![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 13, 10548-10555, March 30, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
§,
,
**,
,

,

,
,
§§
From the
Servicio de Inmunología, Hospital de
la Princesa, Universidad Autónoma de Madrid, Diego de León
62, 28006 Madrid, Spain and the ¶ Departamento de
Inmunología y Oncología, Centro Nacional de
Biotecnología, Consejo Superior de Investigaciones
Científicas, Cantoblanco, 28049 Madrid, Spain
Received for publication, July 13, 2000, and in revised form, December 28, 2000
| |
ABSTRACT |
|---|
|
|
|---|
Hypoxia-inducible factor 1 (HIF-1) induces a gene
expression program essential for the cellular adaptation to lowered
oxygen environments. The intracellular mechanisms by which hypoxia
induces HIF-1 remain poorly understood. Here we show that exposure of various cell types to hypoxia raises the intracellular level of phosphatidic acid primarily through the action of diacylglycerol kinase (DGK). Pharmacological inhibition of DGK activity through use of
the specific DGK inhibitors R59949 and R59022 abrogated specifically
HIF-1-dependent transcription analyzed with a
HIF-1-responsive reporter plasmid. A more detailed analysis revealed
that pharmacological inhibition of DGK activity prevented the
hypoxia-dependent accumulation of the HIF-1 Cells respond to insufficient oxygen delivery to tissues by
inducing a gene expression program governed by the transcription factor
hypoxia-inducible factor 1 (HIF-1)1 (1-5). Some of the
genes induced via HIF-1 are those encoding the vascular endothelial
growth factor (6), which triggers the neovascularization of hypoxic
regions; the glucose transporters and enzymes involved in glycolysis
that facilitate the oxygen-independent provision of ATP enhancing the
glycolytic metabolic pathway (7); and erythropoietin (8), which
elevates the blood oxygen-transport capability by increasing the number
of red blood cells. More recently, the generation of knockout mice for
HIF-1 and the analysis of HIF-1-deficient cell lines has underlined the
essential role of this transcription factor in embryonic development as
well as in tumor progression (9-13).
HIF-1 is an heterodimer composed of The intracellular mechanisms that connect oxygen sensing and the
activation of HIF-1 remain poorly understood. The involvement of
protein phosphorylation has been proposed as inhibitors of tyrosine and
serine/threonine kinases block HIF-1-dependent
transcription (20, 21). Recently, it has been reported that hypoxia
generates mitochondrial reactive oxygen intermediates (ROIs) that are
critical for the induction of HIF-1-dependent transcription
(22, 23). More recently, the Ser-Thr kinase AKT and the
mitogen-activated protein kinase have been also implicated in the
regulation of HIF-1-dependent transcription (24-26).
The activation of signal transduction pathways in response to different
extracellular stimuli often results in the accumulation of lipid second
messengers, such as diacylglycerol (DAG) and phosphatidic acid (PA),
due to the direct action of phospholipase C and phospholipase D (PLD),
respectively (27, 28). DAG serves as an allosteric activator of
classical and novel protein kinase C (PKC) isoforms that mediate many
cellular responses, including cell growth and differentiation (29-31).
PA has been suggested to participate in different cellular processes,
such as cell proliferation and actin polymerization (32-34). The
intracellular level of these two lipids can also be modulated by the
action of DGK, which generates PA by phosphorylation of DAG (35-37).
Although the role of DGK in signal transduction is poorly understood,
it has been proposed that DGK activity might be involved in the
attenuation of positive DAG signaling (38), as well as in the
generation of PA for downstream intracellular events (39-42).
In the present work we have investigated the role of lipid second
messengers in the cellular response to hypoxia and their involvement in
the regulation of HIF-1-dependent transcription. Previous
reports have shown that cellular exposure to hypoxia induces the
intracellular accumulation of DAG (43, 44). Herein we show that
exposure to hypoxia also results in a marked accumulation of the
intracellular level of PA through the action of DGK. In addition,
pharmacological inhibition of DGK activity with the specific DGK
inhibitors R59949 and R59022 prevents HIF-1-dependent transcription due to a reduction of hypoxia-induced HIF-1-DNA complex
formation, as well as HIF-1 Reagents--
[32P]Orthophosphate (carrier free)
and [ Cell Culture, Cell Treatments, and Hypoxic Conditions--
HeLa
cells were grown in RPMI 1640 medium with GLUTAMAX-I (Life Technologies
Ltd.), whereas 293-T and Hep3B cells were grown in Dulbecco's minimal
essential medium (Biochrom KG, Berlin, Germany) in the presence
of 10% (v/v) fetal calf serum (Labtech International Ltd., Woodside,
United Kingdom). Cells were routinely cultured in 95% air/5%
CO2 (normoxic conditions) at 37 °C. To expose cells to
hypoxia, they were placed into an airtight chamber with inflow and
outflow valves that was infused with a mixture of 1% O2,
5% CO2, 94% N2 (S.E. Carburos Metalicos S.A.,
Madrid, Spain) for 30 min. In all experiments, cells were plated at
70-90% confluency, and when cells were completely attached, after
3-4 h in the case of HeLa cells or after 12-14 h in the case of 293-T
and Hep3B cells, they were exposed to normoxia or hypoxia in the
presence or in the absence of R59949 or R59022. The cellular incubation with both DGK inhibitors was performed in serum-free medium because this compound is inactive in the presence of serum (40). All other
experiments were performed using 10% fetal calf serum-supplemented medium.
Measurement of 32P-Radiolabeled
Phospholipids--
Cells were cultured in phosphate-free medium
supplemented with 10% (v/v) fetal calf serum (extensively dialyzed
against 0.9% (w/v) NaCl) for 90 min before the addition of
[32P]orthophosphate (100 µCi/ml) for an additional 90 min. Thereafter, the cells were exposed to normoxia or hypoxia in the
presence or in the absence of 0.5% (v/v) butan-1-ol. Phospholipids
were then extracted by the method of Bligh and Dyer (45) and separated on TLC plates developed with a solvent system consisting of ethyl acetate/isooctane/acetic acid (9:5:2 (v/v/v)) for the separation of
[32P]PA and [32P]PBut or
chloroform/pyridine/88% formic acid (60:30:7 (v/v/v)) for the
detection of endogenous levels of [32P]PA in the absence
of 1-butanol. The dried TLC plates were subjected to autoradiography,
and the bands corresponding to radiolabeled PA and PBut were identified
by comigration with authentic nonlabeled PA and PBut standards.
Quantification of the band corresponding to [32P]PA was
performed using the Bio-Rad Molecular Analyst Software.
Determination of DAG Levels--
Total lipids were extracted
from cells exposed to normoxia or hypoxia for 6 h. The amount of
DAG was determined by its conversion into [32P]PA by
Escherichia coli DGK in the presence of
[ Measurement of DGK Activity--
DGK activity was determined in
cell lysates as previously described (39). Briefly, cell lysates were
incubated with 1,2-dioleoylglycerol in the presence of
[ Recombinant Plasmids--
To generate the p9HIF1-Luc reporter
plasmid, we cloned nine copies in tandem of an oligonucleotide
containing the HIF-1 binding sequence located between positions -985
and -951 of the 5' human vascular endothelial growth factor gene
promoter (6, 48), upstream of a minimal promoter fused to the firefly
luciferase cDNA. For the generation of p3EGR Luc, we cloned a
single copy of the following nucleotide sequence (5' to 3') containing
three binding sites for the transcription factor denominated
early growth response factor 1 (EGR 1) (underlined):
GCGCCCCCGCAAGCTTCGCCCCCGCAAAACGCCCCCGCA.
To generate constructs encoding the GAL4 DNA binding domain (amino
acids 1-147) (GAL4 DBD) in-frame with the amino acid sequences 530-582 or 775-826 of HIF-1 Transfections and Analysis of Luciferase Activity--
Confluent
cell cultures growing in 100 mm culture dishes were transfected in
Dulbecco's modified Eagle's medium containing 10% (v/v) fetal calf
serum with 20 µg of p9HIF-1 Luc or p3EGR Luc plasmids by using a
standard calcium phosphate method (49). For GAL4 experiments, 13 µg
of the pGAL4 DBD or pGAL4 DBD (530) HIF-1 Nuclear Extracts and Electrophoretic Mobility Shift Assays
(EMSAs)--
After cellular treatments, cell plates were rapidly
placed on ice to avoid effects of reoxygenation prior to the
preparation of nuclear extracts according to the procedure described
elsewhere (50).
Nuclear extracts containing 3-5 µg were incubated with 0.5 µg of
poly(dI-dC), 100 ng of calf thymus DNA, and 2.5 µl of 5× DNA binding
buffer (50 mM Tris buffer, pH 7.5, 130 mM KCl,
2 mM MgCl2, 0.5 mM
ZnCl2, 25 mM dithiothreitol, 5 mM
EDTA, 25% (v/v) glycerol) in a final volume of 11 µl for 10 min at
room temperature. For the supershift assay, 1.5 µl of a polyclonal
antibody raised against residues 1-13 of the human HIF-1 Immunoblotting--
Whole cellular lysates from 2 × 105 cells were resolved after heating on an 8%
polyacrylamide-SDS gel and transferred to a nitrocellulose membrane.
Thereafter, immunoblotting was performed as previously described (23)
using the HIF-1 Hypoxia Induces DAG Accumulation--
Because DAG is a well
recognized lipid second messenger, we decided to investigate whether
the level of DAG was affected upon exposure of HeLa cells to hypoxia.
As shown in Fig. 1, the exposure of HeLa
cells to hypoxia induces a significant increase in the intracellular
level of DAG. This result is in agreement with previous reports that
have shown a sustained increase of DAG level in neonatal rat
ventricular myocytes, as well as in the Hep3B cell line in response to
hypoxia (43, 44). These data led us to propose that the accumulation of
DAG could be a common mechanism that underlines the cellular response
to hypoxia.
Hypoxia Induces PA Accumulation through a PLD-independent
Mechanism--
Accumulation of DAG can lead to the activation of PLD
through the induction of DAG-dependent PKC activity (51).
Therefore, we next analyzed whether hypoxia also resulted in the
generation of PA through PLD. The reaction catalyzed by PLD generates
PBut instead of PA when cells are incubated in the presence of the primary alcohol butan-1-ol (32). Therefore the measurement of PBut
levels has been considered a marker of cellular PLD activity. Thus, the
activation of PLD in 32P metabolically labeled HeLa cells
treated with the phorbol ester PMA in the presence of butan-1-ol 0.5%
(v/v) led to a marked increase of [32P]PBut level as
previously described (Fig. 2) (52). In
contrast, exposure of 32P-radiolabeled HeLa cells to
hypoxia produced a strong increase of [32P]PA even in the
presence of the same amount of butan-1-ol, whereas the basal
[32P]PBut level was only moderately increased (Fig. 2).
These data were confirmed with a parallel analysis of
[32P]PA levels by high pressure liquid
chromatography (data not shown). We conclude from these results
that hypoxia induces a marked increase in cellular PA primarily through
a PLD-independent mechanism.
Hypoxia Induces PA Accumulation via DGK--
PA may also arise
from conversion of DAG into PA by DGK (35-37). Because hypoxia
accumulates DAG (Fig. 1), we thought that conversion of DAG into PA by
DGK activity could account for the hypoxia-inducible PA generation in
HeLa cells. Therefore, we analyzed the effect of the previously
recognized DGK inhibitor R59949 (35, 39) on the hypoxia-induced PA
accumulation. First, we tested whether the endogenous DGK activity of
HeLa cells was sensitive to R59949. We found that treatment of HeLa
cells with R59949 (10 µM) produced a significant
inhibition (57%) of total endogenous HeLa DGK activity (Fig.
3A).
Pretreatment of [32P]orthophosphate metabolically labeled
HeLa cells with doses of R59949 ranging from 1 to 10 µM
produced a dose-dependent inhibition of hypoxia-induced
[32P]PA accumulation (Fig. 3B). The basal
[32P]PA level in HeLa cells was also slightly inhibited
in the presence of the same doses of the DGK inhibitor (Fig.
3B). Together, these data led us to propose that the
conversion of hypoxia-dependent DAG accumulation into PA by
a R59949-sensitive DGK isoform(s) is responsible for hypoxia-induced PA
elevation in HeLa cells.
As in the case of HeLa cells, we also found that hypoxia induced a
marked PA accumulation in [32P]orthophosphate
metabolically labeled Hep3B and 293-T cells that was inhibited by the
DGK kinase inhibitor (Fig.
4A). Time course experiments
in 293-T cells revealed a sustained hypoxia-induced PA accumulation
that was detected as soon as after 3 h and remained elevated even
after 15 h (Fig. 4B). The delay of 3 h in the
detection of PA accumulation was probably due to the fact that
~2.5-3 h are required to reach fully established hypoxic conditions
in the culture medium after initial influx of hypoxic atmosphere (data
not shown). In this regard, a similar delay has been observed in other
hypoxia-induced intracellular events, as in the case of activation of
HIF-1 that is only completely induced after 2-4 h of hypoxia (53). In
addition, we performed experiments to answer the question whether the
accumulation of PA was also detected with other cellular stresses or
was it specific to hypoxia. We found that the exposure of HeLa cells to
ultraviolet light C or heat shock during 15 min resulted in an
induction of 1.2 ± 0.3-fold and 1.3 ± 0.4-fold
(n = 4) in the level of PA, respectively, whereas an
induction of 2-3-fold was observed after hypoxia exposure.
Taken together, these data indicate that a sustained PA accumulation
through a R59949-sensitive DGK mechanism is a general cellular response
to low oxygen tension.
Effect of Pharmacological Inhibition of DGK Activity on
HIF-1-dependent Transcription--
Next we asked whether
hypoxia-dependent PA accumulation was involved in the
activation of HIF-1-dependent transcription. As a first
approach, HeLa cells were transfected with the HIF-1-responsive reporter plasmid p9HIF-1 Luc. Pretreatment of transfected HeLa cells
with R59949, at doses identical to those that impaired hypoxia-inducible PA accumulation (1-10 µM), gradually
inhibited the hypoxia-inducible transcription promoted by p9HIF-1 Luc
(Fig. 5, top panel). Similar
results were obtained with R59022 (10 µM), a different
specific DGK activity inhibitor (Fig. 5, top panel). As a
control of specificity, we analyzed in parallel the previously
described PMA-dependent transcription driven by the EGR 1 (54). The response to PMA driven by the EGR-responsive reporter
plasmid, p3EGR Luc, was not markedly affected by pretreatment with the
same doses of R59949 or R59022 (Fig. 5, bottom panel).
The binding of HIF-1 to DNA specific sequences is required to promote
HIF-1-driven transcription. Therefore, we analyzed by EMSA whether
R59949 pretreatment interfered with the formation of HIF-1-DNA complex.
The DNA probe used in this EMSA was the HIF-1 binding sequence
multimerized in the p9HIF-1 Luc. Exposure of HeLa cells to hypoxia
induced the appearance of two major hypoxia-inducible DNA-protein
complexes indicated as H1 and H2 (Fig.
6A). A specific polyclonal
antibody against the
The binding of HIF-1 heterodimer to DNA requires a previous
hypoxia-induced stabilization and subsequent accumulation of the HIF-1
The complete activation of HIF-1-dependent transcription
also requires the hypoxia-inducible transactivation activity of its HIF-1 The pivotal role recognized for HIF-1 in the cellular response to
low oxygen environments has generated a great interest in the signal
transduction mechanisms involved in its regulation. It has previously
been reported that cell exposure to conditions ranging from moderate
hypoxia to anoxia induce a series of intracellular events associated
with signal transduction, such as the activation of c-Src kinase
(56), PKC (43), p38 kinase, and c-Jun N-terminal kinase (JNK) (57-60),
as well as an increase in the level of intracellular calcium (61).
Despite these observations, none of these signaling mechanisms have
been clearly associated with the activation of HIF-1. Chandel and
coworkers showed the first evidence that connected an
hypoxia-inducible intracellular event with HIF-1 activation (22, 23).
They demonstrated that the generation of mitochondrial ROIs upon
hypoxic stimulation mediates the induction of
HIF-1-dependent transcription (22, 23). Most recently, it
has been suggested that the Ser-Thr protein kinase AKT may lead to the
activation of HIF-1 by hypoxia in PTEN mutant glioblastoma cell
lines (26). In addition, recent reports have provided evidence for a
role of the mitogen-activated protein kinase in the regulation of
HIF-1-dependent transcription (24, 25).
In the present work, we show for the first time that the generation of
PA through DGK is a general response to hypoxia and provide evidence
for a role of this kinase in the regulation of HIF-1. Due to the
ability of this enzyme to regulate the level of the lipid second
messengers DAG and PA, it has been proposed that DGK activity can
participate in signal transduction by attenuating the second messenger
functions of DAG as well as by inducing the generation of biologically
active species of PA (36, 37). As we show in HeLa cells, the
hypoxia-dependent elevation of PA via DGK occurred in
parallel with a marked accumulation of DAG (Figs. 1 and 3). The
parallel accumulation of DAG and PA seems to be not only restricted to
HeLa cells, because it has been reported that hypoxia induced DAG
accumulation in different cells types, including Hep3B (44), in which
we have also detected a marked hypoxia-dependent PA
accumulation. This hypoxia-dependent DAG accumulation was
prevented with the previously recognized inhibitor of
phosphatidylcholine-phospholipase C and sphingomyelin synthase activities D609 (51, 62) (data not shown), in agreement with Goldberg
et al. (43). Interestingly, we observed that the
pretreatment with the same doses of D609 that reduced the
hypoxia-dependent DAG accumulation resulted in a complete
inhibition of HIF-1-dependent transcription.2 Therefore, we
proposed that the involvement of hypoxia-dependent generation of DAG in the regulation of HIF-1 depends on its conversion to PA through DGK due to the coordinated activity of
phosphatidylcholine-phospholipase C or sphingomyelin synthase
with DGK enzymes.
In addition, the hypoxia-induced sustained PA accumulation occurred in
parallel with the previously reported sustained induction of HIF-1
protein (53). These time course experiments and the fact that the
pharmacological elimination of hypoxia-dependent PA
accumulation inhibits HIF-1 induction led us to strongly suggest that
the accumulation of PA via DGK plays an essential role in the
regulation of HIF-1.
Nine different isoforms of mammalian DGKs have been identified to date,
and they have been classified in five different families (35-37). All
the enzymes contain a C-terminal catalytic domain and two or three
cysteine-rich domains. The different families are characterized by
having different N-terminal regulatory domains, suggesting different
mechanisms of regulation for the different isoforms. To date, we have
not identified the DGK isoform(s) that controls the activity of HIF-1,
but we have shown that this transcriptional activity is sensitive to
the DGK inhibitor R59949. This compound has been recognized as a
inhibitor of the type I isoforms of DGK and that it binds specifically
to their catalytic domains (35, 39, 63). Previous data have shown that
R59949 does not affect DGK It has been previously proposed that the accumulation of PA regulates
important processes, such as cell cycle progression and cytoskeletal
organization (32-34). Here, we propose a novel role of PA generated
during hypoxia through a DGK-dependent mechanism in the
hypoxia-induced accumulation of HIF-1 Herein we propose that the DGK activity is essential in the regulation
of HIF-1-dependent transcription by low oxygen tension. Recently, it has been shown that the generation of mitochondrial ROIs
in Hep3B and 293 cells lines (22, 23) and the activation of the Ser-Thr
kinase AKT in PTEN mutant glioblastoma cell lines are
intracellular mechanisms involved in the accumulation of HIF-1 Our results also show that although hypoxia raises the level of PA
primarily through DGK, there is also a moderate activation of PLD upon
cellular exposure to hypoxia (Fig. 2). This suggests the existence of
more than one mechanism responsible for PA generation. This
hypoxia-dependent activation of PLD activity has also been detected in hypoxia-exposed sheep pulmonary artery cultured smooth muscle cells (76). This PLD activation is probably due to the activation of the DAG-dependent PKC Taken together, these data suggest that the sustained conversion of DAG
into PA through the action of DGK serves to connect oxygen sensing
mechanisms to the activation of HIF-1-dependent transcription.
subunit and
the subsequent HIF-1-DNA complex formation as well as hypoxia-induced
activity of the HIF-1 transactivation domains localized to amino acids
530-582 and 775-826 of the HIF-1
subunit. Our results
demonstrate for the first time that accumulation of phosphatidic acid
through DGK underlines oxygen sensing and provide evidence for the
involvement of this lipid kinase in the intracellular signaling that
leads to HIF-1 activation.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
and
subunits that belong to
the basic helix-loop-helix Per-Arnt-Sim family of transcription factors (14). In normoxia, HIF-1
is a very unstable protein that is
rapidly degraded by the ubiquitin-proteasome pathway (15, 16). After
the onset of hypoxia, HIF-1
is stabilized, resulting in the
formation of the HIF-1
/
heterodimer that binds to DNA hypoxia-responsive elements to drive transcription (17). The complete
activation of HIF-1 by hypoxia also requires the induction of its
transactivatory function, which has been localized to amino acids
530-582 and 775-826 within the HIF-1
subunit (18, 19).
subunit transactivation activity. These
results demonstrate for the first time that PA generation through DGK
is part of the cellular response to hypoxia and provide evidence for an
essential role of this lipid kinase in the signal transduction pathway
that culminates in the activation of HIF-1.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-32P]ATP (specific activity, 3000 Ci/mmol)
were purchased from Amersham Pharmacia Biotech. Silica gel thin
layer chromatography plates (60 Å, LK6D) were from Whatman
(Clifton, NJ). DGK inhibitor I (R59022) and DGK inhibitor II (R59949)
were purchased from Calbiochem (La Jolla, CA). The authentic
phospholipid standards 1,2-dioleoylglycerol and 1,2-dioleoyl
phosphatidic acid were from Sigma, and phosphatidylbutanol (PBut) was
from Avanti Polar Lipids, Inc. (Alabaster, AL). Phorbol 12-myristate
13-acetate (PMA) was from Sigma. Analytic grade organic solvents
for TLC were from Merck (Darmstadt, Germany).
-32P]ATP as previously described (46). DAG levels
were corrected to the total phospholipid phosphate content. The method
of Bartlett (47) was used for the assay of total phosphate.
-32P]ATP. Thereafter, the generation of
[32P]PA by endogenous DGK was determined by its
separation using TLC employing a solvent system consisting of
chloroform/methanol/4 M ammonium hydroxide (9:7:2 (v/v/v)).
The band corresponding to radiolabeled PA was quantified as above.
subunit, we amplified these regions using the polymerase chain reaction with primers containing
BamHI overhangs and using as template the HIF-1
expression vector (kindly provided by Dr. E. Huang; Brigham & Women's
Hospital, Harvard Medical School, Boston, MA). The polymerase chain
reactions were performed under the previously described conditions
(18). Thereafter, polymerase chain reaction products were cloned into
the BamHI site of the pGAL4 DBD expression vector to
generate the constructs designated pGAL4 DBD (530) HIF-1
and
GAL4 DBD (775) HIF-1
. The pGAL4 DBD vector and the pGAL4 Luc
reporter plasmid were kindly provided by Dr. J. M Redondo (Centro de
Biología Molecular, consejo superior de investigaciones
cientificas, Universidad Autónoma de Madrid, Madrid, Spain)
constructs were
cotransfected with 7 µg of pGAL4 Luc or 7 µg of pGAL4 DBD
(775) HIF-1
plasmid with 13 µg of pGAL4 Luc. After 10-16 h
in the presence of DNA precipitates, cells were treated as indicated
above prior to luciferase analysis.
protein or
the corresponding preimmune serum was added to the binding reaction and
incubated for an additional 10 min. Thereafter, 0.5-1.5 ng (1.5 µl)
of 32P-labeled double-stranded oligonucleotide (10-20 × 107 cpm/µg) was added. After 20 min of incubation at
room temperature, 2 µl of Ficoll 400 20% (w/v) were added, and
DNA-protein complexes were resolved by electrophoresis. The
complementary oligonucleotides annealed and used as probe in
EMSA were (5' to 3')
TCGACCACAGTGCATACGTGGGCTCCAACAGGTCCTCTTC and (5' to 3')
TCGAGAAGAGGACCTGTTGGAGCCCACGTATGCACTGTGG (nucleotides spanning
positions -985 to -951 of the human vascular endothelial growth factor 5' gene promoter sequence are underlined).
antibody (dilution 1:1000) (Transduction
Laboratories, Becton Dickinson) or the Sp-1 antibody (dilution 1:200)
(Santa Cruz Biotechnology, Inc., Santa Cruz, CA).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (35K):
[in a new window]
Fig. 1.
Hypoxia increases the intracellular level of
DAG. HeLa cells were incubated for 6 h in normoxic
(N) (lanes 1 and 2) or hypoxic
(HP) (lanes 3 and 4) conditions.
Cellular lipids were extracted, and DAG levels were determined by the
conversion of DAG into [32P]PA by E. coli DGK.
32P-Radiolabeled PA generated was separated from all other
phospholipids by TLC (top panel) and quantified relative to
the total phospholipid phosphate content (bottom panel).
Each bar represents the DAG content (mean ± S.D.) of a
representative experiment performed in duplicate.

View larger version (44K):
[in a new window]
Fig. 2.
Hypoxia increases the intracellular level of
PA mainly through a mechanism independent of PLD.
[32P]Orthophosphate metabolically labeled HeLa cells were
incubated for 6 h in normoxia (N) (lanes 1 and 2) or hypoxia (HP) (lanes 3 and
4) or for 30 min with PMA (80 ng/ml) (lanes 5 and
6) in the presence of butan-1-ol (0.5% (v/v)). Cellular
phospholipids were extracted, and the 32P-radiolabeled PA
and PBut were separated from all other phospholipids by TLC and then
visualized by autoradiography. An experiment performed in duplicate is
shown. Similar results were obtained from two additional independent
experiments.

View larger version (18K):
[in a new window]
Fig. 3.
The DGK inhibitor R59949 prevents
hypoxia-induced PA accumulation. A, HeLa cells were
incubated with vehicle dimethyl sulfoxide (0.1%
Me2SO (v/v)) or R59949 (10 µM).
Thereafter, cells were lysed, and DGK activity was determined as
indicated under "Experimental Procedures." Thereafter, the
32P-radiolabeled PA generated was separated from all other
phospholipids by TLC (top panel) and quantified
(bottom panel). Each bar represents the relative
PA content (mean ± S.D.) of a representative experiment performed
in duplicate. B, [32P]orthophosphate
metabolically labeled HeLa cells were preincubated with vehicle (-)
(0.1% Me2SO (v/v)) or the indicated doses of R59949 for 15 min before exposure to hypoxia or normoxia for an additional 6 h.
Cellular phospholipids were then extracted and the
32P-radiolabeled PA was visualized by TLC (top
panel) and quantified (bottom panel). A representative
experiment performed in duplicate is shown.

View larger version (23K):
[in a new window]
Fig. 4.
Hypoxia-dependent PA accumulation
via DGK is a general cellular response to low oxygen tension and PA
elevation is sustained during the hypoxic exposure. A,
[32P]orthophosphate metabolically labeled 293-T or Hep3B
cells were preincubated with vehicle (-) (0.4% Me2SO
(v/v)) or (+) R59949 (20 µM) for 15 min before exposure
to hypoxia (HP) or normoxia (N) for an additional
6 h. Cellular phospholipids were then extracted, and the
32P-radiolabeled PA was visualized by TLC (top
panel) and quantified (bottom panel). Each
bar represents the PA fold induction (mean ± S.D.) of
a representative experiment performed in duplicate. Similar results
were obtained from two independent experiments. B,
[32P]orthophosphate metabolically labeled 293-T cells
were exposed to hypoxia or normoxia for 1, 3, 6, or 15 h.
Thereafter, 32P-radiolabeled PA was quantified. Each
bar represents the PA fold induction (mean ± S.D.) of
a representative experiment performed in duplicate.

View larger version (18K):
[in a new window]
Fig. 5.
The pharmacological inhibition of DGK
activity prevents HIF-1 dependent transcription. HeLa cells
transiently transfected with the p9HIF-1 Luc (top panel) or
p3EGR Luc (bottom panel) were preincubated with vehicle (-)
(0.1% Me2SO (v/v)) or the indicated doses of R59949 or
R59022 for 15 min before exposure to normoxia, hypoxia, or PMA (20 ng/ml) for an additional 6 h. After such incubation, luciferase
activity was determined in cell lysates. Each bar represents
the luciferase activity (mean ± S.D.) of duplicate cell lysates.
Normoxic values corresponding to p9HIF-1 Luc were magnified × 10. Similar results were observed in eight independent experiments.
subunit of HIF-1, but not the corresponding
preimmune serum, was able to supershift both hypoxia-inducible complexes without affecting constitutive DNA-protein complexes, evidencing the presence of HIF-1 specifically in H1 and H2 complexes (Fig. 6A). The hypoxia-dependent formation of H1
and H2 complexes was markedly reduced in HeLa cells pretreated with
R59949 (10 µM), whereas we did not observe any
significant effect of the DGK inhibitor on the constitutive DNA-protein
complexes (Fig. 6A). Furthermore, the addition of R59949 (10 µM) to the in vitro binding reaction did not
affect the formation of both HIF-1-DNA complexes (data not shown),
indicating that R59949 affected the cellular mechanisms that lead to
the appearance of HIF-1-DNA complexes upon hypoxic stimulation.

View larger version (38K):
[in a new window]
Fig. 6.
The DGK inhibitor R59949 interferes with the
hypoxia-dependent HIF-1-DNA complex formation and
accumulation of HIF-1
subunit.
A, nuclear extracts were prepared from HeLa cells
preincubated with vehicle (0.1% Me2SO (v/v)) or R59949 (10 µM) for 15 min before exposure to normoxia (N)
or hypoxia (HP) for an additional 6 h. Nuclear extracts
were incubated with a 32P-radiolabeled double-stranded DNA
probe, and DNA-protein complexes were then resolved by electrophoresis
(left panel). For supershift EMSA (right panel),
nuclear extract from HeLa cells exposed to hypoxia were preincubated in
the absence (-) or in the presence of the polyclonal antibody against
HIF-1
(HIF-1
Ab) or the corresponding preimmune serum
(p.i.). Supershifted complexes are indicated by
SS(H1) and SS(H2). Protein-DNA complexes
containing HIF-1 are indicated by H1 and H2.
Arrowheads on the left of each panel indicate the
free labeled -985/-951 probe. B, HIF-1
and Sp-1 protein
levels were analyzed by immunoblotting whole cell lysates of HeLa cells
pretreated with vehicle (-) (0.1% Me2SO (v/v)), R59949
(10 µM), or R59022 (10 µM) and of 293-T and
Hep3B pretreated with (-) (0.4% Me2SO (v/v)) or (+)
R59949 (20 µM) for 15 min before exposure to normoxia
(N) or hypoxia (HP) for an additional 6 h.
Arrowheads indicate specific bands detected with each
antibody.
subunit (17). Therefore, we analyzed whether the
pharmacological inhibition of DGK activity was primarily preventing the
hypoxia-induced accumulation of HIF-1
. We found that R59949 markedly
reduces in HeLa, Hep 3B, and 293-T cells the accumulation of the
HIF-1
subunit upon hypoxic exposure, suggesting that the
accumulation of PA in response to hypoxia is a common mechanism
required to induce HIF-1 (Fig. 6B). Pretreatment with R59949
prevented HIF-1
accumulation in Hep3B and 293-T cells at doses
ranging from 10 to 30 µM, which were slightly higher than
those required in HeLa cells to detect the same level of inhibition
(Fig. 6B and data not shown). As previously described, HIF-1
is detected by Western blotting as double band that reflects its
phosphorylation state (25). As a control for the specific effect of DGK
inhibitor, we also analyzed the protein level of the Sp-1 transcription
factor in the same lysates. The constitutive protein level of Sp-1
detected in the three cell cultures analyzed was not affected when the same dose of R59949 was employed in either normoxia or hypoxia (Fig.
6B). Pretreatment with the other DGK inhibitor, R59022, was
also able to prevent the accumulation of HIF-1
without affecting Sp-1 levels in HeLa cells (Fig. 6B).
subunit (55). The sequences of HIF-1
subunit that mediate its hypoxia-inducible transactivation activity have been located between amino acids 530-582 and 775-826 (18, 19). Therefore, we asked whether the hypoxia-dependent PA accumulation via
DGK activity was also regulating the hypoxia-induced transactivation activity driven by these two minimal sequences. HeLa cells were cotransfected with expression vectors encoding the 530-582 or 775-826
amino acid sequences fused in-frame with the GAL4 DBD (GAL4 DBD
(530) HIF-1
and GAL4 DBD (775) HIF-1
) in combination with the pGAL4 Luc reporter plasmid. Pretreatment of transfected HeLa
cells with R59949 at doses ranging from 1 to 10 µM
gradually inhibited the hypoxia-inducible activity driven by both
sequences without reducing their basal activity found in normoxia (Fig. 7). These experiments also indicated that
the two transactivation domains were differentially affected by cell
exposure to R59949. The hypoxia-dependent transcription
driven by the HIF-1
775-826 sequence returned almost to normoxic
levels in the presence of R59949 (10 µM), whereas the
same dosage of R59949 produced only a partial reduction in
hypoxia-dependent activity driven by the HIF-1
530-582
sequence (Fig. 7). We detected a basal transcriptional activity in HeLa
cells transfected with pGAL4 DBD alone and GAL4 Luc that was not
affected with the same doses of R59949 in either normoxia or hypoxia
(Fig. 7).

View larger version (18K):
[in a new window]
Fig. 7.
The pharmacological inhibition of DGK
activity with R59949 reduces the hypoxia-inducible transcriptional
activity of HIF-1
subunit. HeLa cells
were cotransfected the expression vectors encoding the GAL-4 DBD, GAL4
DBD (530) HIF-1
or GAL4 DBD (775) HIF-1
in combination
with the pGAL4 Luc-responsive luciferase reporter plasmid. Transfected
cells were preincubated with vehicle (0.1% Me2SO (v/v)) or
indicated doses of R59949 for 15 min before exposure to normoxia
(N) or hypoxia (HP) for an additional 6 h.
After such incubation, luciferase activity was determined in cell
lysates. Each bar represents the luciferase activity
(mean ± S.D.) of duplicate cell lysates. These results were
similar in four independent experiments.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
activity (64), although whether this
compound affects other DGK isoforms has not been fully determined.
Because our data strongly suggest that the
hypoxia-dependent PA accumulation through an
R59949-sensitive DGK is a general response of cellular cultures to
hypoxia, it is possible to speculate that a common R59949-sensitive DGK
isoform(s) is exclusively involved in the regulation of this
transcription factor or that every cell type regulates HIF-1 through
its particular set of R59949-sensitive DGK isoforms. It has been
previously reported that every DGK isoform shows a specific
intracellular localization that could be required to control specific
cellular functions (65). In this regard, it has been shown that the
regulation of the cell cycle by DGK
required its nuclear
localization (38). These published data lead us to consider that the
activation of HIF-1 could require the local accumulation of PA in
particular cellular compartments by a specific DGK isoform(s). Further
analysis of the role of DGK in the regulation of HIF-1 will require the
identification of the DGK isotypes expressed in different cell types,
including HeLa, Hep3B, and 293-T cells, as well as the future design of "loss of function" and/or dominant-negative versions of the DGK isoforms identified.
as well as in its transactivational function. By itself, PA is a presumed second messenger that has been shown to be involved in the activation a number
of enzymes, including raf kinase (66), type I
phosphatidylinositol 4-phosphate 5-kinases (67), protein phosphatase 1 (68), n-chimaerin (69), the
isotype of PKC (70), an
unidentified protein kinase that phosphorylates the NADPH oxidase
protein p47phox (71, 72), and the activation of the SHP-1
protein phosphatase (73). It has been previously proposed that the
dephosphorylation of residues 551 and 552 of HIF-1
could prevent its
ubiquitinization and subsequent degradation by the proteasome pathway
in hypoxic conditions (74), as well as that redox modification of the
cysteine residue (C800) of HIF-1
is essential for the recruitment of
transcriptional coactivators to its C-terminal transactivation domain
(75). Therefore, future experiments will be designed to explore whether hypoxia-dependent PA elevation and some of previously
reported PA-dependent intracellular events are required to
connect the accumulation of PA and the posttranslational
modifications of HIF-1
required for its activation.
in
response to hypoxia (26). Further work will be required to establish
whether the accumulation of PA through DGK functions independently of
ROIs and/or AKT or whether they act together in a single transduction
pathway leading to HIF-1 activation. In this regard, studies in our own
laboratory indicate that the regulation of cell cycle entry in
T-lymphocytes exerted by DGK-mediated PA accumulation is independent of
the activation of AKT (40). Therefore, further studies will be
necessary to investigate whether the generation of PA during hypoxia is
related to the activation of AKT.
isoform by hypoxia
(43). Because the accumulation of PA through the action of DGK appears to be important in the regulation of HIF-1, it will be of interest to
explore whether the hypoxia-induced PA generation derived from PLD is
also important for the activation of HIF-1.
| |
ACKNOWLEDGEMENTS |
|---|
We are very grateful to J. M. Redondo,
E. Huang, G. L. Semenza, and O. Hankinson for providing us with
critical reagents that made this work possible. We also thank T. Bellón, F. Sanchez-Madrid, M. D. Gutiérrez, M. C. Castellanos, and L. del Peso for critical reading of the manuscript and
S. Martinez-Martinez for invaluable help in generating the HIF-1
polyclonal antibody.
| |
FOOTNOTES |
|---|
* This work was supported by Grants PM 98/1328 and PM 97/0132 from the Ministerio de Educación y Cultura, by Grant Fis 98/1328 from the Fondo de Investigaciones Sanitarias, and by Grant CAM 08.3/0016/99 from the Comunidad Autonoma de Madrid.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Supported by a fellowship from Fondo de Investigaciones Sanitarias.
Supported by fellowships from the Comunidad Autonoma de Madrid.
** Supported by a fellowship from Instituto de Salud Carlos III.

Supported by fellowships from Ministerio de Educación y Cultura.
§§ To whom correspondence should be addressed. Tel.: 34-91-5202662; Fax: 34-91-3092496; E-mail: mortiz@hlpr.insalud.es.
Published, JBC Papers in Press, January 2, 2001, DOI 10.1074/jbc.M006180200
2 J. Aragonés, D. R. Jones, I. Mérida, and M. O. Landazuri Unpublished results.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: HIF-1, hypoxia-inducible factor 1; PA, phosphatidic acid; DGK, diacylglycerol kinase; DAG, diacylglycerol; PBut, phosphatidylbutanol; DBD, DNA binding domain; EGR, early growth response factor; Me2SO, dimethyl sulfoxide; EMSA, electrophoretic mobility shift assay; PMA, phorbol 12-myristate 13-acetate; ROI, reactive oxygen intermediate; PKC, protein kinase C; PLD, phospholipase D.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Gleadle, J. M., and Ratcliffe, P. J. (1998) Mol. Med. Today 4, 122-129 |
| 2. | Guillemin, K., and Krasnow, M. A. (1997) Cell 89, 9-12 |
| 3. | Bunn, H. F., and Poyton, R. O. (1996) Physiol. Rev. 76, 839-885 |
| 4. | Semenza, G. L. (1998) Curr. Opin. Genet. Dev. 8, 588-594 |
| 5. | Semenza, G. L. (1999) Cell 98, 281-284 |
| 6. | Forsythe, J. A., Jiang, B. H., Iyer, N. V., Agani, F., Leung, S. W., Koos, R. D., and Semenza, G. L. (1996) Mol. Cell. Biol. 16, 4604-4613 |
| 7. | Semenza, G. L., Roth, P. H., Fang, H. M., and Wang, G. L. (1994) J. Biol. Chem. 269, 23757-23763 |
| 8. | Semenza, G. L. (1994) Hematol. Oncol. Clin. North Am. 8, 863-884 |
| 9. | Ryan, H. E., Lo, J., and Johnson, R. S. (1998) EMBO J. 17, 3005-3015 |
| 10. | Maxwell, P. H., Dachs, G. U., Gleadle, J. M., Nicholls, L. G., Harris, A. L., Stratford, I. J., Hankinson, O., Pugh, C. W., and Ratcliffe, P. J. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 8104-8109 |
| 11. | Maltepe, E., Schmidt, J. V., Baunoch, D., Bradfield, C. A., and Simon, M. C. (1997) Nature 386, 403-407 |
| 12. | Iyer, N. V., Kotch, L. E., Agani, F., Leung, S. W., Laughner, E., Wenger, R. H., Gassmann, M., Gearhart, J. D., Lawler, A. M., Yu, A. Y., and Semenza, G. L. (1998) Genes Dev. 12, 149-162 |
| 13. | Carmeliet, P., Dor, Y., Herbert, J. M., Fukumura, D., Brusselmans, K., Dewerchin, M., Neeman, M., Bono, F., Abramovitch, R., Maxwell, P., Koch, C. J., Ratcliffe, P., Moons, L., Jain, R. K., Collen, D., Keshert, E., and Keshet, E. (1998) Nature 394, 485-490 |
| 14. | Wang, G. L., and Semenza, G. L. (1995) J. Biol. Chem. 270, 1230-1237 |
| 15. | Huang, L. E., Gu, J., Schau, M., and Bunn, H. F. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 7987-7992 |
| 16. | Salceda, S., and Caro, J. (1997) J. Biol. Chem. 272, 22642-22647 |
| 17. | Huang, L. E., Arany, Z., Livingston, D. M., and Bunn, H. F. (1996) J. Biol. Chem. 271, 32253-32259 |
| 18. | Jiang, B. H., Zheng, J. Z., Leung, S. W., Roe, R., and Semenza, G. L. (1997) J. Biol. Chem. 272, 19253-19260 |
| 19. | Pugh, C. W., O'Rourke, J. F., Nagao, M., Gleadle, J. M., and Ratcliffe, P. J. (1997) J. Biol. Chem. 272, 11205-11214 |
| 20. | Salceda, S., Beck, I., Srinivas, V., and Caro, J. (1997) Kidney Int. 51, 556-559 |
| 21. | Wang, G. L., Jiang, B. H., and Semenza, G. L. (1995) Biochem. Biophys. Res. Commun. 216, 669-675 |
| 22. | Chandel, N. S., Maltepe, E., Goldwasser, E., Mathieu, C. E., Simon, M. C., and Schumacker, P. T. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 11715-11720 |
| 23. | Chandel, N. S., McClintock, D. S., Feliciano, C. E., Wood, T. M., Melendez, J. A., Rodriguez, A. M., and Schumacker, P. T. (2000) J. Biol. Chem. 275, 25130-25138 |
| 24. | Minet, E., Arnould, T., Michel, G., Roland, I., Mottet, D., Raes, M., Remacle, J., and Michaels, C. (2000) FEBS Lett. 468, 53-58 |
| 25. | Richard, D. E., Berra, E., Gothie, E., Roux, D., and Pouyssegur, J. (1999) J. Biol. Chem. 274, 32631-32637 |
| 26. | Zundel, W., Schindler, C., Haas-kogan, D., Koong, A., Kraper, F., Chen, E., Gottschalk, A. R., Ryan, H. E., Johnson, R. S., Jefferson, A. B., Stokoe, D., and Giaccia, A. J. (2000) Genes Dev. 14, 391-396 |
| 27. | Exton, J. H. (1997) Physiol. Rev. 77, 303-320 |
| 28. | Nishizuka, Y. (1992) Science 258, 607-614 |
| 29. | Hug, H., and Sarre, T. F. (1993) Biochem. J. 291, 329-343 |
| 30. | Michell, R. H. (1997) Essays Biochem. 32, 31-47 |
| 31. | Olson, E. N., Burgess, R., and Staudinger, J. (1993) Cell Growth Differ. 4, 699-705 |
| 32. | Cross, M. J., Roberts, S., Ridley, A. J., Hodgkin, M. N., Stewart, A., Claesson-Welsh, L., and Wakelam, M. J. O. (1996) Curr. Biol. 6, 588-597 |
| 33. | Fukami, K., and Takenawa, T. (1992) J. Biol. Chem. 267, 10988-10993 |
| 34. | Ha, K. S., and Exton, J. H. (1993) J. Cell Biol. 123, 1789-1796 |
| 35. | Sakane, F., and Kanoh, H. (1997) Int. J. Biochem. Cell Biol. 29, 1139-1143 |
| 36. | Topham, M. K., and Prescott, S. M. (1999) J. Biol. Chem. 274, 11447-11450 |
| 37. | van Blitterswijk, W. J., and Houssa, B. (1999) Chem. Phys. Lipids. 98, 95-108 |
| 38. | Topham, M. K., Bunting, M., Zimmerman, G. A., McIntyre, T. M., Blackshear, P. J., and Prescott, S. M. (1998) Nature 394, 697-700 |
| 39. | Flores, I., Casaseca, T., Martinez, A. C., Kanoh, H., and Merida, I. (1996) J. Biol. Chem. 271, 10334-10340 |
| 40. | Flores, I., Jones, D. R., Cipres, A., Diaz-Flores, E., Sanjuan, M. A., and Merida, I. (1999) J. Immunol. 163, 708-714 |
| 41. | Jones, D. R., Flores, I., Diaz, E., Martinez, C., and Merida, I. (1998) FEBS Lett. 433, 23-27 |
| 42. | Jones, D. R., Pettitt, T. R., Sanjuan, M. A., Merida, I., and Wakelam, M. J. (1999) J. Biol. Chem. 274, 16846-16852 |
| 43. | Goldberg, M., Zhang, H. L., and Steinberg, S. F. (1997) J. Clin. Invest. 99, 55-61 |
| 44. | Yoshioka, K., Clejan, S., and Fisher, J. W. (1998) Life Sci. 63, 523-535 |
| 45. | Bligh, E., and Dyer, W. (1959) Can. J. Biochem. Physiol. 37, 911-917 |
| 46. | Flores, I., Martinez, A. C., Hannun, Y. A., and Merida, I. (1998) J. Immunol. 160, 3528-3533 |
| 47. | Bartlett, G. (1958) J. Biol. Chem. 234, 466-468 |
| 48. | Liu, Y., Cox, S. R., Morita, T., and Kourembanas, S. (1995) Circ. Res. 77, 638-643 |
| 49. | Sambrook, J., Fritsch, E., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. |
| 50. | Schreiber, E., Matthias, P., Muller, M. M., and Schaffner, W. (1989) Nucleic Acids Res. 17, 6419 |
| 51. | Wakelam, M. J. (1998) Biochim. Biophys Acta 1436, 117-126 |
| 52. | Edwards, Y. S., and Murray, A. W. (1995) Biochem. J. 308, 473-480 |
| 53. | Wiesener, M. S., Turley, H., Allen, W. E., Willam, C., Eckardt, K. U., Talks, K. L., Wood, S. M., Gatter, K. C., Harris, A. L., Pugh, C. W., Ratcliffe, P. J., and Maxwell, P. H. (1998) Blood 92, 2260-2268 |
| 54. | Gashler, A., and Sukhatme, V. P. (1995) Prog. Nucleic Acids Res. Mol Biol. 50, 191-224 |
| 55. | Jiang, B. H., Rue, E., Wang, G. L., Roe, R., and Semenza, G. L. (1996) J. Biol. Chem. 271, 17771-17778 |
| 56. | Mukhopadhyay, D., Tsiokas, L., Zhou, X. M., Foster, D., Brugge, J. S., and Sukhatme, V. P. (1995) Nature 375, 577-581 |
| 57. | Conrad, P. W., Rust, R. T., Han, J., Millhorn, D. E., and Beitner-Johnson, D. (1999) J. Biol. Chem. 274, 23570-23576 |
| 58. | Seko, Y., Takahashi, N., Tobe, K., Kadowaki, T., and Yazaki, Y. (1997) Biochem. Biophys. Res. Commun. 239, 840-844 |
| 59. | Gozal, E., Simakajornboon, N., Dausman, J. D., Xue, Y. D., Corti, M., El-Dahr, S. S., and Gozal, D. (1999) J. Neurochem. 73, 665-674 |
| 60. | Scott, P. H., Paul, A., Belham, C. M., Peacock, A. J., Wadsworth, R. M., Gould, G. W., Welsh, D., and Plevin, R. (1998) Am. J. Respir. Crit. Care Med. 158, 958-962 |
| 61. | Raymond, R., and Millhorn, D. (1997) Kidney Int. 51, 536-541 |
| 62. | Luberto, C., and Hannun, Y. A. (1998) J. Biol. Chem. 273, 14550-14559 |
| 63. | Jiang, Y., Sakane, F., Kanoh, H., and Walsh, J. P. (2000) Biochem. Pharmacol. 59, 763-772 |
| 64. | Buck, M., and Chojkier, M. (1996) EMBO J. 15, 1753-1765 |
| 65. | Goto, K., and Kondo, H. (1999) Chem. Phys. Lipids 98, 109-117 |
| 66. | Rizzo, M. A., Shome, K., Vasudevan, C., Stolz, D. B., Sung, T. C., Frohman, M. A., Watkins, S. C., and Romero, G. (1999) J. Biol. Chem. 274, 1131-1139 |
| 67. | Jenkins, G. H., Fisette, P. L., and Anderson, R. A. (1994) J. Biol. Chem. 269, 11547-11554 |
| 68. | Kishikawa, K., Chalfant, C. E., Perry, D. K., Bielawska, A., and Hannun, Y. A. (1999) J. Biol. Chem. 274, 21335-21341 |
| 69. | Ahmed, S., Kozma, R., Lee, J., Monfries, C., Harden, N., and Lim, L. (1991) Biochem. J. 280, 233-241 |
| 70. | Limatola, C., Schaap, D., Moolenaar, W. H., and van Blitterswijk, W. J. (1994) Biochem. J. 304, 1001-1008 |
| 71. | Erickson, R. W., Langel-Peveri, P., Traynor-Kaplan, A. E., Heyworth, P. G., and Curnutte, J. T. (1999) J. Biol. Chem. 274, 22243-22250 |
| 72. | McPhail, L. C., Waite, K. A., Regier, D. S., Nixon, J. B., Qualliotine-Mann, D., Zhang, W. X., Wallin, R., and Sergeant, S. (1999) Biochim. Biophys. Acta 1439, 277-290 |
| 73. | Frank, C., Keilhack, H., Opitz, F., Zschornig, O., and Bohmer, F. D. (1999) Biochemistry 38, 11993-12002 |
| 74. | Sutter, C. H., Laughner, E., and Semenza, G. L. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 4748-4753 |
| 75. | Ema, M., Hirota, K., Mimura, J., Abe, H., Yodoi, J., Sogawa, K., Poellinger, L., and Fujii-Kuriyama, Y. (1999) EMBO J. 18, 1905-1914 |
| 76. | Plevin, R., Kellock, N. A., Wakelam, M. J., and Wadsworth, R. (1994) Br. J. Pharmacol. 112, 311-315 |
This article has been cited by other articles:
![]() |
E. L. Bell, T. A. Klimova, J. Eisenbart, C. T. Moraes, M. P. Murphy, G.R. S. Budinger, and N. S. Chandel The Qo site of the mitochondrial complex III is required for the transduction of hypoxic signaling via reactive oxygen species production J. Cell Biol., July 30, 2007; 177(6): 1029 - 1036. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Fradette, J. Batonga, S. Teng, M. Piquette-Miller, and P. du Souich Animal Models of Acute Moderate Hypoxia Are Associated with a Down-Regulation of CYP1A1, 1A2, 2B4, 2C5, and 2C16 and Up-Regulation of CYP3A6 and P-glycoprotein in Liver Drug Metab. Dispos., May 1, 2007; 35(5): 765 - 771. [Abstract] [Full Text] [PDF] |
||||
![]() |
|