JBC PeproTech; Our Business is Cytokines!

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M008696200 on December 4, 2000

J. Biol. Chem., Vol. 276, Issue 13, 9662-9669, March 30, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/13/9662    most recent
M008696200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Körner, K.
Right arrow Articles by Müller, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Körner, K.
Right arrow Articles by Müller, R.

Cell Cycle Regulation of the Murine cdc25B Promoter

ESSENTIAL ROLE FOR NUCLEAR FACTOR-Y AND A PROXIMAL REPRESSOR ELEMENT*

Kathrin Körner, Valérie Jérôme, Thorsten Schmidt, and Rolf MüllerDagger

From the Institute of Molecular Biology and Tumor Research (IMT), Philipps University, Emil-Mannkopff-Strasse 2, 35033 Marburg, Germany

Received for publication, September 22, 2000, and in revised form, November 2, 2000


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Expression of the cdc25B gene is up-regulated late during cell cycle progression (S/G2). We have cloned the murine cdc25B promoter to identify elements involved in transcriptional regulation. A detailed structure-function analysis led to the identification of several elements that are located upstream of a canonical Inr motif at the site of transcription initiation and are involved in transcriptional activation and regulation. Activation of the promoter is largely mediated by NF-Y and Sp1/3 interacting with one and four proximal binding sites, respectively. In addition, NF-Y plays an essential role in cell cycle regulation in conjunction with a repressor element (cell cycle-regulated repressor) located ~30 nucleotides upstream of the putative Inr element and overlapping a consensus TATA motif. The cell cycle-regulated repressor is unrelated to the previously described cell cycle-regulated repressor elements. Taken together, our observations suggest that expression of the cdc25B gene is controlled through a novel mechanism of cell cycle-regulated transcription.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell cycle progression in mammalian cells is associated with the phase-specific transcription of defined sets of genes (1). Such periodically expressed genes frequently encode proteins that either directly control cell cycle progression or function in periodically occurring metabolic processes, such as nucleotide and DNA biosynthesis. A major regulator of the cell cycle-dependent expression of these genes is the transcription factor E2F (2-4). Transcriptionally inactive complexes of E2F with pocket proteins of the Retinoblastoma protein (prb) family assemble in Go/early G1, but during cell cycle progression these complexes dissociate, and the release of transcriptionally active "free E2F" leads to the activation of E2F-responsive genes. It has become clear, however, that E2F can also act either as an active repressor, which, at least in part, appears to be due to the retinoblastoma protein-mediated recruitment of histone deacetylases. The first example of a gene that is repressed by E2F is the mouse B-myb gene (5), but a number of other genes repressed via E2F sites in their promoters have been identified, for example E2F-1 (6, 7), orc-1 (8), cdc 6 (9-11), cdc25A (12, 13), and p107 (14). Interestingly, structure-function analysis of the B-myb promoter identified an E2F binding site close to the transcription start sites, which is necessary but not sufficient for cell cycle regulation (15, 16). Mutational analyses showed that an adjacent element, termed Bmyb-CHR,1 is indispensable for repression and acts as a corepressor element together with the E2F-binding site.

cdc25C exemplifies a group of cell cycle genes whose transcription is up-regulated later than that of B-myb, i.e. in S/G2. cdc25 was originally discovered in Schizosaccharomyces pombe as a regulator of the G2 to M progression (17, 18). Higher eukaryotes contain at least three genes with a high degree of similarity to cdc25, encoding the Cdc25A, Cdc25B, and Cdc25C protein phosphatases (19-28). The Cdc25C phosphatase activates the Cdc2/cyclin B complex and thereby enables the entry into mitosis (20, 24, 28-30). Cdc25A appears to play a role in regulating entry into S phase (13, 26, 31), whereas Cdc25B is required for the G2 to M progression (32-36).

For the cdc25C promoter, repression of upstream activators via a bipartite site, consisting of the "cell cycle-dependent element" and the "cell cycle genes homology region" (CHR), has been established as the major regulatory mechanism (37, 38). As shown by genomic footprinting, both elements are cooperatively bound in a periodic fashion by a repressor that has been designated CDF-1 (37, 39). A similar mechanism seems to be of global relevance, because a number of other similarly regulated cell cycle genes, such as cyclin A (37, 40), cdc2 (37, 41), CENP-A (42), polo-like kinase (43), and survivin (44), have been identified. Recently, a factor (CHF) interacting with the CHR in the cyclin A promoter has been described (45).

Cell cycle regulation of cdc25B resembles that of cdc25C, which is in agreement with its function at the final stages of the cell cycle (32-36). The cdc25B gene is of interest also in view of its possible involvement in human cancer (19, 46-48), and its oncogenic potential in transgenic mice (49, 50). However, to date, the promoter of the cdc25B gene has not been analyzed, and consequently the mechanism controlling the cell cycle-regulated expression is unknown. In the present study, we have addressed this question. We have cloned the murine cdc25B promoter and have identified regulatory elements and interacting transcription factors required for cdc25B transcription and contributing to its regulation of expression during the cell cycle.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture-- The murine cell line NIH3T3 (kindly provided by R. Treisman, ICRF, London) was maintained at 37 °C in 5% CO2 in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, penicillin, and streptomycin.

Transfections and Luciferase Assays-- Cells were plated on 35-mm (diameter) tissue culture plates at a density producing 60-80% confluence at the time of the transfection and transfected using the cationic lipid DOTAP as described by the manufacturer (Roche Molecular Biochemicals). For synchronization in G0, cells were maintained in serum-free medium for 3 days. Stimulation was carried out for the indicated times with 10% fetal calf serum. Luciferase activity was determined as published elsewhere (38, 51).

Library Screening-- The murine genomic lambda -Fix phage library 129 FVJ (Stratagene) was screened with a 69-base pair oligonucleotide (probe 1, 5'-TCTAGCTAGCCTTTGCCCGCCCCGCCACGATGGAGGTACCCCTGCAGAAGTCTGCGCCGGGTTCAGCTC-3') annealing to the 5'-end of the murine cdc25B cDNA (52). Three phage clones were isolated, and the DNA was amplified and further mapped in the 3' direction with probe 2 (5'-GGTCATTCAAAATGAGCAGTTACCATAAAACGCTTCCGATCCTTACCAGTGAGGCTTGCTGGAACACACTCCGGTGCTG-3') and probe 3 (5'-GTTAAAGAAGCATTGTTATTATGGGGAGGGGGGAGCAACCTCTGGGTTCAGAATCTACATATGCTGGAAGGCCCCAATGA-3'). Experimental details have previously been described (51). A 4.6-kilobase fragment containing the promoter region and the noncoding sequence was isolated and subcloned in the EcoRI/SalI sites of the pBluescriptIISK vector (Stratagene).

Primer Extension Analysis-- 32P-labeled primer (10 pmol) and total cellular RNA, isolated from normal cycling NIH3T3 cells, were denatured for 10 min at 65 °C and then incubated for 30 min at 37 °C. Primer extension was carried out in a total volume of 50 µl containing 50 mM Tris, pH 8.3, 75 mM KCl, 10 mM dithiothreitol, 3 mM MgCl2, 400 µM dNTPs, 2 units of RNasin, and 400 units of Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.). After incubation for 1 h at 37 °C, the reaction was stopped with EDTA followed by RNase treatment. The DNA was precipitated, redissolved, and separated by electrophoresis on a 6% acrylamide, 7 M urea gel.

Reverse Transcriptase PCR-- For cDNA synthesis (53), 4 µg of total RNA were annealed to 1 µg of oligo(dT) and incubated with 200 units of Moloney murine leukemia virus reverse transcriptase for 1 h at 37 °C in a final volume of 20 µl. One-tenth of the reaction mixture was amplified by 25 cycles of PCR in the presence of 0.5 µCi of [alpha -32P]dCTP (38, 54). The experimental strategy included the following precautions. (i) The number of PCR cycles was kept low to obtain a linear amplification of the PCR products, which was possible by the incorporation of radioactive precursor nucleotides and evaluation by autoradiography and beta -radiation scanning. (ii) All results were standardized using the signal obtained with glyceraldehyde-3-phosphate dehydrogenase, whose expression is independent of cell proliferation. (iii) All experiments were performed with at least two independent cDNA preparations.

cdc25B Promoter Constructs-- Primers carrying restriction sites were used for PCR with pBIISKcdc25B as the template to generate a series of 5' terminal deletions with compatible ends for cloning as KpnI/NheI fragments into the multiple cloning region of the promoterless luciferase vector pGL3-basic (Promega, Madison, WI). All PCR-amplified fragments were verified by DNA sequencing. 1-7-base pair mutations were introduced into the regions of the cdc25B promoter spanning -950 to +167 or -223 to +167 using PCR-directed mutagenesis (37). Primers carrying the mutations (see below) and a second set of primers for subcloning (5'cdc25B, 5'cdc25B223, and 3'cdc25B) were designed. The first PCR reaction (54) was performed with the oligonucleotides (i) 5'cdc25B and 3'-primer carrying the mutation and (ii) 3'cdc25B and 5'-primer carrying the mutation. The resulting products were purified (QIAquick Spin PCR purification; Qiagen) and amplified in a second PCR reaction using 5'cdc25B or 5'cdc25B223 and 3'cdc25B as primers. Site-directed mutagenesis of the first E-box (-947) (mutated bases underlined) was generated by PCR with the primer 5'mE1 (5'-AGCTGGTACCTTCTCAAGCTTTCCCACTAGGTCCTTCCCAG-3') and the primer cdc25B NheI (see below). The resulting fragments carrying the mutations were cloned into the KpnI/NheI sites of the promoterless luciferase vector pGL3-basic (Promega) and verified by DNA sequencing.

The following oligonucleotides were used as primers: cdc25B KpnI, 5'-AGCTGGTACCAGTTCTCAACTGCCCACTAG-3'; cdc25B223 KpnI, 5'-AGCTGGTACCATGGGAGCGGGCGGGGCCGG-3'; cdc25B NheI, 5'-GGGCAAAGGCTAGCTAGAGGG-3'; 5'mE2, 5'-AAACAGACTCAAGCTTTCAAGGTGATTAGGTCATTAGA-3'; 3'mE2, 5'-TAATCACCTTGAAAGCTTGAGTCTGTTTTCCTGG-3'; 5'mNF-Y, 5'-CGCCCCCATTAATGGCGTCTGGCGGCGCTGC-3'; 3'mNF-Y, 5'-CAGACGCCATTAATGGGGGCGCCGGTTCCGG-3'; 5'2mCCRR, 5'-GCTGTTATTTTTCTCATATATAAGGAGGTGGAGGTGG-3'; 3'2mCCRR, 5'-CCTCCTTATATATGAGAAAAATAACAGCGGCAGCGCC-3'; 5'mG30G, 5'-GCTGTTATTTTTCGAAGATATAAGGAGGTGGAGGTGG-3'; 3'mG30G, 5'-CCTCCTTATATCTTCGAAAAATAACAGCGGCAGCGCC-3'; 5'mTATA, 5'-TTTTCGAACGATGTTGGAGGTGGAGGTGGCAGC-3'; 3'mTATA, 5'-ACCTCCAACATCGTTCGAAAAATAACAGCGGCAG-3'.

Electrophoretic Mobility Shift Assays-- Preparation of nuclear extracts and electrophoretic mobility shift assays (EMSAs) were performed as described (55, 56) using poly(dI·dC) or poly(dA·dT) for CCRR gel shifts or poly(dI·dC) for Sp1 and NF-Y gel shifts as nonspecific competitors. 1-2 µl of HeLa or 4 to 6 µl of NIH3T3 nuclear extracts were incubated with ~0.5 pmol of radiolabeled probe in the suitable binding buffer (NF-Y EMSA: 10 mM Hepes (pH 7.8), 50 mM K-glutamate, 5 mM MgCl2, 1 mM dithiothreitol, 5% (v/v) glycerol, 1 mM EDTA (pH 8.0), 0.5 µg/µl poly(dI·dC); Sp1 EMSA: 20 mM Tris·Cl (pH 7.5), 0.1 mM EDTA, 0.5 mM MgCl2, 10 mM KCl, 0.2 mM ZnSO4, 10% glycerol, 0.4 µg/µl poly(dI·dC); CCRR EMSA: 100 mM Tris·Cl (pH 7.9), 30% glycerol, 0.4 mM EDTA (pH 8.0), 2 mM dithiothreitol, 0.5 µg/µl poly(dA·dT)). EMSA reactions for Sp1/3 and NF-Y binding were performed at room temperature for 15 min followed by gel electrophoresis at 4 °C using 4% polyacrylamide gels. Supershifts were carried out by pre-incubating EMSA reactions on ice for 20 min with 1 µl of the indicated antibodies prior to addition of the radiolabeled probe. For detection of other protein-DNA complexes, EMSA reactions were carried out on ice for 15 min. Sp1 and Sp3 antibodies were obtained from G. Suske (IMT, Marburg, Germany). The NF-Y antibody was obtained from R. Mantovani (Milan). The following oligonucleotides were used as probes and/or competitors: cdc25B NF-Y, 5'-GGAACCGGCGCCCCCATTGGTCG-3'; bona fide NF-Y, 5'-GATTTTTTCCTGATTGGTTAAAAGT-3'; mcdc25B NF-Y (MY), 5'-GGAACCGGCGCCCCCATTAATGG-3'; GT box, 5'-AGCTTCCTTGCCACACCCCTGCAG-3'; -103/-80, 5'-GTTGGTCCCGCCCTCCCGGGAAC-3'; -120/-97, 5'-GTCAGCCTCAGCCCCGCCCTTGGT-3'; -209/-187, 5'-GCCGGGGCGGTACGTGTGGGG-3'; -226/ -206, 5'-GCAATGGGAGCGGGCGGGGC-3'; -64/-29, 5'-GCGTCTGG- CGGCGCTGCCGCTGTTATTTTTCGAATA; -64/-20, 5'-GCGTCTGGCGGCGCTGCCGCTGTTATTTTTCGAATATATAAGGAG-3'; -64/-20 3mCCRR, 5'-GCGTCTGGCGGCGCTGCCGCTGTTATTTTTATCATATATAAGGAG-3'; ns, 5'-GAATAAAGTTTTACTGATTTTTGAGACA-3'. Shown are the top strand oligonucleotides. For radioactive labeling by filling in with [32P]dCTP, an additional G was added to the 5'-end of the bottom strand oligonucleotides. Underlined letters represent mutated bases.

Genomic Footprinting-- For genomic footprinting (38, 57), NIH3T3 cells were maintained in serum-free medium for 3 days for synchronization in G0, and stimulation was carried out for the indicated times with 10% fetal calf serum. The cells were then treated with 0.2% DMS for 2 min. After DMS treatment, cells were washed three times with cold phosphate-buffered saline, and the DNA was isolated. As reference, NIH3T3 genomic DNA was methylated in vitro with 0.2% DMS for 10-30 s. Piperidine cleavage was performed as described. Genomic DNA (3 µg) was used for ligation-mediated PCR as described. The Stoffel fragment of Taq polymerase (PerkinElmer Life Sciences) was used instead of the native enzyme. Samples were phenol-extracted and ethanol-precipitated before primer extension with 32P-labeled primers. The following oligonucleotides were used as primers: first primer (Tm = 52 °C), 5'-d(AGTCACCCTAAGAAGCG)-3'; second primer (Tm = 74 °C), 5'-d(CGAGCAGAAGTAGCTGGTCCAGC)-3'; third primer (Tm = 88 °C), 5'-d(CTGGTCCAGCCTCAGCCTCAGCCCC)-3'.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cloning of the Mouse cdc25B Promoter-- A mouse embryo genomic DNA library was screened with an oligonucleotide representing the mouse cdc25B coding region. Several recombinant phage spanning ~30 kilobases of genomic DNA were isolated and mapped (Fig. 1A). One phage clone (designated III in Fig. 1A) was used to subclone a 1.1-kilobase fragment representing the sequence 5' to the translation start codon. This fragment (B950) was linked to the firefly luciferase gene and transfected into NIH3T3 cells to test whether the isolated promoter fragment was functional in a transient expression assay. As shown in Fig. 2A, B950 was cell cycle-regulated after serum stimulation of cells that had been synchronized in G0. Thus, hardly any luciferase activity was detectable in G0 cells and at early stages after serum stimulation, but there was an ~4-fold induction at 18 h after serum stimulation, peaking at 22 h (8-fold induction). At this stage, most cells had entered or passed through G2 (data not shown). In addition, we determined the expression profile of the endogenous cdc25B gene in the same cell system and found a similar time course (Fig. 2B; cdc2 induction shown for comparison). These data indicate that the isolated promoter fragment is sufficient to confer on a luciferase reporter gene a pattern of cell cycle regulation that mirrors its physiological regulation.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1.   A, genomic structure of the murine cdc25B locus. The map was assembled on the basis of the three analyzed phage clones shown below the map. The subcloned fragment used for promoter analysis is depicted at the bottom. kb, kilobases. B, schematic of the cdc25B promoter showing putative protein binding sites. E, E-box; Sp1, binding site for Sp1 family members; E2F, E2F site; NFY, NF-Y site (reverse CCAAT box); TATA, TATA box). C, nucleotide sequence of the proximal promoter region. The major site of transcription initiation was designated position +1 (see also Fig. 3). Functional element (Sp1/3 and NF-Y sites) motifs identified in the present study, as well as the TATA and Inr, are highlighted.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 2.   Cell cycle regulation of cdc25B transcription. A, time course of luciferase activity in G0-synchronized NIH3T3 cells after transfection of the B950 construct and serum stimulation. B, kinetics of endogenous cdc25B mRNA expression in serum-stimulated NIH3T3 cells. The analysis was performed by reverse transcriptase-PCR. For comparison, the induction of cdc2 mRNA was also measured.

Structure of the Mouse cdc25B Promoter-- The nucleotide sequence of B950 was determined for both strands (GenBankTM accession number AJ296019). The most relevant part of the sequence, as determined below, is shown in Fig. 1B. Inspection of the sequence revealed a match with a canonical TATA box motif 190 nucleotides 5' to the ATG (Fig. 1C). A single transcription start site cluster was identified by primer extension analysis ~30 nucleotides downstream of this motif and overlapping with an Initiator (Inr) consensus sequence (Figs. 1C and 3). Although we cannot formally rule out the formal possibility that the cdc25B gene contains additional initiation sites outside the region analyzed, these observations strongly suggest that a TATA box and/or an Inr element direct the initiation of transcription and define the transcriptional start site. The A within the Inr motif was therefore designated position +1 (see Fig. 1C). A search for potential regulatory sites revealed the presence of additional putative transcription factor binding sites: two E boxes (-947 and -800), three E2F sites (-232, -58, and -50), five Sp1 sites (-570, -217, -200, -105, and -95), and an NF-Y binding site (-70).


View larger version (84K):
[in this window]
[in a new window]
 
Fig. 3.   Mapping of the 5' end of cdc25B mRNA by primer extension in normally cycling NIH3T3 cells. As a negative control, yeast tRNA was used. A sequencing reaction was run alongside (lanes labeled G, A, T, C) to be able to accurately determine the nucleotide positions.

Delineation of Functional Regions in the Mouse cdc25B Promoter by Truncation Analysis-- To identify functionally relevant regions in cdc25B promoter, a series of terminal truncations was generated from the B950 construct (-950/+167) and analyzed for expression in G0 versus normally cycling cells (N) (Fig. 4). This analysis led to the following conclusions. (i) The terminal deletion of 10 nucleotides, which removes a potential E box led to an increase in transcriptional activity of ~40% but had no effect on cell cycle regulation. Truncation of the adjacent fragment spanning positions -980 to -768, which harbors another potential E box, had no detectable effect on transcriptional activity or cell cycle regulation. (ii) The region from -340 to -250 seems to have a negative effect on transcriptional activity. However, because no putative binding sites could be identified in this region, and there was no effect on cell cycle regulation, we did not pursue this finding. (iii) Further deletion of a fragment spanning nucleotides -250 to -223 and harboring a potential E2F site had no detectable effect. (iv) Truncation of a fragment spanning positions -223 to -180, which contains two potential Sp1 sites, led to a clear reduction in transcriptional activity. This was further decreased by truncation of the adjacent region spanning nucleotides -180 to -87, which harbors two more potential Sp1 sites. The loss of these four potential Sp1 sites led to a total decrease in transcriptional activity of 60%, with only a marginal effect on cell cycle regulation. (v) The terminal deletion of an additional 20 nucleotides resulted in a further drop in transcriptional activity but also led to a clear decrease in cell cycle regulation, indicating that this promoter region, which harbors a potential NF-Y site, is of particular functional relevance. (vi) Further truncations had no additional effect on cell cycle regulation, presumably because these constructs all lacked the NF-Y site.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4.   Delineation of functionally important regions in the cdc25B promoter. Terminally truncated cdc25B promoter-luciferase constructs were analyzed in transient expression assays in both quiescent (G0) and normally growing (N) NIH3T3 cells. Values are given as relative luciferase activities normalized to 100 for the longest promoter construct (-950) in normally growing cells.

Identification of Functional Upstream Elements in the Mouse cdc25B Promoter-- To confirm and extend the findings obtained by promoter truncation, the putative E boxes and NF-Y binding site were altered by point mutations, and the functional consequences were analyzed in transient transfection assays. The proximal potential E2F sites were not included in this analysis because no binding of E2F-1, E2F-3, or E2F-4 to the cdc25B promoter could be detected in EMSA using either normal NIH3T3 cells or retrovirally transduced cells overexpressing the respective E2F protein (kindly provided by R. Bernards, Amsterdam), although clear binding was seen in the same assay with a bona fide E2F site from the B-myb promoter (5, 15) (data not shown).

The mutation analyses yielded the following results (Fig. 5). (i) Mutation of the most distal E box led to a slight increase in promoter activity of ~36% but did not show any influence on cell cycle regulation. Mutation of the second E box had only a very weak effect, and mutation of both E boxes had the same effect as mutation of the most distal one alone. These data are in line with the truncation analysis described above and indicate that the E boxes are not crucial with respect to cell cycle regulation. This promoter region was therefore not further investigated. (ii) Point mutations in the NF-Y binding site led to a drastic loss of both transcriptional activity (~73%) and cell cycle regulation (57%). This result is in perfect agreement with the deletion analysis and confirms the importance of the NF-Y site both for transcriptional activity and cell cycle regulation.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 5.   Identification of functionally important elements in the cdc25B promoter. cdc25B promoter-luciferase constructs with point mutations in defined elements (E boxes, NF-Y site) were analyzed in transient expression assays in both quiescent (G0) and normally growing (N) NIH3T3 cells. Values are given as relative luciferase activities normalized to 100 for the wild-type construct (-950) in normally growing cells. N/G0 gives the factor of cell cycle regulation. Sites are labeled as in Fig. 1B.

Interaction of NF-Y and Sp1/Sp3 with the Mouse cdc25B Upstream Activating Sequence-- To investigate protein interactions at the potential NF-Y site in the cdc25B promoter, we performed EMSAs with nuclear extracts from normally cycling NIH3T3 cells. A synthetic oligonucleotide encompassing this element was used as a probe, and competitors representing either the same site (self-competition), a bona fide NF-Y site from the MHC class II promoter (Ealpha -Y) (58), an Sp1 binding site (GT box), or a mutated cdc25B element (MY) were also used. As shown in Fig. 6, only the former two oligonucleotides were able to prevent the formation of a DNA-protein complex. Neither the GT box nor the mutated cdc25B element showed any competition. Likewise, no effect on complex formation was seen when binding sites for other CAAT box-binding factors, i.e. C/EBP or NF-I/CTF (59), were used (data not shown). To obtain further evidence that NF-Y interacts with the cdc25B promoter, we analyzed the effect of a monoclonal antibody (alpha NF-Y A) against the A subunit of NF-Y (kindly provided by D. Mathis) (58). This antibody led to the expected supershift of the observed complex (58, 59). Taken together, these data clearly suggest that the protein complex interacting with the cdc25B site is NF-Y.


View larger version (60K):
[in this window]
[in a new window]
 
Fig. 6.   Binding of NF-Y to the murine cdc25B promoter. A fragment encompassing positions -85 to -63 was used as a probe in EMSA using NIH3T3 nuclear extract. The assay was performed in the presence and absence of antibodies specific for the A subunit of NF-Y (alpha NF-Y A). No effect was seen with irrelevant anti-serum (data not shown). Competitors were identical to the respective probes (self-competition) or represented a bona fide NF-Y site (MHC), a GT box, or the mutated cdc25B NF-Y site (MY).

Similar experiments were performed to analyze protein binding to the four functionally relevant Sp1 sites at positions -217, -200, -105, and -95. EMSAs were performed using four different probes representing these sites in conjunction with a specific (self) or nonspecific competitor (unrelated sequence) and antibodies specific for Sp1 or Sp3 (kindly provided by G. Suske, IMT, Marburg, Germany) (60, 61). The data in Fig. 7 clearly show that all four sites specifically interact with Sp1 and Sp3, leading to the formation of the expected complexes (60).


View larger version (98K):
[in this window]
[in a new window]
 
Fig. 7.   Binding of Sp1 and Sp3 to four elements of the murine cdc25B promoter. Fragments encompassing positions -103 to -80, -120 to -97, -209 to -187, and -226 to -206 were used as probes in EMSAs using NIH3T3 nuclear extract. The assay was performed in the presence and absence of antibodies specific for Sp1 (alpha Sp1) or Sp3 (alpha Sp3). The respective pre-immune sera did not show any effect (data not shown). Competitors (comp.) were identical to the respective probes (s, self-competition) or represented a nonspecific sequence (ns).

Identification of a Proximal Repressor Element-- Finally, we scanned the proximal promoter for the presence of additional sites that might play a role in cell cycle regulation. Toward this end, we introduced point mutations into this region in the context of an otherwise intact promoter fragment (-223/+167 construct). Construct 2mCCRR harbors two mutations at positions -32 and -33, whereas construct m30G is mutated at position -30, i.e. the first nucleotide of the TATA motif. As shown in Fig. 8, both these mutations led to a 3- to 4-fold increased activity in G0 cells, resulting in a 50-60% loss in cell cycle regulation. These results indicate that this region of the promoter functions as a cell cycle-regulated repressor. Previous studies have shown that other S/G2 genes are regulated by two contiguous repressor elements, the cell cycle-dependent element and CHR, whose function is dependent on an exact spacing relative to each other (37, 39). Because the sequence surrounding the repressor element in the cdc25B promoter (TGTTATTTTTCGAATATAT; the approximate position of the repressor element is underlined) only bears a vague resemblance to a cell cycle-dependent element-CHR module (cdc25C: CT GGCGGAAGGTTTGAA; the cell cycle-dependent element and CHR are underlined), it can be concluded that these sequences are functionally unrelated. We refer to this element in the cdc25B promoter as "cell cycle-regulated repressor" (CCRR).


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 8.   Functional analysis of the cdc25B promoter region harboring the CCRR. cdc25B promoter-luciferase constructs with mutations in the CCRR were analyzed in transient expression assays in both quiescent (G0) and normally growing (N) NIH3T3 cells. Nucleotide positions are indicated at the top. Mutated nucleotides are underlined. The dotted line shows the approximate position of the repressor element (CCRR). -223 represents the wild-type (WT) promoter construct. Error bars indicate standard deviations.

Protein Interaction with the CCRR-- Finally, we sought to obtain direct evidence for the existence of a protein complex interacting with the CCRR. For this purpose, we performed EMSAs with a fragment containing nucleotides -64 to -20 of the murine cdc25B promoter as a probe and NIH3T3 nuclear extract. As shown in Fig. 9, the most slowly migrating complex specifically interacted with the CCRR. Whereas self-competition was highly efficient, no competition was seen with the same oligonucleotide harboring a mutation in the region of the CCRR or a 5' truncation of nine nucleotides. Likewise, no competition was observed with an unrelated sequence. In addition, the binding activity was not competed by B-myb or cdc25C CHR sequences (data not shown), which confirms the conclusion that the CCRR represents a functionally unrelated repressor element.


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 9.   Identification of a CCRR binding activity. A fragment encompassing positions -64 to -20 of the murine cdc25B promoter was used as a probe for EMSA using NIH3T3 nuclear extract. Four different competitors were used: s, identical to the probe; -64/-20 3mCCRR, same as probe but with three mutations in the region of the CCRE (at -32, -33, and -34); -64/-29, same as probe but lacking nine nucleotides at the 5' end; ns, nonspecific sequence. The uppermost band represents a specific CCRR-protein complex. The nature of the other complexes is unclear, but on the basis of the competition data these appear to be nonspecific.

In Vivo Protection of the CCRR Region-- To obtain further evidence that the CCRR represents a protein binding site, we performed genomic DMS footprinting of the region surrounding the transcriptional start site in NIH3T3 cells. Fig. 10 shows a typical in vivo footprint of the bottom strand. It is obvious that in the region of the CCRE multiple residues were protected: A at -28, A at -30, and G at -34, the two former nucleotides being part of the TATA motif.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 10.   In vivo footprint of the cdc25B promoter region around the transcriptional start site. Growing NIH3T3 cells were treated with DMS, and protected purine bases were detected by ligation-mediated PCR (bottom strand). Numbers on the left indicate nucleotide positions relative to the start site of transcription (+1). Protected nucleotides can be seen in the region of the CCRR overlapping the TATA motif.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The data reported in the present study suggest that the cdc25B promoter is controlled by a novel mechanism of cell cycle-regulated transcription, which involves both an NF-Y binding site and the CCRR repressor element. Neither of the two binding sites is sufficient to confer cell cycle regulation on its own, pointing to a functional interplay between the putative repressor interacting with NF-Y. Although NF-Y has been shown for a number of other promoters to play a crucial role in cell cycle-regulated transcription (37, 59, 62-65), its precise role has not been determined. The data presented in the present study point to a dual function of NF-Y in the context of the cdc25B promoter. NF-Y is crucial not only for promoter activation, which might be related to its described ability to recruit other transcription factors to a promoter (66), but also for cell cycle regulation. This is reminiscent of the situation described for the cdc25C promoter, where NF-Y cooperates with the cell cycle-regulated repressor CDF-1 (59). In this case, CDF-1 presumably functions by specifically repressing NF-Y-mediated activation, because the repressor function of CDF-1 is dependent on an active promoter and is specific for a small subset of transcriptional activators (67). It is possible that an analogous situation exists in the case of the cdc25B promoter, but the precise underlying mechanism remains to be investigated.

Another interesting aspect relates to the fact that the CCRE apparently overlaps the TATA motif. Although there is no formal proof at present that the putative TATA element is functional in the cdc25B promoter, its sequence (TATATAA) exactly fits that of a canonical TATA box, and its spacing relative to the transcriptional start site and the putative Inr element is within the expected range. This raises the intriguing possibility that a CCRE-interacting repressor functions by interfering with the basal transcriptional machinery, e.g. by inhibiting the assembly of a functional initiation complex. Future analyses will have to address these mechanistic questions in detail. The present study provides the basis for such studies.

    ACKNOWLEDGEMENTS

-We are grateful to R. Bernards for retrovirally transduced cells overexpressing specific E2F family members and to Dr. M. Krause for synthesis of oligonucleotides.

    FOOTNOTES

* This work was supported by grants from the Deutsche Forschungsgemeinschaft (SFB397/C1, Mu601/9-2).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ296019.

Dagger To whom correspondence and requests for reprints should be addressed: Institut für Molekularbiologie und Tumorforschung (IMT), Emil-Mannkopff-Strasse 2, 35033 Marburg, Germany. Tel.: 49 6421 28 66236; Fax: 49 6421 28 68923; E-mail: mueller@imt.uni-marburg.de.

Published, JBC Papers in Press, December 4, 2000, DOI 10.1074/jbc.M008696200

    ABBREVIATIONS

The abbreviations used are: CHR, cell cycle genes homology region; CDF, cell cycle-dependent element-binding factor; PCR, polymerase chain reaction; EMSA, electrophoretic mobility shift assay; CCRR, cell cycle-regulated repressor; NF-Y, nuclear factor-Y; DMS, dimethyl sulfate; Inr, Initiator; CCRE, cell cycle-regulated represser element.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Müller, R. (1995) Trends Genet. 11, 173-178
2. Brehm, A., Miska, E., Reid, J., Bannister, A., and Kouzarides, T. (1999) Br. J. Cancer 80 Suppl. 1, 38-41
3. Lavia, P., and Jansen-Durr, P. (1999) Bioessays 21, 221-230
4. Muller, H., and Helin, K. (2000) Biochim. Biophys. Acta 1470, M1-M12
5. Lam, E. W., and Watson, R. J. (1993) EMBO J. 12, 2705-2713
6. Hsiao, K.-M., McMahon, S. L., and Farnham, P. J. (1994) Genes Dev. 8, 1526-1537
7. Johnson, D. G., Ohtani, K., and Nevins, J. R. (1994) Genes Dev. 8, 1514-1525
8. Ohtani, K., DeGregori, J., Leone, G., Herendeen, D. R., Kelly, T., and Nevins, J. R. (1996) Mol. Cell. Biol. 16, 6977-6984
9. Yan, Z., DeGregori, J., Shohet, R., Leone, G., Stillman, B., Nevins, J. R., and Williams, R. S. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 3603-3608
10. Hateboer, G., Wobst, A., Petersen, B. O., Le Cam, L., Vigo, E., Sardet, C., and Helin, K. (1998) Mol. Cell. Biol. 18, 6679-6697
11. Ohtani, K., Tsujimoto, A., Ikeda, M., and Nakamura, M. (1998) Oncogene 17, 1777-1785
12. Chen, X., and Prywes, R. (1999) Mol. Cell. Biol. 19, 4695-4702
13. Vigo, E., Muller, H., Prosperini, E., Hateboer, G., Cartwright, P., Moroni, M. C., and Helin, K. (1999) Mol. Cell. Biol. 19, 6379-6395
14. Zhu, L., Zhu, L., Xie, E., and Chang, L.-S. (1995) Mol. Cell. Biol. 15, 3552-3562
15. Liu, N., Lucibello, F. C., Zwicker, J., Engeland, K., and Müller, R. (1996) Nucleic Acids Res. 24, 2905-2910
16. Bennett, J. D., Farlie, P. G., and Watson, R. J. (1996) Oncogene 13, 1073-1082
17. Russell, P., and Nurse, P. (1986) Cell 45, 145-153
18. Millar, J. B. A., and Russell, P. (1992) Cell 68, 407-410
19. Nagata, A., Igarashi, M., Jinno, S., Suto, K., and Okayama, H. (1991) New Biol. 3, 959-968
20. Millar, J. B. A., McGowan, C. H., Lenaers, G., Jones, R., and Russell, P. (1991) EMBO J. 10, 4301-4309
21. Millar, J. B. A., Blevitt, J., Gerace, L., Sadu, K., Featherstone, C., and Russell, P. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 10500-10504
22. Lee, M. S., Ogg, S., Xu, M., Parker, L., Donoghue, D., Maller, J., and Piwnica-Worms, H. (1992) Mol. Biol. Cell 3, 73-84
23. Kumagai, A., and Dunphy, W. G. (1991) Cell 64, 903-914
24. Gautier, J., Solomon, M. J., Booher, R. N., Bazan, J. F., and Kirschner, M. W. (1991) Cell 67, 197-211
25. Honda, R., Ohba, Y., Nagata, A., Okayama, H., and Yasuda, H. (1993) FEBS Lett. 318, 331-334
26. Jinno, S., Suto, K., Nagata, A., Igarashi, M., Kanaoka, Y., Nojima, H., and Okayama, H. (1994) EMBO J. 13, 1549-1556
27. Sadhu, K., Reed, S. I., Richardson, H., and Russell, P. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5139-5143
28. Strausfeld, U., Fernandez, A., Capony, J. P., Girard, F., Lautredou, N., Derancourt, J., Labbe, J. C., and Lamb, N. J. (1994) J. Biol. Chem. 269, 5989-6000
29. Dunphy, W. G., and Kumagai, A. (1991) Cell 67, 189-196
30. Sebastian, B., Kakizuka, A., and Hunter, T. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 3521-3524
31. Blomberg, I., and Hoffmann, I. (1999) Mol. Cell. Biol. 19, 6183-6194
32. Forrest, A. R., McCormack, A. K., DeSouza, C. P., Sinnamon, J. M., Tonks, I. D., Hayward, N. K., Ellem, K. A., and Gabrielli, B. G. (1999) Biochem. Biophys. Res. Commun. 260, 510-515
33. Gabrielli, B. G., De Souza, C. P., Tonks, I. D., Clark, J. M., Hayward, N. K., and Ellem, K. A. (1996) J. Cell Sci. 109, 1081-1093
34. Reynolds, R. A., Yem, A. W., Wolfe, C. L., Deibel, M. R., Jr., Chidester, C. G., and Watenpaugh, K. D. (1999) J. Mol. Biol. 293, 559-568
35. Lammer, C., Wagerer, S., Saffrich, R., Mertens, D., Ansorge, W., and Hoffmann, I. (1998) J. Cell Sci. 111, 2445-2453
36. Nishijima, H., Nishitani, H., Seki, T., and Nishimoto, T. (1997) J. Cell Biol. 138, 1105-1116
37. Zwicker, J., Lucibello, F. C., Wolfraim, L. A., Gross, C., Truss, M., Engeland, K., and Müller, R. (1995) EMBO J. 14, 4514-4522
38. Lucibello, F. C., Truss, M., Zwicker, J., Ehlert, F., Beato, M., and Müller, R. (1995) EMBO J. 14, 132-142
39. Liu, N., Lucibello, F. C., Körner, K., Wolfraim, L. A., Zwicker, J., and Müller, R. (1997) Nucleic Acids Res. 25, 4915-4920
40. Huet, X., Rech, J., Plet, A., Vie, A., and Blanchard, J. M. (1996) Mol. Cell. Biol. 16, 3789-3798
41. Tommasi, S., and Pfeifer, G. P. (1995) Mol. Cell. Biol. 15, 6901-6913
42. Shelby, R. D., Vafa, O., and Sullivan, K. F. (1997) J. Cell Biol. 136, 501-513
43. Uchiumi, T., Longo, D. L., and Ferris, D. K. (1997) J. Biol. Chem. 272, 9166-9174
44. Li, F., and Altieri, D. C. (1999) Cancer Res. 59, 3143-3151
45. Philips, A., Chambeyron, S., Lamb, N., Vie, A., and Blanchard, J. M. (1999) Oncogene 18, 6222-6232
46. Wu, W., Fan, Y. H., Kemp, B. L., Walsh, G., and Mao, L. (1998) Cancer Res. 58, 4082-4085
47. Gasparotto, D., Maestro, R., Piccinin, S., Vukosavljevic, T., Barzan, L., Sulfaro, S., and Boiocchi, M. (1997) Cancer Res. 57, 2366-2368
48. Kudo, Y., Yasui, W., Ue, T., Yamamoto, S., Yokozaki, H., Nikai, H., and Tahara, E. (1997) Jpn. J. Cancer Res. 88, 947-952
49. Ma, Z. Q., Chua, S. S., DeMayo, F. J., and Tsai, S. Y. (1999) Oncogene 18, 4564-4576
50. Yao, Y., Slosberg, E. D., Wang, L., Hibshoosh, H., Zhang, Y. J., Xing, W. Q., Santella, R. M., and Weinstein, I. B. (1999) Oncogene 18, 5159-5166
51. Herber, B., Truss, M., Beato, M., and Muller, R. (1994) Oncogene 9, 2105-2107
52. Kakizuka, A., Sebastian, B., Borgmeyer, U., Hermans-Borgmeyer, I., Bolado, J., Hunter, T., Hoekstra, M. F., and Evans, R. M. (1992) Genes Dev. 6, 578-590
53. Belyavsky, A., Vinogradova, T., and Rajewsky, K. (1989) Nucleic Acids Res. 17, 2919-2932
54. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988) Science 239, 487-491
55. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475-1489
56. Barberis, A., Superti-Furga, G., and Busslinger, M. (1987) Cell 50, 347-359
57. Pfeifer, G. P., Steigerwald, S., Mueller, P. R., and Riggs, A. D. (1989) Science 246, 810-813
58. Mantovani, R., Pessara, U., Tronche, F., Li, X. Y., Knapp, A. M., Pasquali, J. L., Benoist, C., and Mathis, D. (1992) EMBO J. 11, 3315-3322
59. Zwicker, J., Gross, C., Lucibello, F. C., Truss, M., Ehlert, F., Engeland, K., and Müller, R. (1995) Nucleic Acids Res. 23, 3822-3830
60. Dennig, J., Hagen, G., Beato, M., and Suske, G. (1995) J. Biol. Chem. 270, 12737-12744
61. Körner, K., Wolfraim, L. A., Lucibello, F. C., and Müller, R. (1997) Nucleic Acids Res. 25, 4933-4939
62. Sorensen, P., and Wintersberger, E. (1999) J. Biol. Chem. 274, 30943-30949
63. Adachi, N., Nomoto, M., Kohno, K., and Koyama, H. (2000) Gene 245, 49-57
64. Bolognese, F., Wasner, M., Dohna, C. L., Gurtner, A., Ronchi, A., Muller, H., Manni, I., Mossner, J., Piaggio, G., Mantovani, R., and Engeland, K. (1999) Oncogene 18, 1845-1853
65. Facchinetti, V., Lopa, R., Spreafico, F., Bolognese, F., Mantovani, R., Tavner, F., Watson, R., Introna, M., and Golay, J. (2000) Oncogene 19, 3931-3940
66. Linhoff, M. W., Wright, K. L., and Ting, J. P. (1997) Mol. Cell. Biol. 17, 4589-4596
67. Zwicker, J., Lucibello, F. C., Jérôme, V., Brüsselbach, S., and Müller, R. (1997) Nucleic Acids Res. 25, 4926-4932


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
S. D. Bush, P. Richard, and J. L. Manley
Variations in Intracellular Levels of TATA Binding Protein Can Affect Specific Genes by Different Mechanisms
Mol. Cell. Biol., January 1, 2008; 28(1): 83 - 92.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
A. Gurtner, I. Manni, P. Fuschi, R. Mantovani, F. Guadagni, A. Sacchi, and G. Piaggio
Requirement for Down-Regulation of the CCAAT-binding Activity of the NF-Y Transcription Factor during Skeletal Muscle Differentiation
Mol. Biol. Cell, July 1, 2003; 14(7): 2706 - 2715.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. E. Schmidt, A. A. Bondareva, J. R. Radke, and M. R. Capecchi
Fundamental Cellular Processes Do Not Require Vertebrate-specific Sequences within the TATA-binding Protein
J. Biol. Chem., February 14, 2003; 278(8): 6168 - 6174.
[Abstract] [Full Text] [PDF]


Home page
J. Dent. Res.Home page
X. Han and S. Amar
Identification of Genes Differentially Expressed in Cultured Human Periodontal Ligament Fibroblasts vs. Human Gingival Fibroblasts by DNA Microarray Analysis
J. Dent. Res., June 1, 2002; 81(6): 399 - 405.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
U. Haugwitz, M. Wasner, M. Wiedmann, K. Spiesbach, K. Rother, J. Mossner, and K. Engeland
A single cell cycle genes homology region (CHR) controls cell cycle-dependent transcription of the cdc25C phosphatase gene and is able to cooperate with E2F or Sp1/3 sites
Nucleic Acids Res., May 1, 2002; 30(9): 1967 - 1976.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/13/9662    most recent
M008696200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Körner, K.
Right arrow Articles by Müller, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Körner, K.
Right arrow Articles by Müller, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.