| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 276, Issue 13, 9903-9909, March 30, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Pharmacology, University of Medicine and
Dentistry of New Jersey-Robert Wood Johnson Medical School,
Piscataway, New Jersey 08854
Received for publication, November 9, 2000, and in revised form, December 20, 2000
The NUDF protein is required for nuclear
migration through the mycelium of the filamentous fungus
Aspergillus nidulans. It is of particular interest, because
it closely resembles a human protein, LIS1, that is required for
development of the cerebral cortex. Both are ~50-kDa proteins with a
short N-terminal predicted coiled coil and seven WD-40 domains in the
C-terminal half of the molecule. They also interact with homologous
proteins, suggesting that they may have similar biochemical functions.
Here we describe the purification to homogeneity of NUDF protein in a
single step from a cell-free extract of A. nidulans. We
demonstrate that NUDF is a homodimer, that its dimerization occurs via
the N-terminal coiled coil region of the molecule, and that it must be
a dimer to support the growth of A. nidulans.
The nud genes of Aspergillus nidulans and
the ropy genes of Neurospora crassa encode
proteins required for nuclear migration through the fungal mycelium.
Many of these proteins are subunits of the
microtubule-dependent motor cytoplasmic dynein and of its activator, dynactin (1-6). In A. nidulans these include the
dynein heavy chain (nudA), an intermediate chain
(nudI), and a light chain (nudG) (6-8).
NudK encodes the ARP1 actin-related protein component of
dynactin (9). Components of dynein and dynactin are also found among
the N. crassa ropy genes. Thus the dynein/dynactin system is
believed to be the main motor for nuclear migration in these fungi.
Some of the nud genes of A. nidulans encode
proteins that are not immediately recognizable as components of dynein or dynactin. Of these the NUDF protein is particularly interesting, because it closely resembles a human protein, LIS1, required for development of the cerebral cortex (10, 11). NUDF encodes a 49-kDa
protein that is 42% identical to LIS1 in its amino acid sequence. It
also has a short predicted coiled coil region near its N terminus and
seven WD-40 repeats in the C-terminal half of the molecule, as does
LIS1. NUDF and LIS1 interact either genetically or physically with the
A. nidulans and mammalian homologs of two other proteins,
NUDC and NUDE (11-14). The close sequence similarity between NUDF and
LIS1 and the fact that NUDF and LIS1 interact with homologous proteins
suggest that they may have a similar biochemical function.
Genetic evidence from A. nidulans has linked NUDF to
cytoplasmic dynein. Loss of function mutations in components of either dynein or its activator complex, dynactin, in A. nidulans, N. crassa, and other filamentous fungi inhibit nuclear migration through the fungal mycelium. As a consequence growth of the mycelium is
severely inhibited. This dynein-related mutant phenotype is phenocopied
by loss of function mutations in the nudF gene, suggesting that NUDF protein is required for dynein to mediate nuclear migration. Strains doubly mutant for NUDF and the cytoplasmic dynein heavy chain
are no more severely affected than their singly mutant parental strains, and mutations causing loss of NUDF function are suppressed by
mutations in the cytoplasmic dynein heavy chain (15). These data mean
that NUDF and dynein are on the same biochemical pathway, and they
imply that NUDF and the dynein heavy chain interact in some way.
Similarly, perturbing LIS1 concentration, either by deletion or
overexpression, phenocopies effects caused by perturbation of dynein
and dynactin function in both mammalian cells and Drosophila melanogaster (16-19). LIS1 colocalizes in developing brain with components of cytoplasmic dynein and also coimmunoprecipitates from
mammalian extracts with components of dynein and dynactin (20, 21).
Like LIS1 cytoplasmic dynein intermediate chains have an N-terminal
predicted coiled coil domain and seven C-terminal WD-40 domains.
Although they are about 25 kDa larger than LIS1, this similarity has
raised the possibility that LIS1 could be a variant cytoplasmic dynein
intermediate chain (22). There appear to be two cytoplasmic dynein
intermediate chains in each cytoplasmic dynein complex (23). Sucrose
gradient centrifugation and gel filtration data have shown that LIS1
synthesized in vitro has a molecular mass of almost
twice the molecular mass predicted from its amino acid sequence.
These results suggested that LIS1 might be a dimer (24). Our
preliminary physical data suggested that NUDF might also be a dimer, as
it sedimented faster from crude extracts of A. nidulans than
expected from its calculated molecular mass of 49 kDa (11). In
this paper we describe the purification of NUDF and its
characterization as a homodimer. We then provide evidence that NUDF
functions as a dimer in the living cell by showing that dimer formation
is required for NUDF to mediate normal growth and nuclear migration.
Construction of Strains Carrying an S-tagged nudF Gene--
A
DNA sequence encoding a 15-amino acid S-tag peptide (Novagen) from the
small subtilisin fragment of RNase A was added to the 3'-end of the
coding region of the nudF gene. The nudF cDNA and its 3'-untranslated region were used as templates in
PCR1 reactions using
the following primer sets: 5'-CCGCTCTAGATCACATCGCTCGCATCCG-3' (P1) and
5'-CTGCTGTCCATGTGCTGGCGTTCGAATTTAGCAGCAGCGGTTTCTTTGAACACCCGTACAGAGT-3' (P2),
5'-CAAAGAAACCGCTGCTGCTAAATTCGAACGCCAGCACATGGACAGCAGCTAAGTCGCGATCTTC-3' (P3) and 5'-CCCCGGTACCCCTTGAGAACCTCAGATTTAG-3' (P4). P1 and P2 (carrying the S-tag sequence) were used to add the S-tag to the 3'-end
of the nudF coding region, and P3 (carrying the S-tag
sequence) and P4 were used to introduce the S-tag at the 5'-end of the
900-nucleotide downstream sequence. The two PCR products were then
annealed to be used as template in a second PCR reaction with P1 and
P4. The second PCR product was cloned into the
XbaI-KpnI sites of a vector pRG to generate a
plasmid pCA1 containing the truncated nudF-S-tag, the DNA
sequence of which was confirmed by DNA sequencing. pCA1 was transformed
into competent nudF6 mutant cells (XX20) and integrated into
the chromosomal nudF gene. A transformant complementing the nudF6 and pyrG89 mutations was selected on plates
lacking uracil and uridine, then grown on a medium containing
fluoroorotic acid to remove the DNA carrying the
nudF6 mutation and the pyr4 gene. The final
strain (named CA1) with the S-tagged nudF
(nudF-S) gene incorporated into the normal nudF
chromosomal locus was confirmed by PCR reactions using the template of
the extracted chromosomal DNA with the primer corresponding to
5'-untranslated region and the P2, P3, and P4 primers.
A strain in which nudF-S was put under the control of the
inducible alcA promoter (26) on a high copy number plasmid
was constructed as follows: a SphI-BamHI DNA
fragment containing the alcA promoter and the 5'-end of the
coding region of nudF gene was cloned into the
SphI-BamHI site of pCA1 to make a new plasmid pCA2. The promoter, the coding and 3'-downstream region of
nudF (a SphI-EcoRI fragment) from
pCA2, was then cloned into the SphI-SmaI site of
a multicopy plasmid pAID. The resulting plasmid, named pAAFS, was then
transformed into the CA1 strain. Three transformants were cultured in
minimal medium containing methyl ethyl ketone (MEK), and the
expression levels of NUDF-S protein were examined on 4-20% SDS-PAGE
gradient gels without a stacking gel followed by Western blotting. The
transformant that expressed the highest level of NUDF-S was selected
and named CA1[pAAFS].
Construction of S-tagged Coiled Coil and WD-40 Domains of
NUDF--
A 0.7-kb DNA sequence containing the S-tag, a stop codon,
and the nudF 3'-untranslated region was made by a PCR
reaction using pCA1 as a template. This 0.7-kb fragment was cloned
between the MunI and BamHI sites of pAAFS (within
the coding region of the nudF gene) to produce pAATFS1. To
produce the S-tagged C-terminal fragment, a 0.5-kb DNA fragment
containing the alcA promoter, the nudF
5'-untranslated region, and the start codon (both ends carry
SphI and MunI sites) was made by PCR using pCA2
as a template. 0.8 kb of DNA between SphI and
MunI sites of pAAFS was replaced by the 0.5-kb PCR fragment
to generate pAATFS2.
In Vitro Mutagenesis of the NUDF Coiled Coil Domain--
To
introduce mutagenized DNA bases in the region encoding the coiled coil
domain of NUDF, PCR reactions were used with the following
oligonucleotide sets:
TTCGGCCTCTGCATCATTTGCTCTTCTTTGCGCTCGGGCAGCTCCCGTCCATTTTTTCTCCAA (MP1)
and AAATGATGCAGAGGCCGAAGCCCGTAGTGCTCAAGCTGAAGCTGAAGCCTCCCCGTCAGCA (MP2), ACTACGGACTTCGGCCTCTTCATCATTTATTCTTCTTTGCAGTCGGGC (MP3) and
GAAGAGGCCGAAGTCCGTAGTCTT (MP4), ATAAGTTTGCATGCGGAACC (P5) and
GAAGGCGACACGTCTCGGATCC (P6).
To make a mutant NUDF in which the amino acids in the "a and d"
position of the coiled coil domain were replaced by alanine (Alaa+d), the MP1/P5 and MP2/P6 primer sets were used. The
resulting two PCR products were annealed and subjected to a second PCR. The second PCR product was digested with
SphI/MunI and used to replace the
SphI-MunI DNA fragment of pAAFS to generate
pAAMFS1. The MP3/P5 and MP4/P6 primer sets were used to make the mutant NUDF in which amino acid residue 72 in the coiled coil motif was replaced by glutamic acid (L72E). The same procedure was used to
generate pAAMFS2.
To obtain DNA constructs that overexpress the coiled coil domains
carrying the Alaa+d and L72E mutations, the same procedure
was used as described above. The 0.7-kb PCR fragment containing the
S-tag construct, stop codon, and nudF 3'-untranslated region
was cloned between the MunI and BamHI sites of
pAAMFS1 (Alaa+d), pAAMFS2 (L72E) to generate pAAMTFS1 and
pAAMTFS2, respectively.
Purification of the NUDF Protein and NUDF Protein
Domains--
The S-tagged NUDF protein was purified from CA1 and
CA1[pAAFS] by binding to S-protein (the large subtilisin subunit of
RNaseA) attached to agarose beads. CA1 cells were grown in YGUU medium (0.5% yeast extract, 2% glucose) supplemented with uridine and uracil
(0.12% of each) for 18 h at 37 °C. The inducible strain CA1[pAAFS] was grown in YG for 14 h at 37 °C, then switched
to fresh medium containing 4 mM glucose, and where
appropriate, 50 mM MEK to induce the alcA
promoter, and grown for an additional 24 h. This yielded ~10 g
of mycelium/liter. S-tagged NUDF protein was purified from CA1 or
CA1[pAAFS] cells by binding to and elution from S-protein-agarose
beads. Cells were disrupted by blending with liquid nitrogen for 5 min,
then mixed and extracted with 3 volumes of buffer A (20 mM
Tris-HCl (pH 8.0), 150 mM NaCl, 0.1% IGEPAL CA-630
detergent (Sigma)). Cell debris was removed by centrifugation. The
protein extract was either loaded on an S-protein-agarose column,
washed with buffer A, and eluted with the same buffer containing the
S-tag 15 amino acid peptide at a concentration of 0.2 mg/ml or divided
into small portions, adsorbed batchwise to the S-protein-agarose,
washed with buffer A containing 0.6 M NaCl, and eluted with
the same buffer containing the S-tag peptide. The eluted fraction was
dialyzed against either buffer B (20 mM Tris-HCl (pH 8.0),
10 mM NaCl, 10% glycerol) or PEM buffer (0.1 M
PIPES (pH 6.9), 2 mM EGTA, 1 mM
MgCl2, 10% glycerol) and, if necessary, concentrated using
a 10-kDa cutoff Centricon filter. The purified protein was stored at
Gel Permeation Chromatography--
The purified NUDF protein was
concentrated 10-fold and applied to a Superdex 200 HR 10/30 FPLC
column, which had been equilibrated with 50 mM sodium
phosphate (pH 7.0) buffer containing 150 mM NaCl and
calibrated with apoferritin (443 kDa), alcohol dehydrogenase (150 kDa),
bovine serum albumin (66 kDa), and lysozyme (14.3 kDa). The column was
eluted using the same buffer at a flow rate of 0.5 ml/min. Fractions of
0.5 ml were collected. Aliquots (20 µl) of each fraction were
directly subjected to SDS-PAGE followed by Western blotting with
alkaline phosphatase-conjugated S-protein. The density of the
NUDF-S protein bands was measured using an ImagemasterTM
(Amersham Phamacia Biotech) densitometer.
Cross-linking of NUDF Protein--
Cross-linking was performed
at room temperature in an 11-µl reaction mixture containing 50 mM HEPES-KOH (pH 7.9), 150 mM KCl, 1 mM EDTA, 30 ng of the purified NUDF, and 2 mM
disuccinimidyl suberate. The reaction was started by adding a freshly
made solution of disuccinimidyl suberate to a reaction mixture
containing all other components and, after various times, was stopped
by adding ethanolamine to 0.36 M. Cross-linked products
were analyzed in a 4-20% gradient SDS-PAGE gel (with no stacking gel)
followed by silver staining.
Analytical Ultracentrifugation--
Equilibrium
ultracentrifugation was performed using a Beckman Optima XL-I
analytical ultracentrifuge with an interference optical system and an
An-60Ti rotor. The molecular mass of NUDF protein was estimated
at 4 °C using short column techniques at four different loading
concentrations (0.16, 0.32, 0.4, and 0.48 mg/ml) and at three different
rotor speeds: 20,000, 26,000, and 34,000 rpm using the program NONLIN.
Purification of NUDF Protein--
NUDF was purified to homogeneity
by S-protein affinity chromatography using the S-tag/S-protein system
(25). We first made a strain (CA1) in which the wild-type chromosomal
nudF gene was replaced by a C-terminally S-tagged
nudF gene (Fig. 1A)
and demonstrated that this strain grew as well as the wild-type strain,
indicating that the S-tagged NUDF protein was functional in
vivo (Fig. 1B). Because only very small amounts of
protein could be purified from this strain, we engineered a second
strain (CA1[pAAFS]) to overexpress the S-tagged NUDF from a high copy
number plasmid. CA1[pAAFS] was grown under inducing conditions,
fragmented frozen by grinding in liquid nitrogen, and a cell-free
extract was prepared. The S-tagged NUDF protein was then purified to
homogeneity in a single step directly from the extract by adsorption to
S-protein linked to agarose beads (Novagen), followed by elution with
an excess of the S-peptide (Fig. 1C). Nothing was eluted
when the same purification procedure was applied to a wild-type strain
that did not contain any S-tagged NUDF protein.
NUDF Protein Is a Homodimer--
We have previously shown by
sucrose gradient ultracentrifugation that the molecular mass at
which wild-type NUDF protein sedimented was greater than its calculated
molecular mass (11). The protein from crude extracts had an S
value consistent with a molecular mass of 120 kDa rather than with the
molecular mass of 49 kDa calculated from the sequence (11). The
purified S-tagged NUDF protein also gave an apparent molecular
mass of ~140 kDa by gel permeation chromatography on Superdex
G-200 (Fig. 2, A and
B). These data suggested that it might be complexed with
another protein(s). However, when the purified S-tagged material was
analyzed by SDS-PAGE electrophoresis it gave only a single 50-kDa band
(Fig. 1C), indicating that it was a homopolymer. The
molecular mass of LIS1, the mammalian homolog of NUDF,
calculated from sedimentation and gel filtration data, is close to that
expected for a dimer (24). This led us to suspect that NUDF might also
be a dimer. To determine whether NUDF was a dimer or was a trimer, as
suggested by its migration on gel permeation chromatography, we
cross-linked the purified S-tagged NUDF protein with disuccinimidyl
suberate and analyzed the denatured, cross-linked protein by SDS-PAGE
(Fig. 3). The uncross-linked 50-kDa
protein band seen at the start of the experiment was converted with
time to a broad band migrating at an apparent molecular mass of 120 kDa. The amounts of NUDF starting material and of the putative dimer
band that was produced were approximately equal, and no aggregated
protein was seen in the wells. If NUDF-S were a trimer we would have
expected to see an intermediate band representing the dimer appear
between the monomer and the 120-kDa band. No such intermediate band was
detected, indicating that NUDF is a homodimer. The fact that the dimer
gave a broad band is presumably due to the fact that different
cross-linking between molecules causes a disperse set of cross-linked
dimers that migrate differently on SDS gels after denaturation (Fig.
3). The result of the cross-linking experiment was confirmed by
equilibrium ultracentrifugation, which showed that the purified NUDF-S
protein is a dimer with a monomer molecular mass of 48,154 kDa
(±4.78% error) and a dissociation constant of 3.63 × 10
The predicted coiled coil region of NUDF is near the N terminus,
between amino acids 60 and 86 (Fig.
5A). It seemed likely that
this coiled coil region of the protein would be implicated in formation
of the NUDF homodimer; however, WD-40 motifs are also believed to be
involved in protein-protein interactions. To learn which parts of the
molecule are involved in dimer formation, we asked whether
overexpression of the coiled coil region or the WD-40 region interferes
with NUDF function, whether either of these regions is sufficient to
form the dimer, and whether the ability to form a dimer is required for
NUDF function.
Overexpression of the Coiled Coil Region Affects Colony
Growth--
We used a set of
alcA(p)::nudF chimeras to
determine whether overexpression of the coiled coil region or the WD-40
region of NUDF affects NUDF function. NUDF is required for normal
colony growth of A. nidulans. If formation of a NUDF dimer
were required for function, overexpression of the domain of the
molecule involved in dimer formation might be expected to act as a
dominant negative and to interfere with dimer formation and function
sufficiently to inhibit colony growth. We constructed a series of
multicopy plasmids with either the whole coding sequence, the coiled
coil region (amino acids 1-100), or the WD-40 region (amino acids
99-444) of NUDF under the control of the alcA alcohol
dehydrogenase promoter, which is repressed on media containing
glucose and up-regulated by growth on alcohols and other inducing
agents, e.g. methyl ethyl ketone. We constructed the genes
and gene fragments with an S-tag at their C termini, which we used for
identification of the proteins by Western blotting and which also
facilitated their purification on S-protein beads. The plasmids were
then transformed into a wild-type strain (CA1) of A. nidulans, and growth of the strains (transformants) on repression
and induction medium was examined. Under repressing conditions there
was no effect on growth; the strains carrying either the full-length
gene (pAAFS) or the N-terminal fragment (pAATFS1) or the C-terminal
fragment (pAATFS2) grew as well as the wild-type strain carrying the
vector (pAA) alone (Fig. 5B). Under inducing conditions
there was overexpression of the ectopic genes carried on the plasmids
(Fig. 5C). The colonies carrying either the full-length NUDF
protein or the C-terminal fragment had the same area as the control
carrying the empty plasmid; however, the area of the colony bearing the
N-terminal fragment was diminished by 50% (Fig. 5B). Since
all the proteins overexpressed were labeled with the S-tag, this result
also showed that the S-tag had no effect on growth. Neither the
N-terminal fragment nor the C-terminal fragment complemented the
temperature sensitivity of the nudF6 mutant strain (data not
shown). The growth inhibition caused by overexpression of the coiled
coil domain was less than expected, but this could be explained if not
all the coiled coil fragment achieved the proper conformation to
interact with the native NUDF protein or if the WD-40 also made a
significant contribution to the interaction between monomers.
The Coiled Coil Region Binds Full-length NUDF Protein--
The
preceding experiment indicated that overexpression of the coiled coil
region of NUDF had a significant effect on NUDF function as measured by
colony growth. This suggested that the overexpressed coiled coil region
was either competing with the endogenous coiled coil region on the
full-length NUDF molecule and thereby inhibiting dimer formation or
that it was interfering with an interaction between NUDF and some other
protein whose interaction with NUDF was necessary for normal growth. To
determine whether the isolated coiled coil domain of the molecule was
able to participate in the dimerization of NUDF, we asked whether the coiled coil region would bind the full-length NUDF protein. We transformed the plasmid bearing the N-terminal fragment (pAATFS1) into
a wild-type strain (GR5), overexpressed it by induction on methyl ethyl
ketone, and purified it from a cell-free extract of an A. nidulans proteins on S-protein beads (Novagen) as described above
for the full-length protein. Note that this strain (GR5) contains the
full-length, endogenous, wild-type, non-S-tagged NUDF protein, which is
necessary to sustain growth. SDS-PAGE analysis of the material eluted
by the S-peptide showed that the N-terminal fragment was purified to
homogeneity and one other protein copurified with it, the non-S-tagged,
full-length, endogenous NUDF protein. That this protein was indeed NUDF
and not another protein of similar molecular mass was verified
using an antibody raised against NUDF (11). A similar experiment using
the C-terminal WD-40 region of NUDF resulted in very little
copurification of the endogenous NUDF protein, suggesting that the
WD-40 portion of the molecule plays little or no role in NUDF dimer
formation (Fig. 6). As there was no NUDF
protein seen in the gels of either the overexpressed full-length
S-tagged protein or the S-tagged C-terminal fragment, NUDF was clearly
binding to the coiled coil domain. This result indicated that the
coiled coil domain fragment interacts strongly and specifically with
NUDF protein, most probably with the coiled coil region of the
full-length, wild-type protein. Interestingly, at least five other
proteins that did not copurify with either the full-length protein or
the coiled coil fragment bound to the S-tagged C-terminal fragment
(Fig. 6).
Mutations That Interfere with the Coiled Coil Interaction Interfere
with NUDF Function--
The coiled coil interaction takes place
between hydrophobic portions of the interacting coils, specifically
between leucines or isoleucines in positions "a" and "d" of the
heptamer repeat (Fig. 7). We generated
two types of mutations that we thought would interfere with NUDF coiled
coil formation. In one, L72E, we replaced the d position leucine
72 in the coiled coil S-tagged fragment by glutamic acid. The strong
negative charge repulsion between the opposed glutamic acid residues
should destabilize the helix-helix interaction. In the second,
Alaa+d, we replaced all the leucines and isoleucines
in the a and d positions between amino acids 62 and 83 in the S-tagged
coiled coil fragment with alanines. This was expected to have an even larger effect on formation of the coiled coil structure. We then tested
the ability of the mutated S-tagged coiled coil fragments to interact
with full-length NUDF protein directly. Plasmids containing the mutant
coiled coil fragment genes were transformed into A. nidulans
(GR5), and their S-tagged protein products were purified on S-protein
beads and eluted with S-peptide as above. The amount of full-length
NUDF protein that bound to the S-tagged proteins and protein fragments
was determined by SDS-PAGE (Fig. 8). Even though the mutated fragments were overproduced in relation to the
unmutated coiled coil fragment, they pulled down much less of the
full-length NUDF protein than the unmutated fragment, and as expected,
the Alaa+d fragment pulled down an even smaller amount of
NUDF protein than the L72E fragment. This experiment together with the
previous experiments suggest strongly that the coiled coil interaction is largely responsible for formation of the NUDF dimer.
Presumably NUDF exists in vivo in an equilibrium between the
monomer and the dimer forms. Since the coiled coil region is involved
in dimer formation, if dimer formation were required for NUDF function,
mutations that interfere with the coiled coil interaction might be
expected to inhibit growth. Accordingly, we have mutagenized the coiled
coil region in ways expected to interfere with dimer formation and have
assayed the effect of these mutations on the ability of the mutated
proteins to support growth in the absence of endogenous NUDF.
Specifically we have asked whether full-length NUDF proteins bearing
the Alaa+d and L72E mutations are able to complement the
growth defect of the temperature-sensitive nudF6 mutation at
restrictive temperature. When transformed into A. nidulans
the wild-type nudF gene fully complemented the
nudF6 mutation (Fig. 9). In
contrast neither the Alaa+d or the L72E mutant
nudF genes were able to reverse the slow growth phenotype of
nudF6. These data suggest strongly that NUDF must be able to
form a dimer to function.
In this paper we describe the affinity purification of NUDF
protein in one step from a crude cell-free extract of A. nidulans. We also show that the purified protein is a dimer. This
finding agrees with prior sucrose gradient sedimentation experiments on crude extracts of A. nidulans, which showed that NUDF
sediments more rapidly than expected from its predicted molecular mass
of 49 kDa (11), indicating that dimer formation was not an artifact of
purification. It is also consistent with a previous study of LIS1, the
mammalian homolog of NUDF, which suggested, but did not demonstrate
conclusively, that LIS1 is a dimer (24). Our data show not only that
the predicted N-terminal coiled coil domain of NUDF is the primary
determinant of dimer formation, but that dimerization is required for
NUDF function. The evidence is 3-fold. We have shown that
overexpression of the coiled coil region acts as a dominant negative,
as would be expected if it interfered with the interaction between NUDF
coiled coil domains during dimer formation. This experiment by itself
is ambiguous as we cannot rule out the possibility that growth
inhibition might result from an interaction between the coiled coil
domain and some other protein required for growth. It nevertheless is
consistent with the idea that NUDF functions as a dimer in
vivo. We have also shown directly that the coiled coil domain is
involved in the interaction between the NUDF monomers by demonstrating
that it binds tightly to the full-length NUDF protein, whereas the
WD-40 region does not. Finally, we have shown that mutations in the
coiled coil region, which prevent the coiled coil interaction, fail to
complement a temperature-sensitive loss of function nudF
mutation. It is possible that preventing the N-terminal domain from
forming a coiled coil blocks its interaction with some protein other
than NUDF. It seems more likely, however, that the inability of the
Alaa+d and L72E mutant proteins to support growth is the
result of their inability to form a NUDF dimer.
The identification of NUDF as a dimer adds additional support to the
idea that NUDF and LIS1 are very similar proteins and strongly suggests
that LIS1 may also need to dimerize to function, particularly in light
of the evidence suggesting that LIS1 is also a dimer (24). Because LIS1
coimmunoprecipitates with components of dynein and its structure
resembles that of the mammalian cytoplasmic dynein intermediate chains,
it and NUDF could be variant intermediate chains (22). The fact that
NUDF is a dimer is consistent with such a role, as there are two copies
of the heavy and intermediate chains per cytoplasmic dynein complex.
The intermediate chains of cytoplasmic dynein bind to the N-terminal
region of the molecule, and they interact with dynactin (22). However,
there is as yet no convincing evidence that either LIS1 or NUDF
interacts directly with the dynein heavy chain.
We are extremely grateful to Yujia Xu
for the sedimentation equilibrium analysis. We also thank Drs. Xin
Xiang and Norma J. Greenfield for help and discussions.
*
This work was supported by National Institutes of Health
Grant GM52309 (to N. R. M.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Published, JBC Papers in Press, December 29, 2000, DOI 10.1074/jbc.M010233200
The abbreviations used are:
PCR, polymerase chain reaction;
MEK, methyl ethyl ketone;
PAGE, polyacrylamide gel electrophoresis;
kb, kilobase pair(s);
PIPES, 1,4-piperazinediethanesulfonic acid.
NUDF, a Fungal Homolog of the Human LIS1 Protein, Functions as a
Dimer in Vivo*
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
80 °C until used. The same method was used to purify the S-tagged
NUDF protein domains.
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (30K):
[in a new window]
Fig. 1.
Purification of the NUDF protein from
A. nidulans. A, construction of a
strain carrying an S-tagged nudF gene (see "Experimental
Procedures"). The vertical rectangle indicates the
position of the S-tag and the asterisks the site of the
nudF6 mutations. B, Growth of the strain
(CA1) carrying S-tagged NUDF. Strains were inoculated on plates
containing YAGUU (YGUU solidified with 2% agar) plus 0.6 M KCl (32 °C) or YAGUU (42 °C) and grown for
2 days. C, SDS-PAGE of the purified NUDF-S protein. The
box on the left shows purified NUDF protein that
has been silver stained. The box on the right is
a Western blot using alkaline phosphatase-linked to the large RNase
subunit (Novagen) to detect the S-tagged NUDF protein. The
arrow indicates NUDF-S protein band. Lane M shows
marker proteins; lane P shows purified NUDF-S
protein.
7 M (Fig.
4). As NUDF protein from crude cell
extracts gave the same apparent native molecular mass as the
S-tagged protein, we conclude that dimerization is a property of NUDF
rather than an effect of the attached S-tag peptide. The fact that both
NUDF and LIS1 appear to be dimeric adds an additional structural
feature to the previously observed similarities between these proteins. The slower than expected migration of the NUDF dimer by sedimentation and gel permeation chromatography suggests that it is an extended molecule.
View larger version (28K):
[in a new window]
Fig. 2.
Gel permeation chromatography of NUDF-S on a
Superdex 200 FPLC column. A, profiles of standard
molecular mass proteins (open circles) and the
purified NUDF-S (closed circles). The column was eluted
using 50 mM sodium phosphate (pH7.0) buffer containing 150 mM NaCl and fractions, of 0.5 ml were collected. Aliquots
of each fraction were subjected to protein determination by the
Bradford method (standard) or SDS-PAGE followed by Western blotting
with S-protein alkaline phosphatase conjugate and the
measurement of density (NUDF-S). B, Western blot of the
fractions for NUDF-S protein.
View larger version (67K):
[in a new window]
Fig. 3.
Time course of cross-linking of NUDF with
disuccinimidyl suberate. The purified S-tagged NUDF protein
was cross-linked for various times as indicated and analyzed by
SDS-PAGE and silver staining.
View larger version (26K):
[in a new window]
Fig. 4.
Sedimentation equilibrium analysis of NUDF-S
protein. The bottom panel shows the fringe gradient in
the centrifuge cell after attaining sedimentation equilibrium. The
solid line is the result of fitting to a monomer-dimer
system, and the circles, triangles, and
squares are the experimental values. The data correspond to
a global fit for three independent experiments performed at 20,000, 26,000, and 34,000 rpm. A starting protein concentration of 0.32 mg/ml
was used. The top panel shows the difference in the fitted
and experimental value as a function of radial position
(residuals).
View larger version (32K):
[in a new window]
Fig. 5.
Inhibition of the growth of A. nidulans by overexpression of N-terminal fragment.
A, schematic representation of NUDF protein. B,
the cells were grown for 48 h. The repression medium was
YAG. The induction medium was minimal medium containing
glycerol (4 mM) and MEK (50 mM). C,
Western blot showing overexpression of NUDF and the fragments. The
cells were grown on liquid minimal medium containing MEK. The cells
were disrupted, and protein extracts were subjected to SDS-PAGE
followed by Western blotting. Lane M shows marker proteins.
Lane 1 is wild-type protein. Lane 2 shows the
overexpressed full-length S-tagged NUDF. Lane 3 shows the
overexpressed coiled coil fragment. Lane 4 shows the
overexpressed WD-40 fragment.
View larger version (35K):
[in a new window]
Fig. 6.
SDS-PAGE of purified S-tagged NUDF and NUDF
fragments. The left panel shows a silver stain of the
purified proteins eluted from the beads. The right panel
shows a Western blot of the purified proteins stained with NUDF
antibody. The asterisk indicates copurified untagged NUDF
protein. The cells used for purification were CA1[pAAFS] (lane
1), GR5[pAATFS1] (lane 2), and GR5[pAATFS2]
(lane 3). The cells were grown in YG medium for 14 h
followed by induction medium (YG containing 4 mM glucose
and MEK) for 24 h.
View larger version (28K):
[in a new window]
Fig. 7.
Amino acid sequences of the coiled coil
region (residues 60-86) of NUDF and mutants
(top). Alaa+d indicates a mutant NUDF
in which all amino acids at the a and d positions are changed to
alanine. In L72E the leucine at residue 72 has been changed to glutamic
acid. Bottom, cross-sectional helical wheel representation
of one heptad of the coiled coil native viewed from the N terminus. The
arrows indicate hydrophobic interactions between the a-a'
and d-d' positions.
View larger version (30K):
[in a new window]
Fig. 8.
SDS-PAGE of purified S-tagged NUDF native and
mutant N-fragments. The top panel shows copurified
native (untagged) NUDF, and the bottom panel shows the
native protein and the mutant N-fragment. The strains involved were
GR5[pAATFS1] (lane 1), GR5[pAAMTFS1] (lane
2), GR5[pAAMTFS2] (lane 3). The cells were grown in
YG medium for 14 h followed by an induction medium (YG containing
4 mM glucose and MEK) for 24 h.
View larger version (28K):
[in a new window]
Fig. 9.
Complementation of a strain carrying the ts
nudF6 mutation by native and mutant nudF
genes. The plasmids pAAFS (native), pAAMFS1
(Alaa+d), and pAAMFS2 (L72E) were transformed into XX20
(nudF6) cells, and the ability of the transformants to grow
and form spores at 42 °C was examined. The black bars
indicate the S-tag, and the asterisks stand for the
mutations.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
ACKNOWLEDGEMENTS
FOOTNOTES
To whom correspondence should be addressed: Dept. of Pharmacology,
University of Medicine and Dentistry of New Jersey-Robert Wood Johnson
Medical School, 675 Hoes Lane, Piscataway, NJ 08854. Tel.:
732-235-4081; Fax: 732-235-4073; E-mail:
morrisnr@umdnj.edu.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Minke, P. F.,
Lee, I. H.,
Tinsley, J. H.,
Bruno, K. S.,
and Plamann, M.
(1999)
Mol. Microbiol.
32,
1065-1076
2.
Plamann, M.,
Minke, P. F.,
Tinsley, J. H.,
and Bruno, K. S.
(1994)
J. Cell Biol.
127,
139-149
3.
Tinsley, J. H.,
Minke, P. F.,
Bruno, K. S.,
and Plamann, M.
(1996)
Mol. Biol. Cell
7,
731-742
4.
Morris, N. R.
(2000)
J. Cell Biol.
148,
1097-1101
5.
Osmani, A. H.,
Osmani, S. A.,
and Morris, N. R.
(1990)
J. Cell Biol.
111,
543-551
6.
Xiang, X.,
Beckwith, S. M.,
and Morris, N. R.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
2100-2104
7.
Beckwith, S. M.,
Roghi, C. H.,
Liu, B.,
and Morris, N. R.
(1998)
J. Cell Biol.
143,
1239-1247
8.
Xiang, X.,
and Morris, N. R.
(1999)
Curr. Opin. Microbiol.
2,
636-640
9.
Xiang, X.,
Liu, B.,
Winklemann, D.,
Zhuo, W.,
and Morris, N. R.
(2000)
Curr. Biol.
10,
603-606
10.
Hirotsune, S.,
Fleck, M. W.,
Gambello, M. J.,
Bix, G. J.,
Chen, A.,
Clark, G. D.,
Ledbetter, D. H.,
McBain, C. J.,
and Wynshaw-Boris, A.
(1998)
Nat. Genet.
19,
333-339
11.
Xiang, X.,
Osmani, A. H.,
Osmani, S. A.,
Xin, M.,
and Morris, N. R.
(1995)
Mol. Biol. Cell
6,
297-310
12.
Efimov, V. P.,
and Morris, N. R.
(2000)
J. Cell Biol.
150,
681-688
13.
Kitagawa, M.,
Umezu, M.,
Aoki, J.,
Koizumi, H.,
Arai, H.,
and Inoue, K.
(2000)
FEBS Lett.
479,
57-62
14.
Morris, S. M.,
Albrecht, U.,
Reiner, O.,
Eichele, G.,
and Yu-Lee, L. Y.
(1998)
Curr. Biol.
8,
603-606
15.
Willins, D. A.,
Liu, B.,
Xiang, X.,
and Morris, N. R.
(1997)
Mol. Gen. Genet.
255,
194-200
16.
Lei, Y.,
and Warrior, R.
(2000)
Dev. Biol.
226,
57-72
17.
Liu, Z.,
Xie, T.,
and Steward, R.
(1999)
Development (Camb.)
126,
4477-4488
18.
Liu, Z.,
Stewart, R.,
and Luo, L.
(2000)
Nat. Cell Biol.
2,
776-783
19.
Swan, A.,
Nguyen, T.,
and Suter, B.
(1999)
Nat. Cell Biol.
1,
444-449
20.
Faulkner, N. E.,
Dujardin, D. L.,
Tai, C.-Y.,
Vaughan, K. T.,
O'Connell, C. B.,
Wang, Y.,
and Vallee, R. B.
(2000)
Nat. Cell Biol.
2,
784-791
21.
Smith, D. S.,
Niethammer, M.,
Ayala, R.,
Zhou, Y.,
Gambello, M. J.,
Wynshaw-Boris, A.,
and Tsai, L.-H.
(2000)
Nat. Cell Biol.
2,
767-775
22.
Vallee, R. B.,
Faulkner, N. E.,
and Tai, C.
(2000)
Biochim. Biophys. Acta
1496,
89-98
23.
Vallee, R.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
8769-8772
24.
Garcia-Higuera, I.,
Fenoglio, J.,
Li, Y.,
Lewis, C.,
Panchenko, M. P.,
Reiner, O.,
Smith, T. F.,
and Neer, E. J.
(1996)
Biochemistry
35,
13985-13994
25.
Kim, J. S.,
and Raines, R. T.
(1993)
Protein Sci.
2,
348-356
26.
Waring, R. B.,
May, G. S.,
and Morris, N. R.
(1989)
Gene (Amst.)
79,
119-130
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. Tsujikawa, Y. Omori, J. Biyanwila, and J. Malicki Mechanism of positioning the cell nucleus in vertebrate photoreceptors PNAS, September 11, 2007; 104(37): 14819 - 14824. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Zhuang, J. Zhang, and X. Xiang Point Mutations in the Stem Region and the Fourth AAA Domain of Cytoplasmic Dynein Heavy Chain Partially Suppress the Phenotype of NUDF/LIS1 Loss in Aspergillus nidulans Genetics, March 1, 2007; 175(3): 1185 - 1196. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. S. Kim, H. Y. Kim, J. H. Yoon, and H. S. Kang Recruitment of the Swi/Snf Complex by Ste12-Tec1 Promotes Flo8-Mss11-Mediated Activation of STA1 Expression Mol. Cell. Biol., November 1, 2004; 24(21): 9542 - 9556. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Wei, J. Jin, and J. W. Harper The Cyclin E/Cdk2 Substrate and Cajal Body Component p220NPAT Activates Histone Transcription through a Novel LisH-Like Domain Mol. Cell. Biol., May 15, 2003; 23(10): 3669 - 3680. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. P. Efimov Roles of NUDE and NUDF Proteins of Aspergillus nidulans: Insights from Intracellular Localization and Overexpression Effects Mol. Biol. Cell, March 1, 2003; 14(3): 871 - 888. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-Y. Tai, D. L. Dujardin, N. E. Faulkner, and R. B. Vallee Role of dynein, dynactin, and CLIP-170 interactions in LIS1 kinetochore function J. Cell Biol., March 18, 2002; 156(6): 959 - 968. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Hoffmann, W. Zuo, A. Liu, and N. R. Morris The LIS1-related Protein NUDF of Aspergillus nidulans and Its Interaction Partner NUDE Bind Directly to Specific Subunits of Dynein and Dynactin and to alpha - and gamma -Tubulin J. Biol. Chem., October 12, 2001; 276(42): 38877 - 38884. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
