|
Originally published In Press as doi:10.1074/jbc.M011218200 on December 22, 2000
J. Biol. Chem., Vol. 276, Issue 13, 10498-10504, March 30, 2001
Human Cytosolic 5'-Nucleotidase I
CHARACTERIZATION AND ROLE IN NUCLEOSIDE ANALOG RESISTANCE*
Sally Anne
Hunsucker ,
Jozef
Spychala §, and
Beverly S.
Mitchell ¶
From the Lineberger Comprehensive Cancer Center, Departments of
Pharmacology and ¶ Medicine, University of North
Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-7295
Received for publication, December 13, 2000
 |
ABSTRACT |
Nucleoside analogs are important in the treatment
of hematologic malignancies, solid tumors, and viral infections. Their
metabolism to the triphosphate form is central to their
chemotherapeutic efficacy. Although the nucleoside kinases responsible
for the phosphorylation of these compounds have been well described,
the nucleotidases that may mediate drug resistance through
dephosphorylation remain obscure. We have cloned and characterized a
novel human cytosolic 5'-nucleotidase (cN-I) that potentially may have
an important role in nucleoside analog metabolism. It is expressed at a
high level in skeletal and heart muscle, at an intermediate level in
pancreas and brain, and at a low level in kidney, testis, and uterus.
The recombinant cN-I showed high affinity toward dCMP and lower
affinity toward AMP and IMP. ADP was necessary for maximal catalytic
activity. Expression of cN-I in Jurkat and HEK 293 cells conferred
resistance to 2-chloro-2'-deoxyadenosine, with a 49-fold increase in
the IC50 in HEK 293 and a greater than 400-fold
increase in the IC50 in Jurkat cells. Expression of cN-I
also conferred a 22-fold increase in the IC50 to
2',3'-difluorodeoxycytidine in HEK 293 cells and an 82-fold increase in
the IC50 to 2',3'-dideoxycytidine in Jurkat cells. These
data indicate that cN-I may play an important role in the regulation of
physiological pyrimidine nucleotide pools and may also alter the
therapeutic efficacy of certain nucleoside analogs.
 |
INTRODUCTION |
Nucleoside analogs are used as chemotherapeutic agents in the
treatment of hematologic malignancies and as anti-viral drugs. These
compounds are taken up by cells through nucleoside transporters in the
cell membrane or, in the case of more lipophilic drugs, through
diffusion (1-3). Once in the cytoplasm, the nucleoside analogs are
substrates for phosphorylation by the nucleoside kinases of the
deoxyribonucleoside salvage pathway (reviewed in Ref. 4). The enzyme
2'-deoxycytidine kinase phosphorylates dAdo, dCyd, and dGuo as
well as the analogs AraC,1
dFdC, and CdA, whereas thymidine kinase 1 phosphorylates dThd and dUrd
as well as the analogs d4T and 5-FU. Phosphorylation to the
monophosphate form is considered the rate-limiting step of activation
of nucleoside analogs (4).
Nucleoside analog monophosphates are rapidly phosphorylated to their
triphosphate forms, which are believed to mediate their cytotoxic
activities by several different mechanisms (reviewed in Ref. 5). For
example, they can be directly incorporated into DNA, leading to chain
termination, or they can inhibit DNA synthesis by direct inhibition of
DNA polymerase. It has recently been demonstrated that certain of these
metabolites, including CdATP, AraATP, and F-AraATP, can induce
apoptosis in nonproliferating cells by interacting with cytochrome
c and apoptosis protein-activating factor-1 (APAF-1) to
cleave and activate the caspases responsible for the induction of
apoptosis (6, 7). In contrast, the triphosphates of antiretroviral
compounds, such as 2',3'-dideoxycytidine (ddC) and d4T, inhibit the
reverse transcriptase of the human immunodeficiency virus
through chain termination. Cytotoxicity can occur when these compounds
are incorporated into nuclear or mitochondrial DNA (reviewed in Ref.
8).
Resistance to nucleoside analogs is a significant clinical problem and
can be caused by a number of factors affecting the metabolism of the
drugs, including decreased numbers of nucleoside transporters,
increased deamination of cytidine and adenosine analogs, loss of
expression of activating kinases, modulation of the downstream
apoptotic machinery, and increased activity of nucleotidases that
catalyze the conversion of nucleotides back to nucleosides (reviewed in
Ref. 5). The 5'-nucleotidases oppose the action of nucleoside kinases
by dephosphorylating the monophosphate form of nucleosides and
nucleoside analogs and, therefore, are likely to be important in
determining the sizes and turnover rates of the deoxyribonucleotide
pools. Thus, 5'-nucleotidases that catabolize the monophosphates of
nucleoside analogs used in the clinic will lower their clinical efficacy.
To date, the substrate specificity of the cytosolic nucleotidases
responsible for dephosphorylation and inactivation of nucleoside monophosphates has not been well defined. Among several potentially important 5'-nucleotidases, only human cytosolic 5'-nucleotidase II
(cN-II) has been studied in detail. cN-II is a 65-kDa protein that is
strongly activated by ATP and prefers IMP to AMP as a substrate
(9-11). Although increased expression of cN-II has been shown to lead
to drug resistance in two cell lines (12, 13), its kinetic properties
make it unlikely to participate in pyrimidine nucleotide
dephosphorylation (10). Cytosolic 5'-nucleotidase I (cN-I) has been
isolated from pigeon, rat, rabbit, dog, and human hearts (14-19). This
5'-nucleotidase is activated by ADP and prefers AMP to IMP as a
substrate (20). Although recent kinetic data suggest that cN-I may
participate in deoxyribonucleoside monophosphate catabolism (17), the
role of this enzyme in nucleoside analog resistance has never been
examined. Thus we hypothesize that cN-I might play a role in
dephosphorylation of deoxyribonucleoside monophosphates and in
inactivation of nucleoside analogs.
To determine the role of the human cN-I enzyme in normal nucleotide
metabolism as well as in drug resistance, we have cloned the human cN-I
cDNA, defined the substrate specificity of the recombinant cN-I
protein, and investigated the role of this enzyme in nucleoside analog resistance.
 |
EXPERIMENTAL PROCEDURES |
Chemicals and Reagents
AraC, ddC, CdA, F-AraA, 5-FU, d4T, and AraCMP were
purchased from Sigma. CdAMP was manufactured by Biolog Life
Science Institute (Bremen, Germany). Compound 506U (AraG prodrug) was
obtained from Glaxo-Wellcome (Research Triangle Park, NC), dFdC was a
gift from Lilly, and F-AraAMP was obtained from Berlex (Richmond, CA).
Cloning of Human cN-I
Reverse transcription-PCR was performed using human heart
poly(A) mRNA (CLONTECH, Palo Alto, CA). Primers
were designed to overlap the 5'
(TAAGCTTGGTACCATGGAACCTGGGCAGCCCCGGGAGCCCCAG) and 3'
(CTACTGTGCAGATGGGGCCTGCTTTGC) ends of the cDNA-coding region. The reverse transcription reaction was performed using avian
myeloblastosis virus reverse transcription (Promega, Madison, WI), the
PCR reaction was performed with Pfu Turbo (Stratagene, La Jolla, CA) in
a buffer containing 10% Me2SO followed by 10 cycles with
Taq polymerase (Life Technologies, Inc.) to enable cloning
into the TA vector (Invitrogen, Carlsbad, CA), and individual clones
were sequenced.
Northern Blot Analysis
Total cellular RNA was extracted using TRI REAGENT
(Molecular Research Center, Cincinnati, OH). Fifteen µg of total RNA
was loaded on each lane and separated in 1% agarose, 100 mM MOPS buffer, and 2.0 M formaldehyde. RNA was
transferred to a nylon membrane, UV-cross-linked, and baked at 80 °C
for 1 h. Blots were prehybridized in 1% SDS, 0.1 M
NaCl at room temperature for 1 h and at 42 °C in High
Efficiency Hybridization System containing 50% formamide (Molecular
Research Center, Cincinnati, OH) for 1 h. The
32P-labeled 671-base pair probe (extending from base pair
437 to base pair 1107 of the cN-I cDNA sequence) was then added and
hybridized overnight at 42 °C. The blots were washed for 30 min at
55 °C and for 30 min at 60 °C in 1× SSC (0.15 M NaCl
and 0.015 M sodium citrate), 0.2% SDS and
autoradiographed. The 32P-labeled -actin probe was
hybridized as described above and washed twice for 15 min at room
temperature in 2× SSC, 0.05% SDS and twice for 20 min at 50 °C in
0.1× SSC, 0.1% SDS.
Baculovirus Expression
cN-I was expressed in Sf9 insect cells using the
baculovirus expression system (Life Technologies) according to the
product protocol. Briefly, the cN-I construct was subcloned into the
PDR120 transfer vector and transfected into DH10Bac cells. Bacmid was isolated from DH10Bac bacterial colonies, and baculovirus was produced
by infecting Sf9 cells with bacmid DNA and harvesting virus from
the media after cell lysis. For protein purification, Sf9 cells
were collected 4 days after infection, pelleted, and frozen at
80 °C.
Purification of cN-I
Recombinant human cN-I was purified using a modification of
previously published protocols for purification of the rabbit enzyme
(16, 17). Sf9 cells (7.7 g) were resuspended in 40 ml of
extraction buffer containing 40 mM NaHEPES, pH 7.0, 15% glycerol, 1 mM EDTA, 1 mM dithiothreitol, 0.2 mM phenylmethylsulfonyl fluoride, 5 mM
benzamidine, and 1× complete protease inhibitor mixture (Roche
Molecular Biochemicals). The cells were homogenized 3 × 10 s
with a tissue homogenizer (Tekmar Tissumizer, Cincinnati, OH)
and centrifuged at 16,000 × g at 4 °C to pellet
membranes. The pellet was re-homogenized, and the supernatants were
combined. cN-I was precipitated with 40% ammonium sulfate, and the
resulting pellet was solubilized in 2 ml of extraction buffer and
dialyzed against 3 changes of buffer A (40 mM NaHEPES, pH
7.0, 15% glycerol, 1 mM EDTA, 1 mM
dithiothreitol, 0.2 mM phenylmethylsulfonyl fluoride, and 5 mM MgCl2) overnight.
After dialysis the sample was rehomogenized in 11 ml of buffer A and
incubated for 1 h at 4 °C with 5 g of wet Whatman
P11-cellulose phosphate (Whatman, Kent, ME). The phosphocellulose was
centrifuged to remove unbound proteins, resuspended in buffer A, and
transferred into a column. The column was washed with 100 ml of buffer
A, and bound proteins were eluted with 100 ml each of 0.25 M NaCl, 0.4 M NaCl, 0.6 M NaCl, and
2 M NaCl/2.1 mM sodium phosphate. Fractions
containing cN-I activity were eluted at 0.25 M NaCl and
were further concentrated to ~15 ml using an Ultrafree-15 filter with
30-kDa cut-off range (Millipore, Bedford, MA). The sample was dialyzed
overnight against buffer A and run on a DEAE-Sepharose column with
buffer A adjusted to pH 7.5. The column was washed, and proteins were
eluted with a 0-0.5 M NaCl gradient in buffer A. The
fractions containing cN-I activity were concentrated to ~1 ml by
spinning through an Ultrafree-15 filter unit with a Biomax-30 membrane
(Millipore). The sample was then run on a Sephacryl S-300 column
(1.6 × 90 cm) with buffer A, pH 7.0, containing 100 mM KCl. The fractions with cN-I activity were dialyzed
overnight against buffer A containing 50% glycerol, and bovine serum
albumin was added to a final concentration of 2 mg/ml. Aliquots of
enzyme were stored at 80 °C until use.
Enzyme Kinetics
Radiochemical Assay and Estimation of Kinetic
Parameters--
Enzyme assays were performed in 50 mM
Tris, pH 7.0, 100 mM KCl, 5 mM
MgCl2, 5 mM -glycerophosphate, 1 mg/ml
bovine serum albumin, 100 µM AMPCP, and 1 mM ADP, with various concentrations of substrate. When AMP
and IMP were used as substrates, 22 nCi of 14C-labeled
compounds were used in a 20-µl reaction volume. Alternatively, 14C-labeled dCMP was used in an amount of 5.5 nCi in a
20-µl reaction volume. Enzyme concentrations were 69 pg/µl when
assayed with dCMP, 552 pg/µl when assayed with AMP and 1.38 ng/µl
when assayed with IMP. Enzymatic reactions were initiated by the
addition of enzyme, run at 37 °C, and stopped by heating at 85 °C
for 2 min. Reaction rates were determined to be linear within the
protein concentrations and incubation times used. Fifteen µl of each
sample was spotted onto cellulose chromatography sheets with
fluorescent indicators (Kodachrome, Eastman Kodak Co. and Analtech,
Newark, DE), and thin layer chromatography was performed in a solvent containing 60% butanol, 20% methanol, 19% dH2O, and 1%
ammonia. Bands were visualized under UV light, and spots corresponding to the nucleoside products were cut out and counted on a Packard scintillation counter. Specific activity was expressed as µmol/min/mg of substrate. The substrate saturation curves were obtained within 5 µM to 60 mM concentrations, and the effect of
ADP, ATP, and GTP (activator saturation curves) was tested within
concentrations ranging from 20 µM to 4 mM.
Data was graphed using SigmaPlot 2000 (SPSS, Inc., Chicago, IL), and
kinetic parameters were derived using either nonlinear regression
(three parametric Hill equation) or linear regression (Hanes equation)
procedures as previously described (10, 21).
Colorimetric Assay and Estimation of Substrate
Specificity--
Colorimetric assays were performed in 50 mM Tris, pH 7.0, buffer containing 100 mM KCl,
5 mM MgCl2, 1 mg/ml bovine serum albumin, 100 µM AMPCP, 1 mM ADP, and 5 mM each substrate. cN-I (34.5 ng/reaction) was incubated in
50 µl final volume for 10 min at 37 °C. The reaction was stopped
with the addition of 1 ml of Chen reagent as previously described (22).
With F-AraAMP and AraCMP, incubation time was increased to 40 min, and
the concentration of cN-I was 10 times higher. For the inhibition
experiments, the buffer included 5 mM AMP and 1 mM competing nucleoside analog monophosphate with a 10 min
incubation and 34.5 ng of cN-I.
Cell Culture
Sf9 cells were maintained in Grace's insect medium (Life
Technologies) supplemented with 10% fetal bovine serum (Sigma) and 1.8 mM L-glutamine (Life Technologies). HEK 293 cells were grown in Dulbecco's modified Eagle's medium (Life
Technologies) supplemented with 10% fetal bovine serum, and Jurkat
cells were maintained in RPMI 1640 medium (Life Technologies)
supplemented with 10% fetal bovine serum. All media was supplemented
with penicillin and streptomycin (Lineberger Cancer Research Center
Tissue Culture Facility, University of North Carolina). Transfected HEK
293 and Jurkat E6-1 cells were maintained in the presence of G418
(Life Technologies).
Development of Stable Cell Lines
The cN-I cDNA was subcloned into the pcDNA3 mammalian
expression vector that contains a pCMV promoter (Invitrogen, Carlsbad, CA). HEK 293 cells were transfected using Fugene6 (Roche Molecular Biochemicals), and Jurkat E6-1 cells were transfected by
electroporation using a Bio-Rad Gene Pulser. The transfected cells were
selected in increasing concentrations of G418, up to 750 µg/ml for
HEK 293 cells and up to 1 mg/ml for Jurkat cells. An empty pcDNA3 vector was used as a control for both cell lines. Individual clones were selected by serial dilution of cells transfected with the cN-I
construct in 96-well plates. Colonies grown from single cells were
tested to determine cN-I activity, and cells were maintained in the
presence of G418. Due to low transfection efficiency, the Jurkat cells
were pre-selected with 0.5 µM CdA for 2 days before the
serial dilutions.
Generation of Polyclonal Antibody and Western Blot Procedure
A synthetic acetylated peptide corresponding to the C-terminal
16 amino acids of cN-I (acetyl-CQTPRRTAPAKQAPSAQ-OH) was synthesized and conjugated to keyhole limpet hemocyanin at the peptide synthesis facility at University of North Carolina. The peptide was used to
produce rabbit polyclonal antisera to cN-I by Rockland Immunochemicals (Gilbertsville, PA). Antibody was purified on a Sulfolink column (Pierce) coupled to the original antigen peptide conjugated to bovine
serum albumin, according to the manufacturer's instructions.
For Western blots, proteins (50 µg) were separated on a 10%
polyacrylamide gel and transferred to an Immobilon-P membrane (Millipore). Protein concentration was measured using the Bio-Rad Protein Assay Dye Reagent. Western blots were performed with cN-I antibody at a dilution of 1:1000 followed by horseradish
peroxide-conjugated anti-rabbit antibody (Amersham Pharmacia Biotech)
at 1:5000. Bands were visualized using ECL (Amersham Pharmacia Biotech).
Drug Sensitivity Studies
To determine whether overexpression of cN-I affects the
IC50 for various nucleoside analogs, HEK 293 and Jurkat
E6-1 parental, pCDNA3-transfected and cN-I-transfected cells were
plated in 96-well plates at a density of 2.5 × 103
cells/well for the HEK 293 cells and 2 × 104
cells/well for the Jurkat E6-1 cells. The cells were treated with
concentrations of nucleoside analogs between 1 nM and 10 mM depending on the toxicity of the drug. Cells were
incubated in 96-well plates in the presence of drug for 4 days.
3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assays
were performed as previously described (23) to determine relative cell
viability, with the absorbance measured at 595 nm.
 |
RESULTS |
Cloning of Human cN-I--
A FASTA search performed with the
cDNA sequence of the pigeon cN-I enzyme (24) identified the human
cN-I gene (GenBankTM accession number: AL035404.20).
Sequence analysis identified six exons with an open reading frame of
1107 bases localized on human chromosome 1 p33-p34.3. Reverse
transcription-PCR using human heart poly(A) mRNA as a template
produced the expected 1107-base pair cDNA. An A to G base change at
position +729 in the cDNA sequence and 75,616 in the
GenBankTM sequence was found in all sequenced PCR products
from several different reactions and is therefore unlikely to be a
PCR-related mutation. The base change does not affect the amino acid
sequence. This sequence was scanned against the GenBankTM
data base and was significantly related to three other sequences: (AL033526.24, a fragment of AL035404.20 containing exons 4-6 of the
cN-I enzyme; AJ131243.1, Columba livia (pigeon) mRNA for
cN-I, with 82% identity to the human sequence (24); and AB045992.1,
Macaca fascicularis (macaque primate) brain cDNA,
containing a stretch of 135 amino acids that is 97% identical to the
first exon of human cN-I. The human cN-I cDNA encodes a 368 amino
acid protein of 47.7 kDa that has 83% identity to the 40-kDa protein
of the cloned pigeon cN-I enzyme.
The human cN-I amino acid sequence was scanned against the
GenBankTM data base and, in addition to pigeon cN-I, was
significantly related to Xylella fastidiosa (proteobacteria)
5'-nucleotidase F82601 (25). An alignment of the human, pigeon, and
X. fastidiosa cN-I amino acid sequences is shown in Fig.
1. All three cN-I sequences contain a
conserved classic Walker B motif
(R/K)X1-4GX2-4 X 2(D/E) ( is a hydrophobic amino acid) (26) at amino acids 220 to 233. The
Walker B motif is found in many ATP-binding proteins and may serve as
part of the nucleotide binding pocket (26). All three cN-I sequences
also contain a conserved kinase-2 motif near the C terminus, IFFDD (at
amino acids 338 to 342 on the alignment). Although the sequences of
kinase-2 domains are highly variable, they usually consist of four
hydrophobic residues followed by an aspartate that interacts with
Mg2+, Ca2+, or other divalent metal ions (26).
Mg2+ is necessary for cN-I activity (16, 18-20), and this
conserved domain may be essential for enzyme function. There are
several additional putative nucleotide binding domains that are
conserved only in the human and pigeon cN-I enzymes: two kinase-2
domains are located at amino acids 31-35 and 313-317, and a putative
kinase 3a domain (26) is located at amino acids 299-304. Three
putative nucleoside monophosphate binding motifs (NMP-2), which
may bind the pentose sugar (26), are located at amino acids 68-73,
177-182, and 313-318 on the alignment. Neither 5'-nucleotidase
signature 1 nor signature 2 (PROSITE), derived from conserved
ecto-5'-nucleotidase domains, was found in the cN-I sequence.

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 1.
Alignment of human, pigeon, and X. fastidiosa cN-I amino acid sequences. Similar conserved
amino acids are shaded. The conserved Walker B and kinase 2 motifs are indicated below the alignment.
|
|
Tissue Expression--
Northern blot analysis was performed on two
human tissue blots (CLONTECH) to determine the
tissue-specific expression of cN-I. Data presented in Fig.
2 show that skeletal muscle expressed a very high level of the ~10-kilobase cN-I transcript, whereas a lower
level of expression was found in heart, brain, and pancreas. Upon
overexposure, expression could also be seen in kidney, testis, and
uterus.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 2.
Expression of cN-I in human tissues.
A, Northern blot analysis was performed with two human
tissue blots (CLONTECH MTN 7760-1 and 7759-1).
The cN-I mRNA migrates at ~10 kilobases (kb).
B, blots were reprobed with -actin cDNA to control
for loading. PBL, peripheral blood
leukocyte.
|
|
Purification of Recombinant cN-I--
Recombinant human cN-I
expressed in Sf9 insect cells was purified from cell
supernatants by ammonium sulfate precipitation followed by
phosphocellulose chromatography, DEAE-Sepharose chromatography, and gel
filtration chromatography (Fig. 3). This
purification procedure yielded a protein that was ~90% pure and had
a specific activity of 14.4 µmol/min/mg when assayed with 200 µM dCMP and 1 mM ADP.

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 3.
Purification of recombinant human cN-I.
Recombinant human cN-I was expressed in Sf9 insect cells using
Life Technologies, Inc. baculovirus expression system. The Sf9
cells were homogenized, and the membranes were pelleted. The
supernatant was precipitated with 40% ammonium sulfate. The sample was
further purified on a phosphocellulose column, a DEAE-Sepharose column,
and a Sephacryl-300 gel filtration column. The following amount of
protein was loaded onto each lane: supernatant, 20 µg; ammonium
sulfate precipitation, 20 µg; phosphocellulose column, 10 µg;
DEAE-Sepharose column, 5 µg; and Sepharcryl-300 column, 5 µg.
Protein was run on a 10% SDS-polyacrylamide electrophoresis gel and
stained with Coomassie Blue.
|
|
Kinetics Parameters--
The relative Vmax
and apparent Km values for AMP, dCMP, and IMP were
determined in both the presence and absence of ADP as an activator.
Table I summarizes the data and shows that the enzyme exhibited the highest Vmax in
the presence of AMP, followed by IMP and dCMP. On the other hand, the
highest substrate affinity was obtained for dCMP. The high ratio of
Vmax/Km for dCMP demonstrated
that it was the most efficient substrate for human recombinant
cN-I.
View this table:
[in this window]
[in a new window]
|
Table I
Substrate specificity of recombinant human cN-I
The Vmax and apparent Km of cN-I
for AMP, IMP, and dCMP were determined by varying the concentration of
substrate both in the presence and absence of ADP as an activator. The
Vmax, apparent Km, and Hill
coefficients were calculated using non-linear regression (10, 21).
Experimental values are shown ± S.E. for two or three (*)
experiments.
|
|
ADP was required for the full activity of recombinant human cN-I. ADP
both increased the Vmax and decreased the
Km for all three substrates (Table I). The Hill
coefficient in the presence of ADP was close to 1 for all three
substrates, whereas in the absence of ADP, it increased to 2.6 or 2.7 (Table I). Such kinetic behavior suggests that ADP functions as an
allosteric activator of cN-I. When cN-I activity was measured at
increasing ADP concentrations (from 20 µM to 2 mM) and at a fixed concentration of dCMP, half-maximal
activity (A0.5) was reached at a concentration of 89 µM (Fig. 4 and Table
II). The steep initial slope of the curve
indicates that ADP at concentrations below 200 µM is a
critical physiological regulator of cN-I activity. GTP also served as
an activator for cN-I, although not as strong as ADP, and there was only slight activation by ATP (Fig. 4 and Table II).

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 4.
The effects of ADP, ATP and GTP concentration
on the activity of cN-I. cN-I specific activity was measured at
varying concentrations of ADP ( ), ATP ( ), and GTP ( ) and at a
fixed concentration (20 µM) of dCMP substrate.
Representative plots are shown.
|
|
View this table:
[in this window]
[in a new window]
|
Table II
Activation of cN-I by ADP, ATP, and GTP
The specific activity of cN-I was measured at varying concentrations of
ADP, ATP, and GTP and a fixed concentration (20 µM) of
dCMP substrate. The Vmax and A0.5
were calculated using linear regression (21) and are presented ± S.E. for two (GTP) or three (ADP, ATP) experiments.
|
|
The data in Table III summarizes the
substrate specificity with a larger range of substrates. In general,
higher specific activities were observed with purine substrates and
pyrimidine ribonucleoside monophosphates, and lower specific activities
were measured with pyrimidine deoxyribonucleoside monophosphates. The
nucleoside analog CdAMP was a good substrate for cN-I, with a relative
activity 39% that of AMP. The other analogues used in clinic, F-AraAMP and AraCMP, were not dephosphorylated by cN-I.
View this table:
[in this window]
[in a new window]
|
Table III
Substrate specificity of recombinant human cN-I
Phosphate generation by cN-I was measured for each nucleoside
monophosphate shown using Chen reagent (22). Specific activity was
calculated in µmol of phosphate generated/min/mg of cN-I protein ± S.D. for three experiments. All substrate concentrations were 5 mM.
|
|
Since F-AraAMP and AraCMP appear to be poor substrates for cN-I,
we tested the possibility that they may function as competitive inhibitors. Table IV demonstrates that,
in an assay buffer containing 5 mM AMP, cN-I activity was
inhibited 70% by 1 mM F-AraAMP and 25% by 1 mM AraCMP, indicating that both compounds negatively affect
the activity of the enzyme.
View this table:
[in this window]
[in a new window]
|
Table IV
Inhibition of AMP dephosphorylation by F-AraAMP and AraCMP
Phosphate generation was measured using 5 mM AMP as a
substrate and 1 mM of competitor. Specific activity
represents the mean ± S.D. for three assays.
|
|
Effect of cN-I Expression on Drug Sensitivity--
Clonal
populations of HEK 293 cells and Jurkat E6-1 cells stably expressing
cN-I were isolated by serial dilution. The Jurkat clone used for this
study had 7-fold higher cN-I activity (9.8 nmol/mg/min) than parental
cells, and the HEK 293 clone had 147-fold higher cN-I activity (128 nmol/mg/min) than parental cells when activity was measured in the
presence of 200 µM dCMP and 1 mM ADP. Under
the assay conditions used, ecto-5'- nucleotidase and cN-II could not
have contributed significantly to measured cN-I activity. Northern and
Western blot analyses showed cN-I mRNA and protein only in the
overexpressing cell lines (Fig. 5,
A and B).

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 5.
Expression of cN-I in stably transfected cell
lines. HEK 293 and Jurkat E6-1 cells were stably transfected with
the cN-I construct in a pcDNA3 vector, and clonal cell lines were
obtained for each. A, Northern blot analysis with cN-I
cDNA (top) and ethidium bromide-stained membrane showing
28 S rRNA (bottom). B, Western blot
analysis with anti-cN-I antibody.
|
|
HEK 293 and Jurkat E6-1 cells were treated with eight nucleoside
analogs for 4 days, and cell viability was determined by the
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. In
the presence of CdA, overexpression of cN-I led to a 49-fold increase
in IC50 in the HEK 293 cell line and a greater than
400-fold increase in IC50 in the Jurkat cell line (Fig.
6 and Table V). The IC50 for
the Jurkat cells expressing cN-I was greater than 100 µM,
the highest concentration used in this assay, so the exact
IC50 and fold increase due to expression of cN-I could not
be determined. Both cell lines showed smaller increases in
IC50 to both AraC and F-AraA and no change in
IC50 with compound 506U (AraG prodrug) or d4T (Table
V). Overexpression of cN-I conferred a
22-fold increase in IC50 to dFdC and a 5.2-fold increase in
IC50 to 5-FU in the HEK 293 cells and an 82-fold increase
in IC50 to ddC in the Jurkat cell line (Fig. 6 and Table
V). Higher levels of cN-I in the HEK 293 cells could not explain all
the differences in drug sensitivity because the Jurkat cells showed a
larger increase in IC50 to ddC, F-AraA, and CdA, indicating that cell type-specific differences are also important.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 6.
Drug resistance in cell lines stably
expressing cN-I. Parental, pcDNA3-transfected, and cN-I
transfected HEK 293 and Jurkat E6-1 cell lines were treated with
nucleoside analogs for 4 days. Cell viability was determined by
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assays and
compared with control cells that did not receive nucleoside analog
treatment. Representative graphs are shown from single experiments done
with nine replicates with parental ( ), vector-transfected ( ), and
cN-I-transfected ( ) cells.
|
|
View this table:
[in this window]
[in a new window]
|
Table V
Fold increase in IC50 of nucleoside analogs in two cell lines
overexpressing cN-I
HEK 293 and Jurkat cell lines were treated with varying concentrations
of nucleoside analogs for 4 days. Percent cell viability was calculated
compared with control cells that did not receive nucleoside analog
treatment. The IC50 values were calculated from graphs of the
data. The average fold increase in IC50 ± S.E. due to
expression of cN-I is shown for two or three (*) experiments, each
containing nine replicate platings. All values represent the fold
increase compared with parental cells unless otherwise indicated ( ),
because transfection with empty vector slightly increased the
sensitivity of the cells to nucleoside analogs. Hence, a comparison of
the cN-I-transfected cells to vector-transfected cells might
overestimate the increase in IC50.
|
|
 |
DISCUSSION |
Interest in cN-I and cN-II originally stemmed from research to
determine which nucleotidase was responsible for increased adenosine
formation from AMP in the heart in response to ischemia, hypoxia, and
increased workloads. During conditions of metabolic stress, net
catabolism of ATP leads to increased ADP and AMP levels (27).
Adenosine, produced by dephosphorylation of AMP, can help restore ATP
levels by decreasing ATP utilization and increasing blood flow and,
therefore, O2 and substrate supply to the heart (28).
Adenosine also contributes to ischemic preconditioning, a
cardioprotective mechanism that can prevent damage from a longer period
of ischemia (29). The kinetic characteristics of cN-I and cN-II have
been studied to determine the contribution of each enzyme to this
process. From the characteristics of the purified cN-I enzyme and the
cloned pigeon cN-I enzyme, cN-I has been identified as the enzyme
responsible for most of the adenosine production in hypoxic and
ischemic heart tissue (15, 19, 24, 30).
Although cN-I has been purified and characterized from rabbit, rat,
pigeon, dog, and human hearts, there is only limited information on its
role in pyrimidine metabolism (17, 20). As has been shown for the
purified cN-I enzymes, recombinant human cN-I showed the highest
specific activity with AMP as a substrate. In addition, the recombinant
enzyme showed high relative activity with all naturally occurring
nucleoside monophosphates except the pyrimidine dexoyribonucleoside
monophosphates. These results are consistent with those obtained for
the pigeon enzyme (20), and although the relative activities are
slightly higher for the human enzyme, the order of relative catalytic
rate is nearly identical. Although the enzyme had a lower specific
activity with pyrimidine deoxyribonucleoside monophosphates, when
catalytic efficiency was assessed by the Vmax/Km ratio, dCMP was 21 times more efficient as a substrate than AMP. Similar results were
reported for the rabbit cN-I enzyme (17). Although the
Km values for TMP and dUMP were not determined,
based on the rabbit enzyme data they are also likely to be efficient
substrates of cN-I. Thus, dCMP and other pyrimidine deoxyribonucleoside
monophosphates are likely to be important physiological substrates of
human cN-I.
Our study demonstrates that ADP is a critical regulator of cN-I
activity, and this feature is compatible with an important role of this
enzyme in adenosine generation in the heart during ischemia (30).
Interestingly, the activation of recombinant human cN-I by ADP was
6-20 times stronger than for the cN-I purified from pigeon, rabbit, or
dog hearts (16, 18, 20). This striking difference may reflect species
differences or result from either copurification of an activator (ADP
or GTP) or from a potential posttranslational modification of a native
protein that renders cN-I less dependent on ADP. Our data suggest that
ADP is a key regulator of human cN-I within the range of 10-200
µM. ADP levels in guinea pig heart increase from 38 µM to 72 µM under conditions of mild
hypoxia and to 238 µM under conditions of severe hypoxia (31). In rat heart, control ADP concentrations of 64 µM
increase to 106 µM under hypoxic conditions (32). These
fluctuations in ADP levels are precisely within the range of
A0.5 value for this activator and further
signify the important role of this enzyme in adenosine generation in
the heart during ischemia (15, 17, 24) and potentially also in working
skeletal muscle. Interestingly, recombinant human cN-I is also
significantly activated by GTP, and an increase in GTP levels, for
example during cellular proliferation, may also play a role in
activation of the enzyme.
The data presented in Table V show that increased activity of cN-I can
lead to resistance to several nucleoside analogs, including CdA, dFdC,
and ddC, and to a smaller extent, to 5-FU, AraC, and F-AraA. The change
in IC50 values for these compounds in the presence of cN-I
seems to correlate with the in vitro activity of cN-I with
CdAMP, F-AraAMP, and AraCMP (Tables III and IV). Thus, the relatively
high activity with CdAMP leads to strong resistance to CdA in cells
overexpressing cN-I and the lack of in vitro activity with
either F-AraAMP or AraCMP correlates with a much smaller increase in
resistance to the respective nucleosides. Unfortunately, we were not
able to extend this comparison to other nucleoside monophosphates since
they are not commercially available.
The strong dependence of cN-I activity on increased ADP concentrations
may also be relevant to resistance to nucleoside analogs in tumors that
experience hypoxia. Hypoxic tumors have poorer clinical prognosis, are
often resistant to both radiation and chemotherapy (33), and are more
likely to metastasize (34). The nucleoside analogs 5-FU and dFdC are
used clinically in the treatment of solid tumors (35, 36), and we have
shown that elevated expression of cN-I increases the IC50
for 5-FU 5.2-fold and the IC50 for dFdC 21.6-fold in the
HEK cells (Table V). Although the effect of hypoxia on drug resistance
in the context of cN-I activity remains to be investigated, this study
provides support for the hypothesis that increased ADP concentrations
in ischemic tumors may facilitate dephosphorylation of several
nucleoside-based drugs and lower their pharmacological efficacy.
Although cN-I was not detected in peripheral blood leukocytes (Fig. 2),
aberrant expression in malignant cells or enhanced expression as a
result of prior chemotherapy exposure could play a role in resistance
to nucleoside analogs in leukemias and lymphomas, where these drugs are
extensively used. Future studies will determine whether cN-I levels are
increased in leukemic cells from patients who are resistant to
nucleoside analog therapy.
 |
ACKNOWLEDGEMENTS |
We thank Dr. Kiran Mahajan for help in
setting up the Baculovirus expression system and Aiwen Jin for
technical advice on the purification of antibodies.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grants 2R01CA034085-18 (NCI) and 5T32GM07040-26.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF331801.
§
To whom correspondence should be addressed. Tel.: 919-966-4340;
Fax: 919-966-8212; E-mail: jozek@med.unc.edu.
Published, JBC Papers in Press, December 22, 2000, DOI 10.1074/jbc.M011218200
 |
ABBREVIATIONS |
The abbreviations used are:
AraC, 1- -D-arabinofuranosylcytosine;
dFdC, 2',3'-difluorodeoxycytidine;
CdA, 2-chloro-2'-deoxyadenosine;
d4T, 2',3'-didehydro-3'-deoxythymidine;
5-FU, 2,4-dihydroxy-5-fluoropyrimidine;
AraATP, adenine-9- -D-arabinofuranoside triphosphate;
F-AraATP, 2-fluoroadenine-9- -D-arabinofuranoside triphosphate;
cN-I, cytosolic nucleotidase I;
cN-II, cytosolic nucleotidase II;
PCR, polymerase chain reaction;
ddC, 2',3'-dideoxycytidine;
F-AraA, 2-fluoroadenine-9- -D-arabinofuranoside;
F-Ara-AMP, 2-fluoroadenine-9- -D-arabinofuranoside monophosphate
AraCMP, 1- -D-arabinofuranosylcytosine monophosphate
AraCMP, 1- -D-arabinofuranosylcytosine monophosphate;
CdAMP, 2-chloro-2'-deoxyadenosine monophosphate;
MOPs, 4-morpholinepropanesulfonic acid;
HEK cells, human embryonic kidney
cells;
AMPCP, ,
-methyleneadenosine-5'-diphosphate.
 |
REFERENCES |
| 1.
|
Cass, C. E.
(1995)
in
Drug Transport in Antimicrobial and Anticancer Therapy
(Georgopapadaku, N. H., ed)
, pp. 403-451, Marcel Dekker, Inc., New York
|
| 2.
|
Plagemann, P. G. W.,
Wohlhuter, R. M.,
and Woffendin, C.
(1988)
Biochim. Biophys. Acta
947,
405-443
|
| 3.
|
Plagemann, P. G. W.,
and Woffendin, C.
(1989)
Mol. Pharmacol.
36,
185-192
|
| 4.
|
Arner, E. S.,
and Eriksson, S.
(1995)
Pharmacol. Ther.
67,
155-186
|
| 5.
|
Grant, S.
(1998)
Adv. Cancer Res.
72,
197-233
|
| 6.
|
Leoni, L. M.,
Chao, Q.,
Cottam, H. B.,
Genini, D.,
Rosenbach, M.,
Carrera, C. J.,
Budihardjo, I.,
Wang, X.,
and Carson, D. A.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
9567-9571
|
| 7.
|
Genini, D.,
Budihardjo, I.,
Plunkett, W.,
Wang, X.,
Carrera, C. J.,
Cottam, H. B.,
Carson, D. A.,
and Leoni, L. M.
(2000)
J. Biol. Chem.
275,
29-34
|
| 8.
|
Lewis, W.,
and Dalakas, M. C.
(1995)
Nat. Med.
1,
417-422
|
| 9.
|
Oka, J.,
Matsumoto, A.,
Hosokawa, Y.,
and Inoue, S.
(1994)
Biochem. Biophys. Res. Commun.
205,
917-922
|
| 10.
|
Spychala, J.,
Madrid-Marina, V.,
and Fox, I. H.
(1988)
J. Biol. Chem.
263,
18759-18765
|
| 11.
|
Spychala, J.,
Chen, V.,
Oka, J.,
and Mitchell, B. S.
(1999)
Eur. J. Biochem.
259,
851-858
|
| 12.
|
Carson, D. A.,
Carrera, C. J.,
Wasson, D. B.,
and Iizasa, T.
(1991)
Biochim. Biophys. Acta
1091,
22-28
|
| 13.
|
Schirmer, M.,
Stegmann, A. P. A.,
Geisen, F.,
and Konwalinka, G.
(1998)
Exp. Hematol.
26,
1223-1228
|
| 14.
|
Newby, A. C.
(1988)
Biochem. J.
253,
123-130
|
| 15.
|
Truong, V. L.,
Collinson, A. R.,
and Lowenstein, J. M.
(1988)
Biochem. J.
253,
117-121
|
| 16.
|
Yamazaki, Y.,
Truong, V. L.,
and Lowenstein, J. M.
(1991)
Biochemistry
30,
1503-1509
|
| 17.
|
Garvey, E. P.,
Lowen, G. T.,
and Almond, M. R.
(1998)
Biochemistry
37,
9043-9051
|
| 18.
|
Darvish, A.,
and Metting, P. J.
(1993)
Am. J. Physiol.
264,
H1528-H1534
|
| 19.
|
Skladanowski, A. C.,
Smolenski, R. T.,
Tavenier, M.,
De Jong, J. W.,
Yacoub, M. H.,
and Seymour, A-M. L.
(1996)
Am. J. Physiol.
270,
H1493-H1500
|
| 20.
|
Skladanowski, A. C.,
and Newby, A. C.
(1990)
Biochem. J.
268,
117-122
|
| 21.
|
Marszalek, J.,
Kostrowicki, J.,
and Spychala, J.
(1989)
Comput. Appl. Biosci.
5,
239-240
|
| 22.
|
Chen, P. S.,
Toribara, T. Y.,
and Warner, H.
(1956)
Anal. Chem.
28,
1756-1758
|
| 23.
|
Hapke, D. M.,
Stegmann, A. P. A.,
and Mitchell, B. S.
(1996)
Cancer Res.
56,
2343-2347
|
| 24.
|
Sala-Newby, G. B.,
Skladanowski, A. C.,
and Newby, A. C.
(1999)
J. Biol. Chem.
274,
17789-17793
|
| 25.
|
Simpson, A. J.,
Reinach, F. C.,
Arruda, P.,
et al..
(2000)
Nature
406,
151-157
|
| 26.
|
Traut, T. W.
(1994)
Eur. J. Biochem.
222,
9-19
|
| 27.
|
Jennings, R. B.,
and Steenbergen, C.
(1985)
Annu. Rev. Physiol.
47,
727-749
|
| 28.
|
Newby, A. C.
(1984)
Trends Biochem. Sci.
9,
42-44
|
| 29.
|
Mullane, K.,
and Bullough, D.
(1995)
J. Mol. Cell. Cardiol.
27,
1041-1054
|
| 30.
|
Sala-Newby, G. B.,
Freeman, N. V. E.,
Skladanowski, A. C.,
and Newby, A. C.
(2000)
J. Biol. Chem.
275,
11666-11671
|
| 31.
|
He, M-X.,
Gorman, M. W.,
Romig, G. D.,
and Sparks, H. V., Jr.
(1992)
J. Mol. Cell Cardiol.
24,
79-89
|
| 32.
|
Headrick, J. P.,
and Willis, R. J.
(1989)
Biochem. J.
261,
541-550
|
| 33.
|
Brown, J. M.
(2000)
Mol. Med. Today
6,
157-162
|
| 34.
|
Rofstad, E. K.
(2000)
Int. J. Radiat. Biol.
76,
589-605
|
| 35.
|
Brito, R. A.,
Medgyesy, D.,
Zukowski, T. H.,
Royce, M. E.,
Ravandi-Kashani, F.,
Hoff, P. M.,
and Padzur, R.
(1999)
Oncology
57,
2-8
|
| 36.
|
van Moorsel, C. J. A.,
Pinedo, H. M.,
Veerman, G.,
Bergman, A. M.,
Kuiper, C. M.,
Vermorken, J. B.,
van der Vijgh, W. J. F.,
and Peters, G. J.
(1999)
Br. J. Cancer
80,
981-990
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. Lechward and K. Tkacz-Stachowska
Expression of cytosolic 5' nucleotidase does not correlate with expression of oxidative metabolism marker: myoglobine in human skeletal muscles
Acta Biochim Biophys Sin,
April 1, 2009;
41(4):
280 - 284.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. V. Simoes, M. Miyagawa, S. Reder, C. Stadele, R. Haubner, W. Linke, T. Lehner, P. Epple, M. Anton, M. Schwaiger, et al.
Myocardial Kinetics of Reporter Probe 124I-FIAU in Isolated Perfused Rat Hearts After In Vivo Adenoviral Transfer of Herpes Simplex Virus Type 1 Thymidine Kinase Reporter Gene
J. Nucl. Med.,
January 1, 2005;
46(1):
98 - 105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Proudfoot, E. Kuznetsova, G. Brown, N. N. Rao, M. Kitagawa, H. Mori, A. Savchenko, and A. F. Yakunin
General Enzymatic Screens Identify Three New Nucleotidases in Escherichia coli: BIOCHEMICAL CHARACTERIZATION OF SurE, YfbR, AND YjjG
J. Biol. Chem.,
December 24, 2004;
279(52):
54687 - 54694.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Rinaldo-Matthis, C. Rampazzo, J. Balzarini, P. Reichard, V. Bianchi, and P. Nordlund
Crystal Structures of the Mitochondrial Deoxyribonucleotidase in Complex with Two Specific Inhibitors
Mol. Pharmacol.,
April 1, 2004;
65(4):
860 - 867.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
V. Bianchi and J. Spychala
Mammalian 5'-Nucleotidases
J. Biol. Chem.,
November 21, 2003;
278(47):
46195 - 46198.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. M. Bengel, M. Anton, T. Richter, M. V. Simoes, R. Haubner, J. Henke, W. Erhardt, S. Reder, T. Lehner, W. Brandau, et al.
Noninvasive Imaging of Transgene Expression by Use of Positron Emission Tomography in a Pig Model of Myocardial Gene Transfer
Circulation,
October 28, 2003;
108(17):
2127 - 2133.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. B. Sala-Newby, N. V. E. Freeman, M. A. Curto, and A. C. Newby
Metabolic and functional consequences of cytosolic 5'-nucleotidase-IA overexpression in neonatal rat cardiomyocytes
Am J Physiol Heart Circ Physiol,
August 7, 2003;
285(3):
H991 - H998.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Reid, P. Wielinga, N. Zelcer, M. de Haas, L. van Deemter, J. Wijnholds, J. Balzarini, and P. Borst
Characterization of the Transport of Nucleoside Analog Drugs by the Human Multidrug Resistance Proteins MRP4 and MRP5
Mol. Pharmacol.,
May 1, 2003;
63(5):
1094 - 1103.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Picher, L. H. Burch, A. J. Hirsh, J. Spychala, and R. C. Boucher
Ecto 5'-Nucleotidase and Nonspecific Alkaline Phosphatase. TWO AMP-HYDROLYZING ECTOENZYMES WITH DISTINCT ROLES IN HUMAN AIRWAYS
J. Biol. Chem.,
April 4, 2003;
278(15):
13468 - 13479.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. R. Wielinga, G. Reid, E. E. Challa, I. van der Heijden, L. van Deemter, M. de Haas, C. Mol, A. J. Kuil, E. Groeneveld, J. D. Schuetz, et al.
Thiopurine Metabolism and Identification of the Thiopurine Metabolites Transported by MRP4 and MRP5 Overexpressed in Human Embryonic Kidney Cells
Mol. Pharmacol.,
December 1, 2002;
62(6):
1321 - 1331.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Gallinaro, K. Crovatto, C. Rampazzo, G. Pontarin, P. Ferraro, E. Milanesi, P. Reichard, and V. Bianchi
Human Mitochondrial 5'-Deoxyribonucleotidase. OVERPRODUCTION IN CULTURED CELLS AND FUNCTIONAL ASPECTS
J. Biol. Chem.,
September 13, 2002;
277(38):
35080 - 35087.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Nakanishi and K. Sekimizu
SDT1/SSM1, a Multicopy Suppressor of S-II Null Mutant, Encodes a Novel Pyrimidine 5'-Nucleotidase
J. Biol. Chem.,
June 7, 2002;
277(24):
22103 - 22106.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Allegrini, A. Scaloni, L. Ferrara, R. Pesi, P. Pinna, F. Sgarrella, M. Camici, S. Eriksson, and M. G. Tozzi
Bovine Cytosolic 5'-Nucleotidase Acts through the Formation of an Aspartate 52-Phosphoenzyme Intermediate
J. Biol. Chem.,
August 31, 2001;
276(36):
33526 - 33532.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|