![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 13, 9662-9669, March 30, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Institute of Molecular Biology and Tumor Research (IMT), Philipps University, Emil-Mannkopff-Strasse 2, 35033 Marburg, Germany
Received for publication, September 22, 2000, and in revised form, November 2, 2000
| |
ABSTRACT |
|---|
|
|
|---|
Expression of the cdc25B gene is
up-regulated late during cell cycle progression (S/G2). We
have cloned the murine cdc25B promoter to identify elements
involved in transcriptional regulation. A detailed structure-function
analysis led to the identification of several elements that are located
upstream of a canonical Inr motif at the site of transcription
initiation and are involved in transcriptional activation and
regulation. Activation of the promoter is largely mediated by NF-Y and
Sp1/3 interacting with one and four proximal binding sites,
respectively. In addition, NF-Y plays an essential role in cell cycle
regulation in conjunction with a repressor element (cell
cycle-regulated repressor) located ~30 nucleotides
upstream of the putative Inr element and overlapping a consensus TATA
motif. The cell cycle-regulated repressor is unrelated to the
previously described cell cycle-regulated repressor elements. Taken
together, our observations suggest that expression of the
cdc25B gene is controlled through a novel mechanism of cell
cycle-regulated transcription.
Cell cycle progression in mammalian cells is associated with the
phase-specific transcription of defined sets of genes (1). Such
periodically expressed genes frequently encode proteins that either
directly control cell cycle progression or function in periodically
occurring metabolic processes, such as nucleotide and DNA biosynthesis.
A major regulator of the cell cycle-dependent expression of
these genes is the transcription factor E2F (2-4). Transcriptionally
inactive complexes of E2F with pocket proteins of the
Retinoblastoma protein (prb) family assemble in
Go/early G1, but during cell cycle progression
these complexes dissociate, and the release of transcriptionally active
"free E2F" leads to the activation of E2F-responsive genes. It has
become clear, however, that E2F can also act either as an active
repressor, which, at least in part, appears to be due to the
retinoblastoma protein-mediated recruitment of histone deacetylases.
The first example of a gene that is repressed by E2F is the mouse
B-myb gene (5), but a number of other genes repressed via
E2F sites in their promoters have been identified, for example
E2F-1 (6, 7), orc-1 (8), cdc 6 (9-11), cdc25A (12, 13), and p107 (14).
Interestingly, structure-function analysis of the B-myb
promoter identified an E2F binding site close to the transcription
start sites, which is necessary but not sufficient for cell cycle
regulation (15, 16). Mutational analyses showed that an adjacent
element, termed Bmyb-CHR,1 is
indispensable for repression and acts as a corepressor element together
with the E2F-binding site.
cdc25C exemplifies a group of cell cycle genes whose
transcription is up-regulated later than that of B-myb,
i.e. in S/G2. cdc25 was originally
discovered in Schizosaccharomyces pombe as a regulator of the G2 to M progression (17, 18). Higher
eukaryotes contain at least three genes with a high degree of
similarity to cdc25, encoding the Cdc25A, Cdc25B, and Cdc25C
protein phosphatases (19-28). The Cdc25C phosphatase activates the
Cdc2/cyclin B complex and thereby enables the entry into mitosis (20,
24, 28-30). Cdc25A appears to play a role in regulating entry into S
phase (13, 26, 31), whereas Cdc25B is required for the G2
to M progression (32-36).
For the cdc25C promoter, repression of upstream activators
via a bipartite site, consisting of the "cell
cycle-dependent element" and the "cell cycle genes
homology region" (CHR), has been established as the major regulatory
mechanism (37, 38). As shown by genomic footprinting, both elements are
cooperatively bound in a periodic fashion by a repressor that has been
designated CDF-1 (37, 39). A similar mechanism seems to be of global
relevance, because a number of other similarly regulated cell cycle
genes, such as cyclin A (37, 40), cdc2 (37, 41),
CENP-A (42), polo-like kinase (43), and
survivin (44), have been identified. Recently, a factor
(CHF) interacting with the CHR in the cyclin A
promoter has been described (45).
Cell cycle regulation of cdc25B resembles that of
cdc25C, which is in agreement with its function at the final
stages of the cell cycle (32-36). The cdc25B gene is of
interest also in view of its possible involvement in human cancer (19,
46-48), and its oncogenic potential in transgenic mice (49, 50).
However, to date, the promoter of the cdc25B gene has not
been analyzed, and consequently the mechanism controlling the cell
cycle-regulated expression is unknown. In the present study, we
have addressed this question. We have cloned the murine
cdc25B promoter and have identified regulatory elements and
interacting transcription factors required for cdc25B
transcription and contributing to its regulation of expression during
the cell cycle.
Cell Culture--
The murine cell line NIH3T3 (kindly provided
by R. Treisman, ICRF, London) was maintained at 37 °C in 5%
CO2 in Dulbecco's modified Eagle's medium supplemented
with 10% fetal bovine serum, penicillin, and streptomycin.
Transfections and Luciferase Assays--
Cells were
plated on 35-mm (diameter) tissue culture plates at a density producing
60-80% confluence at the time of the transfection and transfected
using the cationic lipid DOTAP as described by the manufacturer
(Roche Molecular Biochemicals). For synchronization in G0,
cells were maintained in serum-free medium for 3 days. Stimulation was
carried out for the indicated times with 10% fetal calf serum.
Luciferase activity was determined as published elsewhere (38, 51).
Library Screening--
The murine genomic Primer Extension Analysis--
32P-labeled primer
(10 pmol) and total cellular RNA, isolated from normal cycling NIH3T3
cells, were denatured for 10 min at 65 °C and then incubated for 30 min at 37 °C. Primer extension was carried out in a total volume of
50 µl containing 50 mM Tris, pH 8.3, 75 mM
KCl, 10 mM dithiothreitol, 3 mM
MgCl2, 400 µM dNTPs, 2 units of RNasin, and
400 units of Moloney murine leukemia virus reverse transcriptase
(Life Technologies, Inc.). After incubation for 1 h at 37 °C,
the reaction was stopped with EDTA followed by RNase treatment. The DNA
was precipitated, redissolved, and separated by electrophoresis on
a 6% acrylamide, 7 M urea gel.
Reverse Transcriptase PCR--
For cDNA synthesis (53), 4 µg of total RNA were annealed to 1 µg of oligo(dT) and incubated
with 200 units of Moloney murine leukemia virus reverse
transcriptase for 1 h at 37 °C in a final volume of 20 µl.
One-tenth of the reaction mixture was amplified by 25 cycles of PCR in
the presence of 0.5 µCi of [ cdc25B Promoter Constructs--
Primers carrying restriction
sites were used for PCR with pBIISKcdc25B as the template to
generate a series of 5' terminal deletions with compatible ends for
cloning as KpnI/NheI fragments into the multiple
cloning region of the promoterless luciferase vector pGL3-basic
(Promega, Madison, WI). All PCR-amplified fragments were verified by
DNA sequencing. 1-7-base pair mutations were introduced into the
regions of the cdc25B promoter spanning
The following oligonucleotides were used as primers:
cdc25B KpnI,
5'-AGCTGGTACCAGTTCTCAACTGCCCACTAG-3'; cdc25B223
KpnI, 5'-AGCTGGTACCATGGGAGCGGGCGGGGCCGG-3'; cdc25B
NheI, 5'-GGGCAAAGGCTAGCTAGAGGG-3'; 5'mE2,
5'-AAACAGACTCAAGCTTTCAAGGTGATTAGGTCATTAGA-3'; 3'mE2,
5'-TAATCACCTTGAAAGCTTGAGTCTGTTTTCCTGG-3'; 5'mNF-Y,
5'-CGCCCCCATTAATGGCGTCTGGCGGCGCTGC-3'; 3'mNF-Y,
5'-CAGACGCCATTAATGGGGGCGCCGGTTCCGG-3'; 5'2mCCRR,
5'-GCTGTTATTTTTCTCATATATAAGGAGGTGGAGGTGG-3'; 3'2mCCRR,
5'-CCTCCTTATATATGAGAAAAATAACAGCGGCAGCGCC-3'; 5'mG30G, 5'-GCTGTTATTTTTCGAAGATATAAGGAGGTGGAGGTGG-3'; 3'mG30G,
5'-CCTCCTTATATCTTCGAAAAATAACAGCGGCAGCGCC-3'; 5'mTATA,
5'-TTTTCGAACGATGTTGGAGGTGGAGGTGGCAGC-3'; 3'mTATA,
5'-ACCTCCAACATCGTTCGAAAAATAACAGCGGCAG-3'.
Electrophoretic Mobility Shift Assays--
Preparation of
nuclear extracts and electrophoretic mobility shift assays (EMSAs) were
performed as described (55, 56) using poly(dI·dC) or
poly(dA·dT) for CCRR gel shifts or poly(dI·dC) for Sp1 and NF-Y gel
shifts as nonspecific competitors. 1-2 µl of HeLa or 4 to 6 µl of
NIH3T3 nuclear extracts were incubated with ~0.5 pmol of radiolabeled
probe in the suitable binding buffer (NF-Y EMSA: 10 mM Hepes (pH 7.8), 50 mM K-glutamate, 5 mM MgCl2, 1 mM dithiothreitol, 5%
(v/v) glycerol, 1 mM EDTA (pH 8.0), 0.5 µg/µl
poly(dI·dC); Sp1 EMSA: 20 mM Tris·Cl (pH 7.5), 0.1 mM EDTA, 0.5 mM MgCl2, 10 mM KCl, 0.2 mM ZnSO4, 10%
glycerol, 0.4 µg/µl poly(dI·dC); CCRR EMSA: 100 mM
Tris·Cl (pH 7.9), 30% glycerol, 0.4 mM EDTA (pH 8.0), 2 mM dithiothreitol, 0.5 µg/µl poly(dA·dT)). EMSA
reactions for Sp1/3 and NF-Y binding were performed at room temperature
for 15 min followed by gel electrophoresis at 4 °C using 4%
polyacrylamide gels. Supershifts were carried out by pre-incubating
EMSA reactions on ice for 20 min with 1 µl of the indicated
antibodies prior to addition of the radiolabeled probe. For detection
of other protein-DNA complexes, EMSA reactions were carried out on ice
for 15 min. Sp1 and Sp3 antibodies were obtained from G. Suske (IMT,
Marburg, Germany). The NF-Y antibody was obtained from R. Mantovani (Milan). The following oligonucleotides were used as
probes and/or competitors: cdc25B NF-Y,
5'-GGAACCGGCGCCCCCATTGGTCG-3'; bona fide NF-Y,
5'-GATTTTTTCCTGATTGGTTAAAAGT-3'; mcdc25B NF-Y (MY),
5'-GGAACCGGCGCCCCCATTAATGG-3'; GT box,
5'-AGCTTCCTTGCCACACCCCTGCAG-3'; Genomic Footprinting--
For genomic footprinting (38, 57),
NIH3T3 cells were maintained in serum-free medium for 3 days for
synchronization in G0, and stimulation was carried out for
the indicated times with 10% fetal calf serum. The cells were
then treated with 0.2% DMS for 2 min. After DMS treatment, cells were
washed three times with cold phosphate-buffered saline, and the DNA was
isolated. As reference, NIH3T3 genomic DNA was methylated in
vitro with 0.2% DMS for 10-30 s. Piperidine cleavage was
performed as described. Genomic DNA (3 µg) was used for
ligation-mediated PCR as described. The Stoffel fragment of
Taq polymerase (PerkinElmer Life Sciences) was used
instead of the native enzyme. Samples were phenol-extracted and
ethanol-precipitated before primer extension with
32P-labeled primers. The following oligonucleotides were
used as primers: first primer (Tm = 52 °C),
5'-d(AGTCACCCTAAGAAGCG)-3'; second primer (Tm = 74 °C), 5'-d(CGAGCAGAAGTAGCTGGTCCAGC)-3'; third primer
(Tm = 88 °C),
5'-d(CTGGTCCAGCCTCAGCCTCAGCCCC)-3'.
Cloning of the Mouse cdc25B Promoter--
A mouse embryo genomic
DNA library was screened with an oligonucleotide representing the mouse
cdc25B coding region. Several recombinant phage spanning
~30 kilobases of genomic DNA were isolated and mapped (Fig.
1A). One phage clone
(designated III in Fig. 1A) was used to subclone a
1.1-kilobase fragment representing the sequence 5' to the
translation start codon. This fragment (B950) was linked to the firefly
luciferase gene and transfected into NIH3T3 cells to test whether the
isolated promoter fragment was functional in a transient expression
assay. As shown in Fig. 2A,
B950 was cell cycle-regulated after serum stimulation of cells that had
been synchronized in G0. Thus, hardly any luciferase activity was detectable in G0 cells and at early stages
after serum stimulation, but there was an ~4-fold induction at
18 h after serum stimulation, peaking at 22 h (8-fold
induction). At this stage, most cells had entered or passed through
G2 (data not shown). In addition, we determined the
expression profile of the endogenous cdc25B gene in the same
cell system and found a similar time course (Fig. 2B;
cdc2 induction shown for comparison). These data indicate
that the isolated promoter fragment is sufficient to confer on a
luciferase reporter gene a pattern of cell cycle regulation that
mirrors its physiological regulation.
Structure of the Mouse cdc25B Promoter--
The nucleotide
sequence of B950 was determined for both strands (GenBankTM
accession number AJ296019). The most relevant part of the sequence, as
determined below, is shown in Fig. 1B. Inspection of the
sequence revealed a match with a canonical TATA box motif 190 nucleotides 5' to the ATG (Fig. 1C). A single transcription start site cluster was identified by primer extension analysis ~30
nucleotides downstream of this motif and overlapping with an Initiator
(Inr) consensus sequence (Figs. 1C and
3). Although we cannot formally rule out
the formal possibility that the cdc25B gene contains
additional initiation sites outside the region analyzed, these
observations strongly suggest that a TATA box and/or an Inr element
direct the initiation of transcription and define the transcriptional
start site. The A within the Inr motif was therefore designated
position +1 (see Fig. 1C). A search for potential regulatory
sites revealed the presence of additional putative transcription
factor binding sites: two E boxes ( Delineation of Functional Regions in the Mouse cdc25B Promoter by
Truncation Analysis--
To identify functionally relevant regions in
cdc25B promoter, a series of terminal truncations was
generated from the B950 construct ( Identification of Functional Upstream Elements in the Mouse cdc25B
Promoter--
To confirm and extend the findings obtained by promoter
truncation, the putative E boxes and NF-Y binding site were altered by
point mutations, and the functional consequences were analyzed in
transient transfection assays. The proximal potential E2F sites were
not included in this analysis because no binding of E2F-1, E2F-3, or
E2F-4 to the cdc25B promoter could be detected in EMSA using
either normal NIH3T3 cells or retrovirally transduced cells overexpressing the respective E2F protein (kindly provided by R. Bernards, Amsterdam), although clear binding was seen in the same assay
with a bona fide E2F site from the B-myb promoter (5, 15)
(data not shown).
The mutation analyses yielded the following results (Fig.
5). (i) Mutation of the most distal E box
led to a slight increase in promoter activity of ~36% but did not
show any influence on cell cycle regulation. Mutation of the second E
box had only a very weak effect, and mutation of both E boxes had the
same effect as mutation of the most distal one alone. These data are in
line with the truncation analysis described above and indicate that the
E boxes are not crucial with respect to cell cycle regulation. This
promoter region was therefore not further investigated. (ii) Point
mutations in the NF-Y binding site led to a drastic loss of both
transcriptional activity (~73%) and cell cycle regulation (57%).
This result is in perfect agreement with the deletion analysis and
confirms the importance of the NF-Y site both for transcriptional activity and cell cycle regulation.
Interaction of NF-Y and Sp1/Sp3 with the Mouse cdc25B Upstream
Activating Sequence--
To investigate protein interactions at the
potential NF-Y site in the cdc25B promoter, we performed
EMSAs with nuclear extracts from normally cycling NIH3T3 cells. A
synthetic oligonucleotide encompassing this element was used as a
probe, and competitors representing either the same site
(self-competition), a bona fide NF-Y site from the MHC class II
promoter (E
Similar experiments were performed to analyze protein binding to the
four functionally relevant Sp1 sites at positions Identification of a Proximal Repressor Element--
Finally, we
scanned the proximal promoter for the presence of additional sites that
might play a role in cell cycle regulation. Toward this end, we
introduced point mutations into this region in the context of an
otherwise intact promoter fragment ( Protein Interaction with the CCRR--
Finally, we sought to
obtain direct evidence for the existence of a protein complex
interacting with the CCRR. For this purpose, we performed EMSAs with a
fragment containing nucleotides In Vivo Protection of the CCRR Region--
To obtain further
evidence that the CCRR represents a protein binding site, we performed
genomic DMS footprinting of the region surrounding the transcriptional
start site in NIH3T3 cells. Fig. 10
shows a typical in vivo footprint of the bottom strand. It
is obvious that in the region of the CCRE multiple residues were protected: A at The data reported in the present study suggest that the
cdc25B promoter is controlled by a novel mechanism of cell
cycle-regulated transcription, which involves both an NF-Y binding site
and the CCRR repressor element. Neither of the two binding sites is
sufficient to confer cell cycle regulation on its own, pointing to a
functional interplay between the putative repressor interacting with
NF-Y. Although NF-Y has been shown for a number of other promoters to play a crucial role in cell cycle-regulated transcription (37, 59,
62-65), its precise role has not been determined. The data presented
in the present study point to a dual function of NF-Y in the context of
the cdc25B promoter. NF-Y is crucial not only for
promoter activation, which might be related to its described ability to
recruit other transcription factors to a promoter (66), but also for
cell cycle regulation. This is reminiscent of the situation described
for the cdc25C promoter, where NF-Y cooperates with the cell
cycle-regulated repressor CDF-1 (59). In this case, CDF-1 presumably
functions by specifically repressing NF-Y-mediated activation, because
the repressor function of CDF-1 is dependent on an active promoter and
is specific for a small subset of transcriptional activators (67). It
is possible that an analogous situation exists in the case of the
cdc25B promoter, but the precise underlying mechanism
remains to be investigated.
Another interesting aspect relates to the fact that the CCRE apparently
overlaps the TATA motif. Although there is no formal proof at present
that the putative TATA element is functional in the cdc25B
promoter, its sequence (TATATAA) exactly fits that of a canonical TATA
box, and its spacing relative to the transcriptional start site and the
putative Inr element is within the expected range. This raises the
intriguing possibility that a CCRE-interacting repressor functions by
interfering with the basal transcriptional machinery, e.g.
by inhibiting the assembly of a functional initiation complex. Future
analyses will have to address these mechanistic questions in detail.
The present study provides the basis for such studies.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-Fix phage
library 129 FVJ (Stratagene) was screened with a 69-base pair
oligonucleotide (probe 1, 5'-TCTAGCTAGCCTTTGCCCGCCCCGCCACGATGGAGGTACCCCTGCAGAAGTCTGCGCCGGGTTCAGCTC-3') annealing to the 5'-end of the murine cdc25B cDNA (52).
Three phage clones were isolated, and the DNA was amplified and further mapped in the 3' direction with probe 2 (5'-GGTCATTCAAAATGAGCAGTTACCATAAAACGCTTCCGATCCTTACCAGTGAGGCTTGCTGGAACACACTCCGGTGCTG-3') and probe 3 (5'-GTTAAAGAAGCATTGTTATTATGGGGAGGGGGGAGCAACCTCTGGGTTCAGAATCTACATATGCTGGAAGGCCCCAATGA-3'). Experimental details have previously been described (51). A 4.6-kilobase fragment containing the promoter region and the
noncoding sequence was isolated and subcloned in the
EcoRI/SalI sites of the pBluescriptIISK vector (Stratagene).
-32P]dCTP (38, 54). The
experimental strategy included the following precautions. (i)
The number of PCR cycles was kept low to obtain a linear amplification
of the PCR products, which was possible by the incorporation of
radioactive precursor nucleotides and evaluation by autoradiography and
-radiation scanning. (ii) All results were standardized using the
signal obtained with glyceraldehyde-3-phosphate dehydrogenase, whose
expression is independent of cell proliferation. (iii) All experiments
were performed with at least two independent cDNA preparations.
950 to +167 or
223 to +167 using PCR-directed mutagenesis (37). Primers
carrying the mutations (see below) and a second set of primers for
subcloning (5'cdc25B, 5'cdc25B223, and
3'cdc25B) were designed. The first PCR reaction (54) was
performed with the oligonucleotides (i) 5'cdc25B and
3'-primer carrying the mutation and (ii) 3'cdc25B and
5'-primer carrying the mutation. The resulting products were purified
(QIAquick Spin PCR purification; Qiagen) and amplified in a second PCR
reaction using 5'cdc25B or 5'cdc25B223 and
3'cdc25B as primers. Site-directed mutagenesis of the first E-box (
947) (mutated bases underlined) was generated by PCR with the
primer 5'mE1
(5'-AGCTGGTACCTTCTCAAGCTTTCCCACTAGGTCCTTCCCAG-3') and the
primer cdc25B NheI (see below). The resulting
fragments carrying the mutations were cloned into the
KpnI/NheI sites of the promoterless luciferase
vector pGL3-basic (Promega) and verified by DNA sequencing.
103/
80,
5'-GTTGGTCCCGCCCTCCCGGGAAC-3';
120/
97,
5'-GTCAGCCTCAGCCCCGCCCTTGGT-3';
209/
187,
5'-GCCGGGGCGGTACGTGTGGGG-3';
226/
206,
5'-GCAATGGGAGCGGGCGGGGC-3';
64/
29,
5'-GCGTCTGG- CGGCGCTGCCGCTGTTATTTTTCGAATA;
64/
20,
5'-GCGTCTGGCGGCGCTGCCGCTGTTATTTTTCGAATATATAAGGAG-3';
64/
20 3mCCRR,
5'-GCGTCTGGCGGCGCTGCCGCTGTTATTTTTATCATATATAAGGAG-3'; ns,
5'-GAATAAAGTTTTACTGATTTTTGAGACA-3'. Shown are the top strand oligonucleotides. For radioactive labeling by filling in with [32P]dCTP, an additional G was added to the 5'-end of the
bottom strand oligonucleotides. Underlined letters represent mutated bases.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (25K):
[in a new window]
Fig. 1.
A, genomic structure of the murine
cdc25B locus. The map was assembled on the basis of the
three analyzed phage clones shown below the map. The subcloned
fragment used for promoter analysis is depicted at the
bottom. kb, kilobases. B,
schematic of the cdc25B promoter showing putative protein
binding sites. E, E-box; Sp1, binding site for
Sp1 family members; E2F, E2F site; NFY, NF-Y site
(reverse CCAAT box); TATA, TATA box). C,
nucleotide sequence of the proximal promoter region. The major site of
transcription initiation was designated position +1 (see also Fig. 3).
Functional element (Sp1/3 and NF-Y sites) motifs identified in the
present study, as well as the TATA and Inr, are highlighted.

View larger version (35K):
[in a new window]
Fig. 2.
Cell cycle regulation of cdc25B
transcription. A, time course of luciferase
activity in G0-synchronized NIH3T3 cells after transfection
of the B950 construct and serum stimulation. B, kinetics of
endogenous cdc25B mRNA expression in serum-stimulated
NIH3T3 cells. The analysis was performed by reverse transcriptase-PCR.
For comparison, the induction of cdc2 mRNA was also
measured.
947 and
800), three E2F sites
(
232,
58, and
50), five Sp1 sites (
570,
217,
200,
105,
and
95), and an NF-Y binding site (
70).

View larger version (84K):
[in a new window]
Fig. 3.
Mapping of the 5' end of cdc25B
mRNA by primer extension in normally cycling NIH3T3
cells. As a negative control, yeast tRNA was used. A sequencing
reaction was run alongside (lanes labeled G,
A, T, C) to be able to accurately
determine the nucleotide positions.
950/+167) and analyzed for
expression in G0 versus normally cycling cells
(N) (Fig. 4). This analysis
led to the following conclusions. (i) The terminal deletion of 10 nucleotides, which removes a potential E box led to an increase
in transcriptional activity of ~40% but had no effect on cell cycle
regulation. Truncation of the adjacent fragment spanning positions
980 to
768, which harbors another potential E box, had no
detectable effect on transcriptional activity or cell cycle regulation.
(ii) The region from
340 to
250 seems to have a negative effect on
transcriptional activity. However, because no putative binding sites
could be identified in this region, and there was no effect on cell
cycle regulation, we did not pursue this finding. (iii) Further
deletion of a fragment spanning nucleotides
250 to
223 and
harboring a potential E2F site had no detectable effect. (iv)
Truncation of a fragment spanning positions
223 to
180, which
contains two potential Sp1 sites, led to a clear
reduction in transcriptional activity. This was further decreased by
truncation of the adjacent region spanning nucleotides
180 to
87,
which harbors two more potential Sp1 sites. The loss of these four
potential Sp1 sites led to a total decrease in transcriptional activity
of 60%, with only a marginal effect on cell cycle regulation. (v) The
terminal deletion of an additional 20 nucleotides resulted in a further
drop in transcriptional activity but also led to a clear decrease in
cell cycle regulation, indicating that this promoter region, which
harbors a potential NF-Y site, is of particular functional
relevance. (vi) Further truncations had no additional effect on
cell cycle regulation, presumably because these constructs all
lacked the NF-Y site.

View larger version (17K):
[in a new window]
Fig. 4.
Delineation of functionally important regions
in the cdc25B promoter. Terminally truncated
cdc25B promoter-luciferase constructs were analyzed in
transient expression assays in both quiescent (G0) and
normally growing (N) NIH3T3 cells. Values are given as
relative luciferase activities normalized to 100 for the longest
promoter construct (
950) in normally growing cells.

View larger version (11K):
[in a new window]
Fig. 5.
Identification of functionally important
elements in the cdc25B promoter.
cdc25B promoter-luciferase constructs with point mutations
in defined elements (E boxes, NF-Y site) were analyzed in transient
expression assays in both quiescent (G0) and normally
growing (N) NIH3T3 cells. Values are given as relative
luciferase activities normalized to 100 for the wild-type construct
(
950) in normally growing cells. N/G0 gives the
factor of cell cycle regulation. Sites are labeled as in Fig.
1B.
-Y) (58), an Sp1 binding site (GT box), or a mutated
cdc25B element (MY) were also used. As shown in Fig.
6, only the former two oligonucleotides were able to prevent the formation of a DNA-protein complex.
Neither the GT box nor the mutated cdc25B element showed any
competition. Likewise, no effect on complex formation was seen when
binding sites for other CAAT box-binding factors, i.e.
C/EBP or NF-I/CTF (59), were used (data not shown). To obtain
further evidence that NF-Y interacts with the cdc25B
promoter, we analyzed the effect of a monoclonal antibody (
NF-Y A)
against the A subunit of NF-Y (kindly provided by D. Mathis) (58). This
antibody led to the expected supershift of the observed complex (58,
59). Taken together, these data clearly suggest that the protein
complex interacting with the cdc25B site is NF-Y.

View larger version (60K):
[in a new window]
Fig. 6.
Binding of NF-Y to the murine
cdc25B promoter. A fragment encompassing
positions
85 to
63 was used as a probe in EMSA using NIH3T3 nuclear
extract. The assay was performed in the presence and absence of
antibodies specific for the A subunit of NF-Y (
NF-Y A). No effect
was seen with irrelevant anti-serum (data not shown). Competitors were
identical to the respective probes (self-competition) or represented a
bona fide NF-Y site (MHC), a GT box, or the mutated
cdc25B NF-Y site (MY).
217,
200,
105,
and
95. EMSAs were performed using four different probes representing
these sites in conjunction with a specific (self) or nonspecific
competitor (unrelated sequence) and antibodies specific for Sp1
or Sp3 (kindly provided by G. Suske, IMT, Marburg, Germany) (60, 61).
The data in Fig. 7 clearly show that all four sites specifically interact with Sp1 and Sp3, leading to the
formation of the expected complexes (60).

View larger version (98K):
[in a new window]
Fig. 7.
Binding of Sp1 and Sp3 to four elements of
the murine cdc25B promoter. Fragments
encompassing positions
103 to
80,
120 to
97,
209 to
187,
and
226 to
206 were used as probes in EMSAs using NIH3T3 nuclear
extract. The assay was performed in the presence and absence of
antibodies specific for Sp1 (
Sp1) or Sp3 (
Sp3). The respective
pre-immune sera did not show any effect (data not shown). Competitors
(comp.) were identical to the respective probes
(s, self-competition) or represented a nonspecific sequence
(ns).
223/+167 construct). Construct
2mCCRR harbors two mutations at positions
32 and
33, whereas
construct m30G is mutated at position
30, i.e. the first
nucleotide of the TATA motif. As shown in Fig. 8, both these mutations led to a 3- to
4-fold increased activity in G0 cells, resulting in a
50-60% loss in cell cycle regulation. These results indicate that
this region of the promoter functions as a cell cycle-regulated
repressor. Previous studies have shown that other S/G2
genes are regulated by two contiguous repressor elements, the cell
cycle-dependent element and CHR, whose function is
dependent on an exact spacing relative to each other (37, 39). Because
the sequence surrounding the repressor element in the cdc25B
promoter (TGTTATTTTTCGAATATAT; the approximate position of
the repressor element is underlined) only bears a vague resemblance to
a cell cycle-dependent element-CHR module
(cdc25C: CT GGCGGAAGGTTTGAA; the
cell cycle-dependent element and CHR are underlined), it
can be concluded that these sequences are functionally unrelated. We
refer to this element in the cdc25B promoter as "cell
cycle-regulated repressor" (CCRR).

View larger version (27K):
[in a new window]
Fig. 8.
Functional analysis of the cdc25B
promoter region harboring the CCRR. cdc25B
promoter-luciferase constructs with mutations in the CCRR were analyzed
in transient expression assays in both quiescent (G0) and
normally growing (N) NIH3T3 cells. Nucleotide positions are
indicated at the top. Mutated nucleotides are
underlined. The dotted line shows the approximate
position of the repressor element (CCRR).
223 represents the
wild-type (WT) promoter construct. Error bars
indicate standard deviations.
64 to
20 of the murine
cdc25B promoter as a probe and NIH3T3 nuclear extract. As
shown in Fig. 9, the most slowly
migrating complex specifically interacted with the CCRR. Whereas
self-competition was highly efficient, no competition was seen with the
same oligonucleotide harboring a mutation in the region of the CCRR or
a 5' truncation of nine nucleotides. Likewise, no competition was
observed with an unrelated sequence. In addition, the binding activity
was not competed by B-myb or cdc25C CHR sequences
(data not shown), which confirms the conclusion that the CCRR
represents a functionally unrelated repressor element.

View larger version (41K):
[in a new window]
Fig. 9.
Identification of a CCRR binding
activity. A fragment encompassing positions
64 to
20 of the
murine cdc25B promoter was used as a probe for EMSA using
NIH3T3 nuclear extract. Four different competitors were used:
s, identical to the probe;
64/
20 3mCCRR, same as probe
but with three mutations in the region of the CCRE (at
32,
33, and
34);
64/
29, same as probe but lacking nine nucleotides at the 5'
end; ns, nonspecific sequence. The uppermost band
represents a specific CCRR-protein complex. The nature of the other
complexes is unclear, but on the basis of the competition data these
appear to be nonspecific.
28, A at
30, and G at
34, the two former
nucleotides being part of the TATA motif.

View larger version (24K):
[in a new window]
Fig. 10.
In vivo footprint of the cdc25B
promoter region around the transcriptional start site.
Growing NIH3T3 cells were treated with DMS, and protected purine bases
were detected by ligation-mediated PCR (bottom strand). Numbers on the
left indicate nucleotide positions relative to the start
site of transcription (+1). Protected nucleotides can be seen in the
region of the CCRR overlapping the TATA motif.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
| |
ACKNOWLEDGEMENTS |
|---|
-We are grateful to R. Bernards for retrovirally transduced cells overexpressing specific E2F family members and to Dr. M. Krause for synthesis of oligonucleotides.
| |
FOOTNOTES |
|---|
* This work was supported by grants from the Deutsche Forschungsgemeinschaft (SFB397/C1, Mu601/9-2).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ296019.
To whom correspondence and requests for reprints should be
addressed: Institut für Molekularbiologie und Tumorforschung
(IMT), Emil-Mannkopff-Strasse 2, 35033 Marburg, Germany. Tel.: 49 6421 28 66236; Fax: 49 6421 28 68923; E-mail:
mueller@imt.uni-marburg.de.
Published, JBC Papers in Press, December 4, 2000, DOI 10.1074/jbc.M008696200
| |
ABBREVIATIONS |
|---|
The abbreviations used are: CHR, cell cycle genes homology region; CDF, cell cycle-dependent element-binding factor; PCR, polymerase chain reaction; EMSA, electrophoretic mobility shift assay; CCRR, cell cycle-regulated repressor; NF-Y, nuclear factor-Y; DMS, dimethyl sulfate; Inr, Initiator; CCRE, cell cycle-regulated represser element.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Müller, R. (1995) Trends Genet. 11, 173-178 |
| 2. | Brehm, A., Miska, E., Reid, J., Bannister, A., and Kouzarides, T. (1999) Br. J. Cancer 80 Suppl. 1, 38-41 |
| 3. | Lavia, P., and Jansen-Durr, P. (1999) Bioessays 21, 221-230 |
| 4. | Muller, H., and Helin, K. (2000) Biochim. Biophys. Acta 1470, M1-M12 |
| 5. | Lam, E. W., and Watson, R. J. (1993) EMBO J. 12, 2705-2713 |
| 6. | Hsiao, K.-M., McMahon, S. L., and Farnham, P. J. (1994) Genes Dev. 8, 1526-1537 |
| 7. | Johnson, D. G., Ohtani, K., and Nevins, J. R. (1994) Genes Dev. 8, 1514-1525 |
| 8. | Ohtani, K., DeGregori, J., Leone, G., Herendeen, D. R., Kelly, T., and Nevins, J. R. (1996) Mol. Cell. Biol. 16, 6977-6984 |
| 9. | Yan, Z., DeGregori, J., Shohet, R., Leone, G., Stillman, B., Nevins, J. R., and Williams, R. S. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 3603-3608 |
| 10. | Hateboer, G., Wobst, A., Petersen, B. O., Le Cam, L., Vigo, E., Sardet, C., and Helin, K. (1998) Mol. Cell. Biol. 18, 6679-6697 |
| 11. | Ohtani, K., Tsujimoto, A., Ikeda, M., and Nakamura, M. (1998) Oncogene 17, 1777-1785 |
| 12. | Chen, X., and Prywes, R. (1999) Mol. Cell. Biol. 19, 4695-4702 |
| 13. | Vigo, E., Muller, H., Prosperini, E., Hateboer, G., Cartwright, P., Moroni, M. C., and Helin, K. (1999) Mol. Cell. Biol. 19, 6379-6395 |
| 14. | Zhu, L., Zhu, L., Xie, E., and Chang, L.-S. (1995) Mol. Cell. Biol. 15, 3552-3562 |
| 15. | Liu, N., Lucibello, F. C., Zwicker, J., Engeland, K., and Müller, R. (1996) Nucleic Acids Res. 24, 2905-2910 |
| 16. | Bennett, J. D., Farlie, P. G., and Watson, R. J. (1996) Oncogene 13, 1073-1082 |
| 17. | Russell, P., and Nurse, P. (1986) Cell 45, 145-153 |
| 18. | Millar, J. B. A., and Russell, P. (1992) Cell 68, 407-410 |
| 19. | Nagata, A., Igarashi, M., Jinno, S., Suto, K., and Okayama, H. (1991) New Biol. 3, 959-968 |
| 20. | Millar, J. B. A., McGowan, C. H., Lenaers, G., Jones, R., and Russell, P. (1991) EMBO J. 10, 4301-4309 |
| 21. | Millar, J. B. A., Blevitt, J., Gerace, L., Sadu, K., Featherstone, C., and Russell, P. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 10500-10504 |
| 22. | Lee, M. S., Ogg, S., Xu, M., Parker, L., Donoghue, D., Maller, J., and Piwnica-Worms, H. (1992) Mol. Biol. Cell 3, 73-84 |
| 23. | Kumagai, A., and Dunphy, W. G. (1991) Cell 64, 903-914 |
| 24. | Gautier, J., Solomon, M. J., Booher, R. N., Bazan, J. F., and Kirschner, M. W. (1991) Cell 67, 197-211 |
| 25. | Honda, R., Ohba, Y., Nagata, A., Okayama, H., and Yasuda, H. (1993) FEBS Lett. 318, 331-334 |
| 26. | Jinno, S., Suto, K., Nagata, A., Igarashi, M., Kanaoka, Y., Nojima, H., and Okayama, H. (1994) EMBO J. 13, 1549-1556 |
| 27. | Sadhu, K., Reed, S. I., Richardson, H., and Russell, P. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5139-5143 |
| 28. | Strausfeld, U., Fernandez, A., Capony, J. P., Girard, F., Lautredou, N., Derancourt, J., Labbe, J. C., and Lamb, N. J. (1994) J. Biol. Chem. 269, 5989-6000 |
| 29. | Dunphy, W. G., and Kumagai, A. (1991) Cell 67, 189-196 |
| 30. | Sebastian, B., Kakizuka, A., and Hunter, T. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 3521-3524 |
| 31. | Blomberg, I., and Hoffmann, I. (1999) Mol. Cell. Biol. 19, 6183-6194 |
| 32. | Forrest, A. R., McCormack, A. K., DeSouza, C. P., Sinnamon, J. M., Tonks, I. D., Hayward, N. K., Ellem, K. A., and Gabrielli, B. G. (1999) Biochem. Biophys. Res. Commun. 260, 510-515 |
| 33. | Gabrielli, B. G., De Souza, C. P., Tonks, I. D., Clark, J. M., Hayward, N. K., and Ellem, K. A. (1996) J. Cell Sci. 109, 1081-1093 |
| 34. | Reynolds, R. A., Yem, A. W., Wolfe, C. L., Deibel, M. R., Jr., Chidester, C. G., and Watenpaugh, K. D. (1999) J. Mol. Biol. 293, 559-568 |
| 35. | Lammer, C., Wagerer, S., Saffrich, R., Mertens, D., Ansorge, W., and Hoffmann, I. (1998) J. Cell Sci. 111, 2445-2453 |
| 36. | Nishijima, H., Nishitani, H., Seki, T., and Nishimoto, T. (1997) J. Cell Biol. 138, 1105-1116 |
| 37. | Zwicker, J., Lucibello, F. C., Wolfraim, L. A., Gross, C., Truss, M., Engeland, K., and Müller, R. (1995) EMBO J. 14, 4514-4522 |
| 38. | Lucibello, F. C., Truss, M., Zwicker, J., Ehlert, F., Beato, M., and Müller, R. (1995) EMBO J. 14, 132-142 |
| 39. | Liu, N., Lucibello, F. C., Körner, K., Wolfraim, L. A., Zwicker, J., and Müller, R. (1997) Nucleic Acids Res. 25, 4915-4920 |
| 40. | Huet, X., Rech, J., Plet, A., Vie, A., and Blanchard, J. M. (1996) Mol. Cell. Biol. 16, 3789-3798 |
| 41. | Tommasi, S., and Pfeifer, G. P. (1995) Mol. Cell. Biol. 15, 6901-6913 |
| 42. | Shelby, R. D., Vafa, O., and Sullivan, K. F. (1997) J. Cell Biol. 136, 501-513 |
| 43. | Uchiumi, T., Longo, D. L., and Ferris, D. K. (1997) J. Biol. Chem. 272, 9166-9174 |
| 44. | Li, F., and Altieri, D. C. (1999) Cancer Res. 59, 3143-3151 |
| 45. | Philips, A., Chambeyron, S., Lamb, N., Vie, A., and Blanchard, J. M. (1999) Oncogene 18, 6222-6232 |
| 46. | Wu, W., Fan, Y. H., Kemp, B. L., Walsh, G., and Mao, L. (1998) Cancer Res. 58, 4082-4085 |
| 47. | Gasparotto, D., Maestro, R., Piccinin, S., Vukosavljevic, T., Barzan, L., Sulfaro, S., and Boiocchi, M. (1997) Cancer Res. 57, 2366-2368 |
| 48. | Kudo, Y., Yasui, W., Ue, T., Yamamoto, S., Yokozaki, H., Nikai, H., and Tahara, E. (1997) Jpn. J. Cancer Res. 88, 947-952 |
| 49. | Ma, Z. Q., Chua, S. S., DeMayo, F. J., and Tsai, S. Y. (1999) Oncogene 18, 4564-4576 |
| 50. | Yao, Y., Slosberg, E. D., Wang, L., Hibshoosh, H., Zhang, Y. J., Xing, W. Q., Santella, R. M., and Weinstein, I. B. (1999) Oncogene 18, 5159-5166 |
| 51. | Herber, B., Truss, M., Beato, M., and Muller, R. (1994) Oncogene 9, 2105-2107 |
| 52. | Kakizuka, A., Sebastian, B., Borgmeyer, U., Hermans-Borgmeyer, I., Bolado, J., Hunter, T., Hoekstra, M. F., and Evans, R. M. (1992) Genes Dev. 6, 578-590 |
| 53. | Belyavsky, A., Vinogradova, T., and Rajewsky, K. (1989) Nucleic Acids Res. 17, 2919-2932 |
| 54. | Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988) Science 239, 487-491 |
| 55. | Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475-1489 |
| 56. | Barberis, A., Superti-Furga, G., and Busslinger, M. (1987) Cell 50, 347-359 |
| 57. | Pfeifer, G. P., Steigerwald, S., Mueller, P. R., and Riggs, A. D. (1989) Science 246, 810-813 |
| 58. | Mantovani, R., Pessara, U., Tronche, F., Li, X. Y., Knapp, A. M., Pasquali, J. L., Benoist, C., and Mathis, D. (1992) EMBO J. 11, 3315-3322 |
| 59. | Zwicker, J., Gross, C., Lucibello, F. C., Truss, M., Ehlert, F., Engeland, K., and Müller, R. (1995) Nucleic Acids Res. 23, 3822-3830 |
| 60. | Dennig, J., Hagen, G., Beato, M., and Suske, G. (1995) J. Biol. Chem. 270, 12737-12744 |
| 61. | Körner, K., Wolfraim, L. A., Lucibello, F. C., and Müller, R. (1997) Nucleic Acids Res. 25, 4933-4939 |
| 62. | Sorensen, P., and Wintersberger, E. (1999) J. Biol. Chem. 274, 30943-30949 |
| 63. | Adachi, N., Nomoto, M., Kohno, K., and Koyama, H. (2000) Gene 245, 49-57 |
| 64. | Bolognese, F., Wasner, M., Dohna, C. L., Gurtner, A., Ronchi, A., Muller, H., Manni, I., Mossner, J., Piaggio, G., Mantovani, R., and Engeland, K. (1999) Oncogene 18, 1845-1853 |
| 65. | Facchinetti, V., Lopa, R., Spreafico, F., Bolognese, F., Mantovani, R., Tavner, F., Watson, R., Introna, M., and Golay, J. (2000) Oncogene 19, 3931-3940 |
| 66. | Linhoff, M. W., Wright, K. L., and Ting, J. P. (1997) Mol. Cell. Biol. 17, 4589-4596 |
| 67. | Zwicker, J., Lucibello, F. C., Jérôme, V., Brüsselbach, S., and Müller, R. (1997) Nucleic Acids Res. 25, 4926-4932 |
This article has been cited by other articles:
![]() |
S. D. Bush, P. Richard, and J. L. Manley Variations in Intracellular Levels of TATA Binding Protein Can Affect Specific Genes by Different Mechanisms Mol. Cell. Biol., January 1, 2008; 28(1): 83 - 92. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gurtner, I. Manni, P. Fuschi, R. Mantovani, F. Guadagni, A. Sacchi, and G. Piaggio Requirement for Down-Regulation of the CCAAT-binding Activity of the NF-Y Transcription Factor during Skeletal Muscle Differentiation Mol. Biol. Cell, July 1, 2003; 14(7): 2706 - 2715. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Schmidt, A. A. Bondareva, J. R. Radke, and M. R. Capecchi Fundamental Cellular Processes Do Not Require Vertebrate-specific Sequences within the TATA-binding Protein J. Biol. Chem., February 14, 2003; 278(8): 6168 - 6174. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Han and S. Amar Identification of Genes Differentially Expressed in Cultured Human Periodontal Ligament Fibroblasts vs. Human Gingival Fibroblasts by DNA Microarray Analysis J. Dent. Res., June 1, 2002; 81(6): 399 - 405. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Haugwitz, M. Wasner, M. Wiedmann, K. Spiesbach, K. Rother, J. Mossner, and K. Engeland A single cell cycle genes homology region (CHR) controls cell cycle-dependent transcription of the cdc25C phosphatase gene and is able to cooperate with E2F or Sp1/3 sites Nucleic Acids Res., May 1, 2002; 30(9): 1967 - 1976. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |