JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M010118200 on December 20, 2000

J. Biol. Chem., Vol. 276, Issue 13, 10234-10246, March 30, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/13/10234    most recent
M010118200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Le Chatelier, E.
Right arrow Articles by Canceill, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Le Chatelier, E.
Right arrow Articles by Canceill, D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The RepE Initiator Is a Double-stranded and Single-stranded DNA-binding Protein That Forms an Atypical Open Complex at the Onset of Replication of Plasmid pAMbeta 1 from Gram-positive Bacteria*

Emmanuelle Le Chatelier, Laurent JannièreDagger, S. Dusko Ehrlich, and Danielle Canceill§

From the Laboratoire de Génétique Microbienne, Institut National de la Recherche Agronomique, Domaine de Vilvert, 78350 Jouy en Josas, France

Received for publication, November 7, 2000


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The RepE protein of the broad host range pAMbeta 1 plasmid from Gram-positive bacteria is absolutely required for replication. To elucidate its role, we purified the protein to near homogeneity and analyzed its interactions with different nucleic acids using gel retardation assays and footprinting experiments. We show that RepE is monomeric in solution and binds specifically, rapidly, and durably to the origin at a unique double-stranded binding site immediately upstream from the initiation site of DNA replication. The binding induces only a weak bend (31°). Unexpectedly, RepE also binds nonspecifically to single-stranded DNA with a 2-4-fold greater affinity than for double-stranded origin. On a supercoiled plasmid, RepE binding to the double-stranded origin leads to the denaturation of the AT-rich sequence immediately downstream from the binding site to form an open complex. This open complex is atypical since (i) its formation requires neither multiple RepE binding sites on the double-stranded origin nor strong bending of the origin, (ii) it occurs in the absence of any cofactors (only RepE and supercoiling are required), and (iii) its melted region serves as a substrate for RepE binding. These original properties together with the fact that pAMbeta 1 replication depends on a transcription step through the origin on DNA polymerase I to initiate replication and on a primosome to load the replisome suggest that the main function of RepE is to assist primer generation at the origin.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

DNA replication is carried out by the replisome, a multiprotein complex able to carry on strand separation, primer synthesis, and a rapid, accurate, and concerted synthesis of the continuous and discontinuous strands. At the onset of replication, replisome assembly is generally orchestrated by a protein or a multiprotein complex called initiator. The initiator recognizes and binds specific or preferential sites in DNA molecules (the origin), melts these regions by causing a structural distortion of the DNA, and initiates the loading of the replisome through protein-protein interactions.

The most thoroughly characterized initiator is the Escherichia coli DnaA protein, which possesses conserved homologues in all known bacteria (see for review Ref. 1). Various properties have been attributed to DnaA, such as sequence-specific DNA binding, oligomerization, protein-protein interactions, membrane binding, ATP and ADP binding, and ATPase activity (1, 2). At the onset of chromosome replication, the ATP-bound form of DnaA binds as a monomer to the chromosomal origin at five 9-bp1 repeated sequences called DnaA boxes. It then oligomerizes to form a large nucleoprotein structure containing 20-40 DnaA molecules. The structure confers single-stranded character to a flanking AT-rich region (13-mer), forming an intermediate termed the open complex (3). The process requires negative supercoiling, either IHF or HU, and is activated by transcription and possibly by a direct interaction between DnaA and the AT-rich region (4). DnaA, with the help of DnaC, then recruits the host DNA helicase DnaB to the exposed single-stranded region. DnaB enlarges the unwound region and subsequently loads alone or together with DnaA the primase DnaG and the DNA polymerase III (3, 5-7).

Initiators of plasmid and viral theta  replicons, form, like DnaA, an open complex at their cognate origins to recruit the replisome (8-10). Open complex formation occurs via specific binding of the initiator to repeated sequences (the iterons), oligomerization of the initiator, and eventually local DNA distortions such as bending, untwisting, or wrapping. However, this formation generally also requires DnaA and the help of cofactors including structural proteins (IHF, Fis, HU, SSB) or structural DNA determinants (intrinsically bent DNAs, AT-rich regions, sequences of natural instability such as DNA unwinding elements, or supercoiling of the DNA; reviewed in Refs. 11 and 12). Aside from the apparent consensual role of the initiators in origin binding and denaturation, variations occur in their ability to participate in steps after open complex formation. Some initiators (but not all) act similarly to DnaA, as a "landing pad" for replisome assembly. For instance, the UL9 initiator of herpes simplex virus-1 interacts with the cellular DNA polymerase-alpha primase, the helicase-primase complex, and the processivity polymerase factor (13). Likewise, the plasmid initiators pi  of R6K and RepA of pSC101 are known or supposed to interact with DnaA, the replicative helicase DnaB, the primase DnaG, and the tau  subunit of DNA polymerase III (14-16). Initiators can also be helicases (T-antigen of simian virus 40 (17), UL9 of herpes simplex virus-1 (18), or E1 protein of papillomavirus (19)), whereas others are primases (Rep of ColE2 (20)) or seem to have no extra activities apart from origin binding, bending, and melting (TrfA of RK2 (21)).

theta replicons that do not code for any initiator protein are a noticeable exception to this general scheme. They still initiate DNA replication at preferential sites, but these origins do not carry the relevant features usually found in the initiator-dependent replicons (see above). The initiation mechanism of these systems, such as the E. coli plasmid ColE1, phages T4, or T7 and the mitochondrial DNA of metazoans, mainly relies on the RNA polymerase (RNA pol), which provides the initial primer for DNA synthesis (22). In phage T7, RNA pol stops at the origin by an unknown mechanism, and the arrested transcript serves as a primer to initiate DNA synthesis. In ColE1, phage T4, and mitochondrial DNA replication, although RNA pol transcribes the origin, an R-loop is formed. The RNA strand of the R-loop is then processed by a RNaseH activity into the primer used to initiate leading strand synthesis. In ColE1, the primer is extended by Pol I, which unwinds the downstream region, leading to formation of D-loop structures, allowing, successively, recruitment of PriA or DnaABC primosomes and of full replisome (23, 24).

Another exception to the general scheme of initiation is plasmids of the pAMbeta 1 family from Gram-positive bacteria. Although they encode an initiator protein, they require for replication a small unstructured origin and a transcription step through the origin by the host RNA pol (25, 26). Furthermore, they are dependent on Pol I and independent of DnaA (25, 27, 28). The small origin (44 bp) does not possess some of the features found in other initiator-dependent plasmids, such as iterons, to allow binding of more than one monomer. However, it contains a 16-bp-long AT-rich region (88% AT against 68% for the whole origin). This AT-rich region is located immediately downstream from the initiation site of replication, itself located in the middle of the origin (29). The functions of both the transcription step and the initiator are unknown. The initiator, RepE, is a basic protein of 496 amino acids with no homologues in the data bases and no specific recognizable features (such as ATPase or helicase motives) other than a DNA binding motif (71% probability for a helix-turn-helix motif, according to the Dodd and Egan algorithm (30)) in the C-terminal region. The initial phase of pAMbeta 1 replication has been characterized to a certain extent. First, DNA replication is unidirectional. Second, mRNA originating upstream from the origin and synthesized codirectionally to DNA replication terminates at the initiation site of DNA replication, forming possible primers for leading strand synthesis (26). Third, the leading strand primer is used by Pol I to generate D-loop structures (~200 bp long) that are used as a signal for entry of the host PriA-dependent primosome (31-33).2 It is thought that the primosome directs replisome assembly through the general mechanism of replication fork rescue (34). These observations provide some indirect information on RepE functions as follows. (i) RepE might recognize the origin and play a role in mRNA maturation, since mRNA ending at the initiation site requires the intact origin and an active RepE and (ii) RepE is an unlikely landing pad for replisome assembly, as this task seems to be ensured by the PriA-dependent primosome.

As a first step in unraveling how RepE functions, we purified it to near homogeneity and analyzed its interactions with different nucleic acids. Results show that RepE binding to ori-containing supercoiled molecules leads to formation of an open complex in which the 20-30 nt encompassing the initiation site of DNA replication and downstream sequences are melted. An unexpected strong and nonspecific ssDNA binding activity allows RepE to bind to the melted region of the open complex. These results, which describe for the first time an open complex at the origin of a theta -replicating plasmid from a Gram-positive bacterium, are discussed in terms of possible mode of action of RepE in pAMbeta 1 initiation mechanism.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Strains and Plasmids-- The strains used were E. coli MC1061 (F- araD139 Delta (ara-leu)7696 galE15 galK16 Delta (lac)X74 rpsL (Strr) hsdR (rK- mK+) mcrA mcrB1) and Bacillus subtilis 168, 1A224, and its isogenic polA5 mutant, 1A226, which have been described previously (25). Plasmids pIL253, pHV1455, and pHV1455Rep* were described elsewhere (31, 33, 35).

To express and purify RepE, we constructed pCYB1repE using the pCYB1 vector (IMPACT I system from New England Biolabs), which allows the expression under the control of the Ptac promoter of a fusion between the C terminus of a target protein and the N terminus of a self-cleavable intein/chitin binding domain (CBD) tag. The repE open reading frame was amplified by PCR using pIL253 as substrate and the following primers: 5'-gagggaattccatATGAATATCCCTTTTGTTGT-3' (containing an NdeI site, underlined) and 5'-ggaattcgctcttccgcaGCCTGTATCATAGCTAAACAAATCG-3' (containing a SapI site). The PCR product was cloned into the NdeI and SapI sites of pCYB1, allowing a precise fusion between the last Gly codon of RepE gene and the N terminus of the removable intein tag.

pBend2ori derives from pBend2 (36) by insertion of the minimal 44-bp pAMbeta 1 ori in the SalI site of the polylinker, such as pAMbeta 1 replication would proceed in the direction of the ampicillin gene.

pGEMori mainly derives from pGEM-3Zf+ (Promega) by insertion of a pAMbeta 1 49-bp ori segment in the EcoRI site of the polylinker, such as transcription from T7 promoter through the origin would proceed in the direction of pAMbeta 1 replication.

pMTL500E-ori corresponds to the construct 2 previously described in Bruand and Ehrlich (26). pMTL500E-oriDelta 1 and -oriDelta 2 correspond to pMTL500E-ori, except that the 44-bp ori sequence has been replaced by deleted forms truncated from the 3' end: the 36-bp oriDelta 1 and 27-bp oriDelta 2, which sequences are shown in Fig. 7B.

Purification of the pAMbeta 1 RepE Protein-- The RepE-Intein-CBD fusion protein was cloned under the control of the isopropyl-B-D-thiogalactoside-inducible Ptac promoter, and the construct was introduced in E. coli cells. Upon isopropyl-B-D-thiogalactoside induction, this RepE-Intein-CBD fusion was overproduced to about 2.5% of total protein and was mainly soluble. Typically, MC1061 cells newly transformed with pCYBrepE were grown to mid log at 30 °C into 1 liter of LB medium supplemented with 100 µg/ml ampicillin. At A650 = 0.6, the culture was shifted to 25 °C, and RepE-Intein-CBD fusion expression was induced by the addition of 1 mM isopropyl-B-D-thiogalactoside for 4 h. All the following operations were carried out at 0 to 4 °C. The cell pellet was resuspended in 25 ml of TENG (20 mM Tris-HCl, pH 8, 0.1 mM EDTA, 1000 mM NaCl, 10% glycerol), sonicated, and centrifuged to yield a clear lysate. The lysate was loaded onto a 5-ml chitin resin column (New England Biolabs), and unbound proteins were washed with 150 ml of TENG in which the NaCl concentration was increased to 2000 mM NaCl. To induce intein-mediated self-cleavage, the immobilized fusion protein was incubated overnight with 100 mM DTT in TENG, resulting in the release of a wild type RepE protein about 80% pure, whereas the intein-CBD fusion remained bound to the column. Ammonium sulfate was added to RepE-containing fractions in TENG to 50% saturation, and the precipitate was dissolved in 1 ml of TENG. The solution was diluted with 20 mM Tris-HCl, pH 8, 0.1 mM EDTA, 10% glycerol to a final concentration corresponding to 200 mM NaCl immediately before loading onto a 1-ml cation exchange Hi-Trap SP column (Amersham Pharmacia Biotech) pre-equilibrated in TENG in which the NaCl concentration was decreased to 200 mM NaCl. The column was washed with the same buffer, and the absorbed proteins were eluted with a step gradient at 640 mM NaCl (in a linear gradient, RepE elutes at about 400 mM NaCl). This step allowed eliminating the main contaminants and the DNA. Ammonium sulfate was added to the pooled fractions to 50% saturation. The precipitate was dissolved in 0.22 ml of TENG and applied at 0.1 ml/min on a 25-ml gel filtration Superdex 75 column (Amersham Pharmacia Biotech) equilibrated in 20 mM Tris-HCl, pH 8, 0.1 mM EDTA, 1000 mM NaCl. This chromatographic step allowed discarding traces of shorter contaminants and of some contaminating fusion protein. For storage, glycerol and NaCl were added to RepE fractions >95% pure to a final concentration of 20% and 1 M, respectively. The protein was then stored in aliquots at -80 °C. No loss of activity was observed after at least 1 year. Protein concentrations were quantified using the Coomassie protein assay reagent kit (Pierce) using BSA as a standard. Purity was estimated by SDS-PAGE and SYPRO® red (Molecular Probes) staining (sensitivity similar to that of silver staining).

To avoid aggregation and irreversible inactivation, RepE required throughout the whole purification procedure the presence of 1 M NaCl in Tris-HCl buffer, pH 8, or in phosphate buffers at or above pH 7.5 (insoluble aggregates are formed in phosphate buffers below pH 7.5 and in HEPES or Bicine buffer at pH 8, whatever the salt concentration used). However, temporary dilution at 200 mM NaCl was tolerated. To determine the oligomerization state of RepE, gel filtration chromatography on fast protein liquid chromatography system (Amersham Pharmacia Biotech) was performed as indicated above (in 1 M NaCl), and only one peak corresponding to the monomer was detected. The same chromatographic step performed at 50 mM NaCl allowed us to detect both large aggregates and the monomeric form of RepE.

DNA Substrates for Mobility Shift Assay-- The following oligonucleotides were used to make substrates for the binding reaction (uppercase letters indicate sequences from the minimal 44-bp pAMbeta 1 ori; letters in bold in the 61-mer osmg28 series emphasize the sequences that do not pair to the 61-mer osmg27). 75-mer ori-W, 5'-gggcgaatcgcgtctgaaAATAAAACCCGCACTATGCCATTACATTTATATCTATGATACGTacgcgaattcgag-3'; 75-mer ori-W5', 5'-gggcgaatcgcgttgtttagctatgatacaggctgaaAATAAAACCCGCACTATGCCATTACAcgcgaattcgag-3'; 75-mer ori-W3', 5'-gggcgaatcgcgtATTTATATCTATGATACGTgtttgttttttctttgctgtttagcgaatgacgcgaattcgag-3'; 56-mer ori-W5', 5'-gggcgaatcgcgtctgaaAATAAAACCCGCACTATGCCATTACAcgcgaattcgag-3'; 45-mer ori-W3', 5'-gggcgaatcgcgtATTTATATCTATGATACGTacgcgaattcgag-3'; 48-mer ori-W, 5'-ctgaaAATAAAACCCGCACTATGCCATTACATTTATATCTATGATACG-3'; 75-mer ori-C, 75-mer ori-C5', 75-mer ori-C3', 56-mer ori-C5', 45-mer ori-C3', 48-mer ori-C, which are reverse complementary to 75-mer ori-W, 75-mer ori-W5', 75-mer ori-W3' 56-mer ori-W5', 45-mer ori-W3' and 48-mer ori-W, respectively. 61-mer osmg27, 5'- gacgctgccgaattctaccagtgccttgctaggacatctttgcccacctgcaggttcaccc-3'; 61-mer osmg28-21, 5'-gggtgaacctgcaggtgggcggctgctcatcgtaggttagttggtagaattcggcagcgtc-3'; 61-mer osmg28-15, 5'-gggtgaacctgcaggtgggcaaatgctcatcgtaggttcactggtagaattcggcagcgtc -3'; 61-mer osmg28-9, 5'-gggtgaacctgcaggtgggcaaagattcatcgtagaggcactggtagaattcggcagcgtc -3'; 45-mer map121, 5'-ctatgagtcgcttttgtaaatttggcaggtactgccatatgctct-3'; 30-mer sda37: 5'-ctaatcaggagaattcgtaatcatggtcat-3'.

For the permutation assay, a set of DNA fragments of similar length (179 to 183 bp) but with the origin located at various positions relative to the fragment ends were isolated from pBend2ori either by digestion with different restriction enzymes (filled-in when required by Klenow enzyme) or by PCR using pBend (5'-tcaagaattcacgcg-3') and oriL4 (5'-AATAAAACCCGCACTATGCC-3') as primers.

The other double-stranded ori used were obtained by PCR using either the 75-mer ori-W or 75-mer ori-C oligonucleotide series as substrates and both 5'-gggcgaatcgcgt-3' and 5'-ctcgaattcgcgt-3' as primers or by annealing of the two complementary oligonucleotides. The other non-ori dsDNAs used were the 76-bp fragment of pBR322 digested by MspI and filled-in by Klenow enzyme or a 61-bp DNA obtained by annealing of 61-mer osmg27 and its reverse complementary strand. The n-nt eye substrates were obtained by annealing the 61-mer osmg27 oligonucleotide with the 61-mer osmg28-n. All DNAs used were labeled using either T4 polynucleotide kinase in the presence of [gamma -32P]ATP (3000 Ci/mmol) or Klenow enzyme in the presence of [alpha -32P]dATP (3000 Ci/mmol) and cold dCTP, dGTP, and dTTP, as recommended by the suppliers.

Labeled 75-mer RNA ori-W, the perfect RNA counterpart of 75-mer ori-W, was obtained from pGEMori linearized by EcoRI by in vitro transcription from the T7 promoter using [32P]UTP. 75-bp RNA/DNA ori was obtained by mixing labeled 75-mer RNA ori-W and cold 75-mer ori-C in 50 mM NaCl. The mixture was heated for 5 min at 85 °C and allow to cool slowly to room temperature. The complete formation of the RNA/DNA hybrid was verified during the gel retardation experiment, since 75-mer RNA ori-W and 75-bp RNA/DNA ori clearly have different mobilities.

Mobility Shift Assay-- Binding reactions were carried out in 10 µl of 10 mM Tris-HCl, pH 7.5, 70 mM NaCl, 2.5 mM MgCl2, 1 mM DTT, 5% saccharose, 0.005% xylene cyanol, 0.3 mg/ml BSA, 10 µg/ml poly(dI-dC), and 0.1-1 nM labeled DNA substrates unless otherwise specified. Reaction mixtures were incubated at 20-25 °C for 15 min and applied to a running 6% polyacrylamide gel (with either a 1/29 or 1/80 ratio of bisacrylamide/acrylamide) in 25 mM Tris base, 190 mM glycine, 1 mM EDTA. After electrophoresis at 8 V/cm, the gel was dried and exposed to storage phosphor screen. DNA was visualized on a Storm PhosphorImager and quantified using ImageQuant software (Molecular Dynamics). The equilibrium dissociation constants Kd for the RepE-DNA interaction were determined by the method of Carey (37). For this analysis we used a fixed input DNA concentration and various RepE protein concentrations spanning 4 orders of magnitude. Because the DNA concentration in the reaction mixture was much lower than the protein concentration, Kd was approximated as the RepE concentration needed for half-maximal binding of the DNA.

To measure the association rate, complex formation (between 2 nM radiolabeled 75-bp ori duplex containing the 44-bp minimal ori and 250 nM RepE) was quenched at various times by the addition of 1 µM of unlabeled DNA substrate. For the dissociation rate we let complexes between RepE and labeled 75-bp ori form for 10 min, then 1 µM of unlabeled DNA substrate was added, and the amount of complex remaining in the reaction was measured as a function of time.

Preparation of 3' End Singly Labeled DNA Fragments-- To obtain fragments labeled at only one end, pIl253 plasmid DNA was digested with a first restriction enzyme (AseI for the top strand and NheI for the bottom strand), filled in by the Klenow enzyme (in the presence of [alpha -32P]dATP (3000 Ci/mmol), [alpha -32P]dCTP (3000 Ci/mmol), cold dGTP and dTTP), and finally digested with a second restriction enzyme (HaeII for the top strand and AseI for the bottom strand). The labeled fragments of interest (220-bp AseI-HaeII for the top strand and 167-bp NheI-AseI for the bottom strand) were then purified using nondenaturing PAGE.

DNaseI Footprinting on 3' End Singly Labeled DNA Fragments-- RepE protein (10-1000 nM) was allowed to bind to its 3' end singly labeled substrate (0.1-1 nM; ~50,000 cpm) in 50 µl of DNaseI footprint buffer (10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 2.5 mM MgCl2, 1 mM CaCl2, 2 mM DTT, 50 µg/ml BSA, 10 µg/ml poly(dI-dC)) for at least 10 min at room temperature. RepE·DNA complexes were digested with DNaseI (3-6 ng) for exactly 2 min at room temperature, and the digestion was stopped by the addition of EDTA (final concentration of 25 mM). After ethanol precipitation, samples were resuspended in 5 µl of denaturing loading buffer (95% formamide, 20 mM EDTA, 0.05% bromphenol blue, 0.05% xylene cyanol), heated at 80 °C for 5 min before loading on 6% acrylamide-urea sequencing gels, and run in TBE buffer (90 mM Tris borate, 2 mM EDTA, pH 8.3) for 2 h at 60 W. Bands were visualized by direct exposure of the dried gels to storage phosphor screens and analyzed on a Storm (Molecular Dynamics) PhosphorImager.

DNaseI Footprinting on Supercoiled and Linear Plasmid-- RepE protein (50-500 nM) was allowed to bind to plasmid pIL253 (0.1-1 µg) either supercoiled or linearized in 50 µl of DNaseI footprint buffer (see above) for at least 10 min at room temperature. RepE·DNA complexes were digested with DNaseI (6-12 ng) for exactly 2 min at room temperature, and the digestion was stopped by the addition of EDTA (final concentration of 25 mM). Cleavage sites were mapped by primer extension as described below.

Orthophenanthroline-Copper (OP-Cu) Footprinting on Supercoiled and Linear Plasmid-- RepE protein (50-500 nM) was allowed to bind to plasmid pIL253 (0.1-0.5 µg) either supercoiled or linearized in 20 µl of OP-Cu footprint buffer (10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 2.5 mM MgCl2, 300 µg/ml BSA, 10 µg/ml poly(dI-dC)) for at least 10 min at room temperature. Footprinting reactions were then performed essentially as described by Sigman et al. (38). Briefly, reactions were started by adding 2 µl of 1,10-phenanthroline (1 mM), CuSO4 (0.23 mM) and 2 µl of 3-mercaptopropionic acid (58 mM) to the RepE·DNA complexes and incubated for 1 min at room temperature. Digestions were stopped by adding 2 µl of 2,9-dimethyl-1,10-phenanthroline (Neocuproine, 28 mM) and ethanol-precipitated. The four reaction components were from Sigma. Cleavage sites were mapped by primer extension as described below.

Dimethyl Sulfate (DMS) Footprinting on Supercoiled and Linear Plasmid-- RepE protein (50-500 nM) was allowed to bind to plasmid pIL253 (0.1-0.2 µg) either supercoiled or linearized in 20 µl of DMS footprint buffer (20 mM Tris-HCl, pH 8, 100 mM NaCl, 2.5 mM MgCl2, 300 µg/ml BSA) for at least 10 min at room temperature. Then, DMS footprinting reactions were performed essentially as described by Sasse-Dwight and Gralla (39). Briefly, reactions were started by adding precisely 0.1 µl of pure DMS (Sigma) for exactly 3 min at room temperature (final concentration 50 mM). Reactions were stopped by adding 40 µl of stop solution (1 M beta -mercaptoethanol, M ammonium acetate, 20 mM EDTA), and DMS was carefully eliminated by ethanol precipitation. Methylated nucleotides were mapped by primer extension as described below.

In Vitro KMnO4 Footprinting on Supercoiled and Linear Plasmid-- RepE protein (50-500 nM) was allowed to bind to plasmid pIL253 (0.1-1 µg) either supercoiled or linearized in 45 µl of KMnO4 footprint buffer (20 mM Tris-HCl, pH 8, 100 mM NaCl, 2.5 mM MgCl2, 300 µg/ml BSA) for at least 10 min at room temperature. Then, KMnO4 footprinting reactions were performed essentially as described by Sasse-Dwight and Gralla (39). Briefly, reactions were started by adding 5 µl of KMnO4 (50-100 mM) for 2 min at room temperature. Reactions were stopped by adding 50 µl of stop solution (3 M beta -mercaptoethanol, 40 mM EDTA, 0.6 M sodium acetate, pH 4.8) and ethanol-precipitated. Modified nucleotides were mapped by primer extension as described below.

In Vivo KMnO4 Footprinting-- 1A226 (pol+) or the isogenic polA5 (pol-) strain 1A226 carrying either pHV1455 or pHV1455Rep* was grown at 37 °C in MCD medium (K2HPO4 62 mM, KH2PO4 44 mM, C6H5Na3O7 3.4 mM, K2SO4 11 mM, MgSO4 0.8 mM, glutamine 0.2%, glucose 0.2%, casamino acid 0.5%, tryptophan 0.01%, histidin 0.005%, phenylalanine 0.005%, and ammonium-iron (III) citrate 11 µg/ml) containing erythromycin 0.6 µg/ml. At A650 = 0.5-0.8 and exposed to 10 mM KMnO4 for 2 min essentially as described by Sasse-Dwight and Gralla (39). The reaction was stopped by the addition of 5 mM DTT, the cells were harvested, and plasmid DNA was prepared using either standard alkaline lysis technique or a total DNA extraction procedure (40). Modified nucleotides were mapped by primer extension as described below.

Primer Extension-- First, modified plasmids DNAs from DNaseI, OP-Cu, DMS, or KMnO4 footprinting experiments were purified using Qiaquick PCR purification kit spin columns (Qiagen). DNAs were recovered in 30-50 µl of 10 mM Tris-HCl, pH 8.5, and 10-20 µl were used for the primer extension reactions.

Then primer extension reactions were done either using Sequenase or by linear PCR, as described by Sasse-Dwight and Gralla (39). In both cases, primers elc9 (5'-GAGCATACATTCATTCAAGAGAC-3') and elc17 (5'-CTACTCTCTCCTTCTCCCCC-3') were used unless otherwise specified. The primers were 5' end-labeled with [gamma -32P]ATP (3000 Ci/mmol) and T4 polynucleotide kinase.

When Sequenase was used, about 150 fmol of supercoiled or linear-modified plasmid (~ 0.5 µg) were denatured with 0.2 M NaOH, neutralized, annealed with 100 fmol of 5' labeled primer, and incubated for 10 min at 43 °C in 10 µl containing 3 units of Sequenase (Amersham Pharmacia Biotech), 200 µM each dNTP, 20 mM Tris-HCl, pH 7.5, 25 mM NaCl, 10 mM MgCl2, and 10 mM DTT. Reactions were stopped by adding 6 µl of loading buffer (95% formamide, 20 mM EDTA, 0.05% bromphenol blue, 0.05% xylene cyanol).

When linear PCR was used, about 30 fmol of supercoiled or linear modified plasmid (~0.1 µg) were first digested with restriction enzymes to yield fragments ~500 bp long. Samples were then dialyzed on micromembranes (Millipore VS 0.025 µM) for 20 min against Tris-HCl pH8 10 mM and incubated with 100 fmol of 5'-labeled primer in 25 µl containing 1.25 units of Taq polymerase (Roche Molecular Biochemicals), 200 µM each dNTP, 10 mM Tris-HCl, pH 8.3, 50 mM KCl, and 2.5 mM MgCl2. Linear amplification was done through 10 cycles of denaturation (94 °C, 30 s), annealing (45 °C, 30 s), and polymerization (72 °C, 30 s). Then 12.5 µl of loading buffer (see above) was added. In both cases (Sequenase or Taq polymerase), 8 µl of the mix were heated at 80-90 °C for 5 min before loading on 6% acrylamide-urea sequencing gels and run in TBE buffer (90 mM Tris borate, 2 mM EDTA, pH 8.3) for ~2 h at 60 W.

The regions modified by KMnO4, DNaseI, OP-Cu, or DMS were precisely localized by comparison with dideoxy-sequencing ladders obtained using end-labeled primers on pIL253-unmodified plasmid and run side by side with the footprints. Bands were visualized by direct exposure of the dried gels to storage phosphor screens and analyzed on a Storm PhosphorImager using ImageQuant software (Molecular Dynamics).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Purification of the RepE Protein-- Wild type RepE was purified using a C-terminal fusion of the entire protein with a modified intein protein carrying a chitin binding domain (see "Experimental Procedures" and Fig. 1). Purification on a chitin column followed by self-cleavage of the fusion protein resulted in the release of a wild type RepE protein of the expected size (57 kDa). Two further steps of purification led to a protein >95% pure as judged by SDS-PAGE and SYPRO® red staining (Fig. 1B, lane 5). Gel filtration chromatography allowed us to determine that RepE is monomeric in solution (data not shown; see "Experimental Procedures").


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 1.   Expression and purification of the pAMbeta 1 RepE protein. A, 20 µg total E. coli proteins from cells uninduced (lane 0) or induced by isopropyl-B-D-thiogalactoside (lane 1) for the expression of the gene encoding the RepE-Intein-CBD fusion were loaded on a 8% SDS-PAGE and stained with SYPRO® red. B, protein fractions of the various steps during RepE purification were loaded on a 10% SDS-PAGE: lane 1, crude extract from induced cells containing the RepE-Intein-CBD fusion; lane 2, insoluble protein fraction; lane 3, clarified crude extract; lane 4, RepE eluted after DTT-induced self-cleavage; lane 5, 2 µg of RepE after gel filtration chromatography; lane M, protein size marker. The black and white triangles indicate the positions of RepE and RepE-Intein-CBD protein fusion, respectively.

RepE Specifically Binds to pAMbeta 1 Double-stranded Origin Upstream of the Initiation Site of DNA Replication-- All known initiator proteins bind to their cognate origin to initiate DNA replication. Despite the absence of known iterons in the minimal 44-bp pAMbeta 1 origin, we tested whether RepE specifically recognizes and binds ori. Binding properties of purified RepE protein were investigated with various ori and non-ori dsDNA using a gel retardation assay. RepE binds a 75-bp dsDNA carrying the 44-bp minimal ori (75-bp ori) with a dissociation constant Kd of 18 nM (see Fig. 2A and Table I). The DNA sequence recognized by RepE lies in the 5' end of the minimal ori since the Kd of the 56-bp ori5' is in the same range (27 nM) and much lower than that of a 3' end fragment (>1 µM for the 45-bp ori3'). The differences in affinity between the 5' and 3' end of ori were not due primarily to the different size of the fragments, since similar differences were obtained with the 75-bp ori5' and ori3' (Fig. 2, B and C, Table I). Finally, RepE does not show any measurable affinity for non-ori dsDNA substrates (61- and 76-bp fragments were tested; see Table I and Fig. 3E). Therefore RepE binds specifically to the 24-bp part of the origin located 5' to the initiation site, with an affinity at least 50-fold higher than for non-ori dsDNA or the 3'-end of ori.


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 2.   Gel retardation analysis of RepE binding to various origin substrates. Gel retardation assays were carried out in 10 µl as described under "Experimental Procedures" using 0.1-1 nM either dsDNA (A, B, and C), ssDNA (D and E), RNA corresponding to the transcript through ori (top strand; F) or RNA/DNA ori duplex (G), 100 ng of poly(dI-dC), and the indicated concentrations of RepE protein. Scheme and nucleotide sequences of the substrates are presented in Table I and under "Experimental Procedures," respectively.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Equilibrium dissociation constants (Kd) of RepE on various nucleic acid substrates
The affinity of RepE for various nucleic acids was determined using gel retardation assays as described under "Experimental Procedures." A scheme of the various ori nucleic acids used is given indicating the initiation site of the leading strand (bent arrow), the parts of the minimal ori located either 5' (24-nt long, gray rectangle), or 3' (20-nt long, hatched rectangle) from the initiation site, the non-specific DNA from the top strand (-W, black line) or the bottom strand (-C, dotted line), and non-specific RNA from the top strand (broken line). The drawings are made on scale.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 3.   Gel retardation analysis of RepE binding to various non-origin substrates. Gel retardation assays were carried out as described under "Experimental Procedures" and in the legend of Fig. 2. Non-origin substrates of 61 nucleotides were used, present either in a single-stranded (A) or double-stranded (E) form or as partial double-stranded substrates with a central single-stranded bubble of 21, 15, and 9 nt (B, C, and D). All substrates were made using the labeled 61-mer osmg27 oligonucleotide alone (A) or annealed with fully (E) or partially (B-D) complementary oligonucleotides. The white and black triangles indicate the migration position of the 61-mer and the various bubbles in the free form, respectively.

To determine the association and dissociation rates between RepE and the 75-bp ori, gel retardation assay was used. Both rate constants could not be determined precisely by this technique, since all complexes were already formed at the shortest time tested (5 s; Fig. 4A), and no significant dissociation of the complexes was observed even 30 min after the addition of unlabeled ori (Fig. 4B). RepE thus recognizes and binds ori dsDNA very quickly, the complexes formed being extremely stable.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 4.   Association and dissociation rates of 75-bp ori·RepE complexes. Complex formation between 2 nM radiolabeled 75-bp ori duplex containing the 44-bp minimal ori and 250 nM RepE was quenched at various time with a 500-fold excess of unlabeled 75-mer ori-W either immediately (association rate) or 10 min after RepE addition (to let the complex reach an equilibrium; dissociation rate). The ratio of dsDNA ori bound to RepE at different times was quantified after gel electrophoresis using a Storm PhosphorImager. The data were used to plot the time courses for association (A) and dissociation (B) between RepE and 75-bp ori.

To confirm and define more precisely the RepE binding site, we carried out DNaseI protection assays on end-labeled pAMbeta 1 restriction fragments containing minimal ori flanked on either side by at least 60 bp of plasmid sequences. A region of 19 nt was protected from DNaseI digestion upon RepE binding on both strands (Fig. 5). The protected areas were situated 5' to the initiation site, the protected area on the top strand being shifted by 5 nt relative to the protected area on the bottom strand. A site of enhanced sensitivity at a G residue, which reveals a distortion of the double helix, was located in the middle of the protected region on the bottom strand. These results fit the gel retardation data, which define the RepE binding site to a 24-bp region in the 5' end of the minimal 44-bp ori. The Kd estimated from the DNaseI protection assays was in the same range as that measured by gel retardation assays (15-30 nM).


View larger version (63K):
[in this window]
[in a new window]
 
Fig. 5.   DNaseI footprint of RepE bound on ori fragments. Top, sequencing gel displaying DNaseI protection pattern of each ori strand in the absence and in the presence of RepE. ori-containing pAMbeta 1 restriction fragments were labeled at one end of the top (left panel) or the bottom strand (right panel) and incubated with 0, 200, and 800 nM RepE. Treatment with DNaseI and subsequent separation through a 6% polyacrylamide-urea denaturing gel were as described under "Experimental Procedures." The region protected from cleavage is indicated by double-headed arrows, and the initiation site of the leading strand synthesis is represented by a bent arrow. The black oval indicates a site of increased sensitivity on the bottom strand at a G residue. Numbers refer to the nucleotide sequence of pAMbeta 1 (GenBankTM access number AF007787). Lanes ACGT correspond to a ladder of M13mp18 dideoxy sequence with M13/pUC sequencing primer -40. This control sequence allowed determination of the size of the protected DNA fragments and the position of the footprints relative to the ori sequence. Bottom, schematic representation of the ori region with the DNaseI footprints of RepE data relative to the initiation site (bent arrow), the repE gene (open boxed arrow), and the 5' and 3' parts of the minimal 44-bp ori (gray and hatched boxes, respectively).

RepE Binds with High Affinity to ssDNA and Does Not Bind to RNA-containing Substrates-- A prerequisite for initiation of DNA synthesis is the opening of the origin, which results in the appearance of ssDNA. We therefore tested the affinity of RepE for ssDNA in a gel retardation assay using various ori and non-ori oligonucleotides (Fig. 2 and 3 and Table I). RepE bound to ssDNA containing a complete ori (75-mer ori-W and ori-C) with an affinity about 5-fold higher than comparable dsDNA (Fig. 2, compare panels A, D, and E). This affinity decreased only slightly (2-fold) when either truncated origins or non-origin ssDNAs were used, provided that their size was longer than about 60 nt (see Table I). The affinity decreased greatly for shorter segments, the DNA/RepE interaction being too weak to withstand electrophoretic analysis, which led to a smear of the DNA during the gel-shift assay (data not shown). As observed for the dsDNA ori substrate, the association of RepE to 75-mer ssDNA ori was very quick (kass < 5 s), and the complexes formed were extremely stable (kdiss 30 min; data not shown).

Opening of the origin should lead to the formation of a ssDNA bubble within a dsDNA region. We therefore tested RepE affinity for such structures in a gel retardation assay using segments of 61 bp with central bubbles of 9, 15, or 21 nt. A very high affinity similar to that obtained with the 75-mer ssDNA ori was found with the 21-mer bubble (Kd = 5 nM, Fig. 3B). Furthermore, a second retarded complex as well as traces of other uncharacterized complexes that may reflect the binding of additional Rep molecules appeared at higher RepE concentrations. The affinity of RepE for bubble substrates decreased about 2.5- and 40-fold when the size of the bubble decreased to 15 and 9 nt, respectively (Fig. 3, C and D). We conclude from these results that RepE has a high affinity for bubble structures provided that the ssDNA region is at least 15 nt long.

Initiation of pAMbeta 1 replication requires transcription of the origin. We therefore investigated RepE binding to different ori ribonucleotide substrates. A 75-mer transcript corresponding to the leading strand of the origin and, thus, mimicking a putative initiator transcript, was synthesized in vitro, and its affinity for RepE was tested either in the RNA form (75-mer RNA ori-W) or as RNA/DNA duplex (75-bp RNA/DNA ori). We did not detect a measurable affinity between RepE and the RNA-containing substrates (Fig. 2, F-G, Table I).

RepE Binding Moderately Bends the Double-stranded Origin Upstream of the Initiation Site-- Sequence-specific DNA-binding proteins frequently contort DNA by bending at the site of interaction (41). In the case of replication origin-binding proteins, this bending may facilitate open complex formation. To test whether RepE bends the double-stranded origin, we employed the gel retardation analysis of permuted fragments (42). A set of fragments of identical size, with the origin at variable positions relative to the fragment ends, was generated from plasmid pBend2ori, which contains the 44-bp minimal ori inserted between two tandemly repeated multicloning sites. As seen by gel retardation, free DNA ori segments migrate homogeneously, indicating that they do not possess any natural bend, whereas the complexed fragments show a characteristic bell-shaped curve (Fig. 6). This demonstrates that binding of RepE to the origin introduces a curvature in the DNA. However, the bending angle was very modest, only 31.3° (±0.6°, four independent experiments). The bent zone, identified as the center of the most retarded segments, is located just upstream from the initiation site of DNA replication in the region protected against DNaseI action upon RepE binding.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 6.   Gel retardation analysis of permuted fragments containing the minimal origin. Inset, gel retardation assay carried out as described under "Experimental Procedures" using a set of DNA fragments of similar length (179 to 183 bp) but with the origin located at various positions relative to the fragment ends followed by separation through 6% polyacrylamide gel. The fragments used were generated from pBend2ori either by PCR using as primers pBend and oriL4 (lane 1) or by restriction with the enzymes BglII (lane 2), SfaNI (lane 3), XhoI (lane 4), DraI (lane 5), PvuII (lane 6), SmaI (lane 7), SspI (lane 8), TfiI (lane 9), or BamHI (lane 10). Graph: for each lane, the relative mobility µ of DNA was calculated (µ = mobility of the retarded DNA/mobility of free DNA) and plotted against the position of the binding site. The result obtained with one out of the four independent experiments carried out is shown. The bending angle alpha , obtained by using the empirical formula cos alpha /2 = µ minmax (73), is indicated. Bottom, the minimal 44-bp ori is schematized as in Fig. 5. The position of the maximum of bending induced by RepE is indicated by a hatched rectangle.

RepE Distorts the AT-rich Sequences Downstream from the Initiation Site in Vivo and in Vitro-- To test whether RepE destabilizes the DNA pairing at the origin, potassium permanganate (KMnO4) footprinting was used. This drug oxidizes thymines (and to a lesser extent cytosines) at unwound or sharply distorted DNA sites (43-45). The modified nucleotides are easily detected on supercoiled DNA by primer extension, since DNA polymerases are unable to copy oxidized residues (46). Since KMnO4 efficiently enters bacterial cells, it can be used conveniently for both in vivo and in vitro distortion mapping (39).

In vivo, KMnO4 footprints were carried out using B. subtilis cells harboring plasmid pHV1455, a hybrid of a functional pAMbeta 1 replicon (pIL253) and a pTB19 replicon. Exponentially growing cells were submitted to KMnO4 treatment as described under "Experimental Procedures." Little modification of ori top strand was observed in vivo when repE was inactivated by a frameshift mutation (Fig. 7, A, RepE -). In the presence of RepE, specific sites were hyper-reactive, covering about 20 nt on the top strand, immediately downstream from RepE binding site. The reactivity was independent from DNA synthesis, since similar patterns were obtained in polA- and polA+ contexts. The band of strong intensity at the initiation site, detected in the polA+ context but not in the polA- context, originated from primer extension occurring on the newly synthesized leading strand extruded during DNA preparation from D-loop replication intermediates. RepE-dependent and Pol I-independent modifications of the bottom strand were also observed, but in a much narrower region (4-7 nt), encompassing the initiation site (Fig. 7A). We conclude that RepE-dependent distortion of the AT-rich region of the origin is revealed by KMnO4 oxidation in vivo.


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 7.   In vivo and in vitro KMnO4 sensitivity of pAMbeta 1 ori. A, KMnO4 oxidation patterns of pAMbeta 1 derivatives in vivo and in vitro. In vivo, exponentially growing B. subtilis cells of either wild type (polA+) or deficient in Pol I (polA5) carrying plasmid pHV1455 or a derivative inactivated for RepE synthesis (pHV1455*) were submitted to 10 mM KMnO4 treatment for 2 min as described under "Experimental Proce- dures." In vitro, 1 µg of pIL253 plasmid either supercoiled (sc) or linear (lin) was incubated 10 min at room temperature with or without (+ or -) 120 nM RepE and treated with KMnO4 (0 and 5 mM). Modification of the top and bottom strands were mapped by primer extension, using labeled primers elc17 and elc9, respectively. The same primers and unmodified pIL253 DNA were used for the control sequencing ladders (lanes ACGT). A schematic representation of the minimal 44-bp ori is positioned on the left of each panel (schematized as in Fig. 5). At the bottom of the panel, a comparison of the KMnO4 modifications obtained in vivo and in vitro is represented. The sequence in boxed uppercase letters corresponds to the minimal 44-bp ori. The black bars above and below the sequence indicate the location and intensity of the modifications induced by KMnO4 on the top and bottom strands, respectively. B, KMnO4 oxidation patterns of truncated ori. Supercoiled plasmids with either the wild type minimal 44-bp ori (pMTL500E-ori) or truncated forms containing the RepE binding site but lacking part of the sequences located downstream from the initiation site (pMTL500E-oriDelta 1 and -oriDelta 2) were treated as described above (except that a KMnO4 concentration of 5 mM was used). The primer extensions were done using the M13/pUC reverse sequencing primer -24 (top strand) and the sequencing primer -40 (bottom strand). On the left of each panel, only the wild type ori is schematized. At the bottom of the figure, a comparison of the KMnO4 modifications obtained for the wild type and the truncated origins is given schematically. The legend is as for panel A.

To gain further insight into the distortion mechanism and analyze the parameters involved in this process, we performed in vitro KMnO4 footprints. The role of RepE was investigated using pIL253, either in a supercoiled or linear form. This plasmid was incubated with or without purified RepE and submitted to KMnO4 treatment. Specific sites became hyper-reactive to KMnO4 oxidation upon RepE addition when supercoiled DNA was used. These sites are grouped in a ~23-bp region covering both DNA strands, immediately downstream from RepE binding site (Fig. 7A). This region did not show any peculiar reactivity toward KMnO4 in the absence of RepE, indicating that it does not behave as a DNA-unwinding element. The reactivity required a negatively supercoiled DNA substrate, since plasmid linearization rendered the origin completely resistant to KMnO4 oxidation. Thus, distortion of the origin requires RepE as the sole protein factor and depends strictly on DNA supercoiling. Interestingly, the oxidation patterns obtained in vivo and in vitro were highly similar for the top strand, suggesting that RepE alone promotes denaturation of the origin in vivo. In contrast, clearly different patterns were obtained for the bottom strand (see "Discussion").

The relative importance of ori and flanking sequences for KMnO4 sensitivity was investigated using pAMbeta 1 derivatives carrying either the entire 44-bp minimal ori cloned into a different locus or truncated origins. The extent of the deletions is shown Fig. 7B (bottom; these plasmids, pMTL500E-ori, -oriDelta 1, and -oriDelta 2, replicate in E. coli by their pUC moiety). Whereas pMTL500E-ori efficiently transformed B. subtilis cells and was maintained at a high copy number, the deletion of the 3' end of the origin completely abolished the transformation ability of the pMTL500E-oriDelta plasmids (data not shown). Supercoiled forms of the three plasmids were submitted to KMnO4 oxidation in vitro. The KMnO4 modification pattern of the minimal origin at this new locus was identical to that obtained with pIL253, which showed that the helix distortion of the origin is independent from flanking sequences (Fig. 7B, top). In contrast, the pattern of the truncated origins was highly affected; it showed a shorter modification zone, restricted to the remaining ori sequences (17 nt for the oriDelta 1 derivative; about 10 nt for oriDelta 2). Because the distorted region of the full-length 44-bp ori is particularly AT-rich (85% for the 23-bp distorted region versus 68% for the whole origin), the disappearance of KMnO4 modification observed with ori Delta 1 and Delta 2 may be explained by the replacement of this AT-rich region by a more GC-rich region (Fig. 7B, bottom). These results suggest that the RepE-mediated distortion of the complete AT-rich region of the origin is essential for initiation of DNA replication.

RepE Melts the AT-rich Sequence of the Origin, Forming an Open Complex in Vitro-- KMnO4 reacts not only with fully melted DNA, but also with bent, unstacked, or untwisted DNA (45, 47). Both the size of the modified region and the fact that pyrimidine residues on both strands were reactive with KMnO4 in vitro argue in favor of melted rather than only distorted DNA in pAMbeta 1. To confirm this conclusion, we used a DMS footprint technique (39). DMS modifies differently dsDNA and ssDNA. On dsDNA substrates, it methylates mainly the N-7 of guanines (48), whereas on ssDNA, it modifies N-1 of adenine and, to a lesser extent, the N-3 of cytosine (49). pIL253-supercoiled DNA, complexed or not with RepE, was treated with DMS, and modified residues were mapped by primer extension using Taq polymerase. The main signals obtained with dsDNA substrates in the absence of RepE corresponded to guanines presumably methylated at N-7 (Fig. 8). In the presence of RepE, new signals corresponded mainly to A and C residues in the distorted region revealed by the KMnO4 technique and on both strands (a weak protection of RepE binding site is also detected; see next paragraph). Their appearance argues that the distorted region corresponds to a truly melted region. However, the signals were faint and strictly dependent on the concentrations of DMS and RepE. This can be due either to the fact that not all molecules were denatured or to incomplete accessibility of DMS to the ssDNA. Moreover, we were unable to detect ssDNA in this AT-rich region of the origin by nuclease P1 cleavage in the presence of RepE (data not shown). These results suggest that an open complex is formed at the origin, but intense DMS modification and enzymatic attack of the ssDNA are prevented, possibly by further binding of RepE on this region (see "Discussion").


View larger version (50K):
[in this window]
[in a new window]
 
Fig. 8.   DMS footprint of RepE bound on supercoiled substrates. A, sequencing gel displaying DMS sensitivity of each strand around ori in the absence and in the presence of RepE. Supercoiled pIL253 DNA was incubated without (lanes 1, 4, 5, and 8) or with 300 nM (lanes 2 and 6) and 500 nM (lanes 3 and 7) RepE for 10 min at room temperature and treated with DMS as described under "Experimental Procedures." The modification sites on the top (lanes 1-4) and bottom (lanes 5-8) strands were mapped by primer extension using labeled primers elc17 and elc9 respectively followed by separation through a 6% polyacrylamide-urea sequencing gel. The same primers were used for the control sequencing ladder (lanes ACGT). A schematic representation (as in Fig. 5) of the minimal 44-bp ori is positioned on the left of each panel. Nucleotides partially protected by RepE against DMS modification are indicated with gray open circles. Nucleotides showing marked and slightly increased DMS sensitivity upon RepE binding are indicated with black and gray triangles, respectively. B, quantification of the experiment shown in A by Storm PhosphorImager analysis using ImageQuant software. Scans of lanes 3-4 (top strand) and 7-8 (bottom strand) are drawn at the top and the bottom of the panel, respectively. To facilitate the comparison, the scans obtained for each strand with naked DNA (black line) and RepE-bound DNA (gray line) are superimposed. A schematization of the ori region is presented with the same symbols as defined above.

In addition to the enhanced signals detected in the AT-rich region, a very faint protection (~40% in the top strand and ~40-60% in the bottom strand) was obtained in the region of the RepE double-stranded binding site (Fig. 8). The reason for this weak footprint cannot be due to a poorly active protein, since another footprinting reagent used in the same experiment, the chemical nuclease OP-Cu (see "Discussion"), revealed a clear protection of the RepE binding site. It is possible that the ineffective protection against DMS might be due to the fact that this reagent acts at the major groove of DNA. This may thus be indicative of a binding of RepE in the minor groove of dsDNA (see "Discussion").

Additional RepE Binding to the Melted Region of the Open Complex in Vitro-- Our results suggest that RepE is able to denature ~25 nt in the 3' end of the origin on supercoiled molecules and show that it binds efficiently to oligonucleotides forming bubble structures with ssDNA regions of at least 15 nt. Thus, we wondered whether additional RepE molecules could bind to the melted region of the open complex. To test this hypothesis, DNaseI and the chemical nuclease OP-Cu were used as footprinting reagents of RepE·ori complexes formed on supercoiled DNA, searching for an extension of the footprint observed on linear dsDNA. Neither reagent has any sequence specificity, and they both cleave the DNA through its minor groove. Mapping of the cleaved residues was done by primer extension on supercoiled pIL253 plasmids. As expected, an extended protection pattern, covering both RepE double-stranded binding site and about 30 nt downstream on both strands was clearly observed using OP-Cu footprints (Fig. 9). A similar extended protection area was also observed with DNaseI, although it was much fainter in this case (data not shown, but the result is summarized in Fig. 10). These results show that on supercoiled substrates RepE binding on dsDNA renders the downstream AT-region reactive for fixation of extra RepE molecules. Additionally, the clear footprint of the double-stranded binding site of RepE obtained with DNaseI and OP-Cu, in contrast to the weak one obtained with DMS, supports the hypothesis that RepE binds the DNA in the minor groove.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 9.   OP-Cu footprint of RepE bound on supercoiled substrates. A, sequencing gel displaying OP-Cu protection pattern of each strand around ori in the absence and in the presence of RepE. Supercoiled pIL253 DNA was incubated without (lanes 1, 4, 5, and 8) or with 300 (lanes 2 and 6) and 500 nM (lanes 3 and 7) RepE for 10 min at room temperature and treated with OP-Cu as described under "Experimental Procedures." The cleavage sites on the top and bottom strands were mapped by primer extension using labeled primers elc17 and elc9, respectively, followed by separation through a 6% polyacrylamide-urea sequencing gel. The same primers were used for the control sequencing ladder (lanes ACGT). A schematic representation (as in Fig. 5) of the minimal 44-bp ori is positioned on the left of each panel. Protected regions are represented as double-headed arrows; solid lines indicate the regions strongly (>40%) protected from OP-Cu modification, whereas dashed lines indicate extended and weaker footprints observed only on supercoiled DNA at the highest RepE concentration used. B, quantification of the experiment shown in A by Storm PhosphorImager analysis using ImageQuant software. Scans of lanes 3-4 (top strand) and 7-8 (bottom strand) are drawn at the top and the bottom of the panel, respectively. To facilitate the comparison, the scans obtained for each strand with naked DNA (black line) and RepE-bound DNA (gray line) are superimposed. A schematization of the ori region is presented with the same symbols as defined above.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 10.   Summary and schematic representation of the RepE footprints on the ori region. A compilation of DNaseI, OP-Cu, KMnO4, and DMS footprinting data, collected from the experiments shown in Figs. 5-9, is presented. The 44-bp minimal ori sequence is boxed and represented with its 5' part from the initiation site (bent black arrow) as uppercase letters on a gray background, and its 3' part is represented as uppercase letters on a hatched background. Numbers refer to the nucleotide sequence of pAMbeta 1 (GenBankTM access number AF007787). Flanking nucleotides are represented as smaller letters, and the 3' end of the repE gene is represented as an interrupted boxed arrow. The position of the maximum of bending induced by RepE is indicated above the sequence by a hatched rectangle. Data concerning the footprints detected on the top strand and bottom strand are represented above and below the sequence, respectively. As indicated on the left of the figure, DNaseI and OP-Cu footprints are represented as double-headed arrows; solid lines indicate the regions strongly (>40%) protected from cleavage by the nucleases on supercoiled or linear DNA, whereas dashed lines indicate extended and weaker footprints observed only on supercoiled DNA at high RepE concentration. The two black ovals indicate the sites of DNaseI increased sensitivity at two G residues on the bottom strand on supercoiled DNA (only one hypersensitive G was detected when a linear DNA fragment was used). Light gray open circles represent the very weak protection of the G residues against DMS methylation. The black and gray triangles indicate marked or slight increases of DMS sensitivity, respectively, induced by RepE. The black bars indicate the location of the modifications probed by KMnO4 in vitro and in vivo (their height being proportional to the intensity of modification).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The initiation mechanism of pAMbeta 1 replication is original because it requires a small unstructured origin, an initiator protein (RepE), a transcription fork passing through the origin codirectional to DNA synthesis and Pol I but not DnaA. To better understand this process, we have characterized the RepE/ori interaction. Our observations show that RepE possesses some of the features expected for an initiator together with some unexpected properties. Indeed, RepE binds, bends, and melts the origin in a supercoiling-dependent way to form an open complex. However, the double-stranded origin contains a single RepE binding site (there is no iterons), the bend is weak, and RepE binds nonspecific ssDNA more efficiently than dsDNA. Very importantly, the melted DNA in the open structure is a substrate for further RepE binding. We thus speculate that in open complex formation, the ssDNA binding activity compensates for the weak bend and for the lack of RepE oligomerization on the double-stranded origin.

RepE Interaction with the Double-stranded Origin-- Using gel retardation assays and in vitro footprint experiments, specific and efficient binding was observed between RepE and the double-stranded origin (Kd ~ 20 nM). The binding site was mapped to the 25-bp sequence located upstream from the initiation site. Careful examination of this sequence did not reveal any repeated sequence longer than 2 bp, which suggests that pAMbeta 1 differs from the previously described initiator-encoding replicons by having a unique binding site for the initiator protein in the double-stranded origin (see Ref. 8 for review). Even replicons such as R1, reported as lacking iterons, possess more than one binding site (with a 5-bp common core sequence) for the initiator protein (50). Thus, whatever the replicon, multimers of the initiator protein are involved in origin binding and initiation of replication. In contrast, a single RepE molecule appears to bind to the pAMbeta 1 double-stranded origin since (i) a unique complex is detected by gel shift analysis, and (ii) RepE is a monomer in solution. However, when the plasmid is supercoiled, several monomers of RepE bind to the origin as discussed below.

Comparison of the footprints obtained at RepE double-stranded binding site with various reagents (DNaseI, OP-Cu, DMS) reveals some interesting features (see Fig. 10 for a summary). Efficient protection (70-95%) against reagents that act in the minor groove of the DNA (DNaseI or OP-Cu) was observed, whereas the protection against reagents that act in the major groove (DMS) was much weaker (40-60%). Taken together, these results suggest that RepE binds primarily in the minor groove of the 5' end of the origin. Binding in the minor groove has been demonstrated for protein p6 from B. subtilis phage Phi 29 (a nonspecific dsDNA-binding protein that activates the initiation of Phi 29 DNA replication (51)) and for many architectural factors that introduce large bends in the DNA (such as the prokaryotic IHF and HU proteins and the eukaryotic HMG proteins (52, 53)). However, the initiators DnaA from E. coli and RepA from pPS10 were shown to interact with both major and minor grooves (54, 55).

Open Complex Formation and Binding of Additional RepE on the Melted DNA-- A number of studies in prokaryotic and eukaryotic genomes sustain the idea that the origin must be strongly bent for duplex opening, allowing subsequent entry of the replicative helicase (4, 56, 57). Sharp bending of the origin occurs consequent to the binding of multimers of the initiator (58-60) and may be helped by an intrinsic curve in the DNA (61, 62). Unlike these replicons, pAMbeta 1 origin does not possess any intrinsic bending and only a very weak bend (31°) is induced by RepE binding on linear fragments containing the origin (Fig. 6). This raises the question about the existence of other factors that could enhance this bend and about its function in pAMbeta 1 initiation. Several convergent data suggest that, on supercoiled substrates, RepE binding promotes the denaturation of the downstream AT-rich region. In vitro, KMnO4 footprints show that RepE binding highly distorts the AT-rich region of the origin (Fig. 10). This distortion is strictly dependent on RepE, the presence of the AT-rich sequence, and the supercoiling of the ori-containing substrates. DMS footprint experiments revealed a significant increase in the methylation of the A and C residues of the AT-rich region upon RepE binding at the origin (Fig. 10). This indicates that the AT-rich region is melted. Interestingly, DNaseI and OP-Cu footprints performed on supercoiled templates revealed protections extending from the RepE binding site to more than 30 nt downstream, covering the AT-rich region. These extended footprints together with the fact that RepE binds with a high affinity to dsDNA fragments containing single-stranded bubbles at least 15 nt-long (Fig. 3) suggest that RepE binds the melted region of the origin, protecting it from DNaseI or OP-Cu cleavage. RepE binding in the melted region could explain both the weak accessibility of DMS to the ssDNA and the lack of P1 sensitivity on supercoiled ori-containing plasmid in the presence of RepE. Such a resistance of an origin melted region to P1 nuclease has been described in other systems such as simian virus 40 (47). The fact that the extended footprints observed either with OP-Cu or DNaseI did not reveal 100% protection upon RepE binding might be explain by several hypotheses. First, RepE might not bind to all the supercoiled molecules. Second, some cleavage of ssDNA might occur even in the presence of RepE. Third, binding of RepE might be dynamic, leading to sliding of the protein along ssDNA. Finally, although RepE dissociates from ssDNA very slowly, re-annealing of the melted region could displace the protein from its ssDNA-binding site.

Possible Role for the Strong ssDNA Binding Activity of RepE-- As shown by gel retardation assays, RepE does not bind nonspecific dsDNA but binds efficiently ori-containing dsDNA and even more efficiently any ssDNA. Other initiators have been found to possess some ssDNA binding activity. Preferential binding of DnaA to the upper strand of the open complex at oriC was suggested because of the poor cleavage of this strand by P1 nuclease compared with that of the lower strand (4). However, although bacteriophage