Originally published In Press as doi:10.1074/jbc.M008967200 on December 27, 2000
J. Biol. Chem., Vol. 276, Issue 13, 10338-10346, March 30, 2001
A Single Amino Acid in the Cytoplasmic Domain of the
2 Integrin Lymphocyte Function-associated
Antigen-1 Regulates Avidity-dependent Inside-out
Signaling*
Diederik A.
Bleijs,
Gerard C. F.
van Duijnhoven,
Sandra J.
van
Vliet,
José P. H.
Thijssen,
Carl G.
Figdor, and
Yvette
van Kooyk
From the Department of Tumor Immunology, University Medical Center
Nijmegen, Philips van Leydenlaan 25, Nijmegen 6525 EX, The Netherlands
Received for publication, October 2, 2000, and in revised form, December 20, 2000
 |
ABSTRACT |
The leukocyte-specific
2
integrin lymphocyte function-associated antigen-1 (LFA-1)
(
L/
2) mediates
activation-dependent adhesion to intercellular adhesion
molecule (ICAM)-1. In leukocytes, LFA-1 requires activation by
intracellular messengers to bind ICAM-1. We observed malfunctioning of
LFA-1 activation in leukemic T cells and K562-transfected cells. This
defective inside-out integrin activation is only restricted to
2 integrins, since
1 integrins expressed
in K562 readily respond to activation signals, such as phorbol
12-myristate 13-acetate. To unravel these differences in inside-out
signaling between
1 and
2 integrins, we
searched for amino acids in the
2 cytoplasmic domain
that are critical in the activation of LFA-1. We provide evidence that
substitution of a single amino acid (L732R) in the
2
cytoplasmic DLRE motif, creating the DRRE motif, is sufficient to
completely restore PMA responsiveness of LFA-1 expressed in K562. In
addition, an intact TTT motif in the C-terminal domain is necessary for
the acquired PMA responsiveness. We observed that restoration of the
PMA response altered neither LFA-1 affinity nor the phosphorylation
status of LFA-1. In contrast, strong differences were observed in the capacity of LFA-1 to form clusters, which indicates that inside-out activation of LFA-1 strongly depends on cytoskeletal induced receptor reorganization that was induced by activation of the
Ca2+-dependent protease calpain.
 |
INTRODUCTION |
The lymphocyte function-associated antigen-1
(LFA-11; CD11a/CD18;
L/
2) is a member of the leukocyte
integrin family. LFA-1 expression is leukocyte-specific and mediates
adhesive interactions between cells. The
2 integrin
LFA-1 consists of a common
2 subunit that is
noncovalently associated with an
L subunit (1). By binding to the intercellular adhesion molecule (ICAM)-1, LFA-1 is
important in mediating cellular interactions in the immune system such
as cytotoxic T cells and natural killer cell-mediated cytotoxicity,
helper T lymphocyte responses, and leukocyte adhesion (2-5).
LFA-1 has to be activated via outside-in or inside-out signals to
efficiently bind ICAM-1. Outside-in signaling has been identified by
LFA-1 activating antibodies (6) or immobilized ligands, resulting in
cell spreading, rise in intracellular Ca2+ and pH,
phosphorylation of proteins, and costimulatory signals (7, 8).
Inside-out signals are initiated upon triggering of specific cell
surface molecules, generating intracellular signals that induce a high
affinity and/or avidity state of LFA-1 (9). Both conformational changes
(affinity) in the presence of Mg2+ and altered surface
distribution of LFA-1 into clusters (avidity) upon Ca2+
binding result in strong ligand binding (8, 10, 11).
Although the
L and
2 cytoplasmic domains
of LFA-1 are relatively short and do not contain any intrinsic kinase
activity, they are important for affinity and avidity regulation.
Previous studies have shown that LFA-1 adhesiveness is controlled by
the cytoplasmic domain of the
2 subunit, since
truncation of the cytoplasmic
2 domain, but not the
L domain, eliminates LFA-1 binding to ICAM-1 (12).
Complete deletion of the
2 cytoplasmic domain results in
clustering and spontaneous activation of LFA-1. This constitutively
active LFA-1 deletion mutant strongly binds to ICAM-1. The phorbol
ester PMA that activates PKC cannot further increase the adhesion to
ICAM-1 of this constitutive active LFA-1, in contrast to wild type
LFA-1 (13). It has been proposed that the
L cytoplasmic
domain of LFA-1 is involved in post-ligand binding events, since
deletion of the cytoplasmic
L domain does not affect
binding to ICAM-1 (12). Also, cytoskeleton restraints play a crucial
role in regulating LFA-1 avidity, since clustering of LFA-1 is induced
on resting PBLs after treatment with cytochalasin D (14).
Interestingly, this is not the case for
1 integrins, indicating that
2 and
1 integrins differ
in their ability to cluster into specialized lipidic membrane
microdomains, also termed rafts (15). Replacement of the
2 cytoplasmic domain for that of
1
(
L/
2/
1), creating a
chimeric LFA-1 molecule containing a
1 cytoplasmic
domain, provided us with additional evidence. The chimeric LFA-1
(
L/
2/
1) showed a clustered
cell surface distribution when expressed in the erythroleukemic cell
line K562. Furthermore, PMA activation of the chimeric LFA-1 molecule
increased the adhesion to ICAM-1. This was in contrast to wild type
LFA-1 that, when expressed in K562, is not clustered and is
defective for PMA-induced activation (13).
Several regions within the
2 cytoplasmic domain are
thought to be important in regulating LFA-1. Alanine substitutions of conserved threonines (TTT) in the
2 cytoplasmic domain
reduce ICAM-1 binding, and a serine residue is phosphorylated upon PKC activation by PMA (16). There are different consensus sequences known
in the
2 cytoplasmic domain that can associate with
intercellular components, such as cytohesin-1 (17), Rack1 (18), and
-actinin (19).
The observation that, despite their homology,
2 and
1 integrins are differently regulated by inside-out
signals, prompted us to identify residues within the
2
cytoplasmic domain that are involved in the PMA-induced LFA-1-mediated
ligand binding. To this end, we substituted
2 amino
acids for those of the
1 cytoplasmic domain that are
critical for PMA-induced adhesion in K562 cells. We observed that a
single
2/
1 amino acid substitution is
sufficient to completely restore the PMA responsiveness by enhancing
LFA-1 avidity but not the affinity. In addition, we observed that
activation of LFA-1 by PMA is dependent on cytoskeletal rearrangements
that seem to be mediated by the Ca2+-dependent
protease calpain.
 |
EXPERIMENTAL PROCEDURES |
Monoclonal Antibodies--
The monoclonal antibodies (mAbs)
SPV-L7 (IgG1), NKI-L15 (IgG2a), and NKI-L16 (IgG2a) reactive with the
-chain of LFA-1 were raised as described previously (20). The
nonblocking mAb TS2/4 (IgG1) reactive with
L (21), mAb
60.3 (IgG1) directed against
2 (22), and mAb KIM185
(IgG1) used to activate
2 integrins (6) were kindly
provided by Drs. E. Martz, N. Hogg, J. Harlan, and M. Robinson,
respectively. The blocking mAb SAM-1 (IgG1) was directed against the
5-chain of VLA-5 (23).
DNA Constructs--
The 4.2-kilobases
chain of LFA-1
was cloned in the XbaI site of the pCDM8 vector, which
directs expression of
L from the CMV AD169 immediate
early promoter (pCDL1). The 3'-end of
2 was cloned as an
EcoRI-BglII fragment in the pRc/CMV vector
(containing a neomycin resistance gene; Invitrogen Corp., San Diego,
CA). Within this sequence is a unique ApaI site at position
1980. The C-terminal end was rebuilt from this site using 10 overlapping oligonucleotides and amplification by PCR to obtain the
appropriate hybrids. For the
2/
1 chimeric
protein, amino acid 752 of
1 cytoplasmic domain was
joined to the amino acid 732 of
2. The deletion mutant
of LFA-1 was made by truncation of the
2 cytoplasmic domain from amino acid 724 (13). All point mutations in the
1 and
2 cytoplasmic domain were generated
by the oligonucleotide-directed pAlter® mutagenesis system (Promega,
Madison, WI) according to the protocol. The following
oligonucleotides were used: L732R-
2, CTGAGCGACCGCCGGGAGTAC; Y735F-
2, CTCCGGGAGTTCAGGCGCTTTG;
S756C-
2, CCCCTTTTCAAGTGCGCCACCACGACG;
T758V-
2, TTCAAGAGCGCCGTCACGACGGTCATGAAC; F766Y-
2, AACCCCAAGTATGCTGAGAG; R732L-
1,
ATAATTCATGACCTAAGGGAGTTTGC. For the deletion mutants, the following
oligonucleotides were used:
731-
2,
CACCTGAGCGACTAACGGGAGTACAGG;
732R-
2,
TGAGCGACCGCTGAGAGTACAGGC;
732L-
2,
AGCGACCTCTGAGAGTACAGG. Both double mutants
L732R,S756C-
2 and L732R,T758V-
2 were
created using L732R-
2 as template and subsequent
mutagenesis with the appropriate oligonucleotides for the
S756C-
2 and T758V-
2 point mutation. All
mutations were verified by nucleotide sequencing of the region encoding
the cytoplasmic domain.
Cell Culture and Transfection--
Stable LFA-1-expressing K562
transfectants were established by electroporation of 107
cells in 0.8 ml of phosphate-buffered saline at 280 V and 960 microfarads with the wild-type
L (in pCDM8) together
with wild type
2 subunit (in pRc/CMV), truncated
2 subunit, chimeric
2 subunit, or
point-mutated
2 subunit (13). K562-LFA-1 transfectants were cultured in RPMI 1640 medium (Life Technologies Ltd., Paisley, Scotland), supplemented with 10% fetal calf serum (BioWhitaker, Verviers, Belgium), 1% antibiotics/antimycotics (Life Technologies, Inc.). After 48 h, the neomycin analogue, Geneticin (2 mg/ml; Life
Technologies Ltd.) was added to the culture medium. The different transfectants were sorted three or more times to obtain a homogeneous population of cells expressing high levels of LFA-1. Positive cells
were stained with FITC-conjugated TS2/4 mAb and isolated using a
Coulter Epics Elite cell sorter (Coulter, Hialeah, FL).
Immunofluorescence Analysis--
Expression of LFA-1 on the
transfectants was determined by immunofluorescence. Cells (2 × 105) were incubated (30 min, 4 °C) in phosphate-buffered
saline, containing 0.5% (w/v) bovine serum albumin (Roche Molecular
Biochemicals) and 0.01% sodium azide (10 mM; Merck) with
appropriate dilutions of either an anti-integrin mAb or an
isotype-matched control antibody, followed by incubation with
FITC-labeled goat F(ab')2 anti-mouse IgG mAb
(Zymed Laboratories Inc., San Francisco, CA) for 30 min at 4 °C. The relative fluorescence intensity was measured by
FACScan analysis (Becton Dickinson, Oxnard, CA).
Fluorescent Bead Adhesion Assay--
For cell adhesion to
ICAM-1, cells were resuspended in TSA (TSM (20 mM Tris-HCl,
pH 8.0, 150 mM NaCl, 1 mM CaCl2, 2 mM MgCl2), 0.5% bovine serum albumin (w/v))
(5 × 106 cells/ml). 50,000 cells were preincubated
with or without LFA-1-blocking mAb (20 µg/ml) for 10 min at room
temperature in a 96-well V-shaped bottom plate. Carboxylate-modified
TransFluoSpheres (488/645 nm, 1.0 µm; Molecular Probes, Inc.,
Eugene, OR) were coated with adhesion ligands (ICAM-1 Fc) as described
earlier (24). The ligand-coated TransFluoSpheres (20 beads/cell)
and different integrin stimuli (100 nM PMA (Calbiochem)
or 10 µg/ml LFA-1-activating mAb KIM185) were added, and the
suspension was incubated for 30 min at 37 °C. Optionally, cells were
pretreated with 5 µg/ml cytochalasin D (Sigma) for 15 min at 37 °C
or with 20-100 µg/ml calpeptin (Calbiochem) for 30 min at 37 °C.
The cells were washed with TSA and incubated for 10 min at room
temperature with FITC-conjugated anti-TS2/4-antibody. The cells were
washed with TSA and resuspended in 100 µl of TSA. The LFA-1
transfectants that expressed similar levels of LFA-1, as determined by
staining for TS2/4-FITC (minimum 30% of the cells with a mean
fluorescence intensity of 70-80), were gated and analyzed for
LFA-1-mediated adhesion measured by flow cytometry using the FACScan.
Values are depicted as integrin-specific adhesion (i.e. cell
adhesion percentage minus cell adhesion percentage in the presence of
an integrin-blocking mAb).
Soluble ICAM-1 Fc Binding--
Transfectants were resuspended in
TSA (5 × 106 cells/ml). 50,000 cells were
preincubated with or without LFA-1-blocking mAb (20 µg/ml) for 10 min
at room temperature in a 96-well V-shaped bottom plate. Different
concentrations of purified soluble ICAM-1Fc were added together with
medium or the LFA-1-activating mAb KIM185 (15 µg/ml), and the
suspension was incubated for 30 min at 37 °C. The cells were washed
with TSA and incubated for 30 min at room temperature with
FITC-conjugated goat anti-human Fc-specific antibody (Jackson
Immunoresearch Laboratories, West Grove, PA). The cells were washed
with TSA and resuspended in 100 µl of TSA. The percentage of positive
cells was measured by flow cytometry using the FACScan. Values are
depicted as the percentage of positive cells (i.e. cell
adhesion percentage minus cell adhesion percentage in the presence of
an integrin-blocking mAb). Alternatively, the concentration of soluble
ICAM-1Fc that gives half-maximal adhesion (ED50) is depicted.
Confocal Microscopy--
Cells were fixed with 0.5%
paraformaldehyde. Fixed cells were stained with TS2/4 mAb (10 µg/ml)
for 30 min at 37 °C, followed by incubation with FITC-labeled goat
F(ab')2 anti-mouse IgG mAb (Zymed Laboratories
Inc., San Francisco, CA) for 30 min at room temperature. Cells
were attached to poly-L-lysine-coated glass slides, after
which cell surface distribution of integrins was determined by Confocal
laser-scanning microscopy (CLSM) at 488 nm with a krypton/argon laser
(Bio-Rad; model 1000). The CLSM settings were as follows: lens, × 60;
gain, 1300; pinhole, 1.5 µm; and magnification, × 2.0. The same
instrument settings of the CLSM were used throughout the distinct experiments.
 |
RESULTS |
Substitution of the
2 by the
1
Cytoplasmic Domain Restores PMA Responsiveness in K562 Cells
Transfected with LFA-1--
LFA-1 is a cell adhesion receptor that is
exclusively expressed on leukocytes. Activation of LFA-1 is required
for efficient binding to its ligand ICAM-1. The addition of the phorbol
ester PMA has been shown to activate LFA-1 on leukocytes (10). When wild type LFA-1 is transfected into the
erythroleukemic cell line K562 (K562-
L/
2)
(Figs. 1 and 2), the
2-activating antibody KIM185 can activate LFA-1 and
induce LFA-1-mediated adhesion to ICAM-1; however, an inside-out
activator of LFA-1, such as PMA, cannot activate LFA-1 (Fig.
3A) (13). This lack of PMA
responsiveness of LFA-1 is not caused by a general defect of
intracellular signal molecules, since other endogenous expressed
integrins like VLA-5 can be activated by PMA to bind its ligand
fibronectin. Our finding that expression of chimeric LFA-1 containing
the
1 cytoplasmic domain
(
L/
2/
1) can completely
restore the PMA responsiveness of LFA-1 in K562 cells prompted us to
search for single amino acids that differ between the
1
and
2 cytoplasmic domain.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic diagram of
1 and
2 subunit point mutants. Wild type
1 (A) and 2 (B)
subunits are composed of a large extracellular part, a transmembrane
region (TM), and a cytoplasmic domain. Mutations in the
cytoplasmic domain of 2 amino acids substituted for
1 residues (A) and visa versa (B)
are in boldface type. One-letter amino acid codes
are shown.
|
|

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 2.
Expression of LFA-1 on LFA-1-transfected K562
cells. K562 cells transfected with LFA-1 were stained with
specific antibodies directed against CD11a (SPV-L7), CD18 (60.3), or an
isotype-matching control antibody. The mean fluorescence is indicated
in the graphs. One out of five experiments is shown.
|
|

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 3.
Binding of LFA-1 mutants expressed in K562
cells to ICAM-1-coated fluorescent beads measured by flow
cytometry. A, adhesion of
K562- L/ 2 and
L/ 2/ 1 cells to ICAM-1 or
fibronectin. Cells were incubated in medium, PMA (100 nM),
the activating anti- 1 mAb TS2/16 (10 µg/ml), or the
activating anti- 2 mAb KIM185 (10 µg/ml) together with
ligand-coated TransFluoSpheres for 30 min at 37 °C as
described under "Experimental Procedures." Depicted is the
percentage ± S.D. of either VLA-5- or LFA-1-specific adhesion to
fibronectin or ICAM-1, respectively. Specific adhesion is the
percentage of cells binding minus the percentage of cells binding in
the presence of an LFA-1-blocking mAb (NKI-L15) or a VLA-5-blocking
antibody (SAM-1). B, adhesion of 2
cytoplasmic domain point mutants. Depicted is the mean percentage ± S.D. of LFA-1-specific adhesion to ICAM-1 of the gated cells that
expressed equal amounts of LFA-1 (mean fluorescent intensity 70-80) as
determined by staining with the FITC-conjugated nonblocking anti-LFA-1
antibody (TS2/4). Data are representative of three experiments.
Inset, adhesion of mutant
L/L732R- 2 to various soluble ICAM-1Fc
concentrations with or without activation by PMA. One of two
independent experiments is shown, S.D. 10%.
|
|
Substitution of Leucine for the
1 Arginine in the
DLRE Motif of the
2 Cytoplasmic Domain Restores PMA
Responsiveness of LFA-1 in K562 Cells--
To analyze in detail the
regions in the
1 cytoplasmic domain that are responsible
for the PMA responsiveness of
2/
1
chimeric LFA-1 molecule transfected in K562, several point mutations
were created in the
2 cytoplasmic domain. Amino acids of
the
2 cytoplasmic domain were substituted for the
residues present in the
1 cytoplasmic domain (Fig. 1).
K562 cells were transfected with
L-chain together with
the
2-chain containing cytoplasmic domains of
1 or
2 as described under "Experimental
Procedures." The expression levels of K562 cells transfected with the
LFA-1 chimeras and point mutants were determined by
fluorescence-activated cell sorting analysis using anti-CD11a and
anti-CD18 antibodies (Fig. 2). The mutations in the
2
cytoplasmic domain did not affect the
/
heterodimerization based
on the expression of
/
heterodimer dependent MHM23 epitope, and
immunoprecipitation of LFA-1 from all mutants confirmed that mutant
LFA-1 was expressed as
/
heterodimers (data not shown).
The capacity of the LFA-1 mutants to adhere to ICAM-1 was determined
using an ICAM-1-coated fluorescent bead adhesion assay (24) in the
absence or presence of PMA or the LFA-1-activating antibody KIM185
(Fig. 3B). This adhesion assay allows analysis of only those
cells that have similar expression levels of LFA-1. Only cells with a
mean fluorescence of 70-80 were analyzed for ICAM-1-coated fluorescent
bead binding. All LFA-1 mutants were able to adhere to ICAM-1
for at least 40% when activated by KIM185, indicating that the
LFA-1 molecules are functionally expressed on the K562 cells. The level
of LFA-1-mediated adhesion to ICAM-1 without any activation is low
(<8%) except for the mutant
L/L732R-
2 (18%). Mutation of potential tyrosine and serine phosphorylation sites
within the
2-chain to
1 residues
(
L/Y735F-
2 and
L/S756C-
2) do not restore the PMA
responsiveness (Fig. 3B). The same holds true for the
threonine at position 758, which has been reported to be involved in
cell spreading, and the phenylalanine at position 766, which affects
ligand binding (16). Of all mutants, only substitution of leucine for
the
1 amino acid arginine
(
L/L732R-
2) in the DLRE motif of the
2 cytoplasmic domain results in a significant increase
in adhesion to ICAM-1 upon PMA stimulation. Since the adhesion of
unstimulated
L/L732R-
2 cells is already
high (18%), which might facilitate PMA activation, we investigated
adhesion to decreasing ICAM-1 concentrations to a level in which the
default adhesion of
L/L732R-
2 was similar
to that of wild type LFA-1 (Fig. 3B, inset). At
low ICAM-1 concentration, PMA could still enhance the adhesion of
mutant
L/L732R-
2, indicating that the PMA
responsiveness is truly induced by the point mutation and not by
inherent stronger adhesion. In addition, similar as
L/L732R-
2, mutant
L/S756C-
2 has also a default adhesion of
10% but does not respond to PMA. To investigate whether this single
mutation is crucial for PMA responsiveness, we mutated in the
2/
1 chimera the arginine present in the
DRRE motif of the
1 cytoplasmic domain to a leucine
(
L/R732L-
1). However, in mutant
L/R732L-
1, the PMA responsiveness was not
abolished, suggesting that this arginine residue within the full
1 cytoplasmic domain is not essential for PMA
responsiveness and thus that the PMA activation of
1 integrins is differently regulated than
2 integrins. The
PMA-induced adhesion of the latter mutant seems somewhat lower than in
mutant
2/
1 chimera. However, comparing
the relative PMA inducibility between the PMA-responsive mutants
demonstrates that there are no significant differences (Table
I). Taken together, these results indicate that the created DRRE motif in the
2
cytoplasmic domain is essential for PMA-mediated activation of
2 integrin LFA-1.
Avidity but Not Affinity Changes Correlate with PMA Induction of
2 Cytoplasmic Mutants--
To investigate whether the
restored PMA responsiveness of the
L/L732R-
2 mutant is due to a change in
avidity and/or affinity, we performed confocal microscopy to detect
avidity alterations and soluble ICAM-1 binding studies as affinity
measurements. Analysis of the LFA-1 cell surface distribution by
confocal microscopy shows that substitution of the
2
cytoplasmic domain for the
1 domain leads to clustering
of LFA-1 on the cell surface (13), whereas wild type LFA-1 expressed in
K562 cells shows homogeneous distribution of LFA-1 (Fig.
4A). All point mutants in the
2 cytoplasmic domain have a homogeneous LFA-1
distribution (Fig. 4, C and D, and data not
shown), with the exception of the PMA-responsive LFA-1 mutant
L/L732R-
2 that exhibits clusters of LFA-1
(Fig. 4B). Surprisingly, LFA-1 is clustered in all of the
1 cytoplasmic domain point mutants investigated, whereas
the reversed mutation
L/R732L-
1 has a
homogeneous LFA-1 distribution (data not shown) despite the fact that
the mutant is able to bind to ICAM-1 upon stimulation by PMA. These
results suggest that the clustered status of the
2
integrin LFA-1 in
L/
2/
1
and
L/L732R-
2 may facilitate the PMA
responsiveness of LFA-1.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 4.
Surface distribution of LFA-1 mutants in K562
cells by confocal laser-scanning microscopy. Cells were fixed
(0.5% paraformaldehyde) and subsequently stained with the
anti-LFA-1 mAb TS2/4 and GAM-F(ab')2-FITC second
antibodies. Wild type LFA-1 (A) is found homogeneous on the
cell surface, similar to L/S756C- 2
(C), L/T758V- 2 (D),
and L/L732R,T758V- 2 (E). LFA-1
is localized in large clusters on
L/L732R- 2 (B) and
L/L732R,S756C- 2 (F) as
indicated by arrows. The instrument settings of the CLSM
were the same for the four different panels as follows:
lens, × 60; gain, 1300; pinhole, 1.5 µm; and magnification, × 2.0. One out of three experiments is shown.
|
|
Whether also the affinity of LFA-1 for ICAM-1 is altered in the
L/L732R-
2 mutant that responds to PMA, we determined the concentration of soluble ligand (ICAM-1Fc) that yielded half-maximal direct ligand binding activity (ED50). High affinity of
LFA-1 for ICAM-1 results in a low concentration of ICAM-1Fc needed to obtain 50% of maximal binding. Strong binding of ICAM-1Fc was observed
after stimulation of LFA-1 with the activating mAb KIM185 (Table
II). Binding of ICAM-1Fc to the mutants
was LFA-1-dependent, since LFA-1-blocking antibodies
completely inhibited adhesion (data not shown). When the concentration
of ICAM-1Fc that yielded half-maximal binding was calculated, we
observed an ED50 of ~2 µg/ml for soluble ICAM-1Fc
binding to LFA-1 of K562-
L/
2,
L/
2/
1,
L/L732R-
2,
L/S756C-
2, and
L/T758V-
1. Mutant
L/Y735F-
2 has a slightly, but not
significantly (p = 0.136), lower affinity (ED50 = 4.9 ± 0.14 µg/ml) compared with wild type
LFA-1 (ED50 = 3.0 ± 1.53 µg/ml). Activation of
L/L732R-
2 with PMA (ED50 = 6.0 ± 1.63 µg/ml) does not significantly (p = 0.248) increases the affinity compared with unstimulated cells
(ED50 = 4.5 ± 2.25 µg/ml) as shown in Fig.
3B (inset). Together, these findings indicate that not affinity but avidity changes are responsible for the PMA
responsiveness of mutant
L/L732R-
2 to
bind ICAM-1.
Importance of the
2 Cytoplasmic Domain for PMA
Responsiveness of LFA-1 in K562 Cells--
To determine whether only
L732R in the
2 domain was enough to generate PMA-induced
adhesion, we deleted the
2 cytoplasmic domain directly
after the wild type leucine at position 732 in the DLRE motif, at the
similar position in the mutant
L/L732R-
2, or after the aspartic acid at position 731 (Figs. 1A and 2).
Deleting the cytoplasmic domain immediately after position 731 or 732 completely abolished the PMA-induced adhesion to ICAM-1 (Fig.
5A), whereas the
LFA-1-activating antibody KIM185 induced ICAM-1 binding equally well
(50%). These results demonstrate that next to the
1
residue L732R in the
2 cytoplasmic domain also other
residues within the C-terminal part of the
2 cytoplasmic
domain are necessary for the acquired PMA responsiveness of mutant
L732R-
2.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 5.
Adhesion of LFA-1 deletion mutants expressed
in K562 cells to ICAM-1-coated fluorescent beads measured by flow
cytometry. A, LFA-1-expressing K562 cells were
preincubated in medium, PMA (100 nM), or the activating
anti- 2 mAb KIM185 (10 µg/ml) for 30 min at 37 °C in
the absence or presence of the LFA-1-blocking mAb NKI-L15.
B, adhesion of LFA-1 double mutants transfected into K562
cells. Depicted is the mean percentage ± S.D. of LFA-1-specific
adhesion to ICAM-1 of the gated cells that expressed equal amounts of
LFA-1 (mean fluorescent intensity 70-80) as determined by staining
with the FITC-conjugated nonblocking anti-LFA-1 antibody (TS2/4). In
A, S.D. is 10%. Integrin-specific adhesion represents the
percentage of cells binding minus the percentage of cells binding in
the presence of an integrin-blocking mAb (NKI-L15). One representative
experiment out of four is shown.
|
|
Threonine 758 Is Important for PMA Responsiveness of
L732R-
2--
To investigate which amino acids
C-terminal of position 732 in the
2 cytoplasmic domain
are necessary together with L732R for PMA-induced LFA-1 activation,
double mutants were created that contained both L732R and serine and
threonine mutations located C-terminal of L732R (Fig. 1). Serine and
threonine residues have been shown to be important in LFA-1
phosphorylation and function (16, 25). These two double mutants,
designated
L/L732R,S756C-
2 and
L/L732R,T758V-
2, were stained for
functional expression of LFA-1 (data not shown), and the LFA-1-mediated
adhesion to ICAM-1 was studied using the ICAM-1-coated fluorescent bead
adhesion assay (Fig. 5B). To our surprise, the double mutant
L/L732R,T758V-
2 disrupted the
L732R-induced PMA response from 35 to 5%. Mutation of the potential
serine phosphorylation site (S756C) did not alter the PMA
responsiveness of double mutant
L/L732R,S756C-
2 (37%). These data
suggest that the acquired PMA responsiveness of mutant
L/L732R-
2 depends on the threonine
residue at position 758 but not the serine residue at position 756.
The
2-cytoplasmic domain contains several
phosphorylation-sensitive serine and threonine residues that are
phosphorylated upon phorbol ester stimulation (25). Since the
L/L732R-
2 mutant could restore the PMA
response, whereas the double mutant
L/L732R,T758V-
2 blocked this
responsiveness, we investigated the importance of serine or threonine
phosphorylation of the
2-cytoplasmic domain due to PMA
activation. Both mutants and wild type LFA-1 in K562 cells are serine-
and threonine-phosphorylated on the
L- and
2-cytoplasmic domain with or without PMA stimulation
(data not shown), suggesting that the lack of PMA responsiveness of
mutant
L/L732R,T758V-
2 is not caused by
an impaired phosphorylation on serine or threonine residues in the
LFA-1 molecule.
To further investigate whether affinity and/or avidity changes regulate
the PMA response of the double mutants, we determined the affinity of
ICAM-1 by measuring the soluble ICAM-1Fc concentration needed to yield
half-maximal binding activity (Table II). Although the double mutants
L/L732R,S756C-
2 and
L/L732R,T758V-
2 differed in PMA
responsiveness, no significant changes could be observed for the
ED50 (1.9 ± 0.70 µg/ml ICAM-1 and 3.3 ± 1.79 µg/ml ICAM-1, respectively). However, analysis of the cell surface
distribution of LFA-1 revealed that LFA-1 was homogeneously distributed
on double mutant
L/L732R,T758V-
2 (Fig.
4E), whereas the PMA responsiveness of mutant
L/L732R,S756C-
2 (Fig. 4F)
showed a clustered LFA-1 surface distribution. This demonstrates a
strong correlation between a clustered LFA-1 cell surface distribution
and the capacity to respond to PMA.
PMA-mediated Activation of L732R-
2 Involves
Cytoskeletal Rearrangements--
It has been reported that activation
of LFA-1 in leukocytes is tightly regulated by the organization of the
cytoskeleton. Since LFA-1 clustering strongly correlates with PMA
responsiveness, we studied which cytoskeleton associated proteins are
involved in reorganization of LFA-1. We therefore investigated by
inhibiting actin assembly whether low concentrations of cytochalasin D
could allow integrin clustering and adhesion of non-PMA-responsive
LFA-1 transfectants. To our surprise, cytochalasin D could not restore the PMA response (Fig. 6) or enhance
clustering of LFA-1 (data not shown) as was observed in leukocytes
(14). In contrast, mutant
L/L732R-
2
exposed to cytochalasin D resulted in a constitutively active LFA-1
molecule, and cell adhesion was not further increased by PMA. This
indicates that the clustered
L/L732R-
2
might still be associated with the cytoskeleton.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 6.
Cytoskeletal rearrangements are important for
the LFA-1-mediated adhesion upon PMA stimulation. Wild type LFA-1
and point mutant L/L732R- 2 transfected
into K562 cells were preincubated with 5 µg/ml cytochalasin D or 100 µg/ml calpeptin. Cells were subsequently stimulated with medium, PMA
(100 nM), or the activating anti- 2 mAb
KIM185 (10 µg/ml) for 30 min at 37 °C in the absence or presence
of the LFA-1-blocking mAb NKI-L15.
L/L732R- 2 cells were also preincubated
with 20 µg/ml (dotted bars), 60 µg/ml
(hatched bars), or 100 µg/ml (black
bars) calpeptin before stimulation with PMA. Depicted is the
mean percentage ± S.D. of LFA-1-specific adhesion to ICAM-1 of
the gated cells that expressed equal amounts of LFA-1 (mean fluorescent
intensity 70-80) as determined by staining with the FITC-conjugated
nonblocking anti-LFA-1 antibody (TS2/4). Integrin-specific adhesion is
calculated as explained in Fig. 5. Data are representative for three
experiments.
|
|
Recently, increased levels of intracellular Ca2+ could
enhance LFA-1-mediated adhesion through induction of avidity changes in
LFA-1 due to the activation of a Ca2+-dependent
protease calpain that disrupts the cytoskeletal association with LFA-1
(26). Activation of calpain can be blocked by reagent calpeptin. To
investigate whether our LFA-1-transfected K562 cells regulate their
cell surface distribution by the activation of calpain, we inhibited
adhesion to ICAM-1 with calpeptin at concentrations previously
demonstrated to block calpain activity (26). Surprisingly, calpeptin
completely abrogated the PMA responsiveness of mutant
L/L732R-
2,
whereas a lower concentration of calpeptin (20 µg/ml) could not fully
block the PMA-induced adhesion (Fig. 6). These results indicate that
PMA acts via calpain to promote activation of LFA-1 through partial
dissociation from the cytoskeleton facilitating clustering of LFA-1 molecules.
 |
DISCUSSION |
Using a cell transfection system in which inside-out
signaling of the
2 integrin LFA-1 could be modified by
substitution of the
2 for the
1
cytoplasmic domain, we searched for single amino acids in the
2 cytoplasmic domain that regulate inside-out signaling.
We identified one amino acid at position 732, in which a leucine is
substituted for an arginine that could restore the PMA responsiveness
of LFA-1 completely. PMA inside-out signaling also depends on a
threonine located more C-terminally at position 758. Of all LFA-1
mutants that respond to PMA, avidity alterations and not affinity
changes or
2 phosphorylation seemed important for proper
function. We propose a model for this PMA responsiveness regulated by
position 732 and 758 and avidity changes regulated by activation of a
Ca2+-dependent protease calpain that releases
LFA-1 from the cytoskeleton, thereby allowing the formation of a
signaling complex leading to active LFA-1.
Integrin-dependent adhesion is strongly induced upon
inside-out signaling when PKC is activated through the addition of PMA or via T cell receptor triggering. It remains still obscure how "inside-out" signaling by PMA results in LFA-1 activation. The newly identified single amino acid mutation (L732R) responsible for PMA
activation of LFA-1 is situated in the
2 DLRE motif, which is conserved throughout the other integrins but distinct in one
amino acid (DRRE) in
1 and
7 integrins.
PMA can activate
1 integrins, but not
2
and
7 in K562 cells, suggesting that besides the DRRE
motif also lymphocyte specific elements are involved (13). In addition,
creating the DLRE motif in the
1 cytoplasmic domain
(
L/R732L-
1) did not abolish the PMA
responsiveness, indicating that the PMA activation of
1
integrins is differently regulated compared with
2
integrins. The DLRE motif has been proposed to bind the GFFKR motif in
the
-chain, and both of these cytoplasmic domains serve to constrain
LFA-1 into a default low affinity state (27). Mutations in the TTT
region (positions 758-760) into alanines residues of the
2 cytoplasmic domain have been shown to reduce the
default adhesion to ICAM-1 and the phorbol ester-mediated LFA-1
phosphorylation when expressed in COS cells or B lymphoblastoid cells,
but they do not abrogate the binding to ICAM-1 in response to PMA (16).
In contrast, we observed with the double mutant
L/L732R,T758V-
2 that substitution of the
threonine into the
1 residue valine in K562 cells
completely decreased the PMA-induced adhesion restored by the L732R
mutation and altered the LFA-1 surface distribution. The
phosphorylation level of these threonines after stimulation with PMA is
strongly increased upon pretreatment with okadaic acid, which inhibits
serine and threonine phosphatases (25). Threonine-phosphorylated CD18
molecules have been shown to associate with the cytoskeleton (28) and
play an important role in the formation of stress fibers and
specialized microdomains, such as rafts (15, 29, 30). However, in our
system we could not identify any role of threonine phosphorylation and
the PMA responsiveness of LFA-1, although the threonines themselves are a prerequisite for the PMA response together with the mutation L732R.
In line with the threonine phosphorylation, we observed also no
differences in serine phosphorylation, even in double mutant
L/L732R,S756C-
2 that was still able to
adhere to ICAM-1 upon stimulation with PMA. This further questions the
relevance of this serine residue in phosphorylation and ICAM-1 binding
as shown in other studies (16). The tyrosine-based NPKY motif in the
1 cytoplasmic domain has been implicated in regulating
integrin function (31). However, substitution of the phenylalanine for the
1 tyrosine (F766Y-
2) in this motif
did not restore PMA sensitivity. Thus, phosphorylation of the
2 cytoplasmic domain is not a prerequisite for the
acquired PMA responsiveness.
Cytohesin, a member of the guanine nucleotide exchange factors
for ADP-ribosylation factor G-proteins, specifically interacts with the
2 cytoplasmic domain directly after the
transmembrane region (positions 723-725), thereby controlling T cell
receptor or phorbol ester-induced activation of LFA-1 (17). Cytohesin expression is involved in maintaining LFA-1 in a high avidity state.
Since cytohesin is expressed in K562 cells and associates with LFA-1
(32), it is likely that the high avidity state of our DRRE mutant is a
direct result of cytohesin binding. Double staining of LFA-1 and
cytohesin in the
2 point mutants did not demonstrate
differences in colocalization of LFA and cytohesin (data not shown).
Upon PMA activation, many proteins are phosphorylated and activated via
PKC such as the
2-linked proteins Rack1, MacMARCKS, and
L-plastin. Phosphorylated Rack1 binds PKC, allowing subsequent recruitment of Rack1 to the KALI region in the
2
cytoplasmic domain, which is the same binding region for cytohesin (17, 18). The WD repeats 5-7 of Rack1 interact with
integrins, leaving
the other repeats free for binding to PKC and possible cytohesin. Thus,
Rack1 merely functions as a scaffold protein to recruit PKC and other
2 regulators to the site of action. MacMARCKS is a PKC
substrate phosphorylated upon PMA activation, which leads to an
increase in the lateral diffusion of
2 integrins and
enhanced LFA-1-dependent cell clustering (33). We could not
demonstrate by confocal microscopy any differences in cytosolic localization of MacMARCKS after activation with PMA (data not shown).
Hence, it remains unclear whether MacMARCKS directly binds the
2 cytoplasmic domain or Rack1. The leukocyte-specific
actin-bundling protein L-plastin proved to be important in enhanced
integrin avidity through PKC and PI-3 kinase (34). Upon PMA activation, calcium is released from intracellular stores and binds to the EF-hand
type calcium-binding domain of L-plastin, thereby inhibiting actin
bundling activity. Thus, MacMARCKS as well as L-plastin play a crucial
role in the association of the integrin with the cytoskeleton and
subsequently integrin activation. Besides PKC, phosphatidylinositol
3-kinase and the small GTPase Rap1 modulate LFA-1 avidity in leukocytes
(35, 36). Both Rap1 and the phosphatidylinositol 3-kinase but not PKC
mediated activation up-regulated the NKI-L16 epitope, indicating
increased LFA-1 avidity (35).
The actin cytoskeleton plays a critical role in integrin activation and
signaling by acting as a platform to bring different components close
together, leading to a signaling complex. The
cytoplasmic domain
has been demonstrated to be associated with the cytoskeletal component
-actinin (19), vinculin (37), filamin (38), or talin (39). Treatment
of cells with cytochalasin D, which disrupts the cytoskeleton network,
results in activation of LFA-1 that coincides with clustering of LFA-1,
indicating that the cytoskeleton restraints keep integrins inactive
(14). However, cytochalasin D had no effect on activation or clustering
of wild type LFA-1 expressed in K562 cells, indicating a different
mechanism of cytoskeletal organization. In contrast, the PMA-responsive mutant
L/L732R-
2 could be spontaneously
activated by cytochalasin D. The release of LFA-1 from the cytoskeleton
in lymphocytes is also thought to be regulated by the cysteine protease
calpain that is activated by local Ca2+ fluxes (26).
Indeed, we have evidence that the PMA-induced activation of LFA-1 is
mediated by calpain, since inhibition with calpeptin abrogated the PMA
responsiveness of mutant
L/L732R-
2. Calpeptin also has been reported to induce stress fiber formation in
fibroblasts due to its inhibitory action on protein-tyrosine phosphatases upstream of the small GTPase Rho (40). It is rather unlikely that this additional effect of calpeptin on protein-tyrosine phosphatases also occurs during the integrin-mediated adhesion of the
nonadherent K562 cells that do not induce stress fiber formation.
Proteins identified as potential calpain targets include talin,
filamin, and
-actinin. Talin forms the bridge between the
2 integrin and the actin filaments. Upon activation,
LFA-1 is released from the cytoskeleton as a result of proteolysis of talin, probably by calpain, leading to freely mobile integrin as
postulated by Sampath et al. (46). Next,
-actinin binds the
2 cytoplasmic domain between residues 736 and 746 directly C-terminal of the DLRE motif, thereby stabilizing the
cytoskeleton-integrin interaction necessary for strong adhesion. We
speculate that this
2-specific event is impaired in
K562, whereas the DRRE mutant partly restores the lateral mobility of
LFA-1, resulting in increased LFA-1 avidity. The
-actinin binding
motif is also important for endoplasmic reticulum retention, assembly,
and transport to the cell surface of LFA-1 (37). Peptides from the
1 cytoplasmic domain reveal that pp125FAK
and paxillin bind the membrane-proximal KLLMIIHDRREFA motif, which
includes the DRRE motif (41). In
2 integrins, paxillin is tyrosine-phosphorylated by MacMARCKS, and both colocalize in the membrane ruffles of spreading macrophages (42).
The acquired PMA signaling of our LFA-1 mutants in K562 cells coincides
with a change in a clustered LFA-1 cell surface distribution. Much
attention has been recently given to specialized lipidic membrane
microdomains, also termed "rafts." They function as platforms for
signaling molecules and are involved in the regulation of LFA-1
function and adhesion through avidity changes (15, 30). Whether the
PMA-responsive LFA-1 mutant is differently organized in rafts compared
with wild type LFA-1 remains so far unsolved. Our results suggest that
increased avidity facilitates PMA induced adhesion to ICAM-1 rather
than affinity changes. Clustering of LFA-1 molecules probably leads to
a higher concentration of signaling components involved in LFA-1
signaling such as cytohesin, Rack1, paxillin, or MacMARCKS as shown in
a model in Fig. 7. Furthermore, activation of LFA-1 by PMA is dependent on calpain, which cleaves cytoskeletal components. This is probably a crucial event, because one
can imagine that dislodgment from the cytoskeleton facilitates binding
of signaling molecules, leading to a reorganization of the cytoskeleton
and activation of LFA-1. We have shown that this process can be
overruled by adding cytochalasin D. However, PMA seems ineffective in
cells with a homogeneous distribution of LFA-1. In the case of the
mutants with a clustered LFA-1 distribution, the threshold for
triggering the PMA signaling cascade is lower, since the concentrations
of signaling molecules directly or indirectly connected to the
cytoplasmic domain of LFA-1 are higher. Therefore, we cannot exclude
the possibility that PMA indeed has an effect on LFA-1 in K562 cells,
albeit small and not detectable with our assays. By using the soluble
ICAM-1 binding assay, we can detect relatively small changes in LFA-1
affinity. However, all of our mutants showed an equal ability to bind
soluble ICAM-1, indicating no affinity differences. Previous reports
suggest that affinity changes play an important role in regulating
integrin-mediated adhesion, although we showed earlier that this is not
true for
2 integrins (43, 44). Activation of LFA-1 by
EGTA or Mg2+ leads to enhanced expression of the M24
epitope, indicating that Mg2+ binding induces
conformational changes in LFA-1, leading to enhanced ICAM-1 binding
(45). Since we observed no changes in affinity and M24 expression of
the mutants, we conclude that the acquired PMA responsiveness has no
effect on the extracellular conformational changes of LFA-1.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 7.
Model for dynamic avidity regulated
inside-out signaling of LFA-1. A, schematic model of
the LFA-1 2 cytoplasmic domain that regulates avidity
changes and PMA responsiveness. LFA-1 is kept in an inactive state by
cytoskeletal restraints attached to the cytoplasmic domain of LFA-1.
Wild type LFA-1 expressed in K562 cells
(K562- L/ 2) is nonclustered and cannot be
activated by PMA to bind ligand. The threshold for PMA to activate
LFA-1 is insufficient because an efficient signaling complex or
microdomain cannot be formed due to the absence of clusters of LFA-1.
However, substitution of the leucine at position 732 for the
1 amino acid arginine together with an intact TTT motif
induces LFA-1 to reorganize into clusters and thereby restores the PMA
responsiveness of LFA-1. PMA triggers PKC and subsequently activates,
phosphorylates, and recruits a cascade of substrates, such as cytohesin
(32), Rack1 (18), MacMARCKS (33), paxillin (42), L-plastin (34), and
phosphatidylinositol 3-kinase (35), and increases intracellular
Ca2+ levels (9). Calcium can activate specific proteases
such as calpain that releases LFA-1 from the cytoskeleton (26).
Presumably, talin is cleaved from the cytoskeleton (46), resulting in
mobile LFA-1 and reorganization of the cytoskeleton network.
Cytochalasin D disrupts the cytoskeleton and bypasses the PMA-induced
activation. This allows LFA-1 to recruit signaling components that
re-establish the contact with the cytoskeleton, leading to the
formation of a signaling complex able to efficiently bind
ligand. Because LFA-1 is in a default clustered status in the
L732R- 2 mutant, these signaling components are
concentrated near the LFA-1 cytoplasmic domain, leading to a signaling
complex able to activate the LFA-1 threshold for PMA induced inside-out
signaling. B, amino acid sequence of the 2
cytoplasmic domain with the binding sites (underlined) for
cytohesin, Rack1, and -actinin. The threonine residues at positions
758-760 together with the phenylalanine (position 766) are required
for ligand binding. The mutated lysine creating the DRRE motif
and the essential threonine at position 758 restores the PMA
responsiveness of LFA-1 expressed in K562 cells.
|
|
In summary, we present in this study evidence that substitution of a
single amino acid in the
2 DLRE motif together with an
intact C-terminal TTT sequence is sufficient to restore PMA induced
LFA-1 adhesion to ICAM-1. The gained PMA signaling is probably due to
the presence of a dense LFA-1 intracellular signaling complex,
since these mutants have a clustered surface distribution of LFA-1. The
activation of LFA-1 is dependent on rearrangements of the cytoskeleton
through a mechanism involving a Ca2+-dependent
protease calpain. This work clearly demonstrates that the function of
LFA-1 is strictly regulated and involves a leukocyte-specific signaling element.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom all correspondence and reprint requests should be
addressed: Dept. of Tumor Immunology, UMC Nijmegen, Philips van Leydenlaan 25, Nijmegen, 6525 EX, The Netherlands.
Published, JBC Papers in Press, December 27, 2000, DOI 10.1074/jbc.M008967200
 |
ABBREVIATIONS |
The abbreviations used are:
LFA-1, lymphocyte
function-associated antigen-1;
CLSM, confocal laser-scanning
microscopy;
ICAM, intercellular adhesion molecule;
PKC, protein kinase
C;
PMA, phorbol 12-myristate 13-acetate;
Rack1, receptor for activated
protein kinase C;
VLA-5, very late activation antigen-5;
mAb, monoclonal antibody;
CMV, cytomegalovirus;
PCR, polymerase chain
reaction;
FITC, fluorescein isothiocyanate.
 |
REFERENCES |
| 1.
|
Springer, T. A.
(1990)
Nature
346,
425-434
|
| 2.
|
Krensky, A. M.,
Sanchez-Madrid, F.,
Robbins, E.,
Nagy, J. A.,
Springer, T. A.,
and Burakoff, S. J.
(1983)
J. Immunol.
131,
611-616
|
| 3.
|
Martz, E.
(1987)
Hum. Immunol.
18,
3-37
|
| 4.
|
van Kooyk, Y.,
van de Wiel-van Kemenade, E.,
Weder, P.,
Huijbens, R. J. F.,
and Figdor, C. G.
(1993)
J. Exp. Med.
177,
185-190
|
| 5.
|
Imhof, B. A.,
and Dunon, D.
(1995)
Adv. Immunol.
58,
345-416
|
| 6.
|
Andrew, D.,
Shock, A.,
Ball, E.,
Ortlepp, S.,
Bell, J.,
and Robinson, M.
(1993)
Eur. J. Immunol.
23,
2217-2222
|
| 7.
|
Wacholtz, M. C.,
Patel, S. S.,
and Lipsky, P. E.
(1989)
J. Exp. Med.
170,
431-448
|
| 8.
|
Figdor, C. G.,
van Kooyk, Y.,
and Keizer, G. D.
(1990)
Immunol. Today
11,
277-280
|
| 9.
|
Dustin, M. L.,
and Springer, T. A.
(1989)
Nature
341,
619-624
|
| 10.
|
Rothlein, R.,
and Springer, T. A.
(1986)
J. Exp. Med.
163,
1132-1149
|
| 11.
|
van Kooyk, Y.,
Weder, P.,
Heije, K.,
and Figdor, C. G.
(1994)
J. Cell Biol.
124,
1061-1070
|
| 12.
|
Hibbs, M. L.,
Xu, H.,
Stacker, S. A.,
and Springer, T. A.
(1991)
Science
251,
1611-1613
|
| 13.
|
Lub, M.,
van Vliet, S. J.,
Oomen, S. P.,
Pieters, R. A.,
Robinson, M.,
Figdor, C. G.,
and van Kooyk, Y.
(1997)
Mol. Biol. Cell
8,
719-728
|
| 14.
|
Lub, M.,
van Kooyk, Y.,
van Vliet, S. J.,
and Figdor, C. G.
(1997)
Mol. Biol. Cell
8,
341-351
|
| 15.
|
Pande, G.
(2000)
Curr. Opin. Cell Biol.
12,
569-574
|
| 16.
|
Hibbs, M. L.,
Jakes, S.,
Stacker, S. A.,
Wallace, R. W.,
and Springer, T. A.
(1991)
J. Exp. Med.
174,
1227-1238
|
| 17.
|
Kolanus, W.,
Nagel, W.,
Schiller, B.,
Zeitlmann, L.,
Godar, S.,
Stockinger, H.,
and Seed, B.
(1996)
Cell
86,
233-242
|
<