![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 13, 9896-9902, March 30, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Molecular Microbiology and Immunology, Keck School of Medicine, University of Southern California, Los Angeles, California 90033
Received for publication, September 19, 2000, and in revised form, December 13, 2000
| |
ABSTRACT |
|---|
|
|
|---|
Werner syndrome (WS) is an inherited
disease characterized by premature onset of aging, increased cancer
incidence, and genomic instability. The WS gene encodes a protein with
helicase and exonuclease activities. Our previous studies
indicated that the Werner syndrome protein (WRN) interacts with Ku, a
heterodimeric factor of 70- and 80-kDa subunits implicated in the
repair of double strand DNA breaks. Moreover, we demonstrated that
Ku70/80 strongly stimulates and alters WRN exonuclease activity. In
this report, we investigate further the association between WRN and
Ku70/80. First, using various WRN deletion mutants we show that 50 amino acids at the amino terminus are required and sufficient to
interact with Ku70/80. In addition, our data indicate that the region
of Ku80 between amino acids 215 and 276 is necessary for binding to
WRN. Then, we show that the amino-terminal region of WRN from amino
acid 1 to 388, which comprise the exonuclease domain, can be
efficiently stimulated by Ku to degrade DNA substrates, indicating that
the helicase domain and the carboxyl-terminal tail are not required for
the stimulatory process. Finally, using gel shift assays, we
demonstrate that Ku recruits WRN to DNA. Taken together, these results
suggest that Ku-mediated activation of WRN exonuclease activity may
play an important role in a cellular pathway that requires processing
of DNA ends.
Werner syndrome (WS)1 is
a rare disorder characterized by the early appearance of many diseases
characteristics of human aging such as atherosclerosis, osteoporosis
and diabetes mellitus type II (1-3). In addition, WS patients are
prone to many types of soft tissue tumors (4). Cells from WS patients
display a shortened replicative life span and elevated levels of
chromosomal abnormalities, including insertions, deletions and
translocations (5, 6). The gene responsible for WS has been cloned and
encodes a protein of 1,432 amino acids (WRN) (7). A nuclear
localization signal has been identified at its carboxyl-terminal end
(8), and all the described WS mutations result in a predicted truncated
protein that fails to enter the nucleus. The central region of WRN is homologous to a seven-motif domain found in helicases from a wide variety of organisms, including bacteria (recQ), yeast (Sgs1), and
human (Bloom syndrome (BLM), RecQL) (7, 9, 10). On the other hand, the
amino-terminal region of WRN is quite unique among this family of
helicases because it contains a sequence that resembles the exonuclease
domain of Escherichia coli RNA polymerase I and RNase D (11,
12). Indeed, studies with the purified recombinant protein have shown
that WRN displays both 3'- to 5'-exonuclease and 3'- to 5'-helicase
activities (13-15).
We have shown recently that Ku interacts with and alters the
specificity of the WRN exonuclease (16). These results indicated that
in the presence of Ku, WRN degradation of 3'-recessed strand of a
partial DNA duplex is strongly stimulated. In addition, Ku alters the
specificity of WRN so that the blunt end DNA duplex and
3'-protruding DNA are also hydrolyzed by WRN exonuclease. Ku is a 70- and 80-kDa heterodimer that binds to the ends of double strand DNA and
translocates along the DNA in an ATP-independent manner, allowing
several Ku heterodimers to bind to a single DNA molecule (17-20). In
higher eukaryotes, Ku has been implicated in the metabolism of DNA
ends, including the repair of double strand DNA breaks (DSBs) and the
V(D)J recombination process (21, 22). In mammalian cells, Ku appears to
be the first protein to recognize DSBs. Upon binding to the ends of
broken DNA, Ku interacts with the DNA-dependent protein
kinase catalytic subunit, stabilizes the interaction of this
catalytic subunit with DNA, and enhances its protein kinase activity
(18, 21, 23, 24). The subsequent steps in the end-joining process are
then thought to require the recruitment of specific activities
necessary for the processing and ligation of DNA ends (25-28).
Although factors such as XRCC4 and DNA ligase IV have been shown
to be required for the ligation step, the processing of DNA ends is
still poorly understood, and the identity of the nucleases involved in
this process remains to be defined. Interestingly, the finding that Ku
interacts with and stimulates the activity of the WRN exonuclease suggests that WRN may be one of the factors that function in the processing of broken DNA ends. In this study, to understand better the
functional relevance of this finding, we have characterized the
interaction of WRN with Ku and DNA ends. First, we show that Ku
interacts with the extreme amino terminus of WRN, from amino acid 1 to
50, whereas the central region of Ku80, from amino acid 215 to 276, is
necessary for binding to WRN. Then, we demonstrate that Ku can
efficiently stimulate the exonuclease activity of an amino-terminal
mutant WRN (WRN Protein Purification--
Recombinant FLAG-WRN and a
series of FLAG-WRN deletion mutants were purified as described in Ref
16. Baculoviruses expressing recombinant FLAG epitope-tagged WRN were
used to infect Sf9 cells. Whole cell lysates were prepared
in lysis buffer (10 mM Hepes pH 7.5, 100 mM
NaCl, 1.5 mM MgCl2, 0.5% Nonidet P-40).
FLAG-WRN was purified through a DEAE-cellulose column and by affinity
chromatography on anti-FLAG resin. Histidine-tagged Ku70 and Ku80 were
coexpressed in Sf9 cells, and the Ku70/80 heterodimer was
purified by metal affinity resin (Talon, CLONTECH
Biotech) and DNA cellulose chromatography. The plasmid containing the
WRN cDNA with a substitution at amino acid 82 (Asp Protein Binding Assays--
EcoRI-digested
full-length Ku80 cDNA fragments were subcloned in-frame into the
EcoRI site of pCDNA3.1-HisC. This allows different subdomains of Ku80 to be expressed in vitro under
the control of the T7 RNA polymerase promoter. These constructs were
then subjected to in vitro transcription-translation in the
presence of [35S]methionine (NEN Life Science Products)
using a rabbit reticulocyte lysate translation system (Promega). 2 µg
of FLAG-WRN was immobilized on FLAG beads and then incubated with 15 µl of in vitro translated Ku80 mutants and 135 µl of
buffer containing 10 mM Hepes pH 7.5, 100 mM NaCl, 1.5 mM MgCl2, 0.5 mM EDTA, 10% glycerol, and 0.2% Nonidet P-40. After
extensive washes, resin-bound proteins were released by boiling
in SDS-sample buffer and electrophoresed on SDS-polyacrylamide gel
followed by autoradiography.
Mutant WRNs were generated by insertion of the appropriate cDNA
sequences into either pGEX-2T or pGEX-3X vectors and expressed as GST
fusion proteins in E. coli [(GST-WRN(1-50),
GST-WRN(50-749), and GST-WRN(150-749); numbers represent amino acid
residues spanning the fusion protein)]. 4 µg of each purified GST
fusion protein and FLAG-WRN were immobilized on the appropriate
affinity beads (glutathione or FLAG resins) and then incubated with 500 µl of cell lysates prepared from Sf9 cells expressing Ku80
(the concentration of Ku80 in the extract was estimated at ~3
ng/µl). After extensive washing, bound proteins were eluted from the
beads using BCO buffer (1 M KCl, 10 mM Tris-HCl
pH 7.5, 1 mM EDTA, 5% glycerol, 1 mM dithiothreitol) containing a mixture of protease inhibitors, and analyzed by SDS-PAGE and Western blotting with anti-Ku80 antibodies. In
a similar assay, 4 µg of each WRN GST fusion protein and FLAG-WRN were immobilized on beads and then incubated with 500 µl of lysates from Sf9 cell coinfected with baculoviruses expressing Ku70
and Ku80. After extensive washes, the bound proteins were released from
the beads using BCO buffer, and then analyzed by SDS-PAGE and silver staining.
Exonuclease Assay--
DNA exonuclease activity was
measured as described in (16): 20-oligomer A1 (CGCTAGCAATATTCTGCAGC),
20-oligomer A2 (GCTGCAGAATATTGCTAGCG) complementary to A1, and
46-oligomer A3 (GCGCGGAAGCTTGGCTGCAGAATAT TGCTAGCGGGAAATCGGCGCG)
partially complementary to A1. Oligonucleotides were labeled at
the 5'-end with [32P]ATP and T4 polynucleotide kinase.
The appropriate oligonucleotides were annealed by boiling followed by
slow cooling to room temperature. Reaction mixtures contained 40 mM Tris-HCl pH 7.5, 4 mM MgCl2, 5 mM dithiothreitol, 1 mM ATP, 0.1 mg/ml bovine
serum albumin, 40 fmol of DNA substrate (100,000 cpm), and 100 fmol
each of Ku70, Ku80, Ku70/80, WRN Electrophoretic Mobility Shift Assay--
40-mer (B1)
(GATTTCCCGCTAGCAATATTCTGCAGCCAAGCTTCCGCGC) was labeled using
[32P]ATP and T4 polynucleotide kinase and then annealed
to a partially complementary 46-mer (A3). 32P-Labeled DNA
(80 fmol, 200,000 cpm) was incubated with increasing amounts (100-300
fmol) of Ku and full-length WRN in 10 µl of buffer (10 mM
Tris-HCl pH 7.5, 80 mM NaCl, 4 mM KCl, 2 mM EDTA, and 10% glycerol) at 25 °C for 10 min. Then,
the samples were resolved by electrophoresis through a 4%
polyacrylamide gel at 10 V/cm in the cold room. The gels were dried on
Whatman 3MM paper and subjected to autoradiography. For gel supershift
assays, 200 fmol of Ku and 200 fmol of WRN were first preincubated with
DNA substrates at 25 °C for 10 min under the conditions
described above. Then, 200 ng of goat polyclonal Ku80 antibodies
(Santa Cruz), goat polyclonal Mapping the Interaction Domains between WRN and Ku80--
We have
shown previously that the amino-terminal region of WRN interacts with
Ku80 (16). To identify the minimal amino acid domain of WRN necessary
for this protein-protein interaction, we performed pull-down assays
using GST-WRN fusion proteins containing different segments of the
amino-terminal region of WRN (GST-WRN(1 Ku70/80 Alters the Exonuclease Activity of WRN
To confirm that the DNA degradation is catalyzed by WRN and not by a
contaminating activity present in the Ku preparation, we performed the
exonuclease assay in the presence of WRN82A, a point mutant of WRN
lacking exonuclease activity (13). As shown in Fig.
4, there was no detectable exonuclease
activity in the presence of either WRN82A alone (lane 5),
Ku70 (lane 2), Ku80 (lane 3), Ku70/80 (lane
4), or any combination of WRN82A, Ku70, and Ku80 (lanes
5-8), suggesting that the observed DNA degradation depends on the
presence of a functional WRN exonuclease.
In conclusion, Ku stimulates and alters the exonuclease activity of WRN
lacking the helicase domain, suggesting that DNA unwinding is not
required in this process.
Ku Stimulates WRN Exonuclease Activity in an ATP-independent
Manner--
WRN contains amino acid regions possessing nucleic
acid-dependent ATPase and helicase activities (7, 14). It
has also been shown that the helicase activity of WRN is completely
dependent on the hydrolysis of ATP, and ATP significantly stimulates
the activity of the WRN exonuclease (29, 30). To investigate further the mechanism of stimulation of the WRN exonuclease activity by Ku, we
then asked whether ATP is required for this stimulatory process. As
shown in Fig. 5, in the presence of Ku,
the addition of ATP had no effect on the activity of either full-length
WRN or WRN Ku Recruits WRN to Double Strand DNA--
Ku has high specificity
for DNA substrates, it binds tightly to the ends of double strand DNA,
and has equal affinity for 5'-protruding, 3'-protruding, and blunt end
DNA (18, 31). On the other hand, WRN binds very weakly to double strand
DNA (32, 33). Therefore, we performed electrophoretic mobility shift
analysis to determine whether Ku facilitates the recruitment of WRN to
DNA through protein-protein interactions. Upon incubation of a
40/46-mer DNA duplex with purified Ku, we observed the formation of two
distinct complexes (Fig. 6, lanes
4-6; complexes 1 and 2), most likely representing either one or
two Ku70/80 heterodimers binding to one DNA molecule. In contrast, WRN
failed to bind to DNA, as determined by the absence of any retarded
complex on the gel (lanes 2 and 3). However, when
both WRN and Ku were incubated with the DNA substrate, in addition to
the complexes observed previously (complexes 1 and 2), a slower
migrating band appeared in the gel (lanes 7-12; complex 3).
This band, as well as the Ku·DNA complex 2, was supershifted by
anti-Ku80 antibodies (lane 13). Moreover, the addition of
WRN antibodies supershifted the putative WRN·Ku·DNA complex,
whereas the Ku·DNA complexes were unaffected (lane 14).
Antibodies against an unrelated protein ( Previous studies demonstrated that WRN possesses an intrinsic 3'-
to 5'-exonuclease activity that digests 3'-recessed DNA substrates (13,
15). More recently, our work has indicated that WRN interacts with
Ku70/80 heterodimer, and Ku70/80 stimulates and alters the exonuclease
activity of WRN, so that it can hydrolyze 3'-recessed, 5'-recessed, and
blunt end DNA substrates efficiently (16). Because WRN does not bind to
double strand DNA and has only a weak affinity for single strand DNA
(32), our finding raises the possibility that Ku may function as a
bridging factor that brings WRN in close proximity to its DNA
substrate. Ku-mediated recruitment of WRN may therefore represent a
critical step in the targeting and subsequent activation of WRN
exonuclease on specific DNA sites. In this study, to understand better
the functional relationship between Ku and WRN, we have performed a
detailed analysis of the interactions between these two factors. Our
analysis shows that the interaction between WRN and Ku80 requires a
stretch of 50 amino acids at the extreme amino terminus of WRN. These results are in apparent conflict with the data by Cooper et
al. (34) showing that Ku interacts with the carboxyl-terminal
region of WRN. Under our experimental conditions, we have never
detected a direct interaction between the carboxyl-terminal domain of
WRN and Ku. As we have suggested previously (16), because the carboxyl terminus of WRN can dimerize with the full-length protein (34), it is
possible that cellular WRN may have mediated the interaction observed
in their affinity purification experiment.
Our analysis of Ku80 mutants has also allowed the identification of a
region between amino acids 215 and 276 as an important domain required
for Ku80 binding to WRN. This region is distinct from the regions of
Ku80 which have been found to be involved in interactions with Ku70 and
a DNA-dependent protein kinase catalytic subunit
(35-37).
Because the region of WRN which binds to Ku80 is proximal to the WRN
exonuclease domain, we reasoned that the amino-terminal region of WRN
might be sufficient for Ku stimulation of the exonuclease activity. To
address this point, we investigated the effect of Ku on the exonuclease
activity of WRN
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
C388; amino acids 1-388), indicating that the
helicase and carboxyl-terminal domains of WRN are dispensable for
Ku-stimulated processing of DNA ends. Moreover, using electrophoretic mobility shift assays we show that WRN forms a strong complex with Ku
on DNA.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
Ala; WRN82A)
was constructed using a polymerase chain reaction-based strategy. The
open reading frame with amino acids 1-82A, and 82A-311 were amplified
by polymerase chain reaction using the following DNA primers:
5'-CGGCCATATGAGTGAAAAAAAATTGGA-3'/5'-TGGCCACTCCATGGCAAATCCCACC-3' and
5'-TGGTGGGATT TGCCATGGAGTGGC-3'/5'-AAAGGATCCATGGGCCTCAGTTCAGTCTCA-3'. The amplified fragments were digested with NdeI and
NcoI and subcloned into pRSET-A vector. An
NdeI-EcoRV fragment containing a substitution at
position 82 (Asp
Ala) was then cloned into pcDNA-FLAG-WRN. Full-length WRN cDNA containing the D82A substitution was subcloned into the NdeI-NotI sites of pVL1392-FLAG-WRN.
Recombinant DNA was purified and transfected into Sf9 cells
with linearized baculovirus DNA (BaculoGold, PharMingen) to generate
the recombinant baculovirus expressing FLAG epitope-tagged WRN82A.
C388, WRN, and WRN82A in a final
volume of 10 µl. The reaction mixtures were incubated at room
temperature for 10 min, and each reaction was then terminated by the
addition of 2 µl of a 95% formamide solution. After incubation at
95 °C for 3 min, the DNA products were resolved by either 12% or
16% polyacrylamide-urea gel electrophoresis and visualized by autoradiography.
-actin antibodies (Santa
Cruz), or rabbit polyclonal WRN antibodies (Novus), was added to the
appropriate reaction mixture. After a 10-min incubation at 25 °C,
the samples were loaded on a polyacrylamide gel and processed as
described above.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
50), GST-WRN(50
749), and
GST-WRN(150
749)) (Fig. 1A).
In addition, full-length FLAG-WRN was used in the assay as positive
control. Each GST fusion protein and FLAG-WRN was immobilized on either glutathione or FLAG beads and used in pull-down assays with lysates from Sf9 cells infected with a recombinant baculovirus
expressing Ku80. After extensive washes, the bound products were
resolved on a SDS-PAGE and analyzed by Western blotting with antibodies against Ku80. As expected, Ku80 interacted with FLAG-tagged WRN (Fig.
1B, lane 5). In addition, Ku80 was pulled down by
the GST fusion protein containing the region of WRN from amino acid 1 to 50 (lane 2), whereas GST fusion proteins containing WRN
amino acids 50-749 (lane 4), amino acids 150-749
(lane 3), or a control GST protein (lane 1)
failed to interact with Ku80. These results indicate that the region of
WRN between amino acids 1 and 50 is necessary and sufficient for
binding to Ku80. To demonstrate further that this region of WRN
interacted with an integral Ku70/80 heterodimer, each of the
immobilized GST fusion proteins and FLAG-WRN was incubated with an
Sf9 lysate coinfected with two baculoviruses expressing Ku70
and Ku80. After extensive washes, the bound proteins were analyzed with
SDS-PAGE and silver staining. The results of this experiment confirmed
that the amino-terminal domain (amino acids 1-50) is sufficient for
binding to the Ku70/80 heterodimer (Fig. 1C, lane
3). Identical results were obtained when purified proteins were
mixed in solution prior to pull down (not shown). To complement this
analysis and identify the region of Ku80 necessary for the interaction
with WRN, various deletion mutants of Ku80 were expressed in an
in vitro reticulocyte lysate system in the presence of
[35S]methionine (Fig.
2A, upper panel).
The in vitro translated products were then incubated with
either FLAG-tagged WRN (Fig. 2A, lower panel) or
a control FLAG-tagged hepatitis C virus polymerase (not shown) that
were immobilized on FLAG beads. Bound proteins were resolved on a
SDS-PAGE and analyzed by autoradiography (Fig. 2B). This
experiment revealed that deletion of the carboxyl-terminal region of
Ku80, from amino acid 277 to 732, did not affect the binding to WRN
(lanes 2-4); however, further deletion to amino acid 216 completely abolished the interaction (lane 1). Deletion of
the amino terminus of Ku80, from amino acids 1 to 325, also abrogated
the interaction with WRN (lane 5). The FLAG-tagged hepatitis C virus polymerase did not interact with any of the Ku80 mutants used
in this assay (data not shown). Thus, these results indicate that the
central region of Ku80, from amino acids 215 to 276, is important for
mediating the interaction with WRN.

View larger version (20K):
[in a new window]
Fig. 1.
The amino-terminal region of WRN, from
amino acid 1 to 50, binds to Ku80. A, Coomassie-stained
gel showing the bacterially expressed and purified GST (lane
1), GST-WRN(1-50) (lane 2), GST-WRN(150-749)
(lane 3), GST-WRN(50-749) (lane 4), and FLAG-WRN
(lane 5) used in the protein binding assay. Lane
6 shows the molecular markers. B, approximately 4 µg
of purified GST (lane 1), GST-WRN(1-50) (lane
2), GST-WRN(150-749) (lane 3), GST-WRN(50-749)
(lane 4), and FLAG-WRN (lane 5) was immobilized
on the appropriate affinity beads. Each reaction mixture was then
incubated with 500 µl of cell lysates from insect cells expressing
Ku80, and bound proteins were analyzed by Western blotting with
anti-Ku80 antibodies as described under "Experimental Procedures."
The input lane (lane 6) shows ~5% of the Ku80 used in
each pull-down assay. C, the amino-terminal region of WRN
(1-50 amino acids) binds to Ku70/80 heterodimer. Approximately 4 µg
of purified GST (lane 2), GST-WRN(1-50) (lane
3), GST-WRN(150-749) (lane 4), GST-WRN(50-749)
(lane 5), and FLAG-WRN (lane 6) was immobilized
on affinity beads. Each reaction mixture was then incubated with 500 µl of cell lysates from insect cells expressing Ku7 and Ku80, and
bound proteins were analyzed by SDS-PAGE and silver staining.
Lane 7 shows purified recombinant Ku70/80 heterodimer.

View larger version (24K):
[in a new window]
Fig. 2.
The region of Ku80 between amino acids 215 and 276 is necessary for the interaction with WRN. A,
top panel, autoradiogram showing
[35S]methionine-labeled Ku80(1-215) (lane 1),
Ku80(1-276) (lane 2), Ku80(1-500) (lane 3),
full-length Ku80 (lane 4), and Ku80(325-732) (lane
5) used in the protein binding assay. Bottom panel,
Coomassie-stained gel shows that equal amounts of FLAG-WRN protein were
used in each binding reaction. B, FLAG-tagged WRN (2 µg)
was immobilized on affinity beads that were then incubated with
[35S]methionine-labeled Ku80 mutants as described under
"Experimental Procedures." The bound proteins were separated by
SDS-PAGE and analyzed by autoradiography. Lane 1,
Ku80(1-215); lane 2, Ku80(1-276); lane 3,
Ku80(1-500); lane 4, full-length Ku80; lane 5,
Ku80(325-732).
C388--
WRN
exonuclease activity resides near its amino terminus (13, 29), whereas
the helicase domain is located in the central portion of the protein
(7, 14, 15). A recent study also found that the amino-terminal domain
of WRN, from amino acids 1 to 333, is sufficient for the degradation of
DNA substrates with a 3'-overhang (13). Because our results indicate
that this region of WRN also binds to Ku80 (see Fig. 1), we were
interested in testing whether WRN
C388, a mutant form of WRN
containing the first 388 amino acids and missing the helicase domain,
is sufficient for Ku-dependent enhancement of DNA
hydrolysis. FLAG epitope-tagged mutant WRN (WRN
C388) was produced
using a baculovirus expression system and then used in exonuclease
assays with several DNA substrates in the presence or absence of Ku70,
Ku80, or Ku70/80. WRN
C388 weakly hydrolyzed the 3'-recessed strand
of a partial DNA duplex and the 3'-ends of blunt end DNA (Fig. 3,
A and B, lane
4). Importantly, in the presence of Ku70/80, the exonuclease
activity of WRN
C388 was strongly stimulated (lane 7). The
dramatic increase in exonuclease activity depended on the presence of
Ku70/80 because either Ku70 or Ku80 alone failed to stimulate
WRN
C388 (lanes 5 and 6). More significantly,
in the presence of the Ku70/80 heterodimer, WRN
C388 efficiently
digested 3'-protruding ends and single strand DNA substrates (Fig. 3,
C and D, lane 7).

View larger version (37K):
[in a new window]
Fig. 3.
Ku70/80 heterodimer stimulates
WRN
C388 hydrolysis of double and single strand
DNA. A, 100 fmol of purified WRN
C388,
WRN
C388·Ku70, WRN
C388·Ku80, and
WRN
C388·Ku70/80 was incubated with 3'-recessed,
5'-32P-labeled 20-mer (A1)/46-mer (A3) DNA substrate at
room temperature for 10 min. The reaction products were analyzed by
16% polyacrylamide-urea denaturing gel and autoradiography (lane
1, Ku70; lane 2, Ku80; lane 3, Ku70/80;
lane 4, WRN
C388; lane 5, WRN
C388·Ku70;
lane 6, WRN
C388·Ku80; lane 7,
WRN
C388·Ku70/80; lane 8, DNA probe only). B,
blunt-ended, 5'-32P-labeled 20-mer (A1)/20-mer (A2) DNA
substrate was used in exonuclease assays under the conditions described
above. C, 3'-protruding, 5'-32P-Labeled 46-mer
(A3)/20-mer (A1) DNA substrate was used in exonuclease assays as
described in A. D, 5'-32P-Labeled
5'-20-mer single strand DNA substrate was used in exonuclease assays as
described in A.

View larger version (40K):
[in a new window]
Fig. 4.
Ku70/80 stimulation depends on the presence
of active WRN exonuclease. 5'-Overhang, 5'-32P-labeled
20-mer (A1)/46-mer (A3) DNA substrate was incubated with WRN82A, WRN,
and Ku70/80 (100 fmol each) under the conditions described in Fig. 3.
Lane 1, probe only; lane 2, Ku70; lane
3, Ku80; lane 4, Ku70/80; lane 5, WRN82A;
lane 6, WRN82A·Ku70; lane 7, WRN82A·Ku80;
lane 8, WRN82A·Ku70/80; lane 9, WRN; lane
10, WRN·Ku70/80.
C388, indicating that Ku-mediated stimulation of WRN
exonuclease activity does not require ATP hydrolysis.

View larger version (47K):
[in a new window]
Fig. 5.
ATP is not required for stimulation of WRN
exonuclease activity by Ku. 100 fmol of purified WRN, WRN
C388,
or Ku70/80 was incubated with 5'-32P-labeled 20-mer
(A1)/46-mer (A3) at room temperature for 10 min in exonuclease buffer
(40 mM Tris-HCl pH 7.5, 4 mM MgCl2,
5 mM dithiothreitol, 0.1 mg/ml bovine serum albumin) in the
presence (lanes 2, 4, 6, 8)
or absence (lanes 1, 3, 5,
7) of 1 mM ATP. Products were analyzed by 16%
polyacrylamide-urea denaturing gel and autoradiography (lane
1, WRN
ATP; lane 2, WRN + ATP; lane
3, WRN·Ku70/80
ATP; lane 4, WRN·Ku70/80 + ATP; lane 5, WRN
C388
ATP; lane 6,
WRN
C388 + ATP; lane 7, WRN
C388·Ku70/80
ATP;
lane 8, WRN
C388·Ku70/80 + ATP; lane 9, probe
only).
-actin) had no effect on
the relative mobility of any of the observed complexes (lane
15). Altogether, these results indicate that WNR can form a stable
complex on DNA in the presence of Ku, further supporting the idea that
Ku recruits WRN to DNA ends through specific protein-protein
interaction.

View larger version (52K):
[in a new window]
Fig. 6.
Ku70/80 recruits WRN to DNA.
5'-32P-labeled 40-mer (B1)/46-mer (A3) DNA substrate was
incubated with the indicated amounts (fmol) of WRN and/or Ku70/80 at
room temperature for 10 min in the absence (lanes 1-12) or
presence (lanes 13-15) of the specified antibody (200 ng).
The reactions were analyzed by 4% native polyacrylamide gel
electrophoresis, and the DNA-protein complexes were visualized by
autoradiography (lane 1, DNA probe only; lanes 2 and 3, 100 and 200 fmol of WRN, respectively; lanes
4-6, 100, 200, and 300 fmol of Ku70/80, respectively; lanes
7-9, 100, 200, and 300 fmol of Ku70/80, respectively, and 200 fmol of WRN; lanes 10-12, 100, 200, and 300 fmol of WRN,
respectively, and 200 fmol of Ku70/80; lane 13, 200 fmol of
Ku70/80, 200 fmol of WRN, and 200 ng of Ku80 antibodies; lane
14, 200 fmol of Ku70/80, 200 fmol of WRN, and 200 ng of WRN
antibodies; lane 15, 200 fmol of Ku70/80, 200 fmol of WRN,
and 200 ng of
-actin antibodies).
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
C388, a form of WRN which is missing the helicase
domain and the carboxyl-terminal region. Our results indicate that
although WRN
C388 poorly digests 3'-recessed ends and blunt end DNA
duplexes, in the presence of Ku it efficiently digests 3'-recessed,
5'-recessed ends and blunt end DNA duplexes as well as single strand
DNA. The observed activity is strictly dependent on the presence of a
functional WRN because Ku70/80 does not stimulate WRN82A, a mutant
protein lacking exonuclease activity. In addition, our results show
that ATP is dispensable for this stimulatory process. Thus,
Ku-stimulated WRN exonuclease activity is physically and functionally
separable from the helicase domain and the carboxyl terminus of WRN and
does not require ATP hydrolysis. To investigate how WRN can stably
associate with its DNA substrate, we then performed gel shift assays.
These experiments show that although WRN by itself has undetectable DNA
binding affinity, in the presence of Ku it forms a strong complex with DNA. These results imply that protein interactions between WRN and Ku
play a key role in the recruitment of WRN to DNA ends and suggest a
potential function in the processing of DSBs. In eukaryotic cells, DSBs
produced by external sources such as ionizing radiations or some
chemical agents undermine the integrity of the genome, and if not
repaired, they can lead to cell death (21, 27). In mammals, the Ku
heterodimer, DNA-dependent protein kinase catalytic subunit, and the Ligase4·Xrcc4 complex are involved the repair of
double strand DNA breaks by nonhomologous end joining (23, 24, 38, 39).
In addition, because improper ligation can be potentially deleterious
to the cell, several studies have suggested that nucleolytic activities
are necessary in the repair process to trim the DNA before the ends are
rejoined (40, 41). These nucleases must either recognize the broken DNA
ends or be recruited to the site of DNA damage by specific
protein-protein interactions. Mre11, a 3'- to 5'-exonuclease and
endonuclease, has been implicated in one or more DNA repair pathways
(21, 41). Mre11, Rad50, and NBS1, an Xrs2p-like protein whose loss
leads to Nijmegen breakage syndrome, bind cooperatively to DNA and form
a distinct protein-DNA complex (42). This complex displays several
enzymatic activities, including partial unwinding of the DNA duplex and
cleavage of the 3'-protruding end of double strand DNA. Recently, it
has also been shown that Mre11 can facilitate the joining of mismatched ends, suggesting that Mre11 may direct DNA end joining at sites of
microhomology (43). Nevertheless, whether Mre11 plays a role in
nonhomologous end joining remains unclear. WRN does not bind directly
to double strand DNA; however, it interacts with Ku and is recruited to
DNA ends by specific protein-protein interactions. Therefore, it is
tempting to speculate that WRN, like Mre11, may participate in a
specialized form of DNA repair which requires the proper processing of
DNA ends before they are rejoined. Within the last few years it has
become apparent that several distinct pathways of repairing DSBs
operate in mammalian cells (21, 40). Thus, it is likely that some of
these pathways, although sharing a subset of common components, may
also utilize a number of unique and more specialized factors. WRN
/
fibroblasts are sensitive to 4-nitroquinoline 1-oxide but are
insensitive to other DNA-damaging agents such as ionizing radiation
(44, 45), suggesting that if WRN is directly involved in the processing
of damaged DNA, it may be required for the repair of a specific subset
of DNA lesions. A later study on the ligation of linear plasmid DNA in lymphoblast cells from WS patients showed an increased rate of deletion
at the ligation site but no reduction in end joining (46). These data
may therefore indicate a subtle defect in the accuracy of the DSBs
repair machinery. Further support for the idea that WRN and Ku may be
part of a common pathway comes from studies of Ku80 mutant mice.
WRN
/
fibroblasts and cells from Ku80 knockout mice display
interesting similarities, such as a higher degree of chromosomal
instability characterized by DNA breakage, translocation, and
rearrangements (47-49). In addition, Ku80 knockout mice show signs of
premature aging, such as osteopenia, atrophic skin, and cancer (48).
Thus, both Ku80 and WRN appear to influence the rate of senescence.
Interestingly, WRN is localized in the nucleolus of human cells (50,
51), raising the possibility that its function may be required for a
specific nucleolar process. On the other hand, it is also possible that
WRN is sequestered and kept inactive in the nucleolus, ready to be
released when it is needed, as observed for some cell cycle regulatory
factors (52). Our goal is now to determine the specific process in
which the WRN nucleolytic activity is required. The answer to this and other questions on the function of the WRN will provide important clues
on the biological activities involved in the process of aging.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. W. H. Reeves, University of North Carolina, Chapel Hill, for providing the Ku 80 cDNA clone. We are grateful to T. Bui for technical assistance and to the members of the Comai laboratory for helpful discussions and suggestions.
| |
FOOTNOTES |
|---|
* This work was supported in part by a grant from the Wright Foundation (to L. C.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Molecular
Microbiology and Immunology, University of Southern California, Keck
School of Medicine, 2011 Zonal Ave., HMR-509, Los Angeles, CA
90033. Tel.: 323-442-3950; Fax: 323-442-1721; E-mail:
comai@hsc.usc.edu.
Published, JBC Papers in Press, January 4, 2001, DOI 10.1074/jbc.M008575200
| |
ABBREVIATIONS |
|---|
The abbreviations used are: WS, Werner syndrome; WRN, Werner syndrome protein; DSBs, double strand DNA breaks; GST, glutathione S-transferase; PAGE, polyacrylamide gel electrophoresis.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Epstein, C. J., Martin, G. M., Schultz, A. L., and Motulsky, A. G. (1966) Medicine 45, 177-221 |
| 2. | Dyer, C., and Sinclair, A. (1998) Age Ageing 27, 73-80 |
| 3. | Martin, G. M. (1978) Birth Defects Orig. Artic. Ser. 14, 5-39 |
| 4. | Goto, M., Miller, R. W., Ishikawa, Y., and Sugano, H. (1996) Cancer Epidemiol. Biomark. Prev. 5, 239-246 |
| 5. | Fukuchi, K., Martin, G. M., and Monnat, R. J. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 5893-5897 |
| 6. | Salk, D., Au, K., Hoehn, H., and Martin, G. M. (1985) Adv. Exp. Med. Biol. 190, 541-550 |
| 7. | Yu, C. E., Oshima, J., Fu, Y. H., Wijsman, E., Hisama, F., Alisch, R., Matthews, S., Nakura, J., Miki, T., Ouais, S., Martin, G., Mulligan, J., and Schellenberg, G. (1996) Science 272, 258-262 |
| 8. | Matsumoto, T., Shimamoto, A., Goto, M., and Furuichi, Y. (1997) Nat. Genet. 16, 335-336 |
| 9. | Ellis, N. A., Groden, T. Z., Ye, J., and Straughen, D. J. (1995) Cell 83, 655-666 |
| 10. | Puranam, K. L., and Blackshear, P. J. (1994) J. Biol. Chem. 269, 29838-29845 |
| 11. | Mushegian, A. R., Bassett, D. E., Boguski, M. S., Bork, P., and Koonin, E. V. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 5831-5836 |
| 12. | Moser, M. J., Holley, W. R., Chatterjee, A., and Mian, I. S. (1997) Nucleic Acids Res. 25, 5110-5118 |
| 13. | Huang, S., Li, B., Gray, M., Oshima, J., Mian, I. S., and Campisi, J. (1998) Nat. Genet. 20, 114-116 |
| 14. | Shen, J. C., Gray, M., Oshima, J., and Loeb, L. (1998) Nucleic Acids Res. 26, 2879-2885 |
| 15. | Shen, J. C., Gray, M., Oshima, J., Kamath-Loeb, A., Fry, M., and Loeb, L. (1998) J. Biol. Chem. 273, 34139-34144 |
| 16. | Li, B., and Comai, L. (2000) J. Biol. Chem. 275, 28349-28352 |
| 17. | Devries, E. W., Vandriel, W. C., Bergsma, A. C., and Vandervliet, P. C. (1989) J. Mol. Biol. 208, 65-78 |
| 18. | Mimori, T., and Hardin, J. A. (1986) J. Biol. Chem. 261, 375-379 |
| 19. | Ochem, A. E., Skopac, D., Costa, M., Rabilloud, T., Vuillard, L., Simoncsits, A., Giacca, M., and Falaschi, A. (1997) J. Biol. Chem. 272, 29919-29926 |
| 20. | Pailard, S., and Strauss, F. (1991) Nucleic Acids Res. 19, 5619-5624 |
| 21. | Karran, P. (2000) Curr. Opin. Genet. Dev. 10, 144-150 |
| 22. | Kanaar, R., Hoeijmakers, J., and van Gent, D. C. (1998) Cell Biol. 8, 483-491 |
| 23. | Gottlieb, T. M., and Jackson, S. P. (1993) Cell 72, 131-142 |
| 24. | Hammarsten, O., and Chu, G. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 525-530 |
| 25. | Baumann, P., and West, S. C. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 14066-14070 |
| 26. | Bailey, S. M., Meyne, J., Chen, D., J., Kurimasa, A., Li, G. C., Lehnert, B. E., and Goodwin, E. H. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 14899-14904 |
| 27. | Critchlow, S., and Jackson, S. P. (1998) Trends Biochem. Sci. 23, 394-398 |
| 28. | Ramsden, D. A., and Gellert, M. (1998) EMBO J. 17, 609-614 |
| 29. | Kamath-Loeb, A., Shen, J. C., Loeb, L., and Fry, M. (1998) J. Biol. Chem. 273, 34145-34150 |
| 30. | Gray, M., Shen, J. C., Kamath-Loeb, A., Blank, A., Sopher, B., Martin, G., Oshima, J., and Loeb, L. (1997) Nat. Genet. 17, 100-103 |
| 31. | Jin, S., and Weaver, D. V. (1997) EMBO J. 16, 6874-6885 |
| 32. | Orren, D. K., Brosh, R. M., Nehlin, J. O., Machwe, A., Gray, M. D., and Bohr, V. A. (1999) Nucleic Acids Res. 27, 3557-3566 |
| 33. | Shen, J.-C., and Loeb, L. A. (2000) Nucleic Acids Res. 28, 3260-3268 |
| 34. | Cooper, M. P., Machwe, A., D. K., O., Brosh, R. M., Ramsden, D., and Bohr, V. A. (2000) Genes Dev. 14, 907-912 |
| 35. | Wu, X., and Lieber, M. R. (1996) Mol. Cell. Biol. 16, 5186-5193 |
| 36. | Gell, D., and Jackson, S. P. (1999) Nucleic Acids Res. 27, 3494-3502 |
| 37. | Singleton, B. K., Torres-Arzayus, M. I., Rottinghaus, S. T., Taccioli, G. E., and Jeggo, P. A. (1999) Mol. Cell. Biol. 19, 3267-3277 |
| 38. | Dynan, W. S., and Yoo, S. (1998) Nucleic Acids Res. 26, 1551-1559 |
| 39. | Grawunder, U., Wilm, M., Wu, X., Kulesza, P., Wilson, T. E., Mann, M., and Lieber, M. R. (1997) Nature 388, 492-494 |
| 40. | Karanjawala, Z., Grawunder, U., Hsieh, C. L., and Lieber, M. (1999) Curr. Biol. 9, 1501-1504 |
| 41. | Paull, T. T., and Gellert, M. (1998) Mol. Cell 1, 969-979 |
| 42. | Paull, T. T., and Gellert, M. (1999) Genes Dev. 13, 1276-1288 |
| 43. | Paull, T. T., and Gellert, M. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 6409-6414 |
| 44. | Fujiwara, Y., Higashikawa, T., and Tatsumi, M. (1977) J. Cell. Physiol. 92, 365-374 |
| 45. | Stefanini, M., Scappaticca, S., Lagomarsini, P., Borroni, G., Berardesca, E., and Nuzzo, F. (1989) Mutant Res. 219, 179-181 |
| 46. | Runger, T. M., Bauer, C., Dekant, B., Moller, K., Sobotta, P., Czerny, C., Poot, M., and Martin, G. M. (1994) J. Invest. Dermatol. 102, 45-48 |
| 47. | Gebhart, E., Bauer, R., Raub, U., Schinzel, M., Ruprecht, K. W., and Jonas, J. B. (1988) Human Genet. 80, 135-139 |
| 48. | Vogel, H., Lim, D. S., Karsenty, G., Finegold, M., and Hasty, P. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 10770-10775 |
| 49. | DiFilippantonio, M. J., Zhu, J., Chen, H. T., Meffre, E., Nussenzweig, M. C., Max, E. E., Ried, T., and Nussenzweig, A. (2000) Nature 404, 510-514 |
| 50. | Marciniak, R. A., Lombard, D. B., Johnson, F. B., and Guarente, L. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 6887-6892 |
| 51. | Gray, M. D., Wang, L., Youssoufian, H., Martin, G. M., and Oshima, J. (1998) Exp. Cell Res. 242, 487-494 |
| 52. | Bachant, J. B., and Elledge, S. J. (1999) Nature 398, 757-758 |
This article has been cited by other articles:
![]() |
B. Li, S. P. Jog, S. Reddy, and L. Comai WRN Controls Formation of Extrachromosomal Telomeric Circles and Is Required for TRF2{Delta}B-Mediated Telomere Shortening Mol. Cell. Biol., March 15, 2008; 28(6): 1892 - 1904. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Schild-Poulter, A. Su, A. Shih, O. P. Kelly, M. J. Fritzler, R. Goldstein, and R. J. G. Hache Association of autoantibodies with Ku and DNA repair proteins in connective tissue diseases Rheumatology, February 1, 2008; 47(2): 165 - 171. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Harrigan, J. Piotrowski, L. Di Noto, R. L. Levine, and V. A. Bohr Metal-catalyzed Oxidation of the Werner Syndrome Protein Causes Loss of Catalytic Activities and Impaired Protein-Protein Interactions J. Biol. Chem., December 14, 2007; 282(50): 36403 - 36411. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kitano, N. Yoshihara, and T. Hakoshima Crystal Structure of the HRDC Domain of Human Werner Syndrome Protein, WRN J. Biol. Chem., January 26, 2007; 282(4): 2717 - 2728. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. M. Hisama, V. A. Bohr, and J. Oshima WRN's Tenth Anniversary Sci. Aging Knowl. Environ., June 28, 2006; 2006(10): pe18 - pe18. [Abstract] [Full Text] |
||||
![]() |
B. Li, N. Conway, S. Navarro, L. Comai, and L. Comai A conserved and species-specific functional interaction between the Werner syndrome-like exonuclease atWEX and the Ku heterodimer in Arabidopsis Nucleic Acids Res., December 7, 2005; 33(21): 6861 - 6867. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lan, S. Nakajima, K. Komatsu, A. Nussenzweig, A. Shimamoto, J. Oshima, and A. Yasui Accumulation of Werner protein at DNA double-strand breaks in human cells J. Cell Sci., September 15, 2005; 118(18): 4153 - 4162. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-M. Tseng and A. E. Tomkinson Processing and Joining of DNA Ends Coordinated by Interactions among Dnl4/Lif1, Pol4, and FEN-1 J. Biol. Chem., November 12, 2004; 279(46): 47580 - 47588. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yin, Y. T. Kwon, A. Varshavsky, and W. Wang RECQL4, mutated in the Rothmund-Thomson and RAPADILINO syndromes, interacts with ubiquitin ligases UBR1 and UBR2 of the N-end rule pathway Hum. Mol. Genet., October 1, 2004; 13(20): 2421 - 2430. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Choudhary, J. A. Sommers, and R. M. Brosh Jr. Biochemical and Kinetic Characterization of the DNA Helicase and Exonuclease Activities of Werner Syndrome Protein J. Biol. Chem., August 13, 2004; 279(33): 34603 - 34613. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Opresko, W.-H. Cheng, and V. A. Bohr Junction of RecQ Helicase Biochemistry and Human Disease J. Biol. Chem., April 30, 2004; 279(18): 18099 - 18102. [Full Text] [PDF] |
||||
![]() |
B. Li, S. Navarro, N. Kasahara, and L. Comai Identification and Biochemical Characterization of a Werner's Syndrome Protein Complex with Ku70/80 and Poly(ADP-ribose) Polymerase-1 J. Biol. Chem., April 2, 2004; 279(14): 13659 - 13667. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Plchova, F. Hartung, and H. Puchta Biochemical Characterization of an Exonuclease from Arabidopsis thaliana Reveals Similarities to the DNA Exonuclease of the Human Werner Syndrome Protein J. Biol. Chem., November 7, 2003; 278(45): 44128 - 44138. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Allen, J. Halbrook, and J. A. Nickoloff Interactive Competition Between Homologous Recombination and Non-Homologous End Joining Mol. Cancer Res., October 1, 2003; 1(12): 913 - 920. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Baynton, M. Otterlei, M. Bjoras, C. von Kobbe, V. A. Bohr, and E. Seeberg WRN Interacts Physically and Functionally with the Recombination Mediator Protein RAD52 J. Biol. Chem., September 19, 2003; 278(38): 36476 - 36486. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Matheos, O. Novac, G. B. Price, and M. Zannis-Hadjopoulos Analysis of the DNA replication competence of the xrs-5 mutant cells defective in Ku86 J. Cell Sci., January 1, 2003; 116(1): 111 - 124. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Li and L. Comai Displacement of DNA-PKcs from DNA ends by the Werner syndrome protein Nucleic Acids Res., September 1, 2002; 30(17): 3653 - 3661. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Karmakar, C. M. Snowden, D. A. Ramsden, and V. A. Bohr Ku heterodimer binds to both ends of the Werner protein and functional interaction occurs at the Werner N-terminus Nucleic Acids Res., August 15, 2002; 30(16): 3583 - 3591. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fry The Werner Syndrome Helicase-Nuclease--One Protein, Many Mysteries Sci. Aging Knowl. Environ., April 3, 2002; 2002(13): re2 - 2. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Oshima, S. Huang, C. Pae, J. Campisi, and R. H. Schiestl Lack of WRN Results in Extensive Deletion at Nonhomologous Joining Ends Cancer Res., January 1, 2002; 62(2): 547 - 551. [Abstract] [Full Text] [PDF] |
||||
![]() |