|
Originally published In Press as doi:10.1074/jbc.M008687200 on December 21, 2000
J. Biol. Chem., Vol. 276, Issue 13, 10492-10497, March 30, 2001
Mutational Analysis of Two Putative Catalytic Motifs of the
Type IV Restriction Endonuclease Eco57I*
Renata
Rimseliene and
Arvydas
Janulaitis
From the Institute of Biotechnology, Graiciuno 8, 2028 Vilnius,
Lithuania
Received for publication, September 22, 2000, and in revised form, November 28, 2000
 |
ABSTRACT |
The role of two sequence motifs (SM) as putative
cleavage catalytic centers
77PDX13EAK (SM I) and
811PDX20DQK (SM II) of type IV
restriction endonuclease Eco57I was studied by
site-directed mutational analysis. Substitutions within SM I; D78N,
D78A, D78K, and E92Q reduced cleavage activity of Eco57I to
a level undetectable both in vivo and in vitro.
Residual endonucleolytic activity of the E92Q mutant was detected only when the Mg2+ in the standard reaction mixture was replaced
with Mn2+. The mutants D78N and E92Q retained the ability
to interact with DNA specifically. The mutants also retained DNA
methylation activity of Eco57I. The properties of the SM I
mutants indicate that Asp78 and Glu92 residues
are essential for cleavage activity of the Eco57I,
suggesting that the sequence motif
77PDX13EAK represents the cleavage
active site of this endonuclease. Eco57I mutants
containing single amino acid substitutions within SM II (D812A, D833N,
D833A) revealed only a small or moderate decrease of cleavage activity
as compared with wild-type Eco57I, indicating that the SM
II motif does not represent the catalytic center of Eco57I.
The results, taken together, allow us to conclude that the
Eco57I restriction endonuclease has one catalytic center for cleavage of DNA.
 |
INTRODUCTION |
Nearly 3000 restriction endonucleases with over 200 different
specificities, which together with cognate DNA methyltransferases constitute restriction-modification
(R-M)1 systems, have been
identified in bacteria (1). Restriction-modification enzymes are
traditionally divided into three classes designated type I, II, and III
on the basis of enzyme subunit composition, cofactor requirements,
substrate specificity characteristics, and reaction products (2). An
increasing number of restriction endonucleases that do not fit into the
conventional classification however have been reported (3-7). Their
differences from the type I and type III enzymes are so substantial
that a classification as new kinds of restriction endonucleases; type
IIS, type IIT, type IV, and Bcg-like has been suggested (3-8).
The type IV restriction endonuclease Eco57I has been studied
in detail (4). Similar to type IIS endonucleases, it recognizes an
asymmetric nucleotide sequence, cleaves both DNA strands outside the
target site 5'-CTGAAG(N)16/14 and exists in
solution as a monomer. Other features of Eco57I, however,
such as stimulation of endonucleolytic reaction with the DNA
methyltransferase cofactor S-adenosyl-L-methionine (AdoMet) and methylation
of one strand of the recognition duplex, makes it similar to type III
enzymes. Both endonucleolytic and methylation activities reside within a single large polypeptide of the enzyme. In addition to the
bifunctional restriction endonuclease, the Eco57I R-M system
also includes a separate Eco57I methyltransferase, which
modifies both DNA strands of the target duplex. The methylation domain
has been previously assigned to the carboxyl-half of the
Eco57I restriction endonuclease, where conserved amino acid
sequence motifs typical for m6A DNA methyltransferases
involved in AdoMet binding and catalysis of methyl group transfer are
located (9). The location and identity of the endonuclease active
center though remains to be determined and is addressed here.
In contrast to DNA methyltransferases, the amino acid sequences of
restriction endonucleases share little similarity. This observation
therefore reduces the possibility of identifying catalytic sites of
restriction enzymes on the basis of sequence alignment. Structural and
mutational analysis of type II restriction endonucleases revealed
however the PDXn(D/E)XK motif as a
catalytic/Mg2+ binding signature motif (8, 10, 11). Two
putative catalytic/Mg2+ binding motifs (i.e.
77PDX13EAK and
811PDX20DQK, located in the
N-terminal and C-terminal parts of Eco57I, respectively)
have been described in the amino acid sequence of the enzyme (10). The
statistical significance of these motifs however is low, and their
presence does not allow unambiguous prediction of the active site, as
is evidenced by the following observations. (i) Cfr10I
contains the PDXn(D/E)XK motif, but
it is not part of its catalytic center (12) and (ii) EcoRI
contains two such motifs, one of which is not involved in catalysis
(10).
On the other hand it cannot be excluded that two active centers are
necessary for monomeric Eco57I to cleave both DNA strands. The asymmetric nature of the Eco57I target sequence is
inconsistent with the use of a symmetric dimer for recognition and DNA
cleavage, as in the type II restriction endonucleases. A single
molecule containing two endonucleolytic centers could cleave both DNA
strands. It has been suggested that a molecule recognizing an
asymmetric nucleotide sequence with a single catalytic center must
rearrange the catalytic center for sequential cleavage of each DNA
strand, or it must form a higher order complex to cleave both strands of DNA (13). This second mechanism is utilized by the restriction endonuclease FokI, the only type IIS enzyme characterized in
this respect so far (14). The identification of the Eco57I
catalytic center(s) would increase our understanding of the functional
organization of a unique enzyme, which shares properties with type IIS
and type III enzymes. We therefore constructed single amino acid
substitutions in the putative catalytic motifs of Eco57I to
determine the role of the two putative active centers, if any, in DNA
cleavage. The properties of the mutants suggest that of the two
putative catalytic motifs, only the motif
77PDX13EAK is involved in DNA
cleavage catalysis.
 |
EXPERIMENTAL PROCEDURES |
Bacterial Strains, Plasmids, Phage, and Media--
The
Escherichia coli strain ER2267 was used as host for cloning
procedures and was used to assess the endonuclease activity of the wt
Eco57I and mutants in vivo. It was kindly
provided by E. Raleigh. The E. coli CJ236 strain of genotype
F' cat (= pCJ105; M13sCmR)/dut
ung1 thi-1 relA1 spoT1 mcrA was used to prepare single-stranded DNA for site-directed mutagenesis. The E. coli BL21 strain
(Novagen) was used for the expression of the wild-type
eco57IR and mutant genes. The pUC19-based phagemid
pTZ19R (15) was used as a vector in site-directed mutagenesis
experiments and DNA sequencing. The plasmid pEco57IR3.6
(ApR) was constructed by subcloning eco57IR from
pEco57IRM6.3 (9) into the pET-21b expression vector (Novagen) in the
orientation coinciding with that of the T7 promoter. It was used for
the construction of mutant eco57IR genes and their
expression for purposes of protein purification. Plasmid pEco57IM3.3
(CmR) carries the Eco57I methyltransferase gene
cloned in the vector pACYC184 (9). Transformations of E. coli were carried out by the CaCl2 heat shock method
(16). All strains were grown in Luria-Bertani medium at 37 °C. The
following concentrations of antibiotics were used when necessary:
ampicillin (Ap), 60 µg/ml; kanamycin (Km), 50 µg/ml;
chloramphenicol (Cm), 30 µg/ml. vir was used to test
the in vivo function of the wild-type Eco57I and
mutants. Stocks of this phage were prepared according to Sambrook et al. (16).
Enzymes, Chemicals, and Oligonucleotides--
All enzymes,
including a homogeneous preparation of wt Eco57I, kits, and
DNA were provided by MBI Fermentas and used according to the
manufacturer's recommendations. [ -33P]dATP and
[ -33P]ATP were purchased from Amersham Pharmacia
Biotech. Synthetic oligonucleotides were synthesized at the facilities
of MBI Fermentas. All other chemicals were reagent grade commercial products.
Analysis of Viability of Strains Containing Wt and Mutant
Eco57I--
The ability of strains harboring wt or mutant
Eco57I to survive in the presence or absence of
Eco57I methylase was tested by transforming E. coli strain ER2267 containing or lacking pEco57IM3.3 with plasmids
carrying either wt or mutant eco57IR genes. An aliquot of
0.5 µg of each plasmid DNA (in a total volume of 10 µl) was used to
transform a 100-µl aliquot of competent cells. ApR or
ApRCmR transformants were selected. The
transformation efficiency of competent cells was tested by transforming
them with the control plasmid pBR322. Two independent transformation
experiments were carried out.
DNA Preparation and Manipulation--
Plasmids were prepared by
the alkaline lysis procedure (17) and purified additionally as
described by Marko et al. (18). Recombinant plasmid
construction and isolation of DNA fragments from agarose gels were
performed according to standard techniques (16). DNA sequencing was
carried out by the chain termination method (19).
Site-directed Mutagenesis--
To generate the single-stranded
DNA needed for mutagenesis, a 180-bp
Eco88I-Bst1107I and 680-bp
PstI-Eco105I DNA fragments of the
eco57IR gene (GenBankTM/EBI accession no.
X61122) containing N-terminal (SM I) and C-terminal (SM II) putative
catalytic motifs, respectively were subcloned into the pTZ19R phagemid,
which was then multiplied in the CJ236 strain. Site-directed mutants
were obtained by oligonucleotide mutagenesis using the method of Kunkel
et al. (20). Eco57I mutant proteins that differ
from the wild type by only a single amino acid were made using the
corresponding oligonucleotides: D78N, TAAAAAGCCAAACTACACG;
D78A, TAAAAAGCCAGCCTACACGT; D78K,
TAAAAAGCCAAAGTACACGTTT; E92Q,
TTTTTCCTTCAAGCCAAA; D812A,
TATTAAGCCGGCGCCAACTGGC; D833N, CTGCGATGTTAACCAGAAGCT; D833A,
CTGCGATGTTGCGCAGAAGCT. After introducing changes verified
by DNA sequencing, the fragments of the eco57IR containing
desired point mutations were exchanged with the corresponding fragments
of the wild-type gene in the pEco57IR3.6. The integrity of subcloning
sites was checked by restriction analysis.
Gel Electrophoresis of Proteins--
Gel electrophoresis of
proteins under denaturing conditions was performed as previously
described (21). SDS-PAGE was carried out on a 7.5% separating gel.
Protein bands were visualized after Coomassie Blue R250 staining.
Purification of Mutant and Wild-type Eco57I
Endonucleases--
E. coli BL21, freshly transformed by the
plasmid containing one of the mutant eco57IR genes, was used
as the source of the mutant enzyme. Expression was induced by adjusting
the culture to 1 mM
isopropyl-1-thio- -D-galactopyranoside at an
A600 of about 0.6. After 3 h, the cells
were chilled on ice, harvested by centrifugation and stored at
20 °C. All further steps were carried out at +4 °C. SDS-PAGE
electrophoresis was used throughout all purification steps to identify
chromatographic fractions containing mutant Eco57I proteins.
The purification procedure described below was used for isolation of
all mutant proteins used in experiments.
Twenty five grams of frozen cells were thawed and suspended in 80 ml of
buffer A (10 mM potassium phosphate, pH 7.4, 1 mM EDTA, 7 mM -mercaptoethanol) containing
0.1 M NaCl. Cells were disrupted by sonication and cell
debris was removed by centrifugation. The supernatant was applied to a
Heparin-Sepharose column (1.5 × 30 cm) equilibrated with buffer A
containing 0.1 M NaCl. The column was washed with the same
buffer and eluted with a 400-ml linear gradient of 0.1-1.0
M NaCl in buffer A. Fractions containing the mutant
Eco57I protein, as determined by SDS-PAGE electrophoresis, eluted at ~0.28-0.44 M NaCl. They were pooled and
dialyzed against buffer A containing 0.05 M NaCl and
applied to a Sepharose Q column (1.5 × 20 cm). The column was
washed with the same buffer and eluted with a 340-ml linear gradient of
0.05-0.3 M NaCl in buffer A. The peak fractions, which
eluted at ~0.12-0.17 M NaCl were pooled and dialyzed
against buffer A containing 0.1 M NaCl and applied to an
AH-Sepharose column (1.5 × 9 cm). After the column was washed
with the same buffer, sample was eluted with a 200-ml linear gradient
of 0.1-1.0 M NaCl in buffer A. The peak fractions (eluted
at 0.31-0.38 M NaCl) were pooled, dialyzed against the storage buffer (10 mM potassium phosphate, pH 7.4, 100 mM NaCl, 1 mM EDTA, 7 mM
-mercaptoethanol, and 50% glycerol) and stored at 20 °C.
Essentially the same procedure was used for purification of wt
Eco57I, which was kindly provided by MBI Fermentas. The proteins were homogeneous as judged by polyacrylamide gel
electrophoresis. Protein concentrations were determined
spectrophotometrically at 280 nm using an extinction coefficient of
120,390 M 1 cm 1 for a monomer
calculated from the amino acid composition (22). The concentrations of
Eco57I are given in terms of the monomeric protein.
DNA Cleavage Assay--
The endonuclease activity in
vitro was tested by incubation of serial dilutions of purified
proteins or cell-free extracts prepared as previously described (23)
with 1 µg of DNA at 37 °C for 1 h in a 50-µl reaction
volume containing 10 mM Tris-HCl, pH 7.5, 10 mM
MgCl2, 0.01 mM AdoMet, 0.1 mg/ml bovine serum
albumin (standard reaction mixture), followed by electrophoresis on
0.8% agarose gels. The same reaction buffer was used for determination of specific activity of purified proteins. 1 unit of the endonuclease was defined as the amount required to hydrolyze 1 µg of DNA in
1 h at 37 °C until no change in the cleavage pattern was
observed. In some experiments the standard reaction mixture was
modified to include MnCl2 instead of MgCl2 and
Sinefungin instead of AdoMet.
In vivo activity of wt and mutant restriction endonucleases
was tested by comparison of plating efficiency of the
vir bacteriophage on the strain ER2267 expressing wt
Eco57I or mutants, in the presence of Eco57I
methyltransferase on the compatible plasmid pEco57IM3.3, to that on
ER2267 cells expressing only Eco57I methylase
(nonrestricting host). Portions of serially diluted phage stock were
spotted on a lawn of bacteria, and the plates were incubated at
37 °C. The phage titer was determined (16). The efficiency of
plating (e.o.p.) was defined as the phage titer on the host under
investigation divided by the phage titer on a nonrestricting host.
DNA Methylation Assay--
The modification activity in
vitro was tested by the DNA protection assay where 1 µg of DNA served as substrate in 50 µl of reaction mixture (10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 1 mM dithiothreitol, 0.1 mg/ml bovine serum albumin, 0.1 mM AdoMet). The reaction was initiated by the addition of
varying amounts of sample solution and incubated for 1 h at
37 °C. The reaction was terminated by heating at 65 °C for 20 min. MgCl2 solution (final concentration of 10 mM), and an excess of Eco57I was then added to
the reaction mixture. The incubation was continued for 1 h at
37 °C. The reaction products were resolved by agarose gel electrophoresis. 1 unit of the modification activity was defined as the
amount of the enzyme that in 1 h at 37 °C rendered 1 µg of
DNA resistant to cleavage by Eco57I.
Preparation of DNA Fragments for Gel Mobility Shift Assay--
A
210-bp EcoRI-HindIII DNA fragment excised from
pEco57IRM6.3 containing a single Eco57I site in the middle
of the sequence was used as the specific DNA fragment. It was cloned
into the phagemid pTZ19R, and a single-nucleotide substitution was
introduced using a mispaired oligonucleotide by the method of Kunkel
et al. (20), generating a PstI site instead of
the Eco57I site. The resultant nonspecific 210-bp DNA
fragment was excised from the phagemid with EcoRI and
HindIII restriction endonucleases. Both specific and
nonspecific fragments were gel purified and radiolabeled using Klenow
polymerase to fill in their 5' extensions with
[ -33P]dATP and the other three dNTPs (16). DNA
concentrations were determined spectrophotometrically.
Gel Mobility Shift Assay--
Binding reactions (20 µl)
contained the 33P-endlabeled- specific or -nonspecific DNA
fragment (final concentration 10 pM) and the wt
Eco57I or mutant protein (final concentration in the range of 0-10 nM). The incubation was performed in binding
buffer (10 mM Tris-HCl, pH 8.0, 50 mM NaCl, 10 mM CaCl2, 0.1 mg/ml bovine serum albumin, 10%
glycerol) for 20 min at room temperature, and then the samples were
applied to a 6% polyacrylamide gel (29:1 acrylamide/bis).
Electrophoresis was carried out at 11 V/cm at room temperature in 40 mM Tris acetate, 10 mM CaCl2, pH
8.0 for 2 h. After electrophoresis, the gels were dried, and
radioactive bands were visualized using the OptiQuantTM
Image Analysis Software (Pacard).
 |
RESULTS |
Analysis of the Eco57I amino acid sequence revealed two
putative catalytic/Mg2+ binding sites: sequence motifs
77PDX13EAK (SM I) and
811PDX20DQK (SM II) (10). To assess
their relevance, if any, to cleavage activity of the enzyme, we
constructed a range of single amino acid substitution mutants of the
acidic residues of the motifs; the residues most conserved in
catalytic/Mg2+ binding centers of restriction endonucleases
(8, 11). The following mutants were constructed by site-directed
mutagenesis: D78N, D78A, D78K, E92Q for SM I and D812A, D833N, D833A
for SM II. The mutants were analyzed for their cleavage, methylation, and DNA binding activities.
Assay of Endonuclease Activity of Wild-type and Mutant
Eco57I--
Plasmids carrying either wild-type or mutant
Eco57I genes were used to transform E. coli
ER2267 strains with or without the Eco57I methylase gene (in
trans). As expected the plasmid encoding the wt
Eco57I did not transform E. coli unless it
harbored the protecting Eco57I methylase (see Table
I). Plasmids encoding the SM II mutants
D812A, D833A, and D833N expressed sufficient Eco57I
endonuclease activity to be lethal in the absence of protecting methylase, but transformation was effective in cells that expressed the
Eco57I methylase. Cells expressing the SM I mutants D78N, D78A, D78K, and E92Q did survive without cognate methylase protection however, suggesting that the mutants had no or very low endonucleolytic activity.
Wild-type Eco57I and mutants were also characterized for
their ability to protect E. coli cells against
vir phage infection. Phage titers were determined on
E. coli ER2267 strains expressing wild-type or mutant
eco57IR genes in the presence of the Eco57I methyltransferase and were compared with vir phage
titers on cells expressing only Eco57I methylase. The
e.o.p. of vir on the cells expressing mutants
D78N, D78A, D78K, and E92Q of SM I was practically the same as that on
the nonrestricting host indicating that the mutants failed to restrict
the incoming phage (see Table I). The ability of the D812A mutant to
restrict the vir phage was the same as that of the
wild-type Eco57I. The e.o.p. of vir phage on
the ER2267 strain expressing the D833N and D833A mutants was about
three orders and two orders of magnitude higher than on the cells with
the wild-type enzyme, respectively, indicating that the restriction
activity of these mutants was reduced as compared with the wild-type
Eco57I.
To assess the activities of the mutants in vitro, crude cell
lysates were used to cleave the DNA substrate. D812A, D833N, and
D833A mutants of SM II cleaved DNA specifically, like wild-type Eco57I (see Table I). No cleavage activity was detected in
crude cell lysates obtained from cells expressing the D78N, D78A, D78K, and E92Q mutants of SM I. For further studies of mutant protein enzymatic properties, the D78N, E92Q, D812A, D833A, and D833N mutants
were purified to apparent homogeneity, as described under "Experimental Procedures." Mutants of the conserved motif SM
II-D812A, D833A, and D833N retained specific activities ranging from
approximately the same as wt Eco57I (D812A) to ~40%
(D833N) of wt Eco57I specific activity (see Table I). The
D78N and E92Q mutant proteins did not show any DNA cleavage activity
under standard reaction conditions, even at the highest protein
concentrations tested (52 µg/ml), whereas partial DNA digestion was
observed with wt Eco57I at 0.013 µg/ml (data not shown).
Hence, the D78N and E92Q substitutions reduced Eco57I
endonuclease activity at least 4000-fold. The activity of E92Q (but not
that of D78N) was detected only after Mg2+ in the reaction
mixture was replaced with Mn2+ (Fig.
1). The activity of the E92Q mutant in
the presence of Mn2+ was lower than the activity of wt
Eco57I, as assessed under the same reaction conditions. Both
activities were lower than the cleavage activity of the wt
Eco57I tested in the presence of Mg2+. Even at
the highest wt Eco57I concentration (26 µg/ml) used in our
experiments in the presence of Mn2+, only partial DNA
digestion was observed (see Fig. 1), whereas 7.2 µg/ml was sufficient
in the presence of Mg2+ to yield complete DNA cleavage
(data not shown).

View larger version (85K):
[in this window]
[in a new window]
|
Fig. 1.
Effect of cofactors on endonucleolytic
activities of the wild-type and mutant Eco57I.
For each reaction 1 µg of DNA was incubated with 26 µg/ml of
purified wt Eco57I (W), D78N (D)
mutant, or E92Q (E) mutant protein for 1 h at 37 °C.
Reaction mixtures contained 10 mM Tris-HCl, pH 7.5, 0.1 mg/ml bovine serum albumin, and 10 mM MgCl2 or
10 mM MnCl2, as indicated. Reactions were
performed in the absence of AdoMet or Sinefungin ( ) or in the
presence of 0.01 mM AdoMet or 0.01 mM of
Sinefungin, as indicated. As controls, undigested DNA (lane
1) and DNA digested with 5 units of wt Eco57I in
the standard reaction buffer (lane 2) were used. Reaction
products were separated by electrophoresis on an 0.8% agarose
gel.
|
|
In vitro cleavage activity correlated well enough with the
restriction activities observed in vivo to suggest that
amino acids Asp-78 and Glu-92 are essential for the endonucleolytic
activity of the Eco57I restriction endonuclease, whereas
Asp-812 and Asp-833 of SM II are not. To test whether this effect was
caused by the loss of ability to cleave DNA by the D78N and E92Q
mutants or a deficiency in specific DNA binding, an electrophoretic
mobility shift assay was used for characterization of the mutants as
compared with wild-type Eco57I.
Binding of Wt and D78N, E92Q Mutant Proteins to the Eco57I Target
Site--
The effects of mutations on binding of the mutant
Eco57I proteins to DNA were examined using the gel mobility
shift assay. Two DNA fragments were used: a 210-bp DNA fragment
containing one Eco57I site in the middle of the sequence
(specific DNA) and a nonspecific DNA fragment, which had the same
sequence, except it lacked the Eco57I site as a result of a
1-bp substitution. The experiments were performed with purified
wild-type Eco57I, D78N, and E92Q mutant proteins. In initial
experiments, the DNA binding for the wild-type Eco57I
restriction endonuclease was characterized. Increasing amounts of the
Eco57I endonuclease were added to a fixed amount of
33P-endlabeled specific or -nonspecific DNA fragment, and
the free DNA was separated by electrophoresis from the DNA complexed
with the protein. Several attempts to visualize specific
Eco57I-DNA complexes in the absence of divalent metal ions
were unsuccessful. As previously described for EcoRV (24),
MunI (25), PvuII (26), and Cfr10I
(27), a stable protein-DNA complex was formed in the presence of
CaCl2. The gel shift assay of wt Eco57I binding with the specific fragment in the presence of 10 mM
CaCl2 revealed a shifted DNA band at low (0.01 nM) protein concentration (Fig. 2). The amount of the initial complex
increased with increasing protein concentration in the range of
0.01-0.1 nM and then progressively decreased as protein
concentration increased further (0.5-10 nM). Similar
binding studies of wt Eco57I with the noncognate DNA
revealed no shifted band corresponding to the initial complex. The DNA with retarded electrophoretic mobilities was observed only at high
protein concentrations (0.5-10 nM). Further, comparison of the wt Eco57I interaction with cognate and noncognate DNA
indicates that the initial complex (Fig. 2) corresponds to the specific enzyme-DNA complex, whereas bands of lower mobility correspond to the
complexes that are represented by DNA fragments bound both by
specifically and nonspecifically interacting enzyme molecules (28). The
binding pattern of the D78N and E92Q mutants to specific DNA fragments
indicates that they retain the ability to generate specific complexes
with cognate DNA similar to that of wt enzyme (Fig. 2). The same
results were obtained with the D812A, D833N, and D833A mutant proteins
(data not shown). At the same time, the single amino acid substitutions
D78N and E92Q were likely to weaken nonspecific binding as judged by
the absence (compared with wt Eco57I), of the clearly
defined band with the nonspecific DNA fragment and the band of lowest
mobility with the specific fragment at 10 nM protein
concentration (see Fig. 2).

View larger version (60K):
[in this window]
[in a new window]
|
Fig. 2.
Binding of wild-type Eco57I
or the D78N and E92Q mutants to specific and nonspecific DNA. The
210-bp fragment containing one Eco57I site (CTGAAG) was used
as specific DNA. The nonspecific DNA differed in only 1 base in the
center of the target site (CTGCAG). The binding mixtures contained 10 mM Tris-HCl, pH 8.0, 50 mM NaCl, 10 mM CaCl2, 0.1 mg/ml bovine serum albumin, 10%
glycerol, 10 pM specific or nonspecific
33P-endlabeled DNA and wt Eco57I or mutant
proteins at concentrations indicated below each lane of the
gel.
|
|
Methylation Activity of Wild-type and Mutant Eco57I--
The
cleavage-deficient mutants D78N and E92Q were also tested for
methylation activity. The reactions were performed with purified
proteins using the DNA protection assay (see "Experimental Procedures"). Both mutants methylated DNA efficiently, and the specific activity of the D78N mutant was even higher than that of the
wt Eco57I (Table I). The reaction mixture used in our experiments for assessing the cleavage activity of the wt and mutant
Eco57I included AdoMet, an effective stimulator of
endonucleolytic activity of the enzyme (4). It could not be excluded
therefore that the observed cleavage deficiency of the D78N and/or E92Q mutants was attributed to the substitution of amino acids affecting the
competition between cleavage and methylation activities of the
bifunctional enzyme, rather than the amino acids involved in DNA
cleavage catalysis per se. Such mutants in contrast to wt
Eco57I, would initially methylate but not cleave DNA,
rendering the modified DNA resistant to hydrolysis. AdoMet was
therefore replaced by its analog Sinefungin, an inhibitor of the
methylation reaction, in the reaction mixture to discriminate between
these two alternatives: a cleavage deficiency as compared with
preferential methylation mutant phenotypes. Sinefungin activated wt
Eco57I as effectively as AdoMet (see Fig. 1). Under the same
reaction conditions, no cleavage activity was detected in either the
D78N or the E92Q mutant (Fig. 1).
 |
DISCUSSION |
Eco57I Catalytic Site--
The results of mutational analysis in
this study strongly suggest that of the two putative catalytic motifs
77PDX13EAK (SM I) and
811PDX20DQK (SM II), only the first
one represents a DNA cleavage active site. Substitutions within SM I of
negatively charged amino acids, which are most conserved in the
catalytic centers of restriction endonucleases (8, 11), with
functionally unrelated (D78A, D78K) or functionally similar (D78N,
E92Q) amino acids reduced cleavage activity of the Eco57I to
a level undetectable both in vivo and in vitro.
Two mutants D78N and E92Q, which were selected for more detailed
studies, however, retained the ability, as assessed by gel mobility
shift assay, to interact with the target site specifically. The
mutations also spared the DNA methylation activity of Eco57I
restriction endonuclease, an observation which provides additional
evidence that specific DNA binding as well as AdoMet binding were not
affected by D78N and E92Q substitutions. Hence D78N and E92Q mutations
display the properties expected for active site residue mutants; they
uncouple the sequence-specific DNA binding and strand scission
activities of the enzyme. However, bifunctionality of Eco57I
suggested still another explanation for the observed phenotype of the
mutant proteins. Namely, mutations that reverse the preferential order
of expression of the two wild-type Eco57I enzymatic
activities (cleavage then methylation) would be phenotypically
indistinguishable from mutations affecting amino acid residues involved
in catalysis/metal ion binding. This possibility was excluded by the
observation that the endonucleolytic activity of the wt
Eco57I was effectively stimulated not only by AdoMet but
also by its analog Sinefungin. However, no DNA cleavage was detected
regardless of which of the two cofactors was added to the reaction
mixture with D78N and E92Q mutants. Some activity of the E92Q mutant
(but not that of the D78N mutant) was detected only when the
Mg2+ in the standard reaction mixture was replaced with
Mn2+. Similar effects of metal ion replacement on enzymatic
activities of the MunI catalytic mutants D83A and E98Q have
been previously reported and explained on the basis of differential
effects of the mutational replacements on the binding of
Mg2+ and Mn2+ (25). This observation provides
additional evidence to support the conclusion that the Asp-78 and
Glu-92 residues of Eco57I are involved in catalysis and
metal ion binding. The fact that the Asp-83 and Glu-98 residues of
MunI (25) and the Asp-78 and Glu-92 residues of
Eco57I occupy equivalent positions in the
PDXnEXK motif of the respective
enzymes is noteworthy.
Eco57I mutants containing single amino acid substitutions
within SM II (D812A, D833N, and D833A) revealed only a small or moderate decrease of cleavage activity as compared with wt
Eco57I to suggest that SM II does not represent the
catalytic center.
Circumstantial evidence supporting the conclusion that SM I represents
the DNA cleavage center and SM II only mimics it as an amino acid
sequence motif comes from an alignment of Eco57I and
GsuI restriction endonucleases, whose recognition sequences are related (CTGAAG and CTGGAG, respectively). The homology of the
enzymes is significant enough to conclude that they are evolutionary related (29).2 Of the two
putative Eco57I catalytic motifs, only a homolog of SM I is
represented in GsuI, whereas that of SM II is absent.
It has been demonstrated that as expected, an asymmetric DNA target is
recognized by the FokI monomer (30), whereas cleavage of
both strands of DNA is carried out by two FokI molecules
dimerized through their endonucleolytic domains (14). The asymmetric
nature of the Eco57I target sequence is also inconsistent
with the use of a symmetric dimer for recognition and DNA cleavage.
Whether a mechanism similar to that of FokI is used by
Eco57I to cleave DNA remains to be determined.
Restriction endonucleases catalyze phosphodiester bond cleavage in
double-stranded DNA in the presence of Mg2+, leaving a
5'-phosphate and a 3'-hydroxyl group (8). The active sites of only a
few of the numerous restriction endonucleases have been characterized
so far (8). They share a triad of charged Asp, (Glu/Asp), and (Lys/Asp)
amino acids. The catalytic relevance of the triad has been demonstrated
not only for type II endonucleases but also for the type IIS
restriction endonuclease FokI (13), another nontype II
endonuclease BcgI (31), and a few type I enzymes (32, 33).
This study provides evidence that the catalytic/metal binding center of
the type IV restriction endonuclease Eco57I is most likely
also represented by a triad of charged amino acids Asp, Glu, and Lys
located within the sequence motif
77PDX13EAK of Eco57I.
Restriction endonucleases, even those that belong to the same type,
share little primary sequence similarity. The available data however
indicate that the similarity of the chemical reaction catalyzed by
these enzymes and their cofactor (Mg2+) requirements
dictate a similarity in their catalytic/Mg2+ binding sites,
independent of any affiliation of restriction endonucleases to the
specific types of these enzymes.
Structure-Function Organization of Eco57I--
The restriction
endonuclease Eco57I combines, in a single polypeptide
DNA-specific recognition, cleavage, and methylation activities (4).
This study provides evidence that the catalytic DNA cleavage center is
located near the N-terminal end of Eco57I (Fig.
3). The central part is occupied by
conserved motifs of m6A DNA methylases, involved in AdoMet
binding and catalysis (9). The methylase part of Eco57I
belongs to the group of DNA amino-methyltransferases (34). It has
been suggested that the C-terminal variable part of enzymes in this
group of methylases comprise DNA recognition region, which includes the
target recognition domain (TRD) (34). We speculate that the same is
true for Eco57I restriction endonuclease. On the basis of
the above data, the Eco57I primary sequence can be
provisionally subdivided into three structure-function regions (Fig.
3).

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 3.
Schematic map of the structure-function
organization of Eco57I. The blocks of
conserved amino acid residues common to group of DNA
amino-methyltransferases are indicated and numbered. They were
identified based on their similarity to the characterized
methyltransferase motifs in Ref. 34. The conserved sequence motifs are:
X, 354DVVTTPTHIVKEIIRNT; I,
388FADIACGSAFIIVA; IV,
520FDVIVGNPPYMATEHMNQ; V+VI,
558DKYFLFIERSIQILKEYGYLGYILPSRFI; VII,
594LRKFLSENKYLSKLI; VIII,
612SHQVFKNKT.
|
|
The SM II mutations are located in the C-terminal part of the enzyme.
They did not impair specific DNA binding nor dramatically decrease the
enzyme activity, which could be expected for TRD mutants. Because the
exact position of TRD in the carboxyl domain of Eco57I is
not known, the SM II mutations may be located beyond it. Even if the
opposite were true, the SM II mutations are site specific with respect
to the putative catalytic motif (SM II) but are random with respect to
the putative TRD. Analysis of random mutants of a few m6A
MTases showed that only a small fraction of them located in the
variable region reveals the expected phenotype; a loss of specific DNA
binding and activity (35, 36). More detailed mutational analysis of the
C-terminal part is required to prove or disprove the suggestion that it
includes the Eco57I target recognition domain.
Structure-function organization of Eco57I suggests that its
evolution involves fusion of a methylase and an endonuclease. It has
been speculated that the progenitor of Eco57I was generated by the fusion of Mod and Res subunits of a type III endonuclease (9). This assumption was based on enzymatic properties (incomplete cleavage of DNA, stimulation of cleavage activity by AdoMet,
methylation of one DNA strand), substrate specificity (asymmetric
recognition sequence), and cleavage mode (outside of the target duplex)
of Eco57I, which are similar to the properties of type III
restriction endonucleases. However, the following observations make the
R-M fusion hypothesis unlikely. (i) In contrast to type III
endonucleases, Eco57I is not stimulated by ATP (4); (ii)
DEAD box motifs involved in ATP hydrolysis and DNA translocation that
have been identified in Res subunit (37) are not present in the
Eco57I amino acid sequence; and (iii) the size of the
Eco57I endonuclease domain is ~350 amino acids (see Fig.
3), whereas that of Res subunits is 873-982 amino acids (38-40).
Therefore generating the progenitor for the endonuclease domain of
Eco57I from the Res subunit would require dramatic
rearrangements of the latter.
The evolution of type IIS enzymes, which like Eco57I
recognize asymmetric nucleotide sequences and cleave DNA at a defined distance from them but are not stimulated by AdoMet (neither contain the conserved motifs of MTases), possibly involves fusion of a DNA-specific-binding protein and an endonuclease (41). In type IIS R-M
systems, two separate MTases exist, each specific for a different
strand of asymmetric target duplex (42-44). The fusion of a
single-strand-specific MTase with a DNA endonuclease could generate a
progenitor of Eco57I, which potentially could reveal both
DNA cleavage and methylation (of one strand). The cofactor requirement
(Mg2+ and AdoMet), enzymatic activities (endonucleolytic,
methylation at one DNA strand), and structure (a methylase fused with
endonuclease) of such a hypothetical hybrid protein makes it a more
likely candidate for the Eco57I predecessor than the product
of Res-Mod fusion.
 |
ACKNOWLEDGEMENTS |
We thank MBI Fermentas for a gift of enzymes
and kits, Jolanta Giedriene for purification of mutant
Eco57I proteins, Elizabeth Raleigh for E. coli
strain ER2267. We are also grateful to Virginijus Siksnys for critical
reading of the manuscript and valuable comments and to Barbara
Richmond-Smith for linguistic help. We are indebted to Jurate
Makariunaite for help with manuscript preparation.
 |
FOOTNOTES |
*
This work was supported by a grant from the Lithuanian
National Research Program Molecular Basis of Biotechnology and by Grant N216 from the Lithuanian State Foundation for Science and Studies.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Inst. of
Biotechnology, Graiciuno 8, 2028 Vilnius, Lithuania. Tel.: 370-2 602-110; Fax: 370-2 602-116; E-mail: janulait@ibt.lt.
Published, JBC Papers in Press, December 21, 2000, DOI 10.1074/jbc.M008687200
2
R. Vaisvila and A. Janulaitis, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
R-M, restriction-modification;
wt, wild-type;
bp, base pairs;
PAGE, polyacrylamide gel electrophoresis;
AdoMet, S-adenosyl-L-methionine;
e.o.p., efficiency of
plating;
TRD, target recognition domain;
SM, sequence motif.
 |
REFERENCES |
| 1.
|
Roberts, R. J.,
and Macelis, D.
(2000)
Nucleic Acids Res.
28,
306-307
|
| 2.
|
Yuan, R.
(1981)
Annu. Rev. Biochem.
50,
285-315
|
| 3.
|
Szybalski, W.,
Kim, S. C.,
Hasan, N.,
and Podhajska, A. J.
(1991)
Gene
100,
13-26
|
| 4.
|
Janulaitis, A.,
Petrusyte, M.,
Maneliene, Z.,
Klimasauskas, S.,
and Butkus, V.
(1992)
Nucleic Acids Res.
20,
6043-6049
|
| 5.
|
Kong, H.,
Morgan, R. D.,
Maunus, R. E.,
and Schildkraut, I.
(1993)
Nucleic Acids Res.
21,
987-991
|
| 6.
|
Stankevicius, K.,
Lubys, A.,
Timinskas, A.,
Vaitkevicius, D.,
and Janulaitis, A.
(1998)
Nucleic Acids Res.
26,
1084-1091
|
| 7.
|
Piekarowicz, A.,
Golaszewska, M.,
Sunday, A. O.,
Siwinska, M.,
and Stein, D. C.
(1999)
J. Mol. Biol.
293,
1055-1065
|
| 8.
|
Pingoud, A.,
and Jeltsch, A.
(1997)
Eur. J. Biochem.
246,
1-22
|
| 9.
|
Janulaitis, A.,
Vaisvila, R.,
Timinskas, A.,
Klimasauskas, S.,
and Butkus, V.
(1992)
Nucleic Acids Res.
20,
6051-6056
|
| 10.
|
Anderson, J. E.
(1993)
Curr. Opin. Struct. Biol.
3,
24-30
|
| 11.
|
Aggarwal, A. K.
(1995)
Curr. Opin. Struct. Biol.
5,
11-19
|
| 12.
|
Skirgaila, R.,
Grazulis, S.,
Bozic, D.,
Huber, R.,
and Siksnys, V.
(1998)
J. Mol. Biol.
279,
473-481
|
| 13.
|
Waugh, D. S.,
and Sauer, R. T.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
9596-9600
|
| 14.
|
Bitinaite, J.,
Wah, D.,
Aggarwal, A. K.,
and Schildkraut, I.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
10570-10575
|
| 15.
|
Mead, D. A.,
Szczesna-Skorupa, E.,
and Kemper, B.
(1986)
Protein Eng.
1,
67-74
|
| 16.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd Ed.
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 17.
|
Birnboim, H. C.,
and Doly, J.
(1979)
Nucleic Acids Res.
7,
1513-1523
|
| 18.
|
Marko, M. A.,
Chipperfield, R.,
and Birnboim, H. C.
(1982)
Anal. Biochem.
121,
382-387
|
| 19.
|
Sanger, F.,
Nicklen, S.,
and Coulson, A. R.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
5463-5467
|
| 20.
|
Kunkel, T. A.,
Roberts, J. D.,
and Zakour, R. A.
(1987)
Methods Enzymol.
154,
367-382
|
| 21.
|
Ausubel, F. M.,
Kingston, R. E.,
Moore, D. D.,
Seidman, J. G.,
Smith, J. A.,
and Struhl, K.
(1992)
in
Short Protocols In Molecular Biology
(Ausubel, F. M., ed), 2nd Ed.
, pp. 10-7-10-28, Green Publishing Associates and John Wiley & Sons, NY
|
| 22.
|
Pace, C. N.,
Vajdos, F.,
Fee, L.,
Grimsley, G.,
and Gray, T.
(1995)
Protein Sci.
4,
2411-2423
|
| 23.
|
Whitehead, P. R.,
and Brown, N. L.
(1985)
Arch. Microbiol.
141,
70-74
|
| 24.
|
Vipond, I. B.,
and Halford, S. E.
(1995)
Biochemistry
34,
1113-1119
|
| 25.
|
Lagunavicius, A.,
and Siksnys, V.
(1997)
Biochemistry
36,
11086-11092
|
| 26.
|
Nastri, H. G.,
Evans, P. D.,
Walker, I. H.,
and Riggs, P. D.
(1997)
J. Biol. Chem.
272,
25761-25767
|
| 27.
|
Skirgaila, R.,
and Siksnys, V.
(1998)
Biol. Chem.
379,
595-598
|
| 28.
|
Taylor, J. D.,
Badcoe, I. G.,
Clarke, A. R.,
and Halford, S. E.
(1991)
Biochemistry
30,
8743-8753
|
| 29.
|
Janulaitis, A.
(1996)
Biologija
2,
28-31
|
| 30.
|
Skowron, P.,
Kaczorowski, T.,
Tucholski, J.,
and Podhajska, A. J.
(1993)
Gene
125,
1-10
|
| 31.
|
Kong, H.
(1998)
J. Mol. Biol.
279,
823-832
|
| 32.
|
Janscak, P.,
Sandmeier, U.,
and Bickle, T. A.
(1999)
Nucleic Acids Res.
27,
2638-2643
|
| 33.
|
Davies, G. P.,
Martin, I.,
Sturrock, S. S.,
Cronshaw, A.,
Murray, N. E.,
and Dryden, D. T. F.
(1999)
J. Mol. Biol.
290,
565-579
|
| 34.
|
Malone, T. J.,
Blumenthal, R. M.,
and Cheng, X.
(1995)
J. Mol. Biol.
253,
618-632
|
| 35.
|
Jeltsch, A.,
Sobotta, T.,
and Pingoud, A.
(1996)
Protein Eng.
9,
413-423
|
| 36.
|
Szegedi, S. S.,
and Gumport, R. I.
(2000)
Nucleic Acids Res.
28,
3972-3981
|
| 37.
|
Davies, G. P.,
Powell, L. M.,
Webb, J. L.,
Cooper, L. P.,
and Murray, N. E.
(1998)
Nucleic Acids Res.
26,
4828-4836
|
| 38.
|
Su, P.,
Im, H.,
Hsieh, H.,
Kang, A. S.,
and Dunn, N. W.
(1999)
Appl. Environ. Microbiol.
65,
686-693
|
| 39.
|
Humbelin, M.,
Suri, B.,
Rao, D. N.,
Hornby, D. P.,
Eberle, H.,
Pripfl, T.,
Kenel, S.,
and Bickle, T. A.
(1988)
J. Mol. Biol.
200,
23-29
|
| 40.
|
Dartois, V.,
De Backer, O.,
and Colson, C.
(1993)
Gene
127,
105-110
|
| 41.
|
Kim, Y. G.,
and Chandrasegaran, S.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
883-887
|
| 42.
|
Lubys, A.,
Lubiene, J.,
Kulakauskas, S.,
Stankevicius, K.,
Timinskas, A.,
and Janulaitis, A.
(1996)
Nucleic Acids Res.
24,
2760-2766
|
| 43.
|
Sugisaki, H.,
Yamamoto, K.,
and Takanami, M.
(1991)
J. Biol. Chem.
266,
13952-13957
|
| 44.
|
Sapranauskas, R.,
Sasnauskas, G.,
Lagunavicius, A.,
Vilkaitis, G.,
Lubys, A.,
and Siksnys, V.
(2000)
J. Biol. Chem.
275,
30878-30885
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J. Orlowski and J. M. Bujnicki
Structural and evolutionary classification of Type II restriction enzymes based on theoretical and experimental analyses
Nucleic Acids Res.,
June 1, 2008;
36(11):
3552 - 3569.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zheng, R. J. Roberts, and S. Kasif
Identification of genes with fast-evolving regions in microbial genomes
Nucleic Acids Res.,
December 2, 2004;
32(21):
6347 - 6357.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. K. Raghavendra and D. N. Rao
Functional cooperation between exonucleases and endonucleases--basis for the evolution of restriction enzymes
Nucleic Acids Res.,
April 1, 2003;
31(7):
1888 - 1896.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. B. Lawrenz, H. Kawabata, J. E. Purser, and S. J. Norris
Decreased Electroporation Efficiency in Borrelia burgdorferi Containing Linear Plasmids lp25 and lp56: Impact on Transformation of Infectious B. burgdorferi
Infect. Immun.,
September 1, 2002;
70(9):
4798 - 4804.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|