparison of the KMnO4 modifications
obtained in vivo and in vitro is represented. The
sequence in boxed uppercase letters corresponds to the
minimal 44-bp ori. The black bars above and below
the sequence indicate the location and intensity of the modifications
induced by KMnO4 on the top and bottom strands,
respectively. B, KMnO4 oxidation patterns of
truncated ori. Supercoiled plasmids with either the wild
type minimal 44-bp ori (pMTL500E-ori) or
truncated forms containing the RepE binding site but lacking part of
the sequences located downstream from the initiation site
(pMTL500E-ori 1 and -ori 2) were treated as
described above (except that a KMnO4 concentration of 5 mM was used). The primer extensions were done using the
M13/pUC reverse sequencing primer 24 (top strand) and the sequencing
primer 40 (bottom strand). On the left of each panel, only
the wild type ori is schematized. At the bottom of the
figure, a comparison of the KMnO4 modifications obtained
for the wild type and the truncated origins is given schematically. The
legend is as for panel A.
|
|
To gain further insight into the distortion mechanism and analyze the
parameters involved in this process, we performed in vitro
KMnO4 footprints. The role of RepE was investigated using pIL253, either in a supercoiled or linear form. This plasmid was incubated with or without purified RepE and submitted to
KMnO4 treatment. Specific sites became hyper-reactive to
KMnO4 oxidation upon RepE addition when supercoiled DNA was
used. These sites are grouped in a ~23-bp region covering both DNA
strands, immediately downstream from RepE binding site (Fig.
7A). This region did not show any peculiar reactivity toward
KMnO4 in the absence of RepE, indicating that it does not
behave as a DNA-unwinding element. The reactivity required a negatively
supercoiled DNA substrate, since plasmid linearization rendered the
origin completely resistant to KMnO4 oxidation. Thus,
distortion of the origin requires RepE as the sole protein factor and
depends strictly on DNA supercoiling. Interestingly, the oxidation
patterns obtained in vivo and in vitro were
highly similar for the top strand, suggesting that RepE alone promotes
denaturation of the origin in vivo. In contrast, clearly
different patterns were obtained for the bottom strand (see
"Discussion").
The relative importance of ori and flanking sequences for
KMnO4 sensitivity was investigated using pAM
1
derivatives carrying either the entire 44-bp minimal ori
cloned into a different locus or truncated origins. The extent of the
deletions is shown Fig. 7B (bottom; these
plasmids, pMTL500E-ori, -ori
1, and
-ori
2, replicate in E. coli by their pUC
moiety). Whereas pMTL500E-ori efficiently transformed
B. subtilis cells and was maintained at a high copy number,
the deletion of the 3' end of the origin completely abolished the
transformation ability of the pMTL500E-ori
plasmids (data
not shown). Supercoiled forms of the three plasmids were submitted to
KMnO4 oxidation in vitro. The KMnO4
modification pattern of the minimal origin at this new locus was
identical to that obtained with pIL253, which showed that the helix
distortion of the origin is independent from flanking sequences (Fig.
7B, top). In contrast, the pattern of the
truncated origins was highly affected; it showed a shorter modification
zone, restricted to the remaining ori sequences (17 nt for
the ori
1 derivative; about 10 nt for ori
2).
Because the distorted region of the full-length 44-bp ori is
particularly AT-rich (85% for the 23-bp distorted region
versus 68% for the whole origin), the disappearance of KMnO4 modification observed with ori
1 and
2 may be explained by the replacement of this AT-rich region by a
more GC-rich region (Fig. 7B, bottom). These
results suggest that the RepE-mediated distortion of the complete
AT-rich region of the origin is essential for initiation of DNA replication.
RepE Melts the AT-rich Sequence of the Origin, Forming an Open
Complex in Vitro--
KMnO4 reacts not only with fully
melted DNA, but also with bent, unstacked, or untwisted DNA (45, 47).
Both the size of the modified region and the fact that pyrimidine
residues on both strands were reactive with KMnO4 in
vitro argue in favor of melted rather than only distorted DNA in
pAM
1. To confirm this conclusion, we used a DMS footprint technique
(39). DMS modifies differently dsDNA and ssDNA. On dsDNA substrates, it
methylates mainly the N-7 of guanines (48), whereas on ssDNA, it
modifies N-1 of adenine and, to a lesser extent, the N-3 of cytosine
(49). pIL253-supercoiled DNA, complexed or not with RepE, was treated
with DMS, and modified residues were mapped by primer extension using
Taq polymerase. The main signals obtained with dsDNA
substrates in the absence of RepE corresponded to guanines presumably
methylated at N-7 (Fig. 8). In the
presence of RepE, new signals corresponded mainly to A and C residues
in the distorted region revealed by the KMnO4 technique and
on both strands (a weak protection of RepE binding site is also
detected; see next paragraph). Their appearance argues that the
distorted region corresponds to a truly melted region. However, the
signals were faint and strictly dependent on the concentrations of DMS
and RepE. This can be due either to the fact that not all molecules
were denatured or to incomplete accessibility of DMS to the ssDNA.
Moreover, we were unable to detect ssDNA in this AT-rich region of the
origin by nuclease P1 cleavage in the presence of RepE (data not
shown). These results suggest that an open complex is formed at the
origin, but intense DMS modification and enzymatic attack of the ssDNA
are prevented, possibly by further binding of RepE on this region (see
"Discussion").

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 8.
DMS footprint of RepE bound on supercoiled
substrates. A, sequencing gel displaying DMS
sensitivity of each strand around ori in the absence and in
the presence of RepE. Supercoiled pIL253 DNA was incubated without
(lanes 1, 4, 5, and 8) or
with 300 nM (lanes 2 and 6) and 500 nM (lanes 3 and 7) RepE for 10 min at
room temperature and treated with DMS as described under
"Experimental Procedures." The modification sites on the top
(lanes 1-4) and bottom (lanes 5-8) strands were
mapped by primer extension using labeled primers elc17 and elc9
respectively followed by separation through a 6% polyacrylamide-urea
sequencing gel. The same primers were used for the control sequencing
ladder (lanes ACGT). A schematic representation (as in Fig.
5) of the minimal 44-bp ori is positioned on the left of
each panel. Nucleotides partially protected by RepE against
DMS modification are indicated with gray open
circles. Nucleotides showing marked and slightly increased
DMS sensitivity upon RepE binding are indicated with black
and gray triangles, respectively. B,
quantification of the experiment shown in A by Storm
PhosphorImager analysis using ImageQuant software. Scans of lanes
3-4 (top strand) and 7-8 (bottom strand)
are drawn at the top and the bottom of the panel,
respectively. To facilitate the comparison, the scans obtained for each
strand with naked DNA (black line) and RepE-bound DNA
(gray line) are superimposed. A schematization of the
ori region is presented with the same symbols as defined
above.
|
|
In addition to the enhanced signals detected in the AT-rich region, a
very faint protection (~40% in the top strand and ~40-60% in the
bottom strand) was obtained in the region of the RepE double-stranded binding site (Fig. 8). The reason for this weak footprint cannot be due
to a poorly active protein, since another footprinting reagent used in
the same experiment, the chemical nuclease OP-Cu (see
"Discussion"), revealed a clear protection of the RepE binding site. It is possible that the ineffective protection against DMS might
be due to the fact that this reagent acts at the major groove of DNA.
This may thus be indicative of a binding of RepE in the minor groove of
dsDNA (see "Discussion").
Additional RepE Binding to the Melted Region of the Open Complex in
Vitro--
Our results suggest that RepE is able to denature ~25 nt
in the 3' end of the origin on supercoiled molecules and show that it
binds efficiently to oligonucleotides forming bubble structures with
ssDNA regions of at least 15 nt. Thus, we wondered whether additional
RepE molecules could bind to the melted region of the open complex. To
test this hypothesis, DNaseI and the chemical nuclease OP-Cu were used
as footprinting reagents of RepE·ori complexes formed on
supercoiled DNA, searching for an extension of the footprint observed
on linear dsDNA. Neither reagent has any sequence specificity, and they
both cleave the DNA through its minor groove. Mapping of the cleaved
residues was done by primer extension on supercoiled pIL253 plasmids.
As expected, an extended protection pattern, covering both RepE
double-stranded binding site and about 30 nt downstream on both strands
was clearly observed using OP-Cu footprints (Fig.
9). A similar extended protection area
was also observed with DNaseI, although it was much fainter in this
case (data not shown, but the result is summarized in Fig.
10). These results show that on
supercoiled substrates RepE binding on dsDNA renders the downstream
AT-region reactive for fixation of extra RepE molecules. Additionally,
the clear footprint of the double-stranded binding site of RepE
obtained with DNaseI and OP-Cu, in contrast to the weak one obtained
with DMS, supports the hypothesis that RepE binds the DNA in the minor
groove.

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 9.
OP-Cu footprint of RepE bound on supercoiled
substrates. A, sequencing gel displaying OP-Cu
protection pattern of each strand around ori in the absence
and in the presence of RepE. Supercoiled pIL253 DNA was incubated
without (lanes 1, 4, 5, and
8) or with 300 (lanes 2 and 6) and 500 nM (lanes 3 and 7) RepE for 10 min at
room temperature and treated with OP-Cu as described under
"Experimental Procedures." The cleavage sites on the top and bottom
strands were mapped by primer extension using labeled primers elc17 and
elc9, respectively, followed by separation through a 6%
polyacrylamide-urea sequencing gel. The same primers were used for the
control sequencing ladder (lanes ACGT). A schematic
representation (as in Fig. 5) of the minimal 44-bp ori is
positioned on the left of each panel. Protected regions are
represented as double-headed arrows; solid lines
indicate the regions strongly (>40%) protected from OP-Cu
modification, whereas dashed lines indicate extended and
weaker footprints observed only on supercoiled DNA at the highest RepE
concentration used. B, quantification of the experiment
shown in A by Storm PhosphorImager analysis using ImageQuant
software. Scans of lanes 3-4 (top strand) and
7-8 (bottom strand) are drawn at the top and the
bottom of the panel, respectively. To facilitate the
comparison, the scans obtained for each strand with naked DNA
(black line) and RepE-bound DNA (gray line) are
superimposed. A schematization of the ori region is
presented with the same symbols as defined above.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 10.
Summary and schematic representation of the
RepE footprints on the ori region. A compilation
of DNaseI, OP-Cu, KMnO4, and DMS footprinting data,
collected from the experiments shown in Figs. 5-9, is presented. The
44-bp minimal ori sequence is boxed and
represented with its 5' part from the initiation site (bent black
arrow) as uppercase letters on a gray
background, and its 3' part is represented as uppercase
letters on a hatched background. Numbers refer to the
nucleotide sequence of pAM 1 (GenBankTM access number
AF007787). Flanking nucleotides are represented as smaller
letters, and the 3' end of the repE gene is represented
as an interrupted boxed arrow. The position of the maximum
of bending induced by RepE is indicated above the sequence by a
hatched rectangle. Data concerning the footprints detected
on the top strand and bottom strand are represented above and below the
sequence, respectively. As indicated on the left of the figure, DNaseI
and OP-Cu footprints are represented as double-headed
arrows; solid lines indicate the regions strongly
(>40%) protected from cleavage by the nucleases on supercoiled or
linear DNA, whereas dashed lines indicate extended and
weaker footprints observed only on supercoiled DNA at high RepE
concentration. The two black ovals indicate the sites
of DNaseI increased sensitivity at two G residues on the bottom strand
on supercoiled DNA (only one hypersensitive G was detected when a
linear DNA fragment was used). Light gray open circles
represent the very weak protection of the G residues against DMS
methylation. The black and gray triangles
indicate marked or slight increases of DMS sensitivity, respectively,
induced by RepE. The black bars indicate the location of the
modifications probed by KMnO4 in vitro and
in vivo (their height being proportional to the intensity of
modification).
|
|
 |
DISCUSSION |
The initiation mechanism of pAM
1 replication is original
because it requires a small unstructured origin, an initiator protein (RepE), a transcription fork passing through the origin codirectional to DNA synthesis and Pol I but not DnaA. To better understand this
process, we have characterized the RepE/ori interaction. Our
observations show that RepE possesses some of the features expected for
an initiator together with some unexpected properties. Indeed, RepE
binds, bends, and melts the origin in a
supercoiling-dependent way to form an open complex.
However, the double-stranded origin contains a single RepE binding site
(there is no iterons), the bend is weak, and RepE binds nonspecific
ssDNA more efficiently than dsDNA. Very importantly, the melted DNA in
the open structure is a substrate for further RepE binding. We thus
speculate that in open complex formation, the ssDNA binding activity
compensates for the weak bend and for the lack of RepE oligomerization
on the double-stranded origin.
RepE Interaction with the Double-stranded Origin--
Using gel
retardation assays and in vitro footprint experiments,
specific and efficient binding was observed between RepE and the
double-stranded origin (Kd ~ 20 nM).
The binding site was mapped to the 25-bp sequence located upstream from
the initiation site. Careful examination of this sequence did not reveal any repeated sequence longer than 2 bp, which suggests that
pAM
1 differs from the previously described initiator-encoding replicons by having a unique binding site for the initiator protein in
the double-stranded origin (see Ref. 8 for review). Even replicons such
as R1, reported as lacking iterons, possess more than one binding site
(with a 5-bp common core sequence) for the initiator protein (50).
Thus, whatever the replicon, multimers of the initiator protein are
involved in origin binding and initiation of replication. In contrast,
a single RepE molecule appears to bind to the pAM
1 double-stranded
origin since (i) a unique complex is detected by gel shift analysis,
and (ii) RepE is a monomer in solution. However, when the plasmid is
supercoiled, several monomers of RepE bind to the origin as discussed below.
Comparison of the footprints obtained at RepE double-stranded binding
site with various reagents (DNaseI, OP-Cu, DMS) reveals some
interesting features (see Fig. 10 for a summary). Efficient protection
(70-95%) against reagents that act in the minor groove of the DNA
(DNaseI or OP-Cu) was observed, whereas the protection against reagents
that act in the major groove (DMS) was much weaker (40-60%). Taken
together, these results suggest that RepE binds primarily in the minor
groove of the 5' end of the origin. Binding in the minor groove has
been demonstrated for protein p6 from B. subtilis phage
29 (a nonspecific dsDNA-binding protein that activates the
initiation of
29 DNA replication (51)) and for many architectural
factors that introduce large bends in the DNA (such as the prokaryotic
IHF and HU proteins and the eukaryotic HMG proteins (52, 53)).
However, the initiators DnaA from E. coli and RepA from
pPS10 were shown to interact with both major and minor grooves (54,
55).
Open Complex Formation and Binding of Additional RepE on the Melted
DNA--
A number of studies in prokaryotic and eukaryotic genomes
sustain the idea that the origin must be strongly bent for duplex opening, allowing subsequent entry of the replicative helicase (4, 56,
57). Sharp bending of the origin occurs consequent to the binding of
multimers of the initiator (58-60) and may be helped by an intrinsic
curve in the DNA (61, 62). Unlike these replicons, pAM
1 origin does
not possess any intrinsic bending and only a very weak bend (31°) is
induced by RepE binding on linear fragments containing the origin (Fig.
6). This raises the question about the existence of other factors that
could enhance this bend and about its function in pAM
1 initiation.
Several convergent data suggest that, on supercoiled substrates, RepE binding promotes the denaturation of the downstream AT-rich region. In vitro, KMnO4 footprints show that RepE
binding highly distorts the AT-rich region of the origin (Fig. 10).
This distortion is strictly dependent on RepE, the presence of the
AT-rich sequence, and the supercoiling of the ori-containing
substrates. DMS footprint experiments revealed a significant increase
in the methylation of the A and C residues of the AT-rich region upon
RepE binding at the origin (Fig. 10). This indicates that the AT-rich
region is melted. Interestingly, DNaseI and OP-Cu footprints performed on supercoiled templates revealed protections extending from the RepE
binding site to more than 30 nt downstream, covering the AT-rich
region. These extended footprints together with the fact that RepE
binds with a high affinity to dsDNA fragments containing single-stranded bubbles at least 15 nt-long (Fig. 3) suggest that RepE
binds the melted region of the origin, protecting it from DNaseI or
OP-Cu cleavage. RepE binding in the melted region could explain both
the weak accessibility of DMS to the ssDNA and the lack of P1
sensitivity on supercoiled ori-containing plasmid in the
presence of RepE. Such a resistance of an origin melted region to P1
nuclease has been described in other systems such as simian virus 40 (47). The fact that the extended footprints observed either with OP-Cu
or DNaseI did not reveal 100% protection upon RepE binding might be
explain by several hypotheses. First, RepE might not bind to all the
supercoiled molecules. Second, some cleavage of ssDNA might occur even
in the presence of RepE. Third, binding of RepE might be dynamic,
leading to sliding of the protein along ssDNA. Finally, although RepE
dissociates from ssDNA very slowly, re-annealing of the melted region
could displace the protein from its ssDNA-binding site.
Possible Role for the Strong ssDNA Binding Activity of
RepE--
As shown by gel retardation assays, RepE does not bind
nonspecific dsDNA but binds efficiently ori-containing dsDNA
and even more efficiently any ssDNA. Other initiators have been found
to possess some ssDNA binding activity. Preferential binding of DnaA to
the upper strand of the open complex at oriC was suggested because of the poor cleavage of this strand by P1 nuclease compared with that of the lower strand (4). However, although bacteriophage 