![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 14, 10646-10654, April 6, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
, andFrom the Max-Delbrück-Centrum für Molekulare Medizin, Robert-Rössle-Strasse 10, Berlin D-13092, Germany
Received for publication, November 26, 2000
| |
ABSTRACT |
|---|
|
|
|---|
Neurofascin belongs to the L1 subgroup of the
immunoglobulin superfamily of cell adhesion molecules and is implicated
in axonal growth and fasciculation. We used yeast two-hybrid screening
to identify proteins that interact with neurofascin intracellularly and
therefore might link it to trafficking, spatial targeting, or signaling
pathways. Here, we demonstrate that rat syntenin-1, previously
published as syntenin, mda-9, or TACIP18 in human, is a
neurofascin-binding protein that exhibits a wide-spread tissue expression pattern with a relative maximum in brain. Syntenin-1 was
found not to interact with other vertebrate members of the L1 subgroup
such as L1 itself or NrCAM. We confirmed the specificity of the
neurofascin-syntenin-1 interaction by ligand-overlay assay, surface
plasmon resonance analysis, and colocalization of both proteins in
heterologous cells. The COOH terminus of neurofascin was mapped
to interact with the second PDZ domain of syntenin-1. Furthermore, we
isolated syntenin-2 that may be expressed in two isoforms. Despite
their high sequence similarity to syntenin-1, syntenin-2 Neurofascin is a member of the L1 subgroup of the immunoglobulin
superfamily of cell adhesion molecules, which also includes L1
(NgCAM)1 itself, CHL1, NrCAM in vertebrates, neuroglian in
insects, and tractin in leeches. These transmembrane glycoproteins
share a well conserved overall domain organization with six
immunoglobulin-like and four to five fibronectin type III
(FNIII)-like domains. Their diverse homo-
and heterophilic interactions mediate cell-cell contacts and can
promote neuronal migration, axonal growth, and fasciculation in the
developing nervous system (1-3). A crucial role of the L1 subgroup in
neural development is exemplified by a range of neuroanatomical and
neurological disorders caused by knock-out of the murine L1 gene
(4-6) and by mutations in the human L1 gene, which affect L1 binding
activity and trafficking (7, 8).
Unlike L1 and other subgroup members, neurofascin is subjected to
extensive alternative splicing that is regulated during embryonic
development of the chicken brain (9). This differential splicing has
been shown to modulate interactions of neurofascin with axonal NrCAM,
F11, axonin-1, and the extracellular matrix protein tenascin-R, and to
influence neurite extension in vitro (10, 11). Specific
isoforms of neurofascin are localized to initial axon segments of
Purkinje cells and to the nodes of Ranvier of myelinated nerves, where
they interact with the cytoskeleton adapter-protein ankyrin-G (12). In
particular, an oligodendrocyte-specific form of neurofascin (termed
NF155) was found to localize to the paranodal region, whereas a
neuron-specific form (NF186) was confined to the nodal region (13, 14).
Ankyrin binding appears to be a common feature of all L1-type molecules
and is thought to stabilize cell adhesion (15-18). Interaction with
ankyrin requires a highly conserved sequence within the cytoplasmic
tails of L1 subgroup members and is inhibited by its tyrosine
phosphorylation as demonstrated for neurofascin (19-21). Furthermore,
palmitoylation of neurofascin at a highly conserved cysteine residue in
its membrane-spanning segment might affect the targeting of neurofascin
to specialized plasma membrane microdomains (22). L1CAM-mediated
cellular processes may also be regulated by changes in the expression
levels of CAMs on the cell surface. Tyrosine phosphorylation of the
endocytic motif YRSL, which represents a binding site of the AP-2
clathrin adaptor complex, regulates not only the internalization of the neuronal L1 form but probably also of NrCAM and neurofascin (23, 24).
Recently, cross-linking of L1 expressed in heterologous cells has been
shown to trigger the activation of ERK2, a component of the MAPK signal
cascade. ERK2 activation appears to be coupled with L1 internalization
and phosphorylation of two cytoplasmic serines that are conserved in
the L1 subgroup (25).
Although the cytoplasmic tails are the most conserved segments of the
L1-type molecules, there are also some differences, particularly at
their COOH termini. These differences might provide the structural
basis for individual intracellular interactions and therefore distinct
functional features within the L1 subgroup. To identify proteins that
might mediate signaling, spatial targeting, or trafficking of L1-type
molecules by direct interaction with their cytoplasmic segments, we
performed yeast two-hybrid screens of brain cDNA libraries. Here,
we demonstrate that syntenin-1 is an intracellular binding partner of
neurofascin but not of L1 or NrCAM. Syntenin-1 contains two PDZ
domains. PDZ domains are multifunctional protein-binding modules, which
were first identified in PSD-95, DlgA, and
ZO-1, and are now found in a growing number of other
cytoplasmic proteins (26). The PDZ domains of syntenin-1 have been
previously shown to interact with the COOH termini of syndecans, class
B ephrins, EphA7, pro-TGF- cDNA Constructs Used in the Yeast Two-hybrid
System--
cDNAs encoding cytoplasmic segments of chick
neurofascin and NrCAM, both wild-type and mutants, as well as of rat
L1, human syndecan-3, pro-TGF-
The rat syntenin-1 cDNA that was isolated by the yeast two-hybrid
screen was subcloned from the library vector pGAD10 into the pGBT9 and
pGAD424 (all from CLONTECH). cDNA fragments
encoding the 115 NH2-terminal amino acids, the 30 COOH-terminal amino acids, or lacking the 101 NH2-terminal
amino acids of rat syntenin-1 were amplified by PCR using specific
primers and inserted in-frame into the pGBT9 and pGAD424 vectors. A
syntenin-1 construct encoding the NH2-terminal segment,
PDZ1 and the first seven amino acids of PDZ2 was generated from
pGAD424(ST-1) by restriction digestion with NsiI and
PstI and ligation of the overlapping plasmid ends. The
cDNA of a mutant lacking 141 NH2-terminal amino acids,
including 29 residues of the PDZ1 domain, was generated from
pGAD10(ST-1) by restriction digestion with XhoI and
SpeI followed by filling-in and in-frame ligation of the
plasmid ends. The amino acid substitutions G128E and G212D within the
PDZ1 and PDZ2 of syntenin-1, respectively, were generated by
site-directed mutagenesis using the Transformer site-directed
mutagenesis kit (CLONTECH). The corresponding G383A and G635A nucleotide substitutions were introduced into the rat syntenin-1 encoding cDNA by simultaneously annealing the mutagenic primers 5'-pGGATCAAGATGGAAAAATTGAGCTCAGACTGAAG and/or
5'-pGCAGTGGACATGTTGACTTTATCTTTAAAAGTGG, respectively, and the selection
primer 5'-pCCCTGACTTTCTCGACTTGGT, which carried a mutation of the
single XbaI site within the sequence of syntenin-1, to one
strand of the denatured pGAD10(ST-1) plasmid. The second strand
was synthesized subsequently, and the selection procedure was performed
as described in the manufacturer's manual. The resulting full-length
cDNA mutants PDZ1*, PDZ2*, and PDZ1*2* were subsequently inserted
also into the pGBT9 vector.
cDNA encoding syntenin-2 isoforms
All constructs described here and below were verified by automated
sequence analysis using the Auto-Read sequencing kit (Amersham Pharmacia Biotech).
Yeast Two-hybrid System--
The pGBT9 constructs of wild-type
neurofascin, NrCAM and L1, were used to screen an adult rat brain
cDNA library cloned into the pGAD10 vector
(CLONTECH). The two-hybrid screens were performed with the yeast HF7c reporter strain according to the instructions of
the distributor (CLONTECH). Prey plasmids isolated
from the positive clones were retransformed together with the baits or control constructs into the yeast reporter strains SFY526 or Y187 for
further analysis. The library cDNA clones revealing specific binding in all strains were sequenced as mentioned above.
GST- and MBP-syntenin-1 Fusion Proteins--
To generate fusion
proteins of syntenin-1 with GST or MBP, rat syntenin-1 cDNA was
inserted in-frame into the pGEX-3X (Amersham Pharmacia Biotech) or
pMAL-c2 (New England BioLabs) expression vectors, respectively.
MBP- Cell Cultivation and Transfection--
COS7 and L929 cells were
cultivated in Dulbecco's modified Eagle's medium supplemented with
10% fetal calf serum, penicillin, and streptomycin at 37 °C and 5%
CO2. COS7 cells were transiently transfected by the
DEAE-dextran/Me2SO method as described previously (11). To
transiently transfect L929 cells, cells were harvested from 10-cm
plates with trypsin, washed twice, and resuspended in 0.4 ml of RPMI
with 100 µM dithiothreitol. Electroporation of the cell
suspension was performed in a 4-mm cuvette with 12 µg of DNA using an
EasyjecT PLUS device (Eurogentec) at 350 V, 600 microfarads, and room
temperature. Immediately after electroporation, cells were transferred
in a 5-cm PetriPERM dish (Hereaus) precoated with 0.5 mg/ml collagen
type I (Sigma) and cultivated for 48 h under standard conditions.
Western Blot Analysis--
To generate EGFP-syntenin-1, -2 Ligand-overlay Assay--
COS7 cells were transfected with pSG5
expression vectors (Stratagene) encoding NgCAM (gift of P. Sonderegger,
University of Zürich), chick neurofascin isoform Nf17 (10, 33),
or a truncated GPI-anchored construct Nf17GPI. In the latter construct,
the transmembrane and the cytoplasmic domain of neurofascin isoform
NF17 were replaced by the COOH-terminal region of the cell adhesion
molecule F11 (34) containing a part of the third and the complete
fourth FNIII domain as well as the GPI anchor signal. After 48-h
cultivation, cells were solubilized in radioimmune precipitation buffer
and centrifuged as described above. NgCAM and neurofascin were
immunoprecipitated from cell lysates using specific monoclonal
antibodies (35, 36) and Protein G-agarose (Roche Molecular
Biochemicals) followed by 7.5% SDS-PAGE and blotting to PVDF membranes
(Amersham Pharmacia Biotech). Blots were either stained with
corresponding antibodies or incubated overnight at 4 °C with 40 µg/ml MBP-syntenin-1 or MBP- Analysis of Colocalization of Neurofascin and
Syntenin-1--
L929 cells were transiently cotransfected with
EGFP-syntenin-1 and wild-type neurofascin or the truncated GPI-anchored
neurofascin construct described above. To induce and visualize
clustering of neurofascin, cells were incubated in culture medium with
30 µg/ml Fab fragments of rabbit anti-neurofascin IgGs (35) followed by Cy5-conjugated goat anti-rabbit secondary antibodies (1:100, Dianova), for 1 h each, at the same conditions. After washing with
warm medium and fixation with ice-cold 4% formaldehyde for 10 min, cells were covered with 50% glycerol in PBS and processed for
confocal imaging using a Bio-Rad MRC-1000 system.
Surface Plasmon Resonance Analysis--
200 RU (resonance units)
of synthetic neurofascin peptides corresponding to the last 15 COOH-terminal amino acids of either its wild-type or the
A(0)S-substituted sequence and containing an additional
NH2-terminal lysine residue (Biosyntan, Berlin) were
immobilized on the CM5 sensor chips activated by 50 mM
N-hydroxysuccineimide, 200 mM
N-ethyl-N'-(dimethylaminopropyl)carbodiimide.
Binding of the immobilized surfaces to MBP-syntenin-1 or
MBP- Gel Filtration Chromatography--
Purified MBP-syntenin-1
fusion protein (30 µg) was analyzed using the SMART System on a
Superdex 200 PC 3.2/30 column (Amersham Pharmacia Biotech) equilibrated
with 20 mM Hepes/HCl, pH 7.5, 150 mM NaCl at a
flow rate of 50 µl/min. Fractions of 80 µl were analyzed by
SDS-PAGE followed by Coomassie staining. The chromatogram of the
molecular mass standards (Bio-Rad) was monitored under the same
conditions to generate a calibration curve.
Immunocoprecipitation--
To analyze the self-association
behavior of syntenin-1 tagged with Myc or FLAG epitopes, syntenin-1
cDNA was inserted in-frame into the pMyc-CMV
(CLONTECH) and pFLAG-CMV-2 (Sigma) expression vectors, respectively. 48 h after transfection with one or both of
these constructs, COS7 cells cultivated on 15-cm plates were washed
with ice-cold PBS followed by solubilization in 1 ml of IP buffer (50 mM Hepes, pH 7.4, 150 mM NaCl, 1 mM
EDTA, 10% glycerol, 1% Triton X-100) containing protease inhibitors
at 4 °C. After 20-min centrifugation at 100,000 × g
and 4 °C, 0.7 ml of clarified lysates was incubated for 4 h
with 3 µg of 9E10 anti-Myc monoclonal antibodies
(CLONTECH) or 5 µg of anti-FLAG M5 (Sigma) and 10 µl of Protein G-agarose (Roche Molecular Biochemicals). The
immunoprecipitates were collected by centrifugation at 13,000 rpm for 1 min and washed three times with ice-cold IP buffer. For Western
blotting, the immunocomplexes were denatured by boiling with 40 µl of
SDS sample buffer followed by 10% SDS-PAGE and electrotransfer to a
PVDF membrane (Amersham Pharmacia Biotech). Myc- and FLAG-syntenin-1 were recognized by using 1 µg/ml 9E10 anti-Myc or 2 µg/ml M5
anti-FLAG (Sigma) primary antibodies and 1:5000 dilution of
AP-conjugated rabbit anti-mouse IgG (Dianova).
Identification of Rat Syntenin-1 as a Neurofascin-binding
Protein--
To identify proteins that interact with the cytoplasmic
segments of the L1-type cell adhesion molecules, we performed several yeast two-hybrid screens. One such screen of a rat brain cDNA library using the cytoplasmic segment of chicken neurofascin as a bait
(90% identity with rat neurofascin at the level of the amino acid
sequence) resulted in the identification of eight positive clones out
of 6 × 106 HF7c yeast transformants. The 1.3 kb
cDNA inserts isolated from three positive clones were identical and
encoded a 432-amino acid residues segment of NH2-terminal
repeats of erythrocyte ankyrin. This is consistent with the known
interaction of neurofascin with ankyrins (15). The 2-kb-long prey
cDNA from the other five positive clones consisted of a 900-bp open
reading frame flanked by 15 bp of the 5'- and 1.1-kb-long 3'-uncoding
region. Conceptual translation of the open reading frame revealed a
sequence of 300 amino acids that shows 91% identity with human
syntenin (27) and can be considered to represent the rat homologue of
human syntenin. Subsequently, it will be referred to as syntenin-1 (see
below) (Fig. 1A). Syntenin-1 is a cytoplasmic protein consisting of a tandem of two PDZ domains flanked by a NH2-terminal segment of 112 amino acid
residues and a short COOH-terminal stretch of 26 residues. Both these
flanking segments do not show any significant similarities to any known polypeptide modules. Furthermore, on the basis of various data base
entries we cloned two isoforms of a protein, termed syntenin-2 in the
following, which are highly related at the amino acid level (70%
identity over the PDZ domains) and in their overall domain organization
to syntenin-1 (Fig. 1, A and B). The stop
codon containing the 5'-uncoding region of the cloned cDNA of the
shorter isoform, designated syntenin-2
To study the tissue expression pattern of syntenin-1 and to compare it
with neurofascin, we generated antibodies against bacterially expressed
GST-syntenin-1 fusion protein in rabbits. To rule out a possible
cross-reactivity with syntenin-2, Western blots of syntenin-1, -2 Syntenin-1 but Not Syntenin-2 Binds to the COOH Terminus of
Neurofascin--
Most PDZ domains investigated so far bind directly to
the COOH termini of transmembrane proteins. The specificity of these interactions is determined by the structural features of the respective PDZ binding pockets and the COOH-terminal amino acids of transmembrane molecules (38). We therefore investigated whether syntenin-1 interacts
with the COOH terminus of neurofascin (SLA-COOH in chick and rat) and
with the COOH termini of other L1 subgroup members. In particular,
NrCAM and neuroglian share a class I PDZ binding motif
(S/T)X(V/I) at their COOH termini. First, we tested
different deletion and substitution constructs in the yeast two-hybrid
system. Fourteen of the most COOH-terminal amino acids of neurofascin were sufficient to bind syntenin-1, whereas deletion of the alanine residue at the position 0 abolished the interaction completely. This
demonstrates that the COOH terminus of neurofascin is the binding site
for syntenin-1 (Table I). Moreover, we
showed that the interaction with syntenin-1 is not affected by the
alternative splicing of the neurofascin cytoplasmic exon, which encodes
the four-amino acid residue stretch RSLE. This sequence motif is also differentially spliced in L1/NgCAM and NrCAM (1). In contrast, syntenin-1 interacted only with the long, nervous system-specific splice isoform (COOH-terminal tripeptide TYV) of the intracellular segment of Drosophila neuroglian but not with its short form
(KGL-COOH) that is widely expressed (39). As expected, syntenin-1
failed to interact with the cytoplasmic tail of L1 (ALE-COOH) and,
surprisingly, with that of NrCAM (SFV-COOH). Because the fourth
vertebrate member of the L1 group CHL1 does not contain any appropriate
COOH-terminal PDZ binding motif (LRA-COOH), similarly to L1, its
interaction with syntenin-1 was not analyzed. The cloning of
syntenin-2
To define amino acid residues that determine the binding behavior of
neurofascin and NrCAM with respect to syntenin-1, a number of
substitution constructs of neurofascin and NrCAM were investigated. The
combined results of the yeast two-hybrid assays, which are presented in
Table I, are consistent with the conclusion that the binding to
syntenin-1 is determined by the residues 0,
To demonstrate the specificity of the interaction between neurofascin
and syntenin-1, we employed several other experimental systems besides
the yeast two-hybrid one. In Fig.
3A the results of a
ligand-overlay assay are shown. The blots of immunoprecipitated wild-type neurofascin, truncated GPI-anchored neurofascin construct, and NgCAM (the chicken homologue of mammalian L1) were incubated either
with MBP-
Furthermore, surface plasmon resonance analysis using a BIAcore system
also confirmed the specificity of the neurofascin-syntenin-1 interaction (Fig. 3B). We observed a strong dose-responsive
binding of MBP-syntenin-1 to an immobilized peptide corresponding to
the 15 COOH-terminal amino acid residues of wild-type neurofascin. (Assuming an A + B
To demonstrate the association of syntenin-1 with neurofascin in
mammalian cells, L929 cells were cotransfected with plasmids encoding
syntenin-1 fused to EGFP and either wild-type neurofascin or the
truncated GPI-anchored neurofascin construct (Fig. 3C). Colocalization of neurofascin clustered by antibodies and
EGFP-syntenin-1 was observed in a subpopulation of cells expressing
wild-type neurofascin but not in the control cultures. This further
confirmed the specificity of the investigated interaction.
Neurofascin and Several Other Transmembrane Proteins
(Neuroglian-180, Pro-TGF-
Taken together, we conclude that neurofascin and the other tested
transmembrane proteins bind to the second syntenin-1 PDZ domain that is
inactive if separated from other parts of the molecule. In addition,
the specificity of this domain appears to be unusual, in that it is
able to bind class I (neurofascin, neuroglian, and pro-TGF- Homo- and Heterodimerization of Syntenin-1 and Syntenin-2--
To
further our understanding of the molecular functions of syntenin-1 and
syntenin-2, we examined the ability of these proteins to self- and
heteroassociate using the two-hybrid assay. Full-length syntenin-1 as well as syntenin-2
To address the question of the structural basis of the self- and
heteroassociation of syntenin-1 and -2, we again used the yeast
two-hybrid system to test different combinations of wild-type, deletion, and point mutants of syntenin-1 as well as the two isoforms of syntenin-2. No interaction of full-length syntenin-1 with
overlapping deletion constructs consisting of either the
NH2-terminal domain alone or combined with PDZ1, of PDZ2
with the COOH-terminal stretch, or of the COOH-terminal stretch of 30 amino acid residues alone could be detected by the two-hybrid assay
(data not shown). In contrast, full-length syntenin-1 bound to the
syntenin-1 construct lacking its NH2-terminal third with
only slightly reduced intensity, whereas this N
Taken together, our observations indicate that the individual domains
alone are not sufficient and the overall integrity of syntenin-1 is
required for the self-association of syntenin-1. The inhibition of the
homodimerization of syntenin-1 might concomitantly affect its
PDZ-mediated binding to neurofascin and to other tested transmembrane proteins.
In this study, we identified the PDZ domains containing molecule
syntenin-1 as an intracellular neurofascin binding partner. The
interaction of syntenin-1 with the cytoplasmic domain of neurofascin was observed in the yeast two-hybrid system and confirmed by overlay assay, by surface plasmon resonance measurements, and by the
colocalization of both proteins in transfected cells. In addition to
rat syntenin-1, we isolated a novel human syntenin-1-related molecule,
syntenin-2, which can be expressed as a long isoform (syntenin-2 We demonstrated that other vertebrate members of the L1 subgroup of
cell adhesion molecules bind neither syntenin-1 nor syntenin-2. Interestingly, syntenin-1 was also able to interact in yeast with the
nervous system-specific isoform of the cytoplasmic tail of Drosophila L1-type protein neuroglian. This finding raises
the question whether there is a syntenin-1-like molecule in flies. Because neuroglian has been considered as the sole L1-type molecule in
Drosophila (3), it might be able to substitute for several functions that are conferred by diverse L1-type molecules (neurofascin, NrCAM, L1, CHL1) in vertebrates, including binding to a putative Drosophila syntenin-1-related protein. Although we failed to
identify a syntenin-1-like protein in the complete
Drosophila genomic data base, another PDZ protein might
interact with the long neuroglian isoform in the insect cells.
Although the majority of known PDZ domains bind to specific
COOH-terminal peptides of transmembrane molecules, several of them
interact with internal sequences or with other PDZ domains. Here, using
site-directed mutagenesis, we mapped the binding sites to the COOH
terminus of neurofascin and to the PDZ2 domain of syntenin-1. Moreover,
we found that PDZ2 is also responsible for the interaction with
neuroglian-180 and several other transmembrane proteins that were
previously reported to bind syntenin-1. One of them is pro-TGF- In accordance with other publications on syntenin-1, the two-hybrid
construct composed only of the PDZ2 domain was found not to interact
with neurofascin nor with other transmembrane proteins tested here. How
might this inability of the isolated PDZ2 domain to bind be explained?
The overall structural integrity of the syntenin-1 molecule might be
required either directly, for its interactions with transmembrane
proteins by means of multiple ligand binding sites, or indirectly, for
the stabilization of the active conformation of the PDZ2 domain. In
this context, Grootjans et al. (28) proposed recently a
cooperative binding mode of specific class II peptides with both PDZ
domains of syntenin-1. In our experiments, mutation in the
carboxylate-binding loop of PDZ1, in opposite to that of PDZ2, hardly
impaired the interactions of syntenin-1 with any of the tested
transmembrane proteins. In contrast, interactions of class I COOH
termini with syntenin-1 lacking its NH2-terminal domain
(N Because we are primarily concentrating here on the molecular aspects of
syntenin interactions, the biological functions of these interactions,
in particular between syntenin-1 and neurofascin in the developing
nervous system, remain to be established. PDZ domains have been
investigated in a number of so-called scaffolding proteins that are
restricted to polarized subcellular sites where they cluster
transmembrane and cytosolic components to multimolecular complexes
(42). For example, in the nervous system, PDZ-containing proteins have
been implicated in the targeting and clustering of pre- and
postsynaptic proteins (43, 44). In particular, the self-association of
syntenin-1 and its heterodimerization with syntenin-2 might suggest a
function to cluster neurofascin and other transmembrane proteins to
subdomains of the plasma membrane of neural cells. However, syntenin-1
was not found to co-cluster with neurofascin at nodes of Ranvier in the
optic nerve of adult mouse,3
making a scaffolding function of syntenin-1 at least at this site less
likely. On the other hand, homo- and heterodimerization of syntenin-1
may allow a large spectrum of transmembrane receptors belonging to
different protein families to be assembled together with neurofascin.
Neurofascin has been shown to be implicated in axonal growth and
fasciculation (10, 11, 35). These dynamic cellular processes require a
mechanism to regulate the cell surface expression of neurofascin. One
possible way to modulate the number of neurofascin molecules on the
neural surface might be to internalize or to target it to specific cell
surface domains. Insertion and removal of plasma membrane components
are part of the growth cone machinery, and evidences have been
accumulated in the past that vesicular transport and the subcellular
targeting of proteins in neurons are involved in neurite extension
(45). Because syntenin-1 appears to be necessary for correct targeting
of pro-TGF-
, which
interacts with neurexin I, and syntenin-2
do not bind to neurofascin
or several other transmembrane proteins that are binding partners of
syntenin-1. Finally, we report that syntenin-1 and -2 both form
homodimers and can interact with each other.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
, neurexins, and the anion exchanger AE2
(27-32). In this study, we identified the second PDZ domain of
syntenin-1 as a binding site of the COOH terminus of neurofascin and of
several other transmembrane proteins mentioned above. Neurofascin was
found not to interact with syntenin-2
or -2
, two isoforms of a
novel protein closely related to syntenin-1. Furthermore, we observed a
homo- and heterodimerization of syntenin-1 and syntenin-2 that appears
to involve larger portions of these molecules. This capacity for
self-association might be crucial for homo- and heterotypic clustering
of neurofascin and other syntenin-binding proteins.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
, ephrin-B2, and EphA7, were obtained
by PCR using specific primers and inserted in-frame into the pGBT9 vector. pGAD10 vector containing cDNA corresponding to the 435 COOH-terminal amino acid residues of human neurexin I-
was obtained by a yeast two-hybrid screen with syntenin-1 as a
bait.2 cDNAs encoding
cytoplasmic segments of neuroglian-167 and -180 were subcloned into the
pGBT9 vector from pRIT3 plasmids provided generously by M. Hortsch
(University of Michigan, Ann Arbor, MI).
and
were cloned by PCR
from a fetal human brain cDNA library
(CLONTECH) using the following primer pairs,
respectively: 5'-GGAATTCATGTCATCCCTGTACCCATCTCTAGAG and
5'-CGAATTCAGGCATCTGGGATGGAGTGGRCC, or 5'-GGAATTCCAGATGGTGGCACCGGTAACCGG and 5'-GGAATTCATCCGAGGGTGGTTGCCCTTTGCTG. The PCR products were inserted
in-frame into the pGBT9 and pGAD424 vectors. In addition, for
analytical reasons, a downstream primer
5'-GGAATTCGTGTCTCCTGAGGCACAGGGTCCC was used to amplify syntenin-2
cDNA containing 93 bp of the isoform-specific 5'-uncoding region.
-galactosidase (
-fragment) fusion protein was expressed using
the pMAL-c2 vector. After transformation of Escherichia coli
strain M15(pREP4) (Qiagen), recombinant proteins were purified by
affinity chromatography using glutathione-Sepharose 4B (Amersham
Pharmacia Biotech) or amylose resin (New England BioLabs) columns as
recommended by the manufacturers.
,
and -2
fusion proteins, syntenin-1 cDNA was inserted in-frame
into the pEGFP-C1, syntenin-2
and -2
into the pEGFP-C2 vectors
(CLONTECH). To obtain these proteins without any
tags, we removed the EGFP encoding segment from the pEGFP-C1(ST-1) or
inserted syntenin-2
and -2
encoding cDNAs into the pSG5
expression vector (Stratagene). COS7 cells were solubilized 48 h
after transfection at 4 °C in radioimmune precipitation buffer (50 mM Tris/HCl, pH 7.4, 150 mM NaCl, 0.5% Triton
X-100, 0.1% SDS, 0.5% sodium deoxycholate, 1 mM
dithiothreitol, 1 mM EDTA) supplemented with protease
inhibitors. The lysates were clarified by centrifugation for 30 min at
13,000 rpm and 4 °C, and their total protein amounts were adjusted
using SDS-PAGE and Coomassie Blue staining. Tissues of 10-week-old rats
were homogenized on ice in radioimmune precipitation buffer containing protease inhibitors followed by centrifugation two times for 20 min at
100,000 × g and 4 °C. 50 µg of each protein
extract were separated on SDS-PAGE followed by electrotransfer to a
PVDF membrane (Amersham Pharmacia Biotech). Rabbit anti-GFP antibodies
(IgG fraction, CLONTECH) were applied at a dilution
of 1:2500. Anti-syntenin-1 antibodies were generated in rabbits by
immunizing 100 µg of GST-syntenin-1 fusion protein at fortnightly
intervals. The IgG fraction, which was isolated from the antiserum
using a Protein A-Sepharose CL-4B (Amersham Pharmacia Biotech) affinity
column, was applied at a concentration of 0.5 µg/ml while the
anti-neurofascin (cytoplasmic peptide) antiserum (13), provided kindly
by P. J. Brophy (University of Edinburgh), as well as the
secondary AP-conjugated goat-anti-rabbit-IgG antibodies (Dianova), were
applied at a dilution of 1:5000. Immunoreactivity was visualized using
5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium AP-Substrat (Biomol).
-galactosidase fusion proteins in PBS,
pH 7.4, supplemented with 0.2% bovine serum albumin and 0.05%
Tween-20. Ligand binding was visualized using anti-MBP antiserum
(1:10,000, New England BioLabs), horseradish peroxidase-conjugated
secondary antibodies (1:10,000, Dianova), and a Metal Enhanced DAB
substrate kit (Pierce).
-galactosidase fusion proteins at the indicated concentrations
and 5 µg/ml flow rate was analyzed using a BIAcore X instrument
(Pharmacia Biosensor) as described elsewhere (37). Data were analyzed
by nonlinear curve fitting using the BIAevaluation software (Pharmacia Biosensor).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
, which lacks almost the
complete NH2-terminal segment, is distinct from that of the
longer 2
-isoform. This finding might be taken as evidence that
syntenin-2
is generated by alternative splicing instead of using the
methionine residue at position 86 within the sequence of syntenin-2
as an alternative translational start site (data not shown and Fig. 1,
A and B).

View larger version (78K):
[in a new window]
Fig. 1.
Amino acid sequences of rat syntenin-1 and
human syntenin-2 and their overall domain organization.
A, alignment of rat syntenin-1 with mouse and human
syntenin-1 and with human syntenin-2. Rat syntenin-1 was identified by
its interaction with neurofascin in a yeast two hybrid screen. Two
isoforms of human syntenin-2,
and
, were cloned on the basis of
the GenBankTM data base entries with accession numbers
AL136531, AF131809, AF159228 and analyzed by sequencing.
Differences between the amino acid sequences are emphasized in
black. The PDZ1 domain is underlined, whereas
PDZ2 is underlined twice. Conserved glycine residues within
the carboxylate-binding loops that were mutated (see Table II) are
indicated by asterisks. Amino acid residues positions are
given at the right. B, schematic representation
of the overall domain organization and homology of syntenins.
NH2 termini are at the left side. Percentages
indicate amino acid sequence identity between corresponding domains of
rat and human syntenin-1 and -2. Amino acid positions are
printed above each scheme. Positions of the start
methionine of syntenin-2
and of the putative
-isoforms of
syntenin-1 are indicated in brackets.
,
-2
or EGFP fusion proteins of these expressed in COS7 cells were
analyzed by generated antibodies. Syntenin-1 migrated with a molecular
mass of ~36 kDa (predicted 32.4 kDa), whereas syntenin-2
(predicted molecular mass 34.4 kDa) was weakly detected as a single
band at ~39 kDa, indicating that both proteins can be distinguished
on the basis of their apparent molecular masses in SDS-PAGE (Fig.
2A). Although syntenin-1 and
-2 were expressed at equal amounts in COS7 cells as judged from the
staining intensities of EGFP-syntenin-1 and -2 fusion proteins using
antibodies against GFP (Fig. 2B), comparison of the staining
intensities demonstrates that the anti-syntenin-1 antibodies reacted
only very weakly with syntenin-2
and do not detect syntenin-2
(Fig. 2C). To analyze the expression pattern of syntenin-1
and neurofascin, Western blots of detergent extracts of various rat
tissues were performed. In contrast to neurofascin, which was found to
be expressed exclusively in the brain (Fig. 2E), syntenin-1
with an apparent molecular mass of ~36 kDa, as also observed in
transected COS7 cells, revealed a wide-spread expression pattern (Fig.
2D). Comparison of the staining intensities indicated
strongest expression of syntenin-1 in brain followed by testis, lung,
and heart. The lowest level of syntenin-1 staining was detected in
skeletal muscles and liver. Syntenin-2 was not detected in this blot,
most likely due to the low cross-reactivity of the anti-syntenin-1
antibodies as described above. The observed tissue expression pattern
of syntenin-1 suggests that functions of syntenin-1 are not restricted to neurofascin, consistent with former studies on syntenin/TACIP18.

View larger version (11K):
[in a new window]
Fig. 2.
In contrast to neurofascin, syntenin-1 shows
a wide-spread tissue expression pattern. A-C,
syntenin-1 and -2 can be distinguished by Western blotting on the basis
of their apparent molecular masses using polyclonal anti-syntenin-1
antibodies. A, Western blot of detergent extracts of
untransfected COS7 cells (lane 1), cells transfected with
cDNAs encoding rat syntenin-1 (lane 2), human
syntenin-2
(lane 3), or -2
(lane 4).
Syntenin-1 and syntenin-2
are recognized by the antibodies generated
in rabbits against GST-syntenin-1 as 36-kDa and 39-kDa components,
respectively, whereas syntenin-2
is not recognized. The staining for
syntenin-1 appears markedly stronger than for syntenin-2
.
B and C, Western blots of COS7 cells expressing
EGFP (lane 1), EGFP-syntenin-1 (lane 2), -2
(lane 3), or -2
(lane 4) fusion proteins.
B, polyclonal antibodies against GFP recognized EGFP as a
31-kDa band, whereas EGFP-syntenin-1, EGFP-syntenin-2
, and
EGFP-syntenin-2
are detected as 62-kDa, 63-kDa, and 53-kDa
polypeptides, respectively. C, anti-syntenin-1 antibodies
recognized EGFP-syntenin-1 as a band corresponding to 62 kDa and
several proteolytic degradation products. Although EGFP fusion proteins
are expressed at a similar level (B), EGFP-syntenin-2
is
detected very weakly (63 kDa, not visible on this copy) and -2
is
not recognized by antibodies against syntenin-1. D and
E, Western blot analysis of syntenin-1 and neurofascin in
various rat tissues: heart (1), brain (2), spleen
(3), lung (4), liver (5), skeletal
muscle (6), kidney (7), testis (8),
stomach (9). D, syntenin-1 is detected at 36 kDa
by the rabbit antibodies used in A and C. The
very weak syntenin-1 bands in liver and skeletal muscle lanes are not
visible on this copy. E, neurofascin, which is generated in
several isoforms, was identified by an antibody raised against a
cytoplasmic peptide of mouse neurofascin exclusively in brain. The
identity of the polypeptide band of ~70 kDa that is recognized by the
anti-neurofascin antiserum in all tissues with the exception of brain
and spleen is unknown.
and -2
allowed us also to test whether they bind to
any member of the L1 subfamily or to the other transmembrane proteins
targets that are known to interact with syntenin-1. Among these, only neurexin I, which shares its COOH-terminal sequence with neurexins II
and III, was found to interact with syntenin-2
but not with -2
in
a yeast two hybrid assay (Table II).
The COOH-terminus of neurofascin is required to bind to syntenin-1
-galactosidase filter
assays (the time it takes colonies to start turning blue) were scored
as follows: ++++
15 min < +++
30 min < ++
1 h < +
2 h < +/
4 h <
.
Two-hybrid analysis of interactions between different membrane proteins
and syntenin-1 or -2
101) and point mutants of the first and/or second PDZ domain
(PDZ1*, G128E; PDZ2*, G212D) as well as syntenin-2
and -2
were
tested for binding to the cytoplasmic segments of neurofascin and
various other transmembrane proteins (their four most COOH-terminal
amino acid residues are given). The results were scored as indicated in
the legend of Table I.
2, and
3 of neurofascin
COOH terminus. Moreover, the failure of NrCAM to bind syntenin-1 is
caused by its
3 asparagine, as indicated by the N(
3)Y substitution
that enabled this mutant to interact with syntenin-1 equally as strong
as neurofascin.
-galactosidase or with MBP-syntenin-1 fusion proteins.
After washing, the membranes were stained with anti-MBP antiserum. This
assay revealed selective binding of MBP-syntenin-1 to wild-type
neurofascin containing the cytoplasmic tail but not to NgCAM or to the
truncated construct of neurofascin.

View larger version (28K):
[in a new window]
Fig. 3.
Syntenin-1 binds specifically to
the cytoplasmic COOH terminus of neurofascin. A,
ligand-overlay assay. NgCAM (lane 1), wild-type neurofascin
(lane 2), and GPI-anchored neurofascin (lane 3)
were immunoprecipitated from detergent extracts of transfected COS7
cells, followed by SDS-PAGE, and transfer to PVDF membranes. To compare
the relative amounts of the immunoprecipitated proteins, one blot was
stained using antibodies against NgCAM and neurofascin. Two other
identical blots were incubated overnight either with MBP-syntenin-1 or
with MBP-
-galactosidase. Binding of MBP fusion proteins was analyzed
by anti-MBP antibodies. Only MBP-syntenin-1 was found to bind to
wild-type neurofascin but not to NgCAM or to GPI-linked neurofascin.
Bands corresponding to the heavy chains of antibodies used for
immunoprecipitation are indicated by the arrow. In the
GPI-anchored form of neurofascin, the transmembrane and cytoplasmic
segments were replaced by one and a half FNIII-like domains followed by
the GPI attachment signal of the F11 molecule. B, surface
plasmon resonance measurements. MBP-
-galactosidase or MBP-syntenin-1
were perfused over the BIAcore sensor chips, which contained
immobilized synthetic peptides corresponding to the last 15 COOH-terminal amino acid residues of either wild-type or of the
A(0)S-substituted neurofascin. Binding curves monitored at different
protein concentrations are shown. Curves representing interaction of
MBP-syntenin-1 with the mutant and of MBP-
-galactosidase with the
wild-type peptide are indicated by single and double
asterisks, respectively. In two independent sets of experiments,
only MBP-syntenin-1 was found to bind selectively and in a
dose-responsive manner to the wild-type but not to the mutated COOH
terminus of neurofascin. (RU, resonance units).
C, colocalization of neurofascin and syntenin-1 in
heterologous cells. EGFP-syntenin-1 was coexpressed in L929 cells
either with wild-type neurofascin (upper panel) or with
GPI-anchored neurofascin construct. Clustering of neurofascin was
achieved by subsequent application of polyclonal anti-neurofascin and
Cy5-conjugated secondary antibodies at 37 °C in culture medium.
Following fixation, the subcellular localization of neurofascin and
EGFP-syntenin-1 was analyzed by confocal microscopy. Arrows
indicate colocalization. (The scale bar represents 10 µm.)
AB interaction, the apparent dissociation rate
constant was calculated to be ~1 × 10
4
s
1. However, a further analysis of the obtained binding
curves revealed that they are not consistent with such a simple model.)
In contrast, no significant binding was detected using the
A(0)S-substituted neurofascin peptide with MBP-syntenin-1, or the
wild-type peptide with MBP-
-galactosidase.
, Syndecans, B-ephrins, EphA7, and
Neurexins) Bind to the Second PDZ Domain of Syntenin-1--
Syntenin-1
contains two PDZ domains and interacts with the COOH terminus of
neurofascin and several other transmembrane proteins. This suggests
that at least one of these domains is responsible for these
interactions. To determine the individual binding specificity of the
two syntenin-1 PDZ domains for different known interacting transmembrane proteins, we generated several syntenin-1 mutants and
tested these in the two-hybrid assay. We observed that neither of the
overlapping deletion constructs of syntenin-1, which were composed of
the NH2-terminal third only or together with PDZ1, or of
the isolated PDZ2 with the COOH-terminal stretch, did interact with the
cytoplasmic tail of neurofascin (data not shown). This is consistent
with the published data on the interaction of syntenin-1 with syndecan
or pro-TGF-
(28, 29). To address the binding specificity of the
syntenin-1 PDZ domains further and to map binding sites within
syntenin-1, we substituted the last glycine residue in the
carboxylate-binding loop of each PDZ domain (see Fig. 1A) by
glutamate (G128E in PDZ1) or aspartate (G212D in PDZ2). This glycine is
the most conserved residue throughout all PDZ domains and allows the
loop preceding the
2 strand to form a turn that is necessary for
interaction with the ligand's carboxylate group (40). Three resulting
point mutants (PDZ1*, PDZ2*, and PDZ1*2*) were then tested for binding
to the cytoplasmic tails of several transmembrane proteins listed in
Table II. The mutation in the first domain (PDZ1*) did not cause any
significant reduction of the binding as observed in the two-hybrid
assay. In contrast, the PDZ2* construct, as well as the double-mutant
PDZ1*2*, failed to interact with any of the tested cytoplasmic
segments. This indicates that the second PDZ domain is required to bind
them. However, the deletion construct of syntenin-1 containing the PDZ tandem but lacking 101 NH2-terminal amino acids (N
101)
also failed to bind neurofascin, neuroglian-180, and pro-TGF-
,
whereas the intensity of its interaction with syndecan-3, ephrin B-2,
or EphA7 was reduced (Table II).
) and
class II (syndecans, class B ephrins, EphA7, and neurexins) COOH
termini. Abolishment or reduction of binding caused by the deletion of
the PDZ1 and/or the NH2-terminal segment of syntenin-1
might be the result of inappropriate folding of the obtained
polypeptides. Alternatively, these domains might be indirectly involved
in the interaction between syntenin-1 and the transmembrane proteins.
One such conceivable mechanism might include the oligomerization of
syntenin-1.
showed a strong homotypic
interaction and a weaker heterotypic interaction as judged by the
-galactosidase assay (Tables III and
IV). To gather additional evidence for the homotypic oligomerization of
syntenin-1, we transiently cotransfected COS7 cells with plasmids
encoding Myc- and FLAG-tagged syntenin-1. Specific coprecipitation of
Myc- or FLAG-syntenin-1 from detergent lysates of double-transfected
cells with either anti-FLAG or anti-Myc monoclonal antibodies,
respectively, was readily observed (Fig. 4A). Full-length syntenin-1
without any epitope extensions also coprecipitated with FLAG- as well
as with Myc-syntenin-1, suggesting that oligomerization might not be
caused by the Myc or FLAG epitopes (data not shown). In addition, size
exclusion chromatography of purified bacterially expressed
MBP-syntenin-1 fusion protein revealed three peaks. One peak, estimated
at a molecular mass of ~90 kDa, fits relatively well with the
monomeric form (predicted molecular mass 77 kDa), whereas the other at
~163 kDa represents most likely the dimeric form of recombinant
MBP-syntenin-1 (Fig. 4B). A third MBP-syntenin-1 peak was
observed in the exclusion volume of the column and probably contains
supermolecular aggregates. Taken together, these investigations
indicate that syntenin-1 self-associates and forms homodimers.
Self-association of syntenin-1

View larger version (22K):
[in a new window]
Fig. 4.
Syntenin-1 forms homodimers.
A, coimmunoprecipitation of FLAG-syntenin-1 with
Myc-syntenin-1 and vice versa. FLAG- and Myc-tagged
syntenin-1 were expressed either separately or together in COS7 cells
by transient transfection. FLAG-syntenin-1 was immunoprecipitated with
monoclonal antibody M5 against the FLAG epitope followed by Western
blotting and detection of Myc-syntenin-1 by monoclonal antibody 9E10
against the Myc epitope, whereas Myc-tagged syntenin-1 was
immunoprecipitated by monoclonal antibody 9E10 followed by Western
blotting and detection of FLAG-syntenin-1 by monoclonal antibody M5.
(IP, immunoprecipitation; WB, Western blot;
P, precipitate; S, supernatant; H,
heavy chain; L, light chain of antibodies; ST,
Myc- or FLAG-syntenin-1.) B, size exclusion chromatography.
Purified MBP-syntenin-1 fusion protein (30 µg) was analyzed using a
Superdex 200 gel filtration column that had been calibrated by the
molecular mass standards indicated in the diagram by small
squares (thyroglobulin (670 kDa), bovine gamma globulin (158 kDa),
chicken ovalbumin (44 kDa), equine myoglobin (17 kDa)). Two observed
peaks at 90 kDa and 163 kDa (larger squares) contained
MBP-syntenin-1 and presumably represent its monomeric and dimeric
forms. A third peak (not shown) was observed in the exclusion volume of
the column.
101 mutant was not
able to self-associate (Table III). These observations indicate that
the NH2-terminal third might be required but is not
sufficient for the homotypic interaction of syntenin-1 and that it
might bind to some part of the molecule other than itself. Similarly,
syntenin-2
, which is comparable to the N
101 construct of
syntenin-1 (see Fig. 1), was found to self-associate significantly
weaker than the long
-isoform (Table IV). We tested whether the point
mutations within carboxylate-binding loops of PDZ domains can affect
the self-association of syntenin-1. For this reason, PDZ1*, PDZ2*, and
PDZ1*2* mutants were assayed for their ability to interact with each
other, wild-type, or deletion constructs of syntenin-1. Only results
were considered that could be confirmed by a vice versa
exchange of the two-hybrid vectors (BD and AD) in which a particular
pair of constructs was expressed. The data illustrate an apparent
implication of the PDZ domains in the self-association mechanism of
syntenin-1, but details remain to be investigated in the future.
Self-association of syntenin-2 and its heterodimerisation with
syntenin-1
, -2
, and -1 were tested for self- or heteroassociation
by a yeast two-hybrid assay. The results were scored as indicated in
the legend of Table I.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
)
that has the same domain organization as syntenin-1 and as a short
isoform (syntenin-2
) that contains the PDZ-tandem but lacks mostly
the NH2-terminal third. Syntenin-2
but not syntenin-2
was shown to interact with neurexins, but neither with neurofascin nor
with several other transmembrane proteins. Syntenin-1 and syntenin-2 both were able to self-associate and to interact with each other in the
two-hybrid system. The homodimerization of syntenin-1 was confirmed by
coimmunoprecipiation experiments and gel filtration chromatography.
Although the binding sites sufficient for the homodimerization of
syntenin-1 are still unknown, we consider a homotypic binding mode, in
which the PDZ tandem and at least a part of the
NH2-terminal domain are essential. The binding of the
syntenin-1 deletion mutant N
101 to wild-type syntenin-1 and its
failure to interact with itself exclude the possibility that dimers are
formed by association of the NH2 termini of two syntenin-1 molecules. More likely, binding of the NH2 terminus of
syntenin-1 to an unknown site within the COOH-terminal two thirds of
the molecule enables an antiparallel or "head to tail" association.
,
which, together with neurofascin and neuroglian-180, contains a
threonine or a serine at the COOH-terminal position
2 and belongs
therefore to the class I PDZ-binding proteins (38). Another group of
syntenin-1-interacting proteins tested here consists of syndecans,
neurexins I-III, class B ephrins, and EphA7, all of which belong to
the class II PDZ-binding proteins that contain an aromatic or
hydrophobic residue at position
2. On the basis of their sequences,
the PDZ domains of syntenin-1 should interact with the class
II-specific sequence motifs (28). Indeed, affinity of syntenin-1 to
class II COOH termini appears to be higher than to class I COOH
termini. Nevertheless, our data together with the observations of
Fernandez-Larrea et al. (29) on pro-TGF-
strongly support
that the syntenin-1 PDZ2 domain also binds to specific class I COOH
termini. Screens of oriented peptide libraries and yeast two-hybrid
studies have demonstrated that PDZ binding may require side-chain
interactions in addition to those at the COOH-terminal amino acid
positions 0 and
2 (38, 41). Here, we showed that binding to
syntenin-1 PDZ2 domain is also determined by the
3 residue of the
ligand. NrCAM containing the COOH-terminal PDZ-binding motif SXV-COOH
and an asparagine residue at position
3 failed to bind syntenin-1,
whereas the single substitution Y(
3)N within the sequence of
neurofascin abolished its interaction with syntenin-1 in yeast.
Moreover, the reciprocal substitution N(
3)Y within the COOH-terminal
sequence of the NrCAM enabled this mutant to bind. These findings,
however, leave open the possibility for other critical positions in
addition to 0,
1, and
3, as well as the question of the structural
basis of the unusual ligand recognition by the syntenin-1 PDZ2 domain.
In the future, the issue of the binding specificity of the syntenin-1
PDZ1 domain might be addressed by screening for proteins interacting
with it.
101) were abolished, whereas the binding of class II COOH termini
to this mutant was retained. As it was shown that this deletion
construct does not self-associate, dimerization of syntenin-1 might be
considered as a prerequisite for interactions with class I but not with
class II COOH-terminal peptides. Although there is currently no direct
evidence proving this binding model, future studies might reveal
whether the homodimerization allosterically enhances the affinity of
the PDZ2 to specific ligands of class II and even enables this domain
for interactions with class I proteins such as neurofascin and
pro-TGF-
.
to the surface of Chinese hamster ovary cells (29) and
is colocalized with internalized transferrin in early apical recycling
endosomes in Madin-Darby canine kidney cells (46), it might function by
linking bound neurofascin or other transmembrane proteins to
trafficking or recycling pathways also in neural cells. The
identification of syntenin-1 as an intracellular binding partner of
neurofascin may allow us to study the removal and insertion of
neurofascin in the context of neurite extension during early neural
development or its targeting to axonal initial segments and to the
nodes of Ranvier in the differentiated nervous system. Further insights into the functions of syntenin-1 and -2 might also be obtained by
identifying cytoplasmic proteins linking them to trafficking or
signaling pathways.
| |
ACKNOWLEDGEMENTS |
|---|
We appreciate the technical assistance of Hannelore Drechsler, and critical reading of the manuscript by Michael Hortsch, Thomas Brümmendorf, and Alistair Garrat. We are grateful to Vladislav Kiselyov and Elisabeth Bock (Panum Institute, University of Copenhagen) for their help with the BIAcore experiments, and to Stefan Schumacher (Max-Delbrück-Centrum) and Alex Babich (Freie Universität Berlin) for their introduction to fast protein liquid chromatography systems. We thank Peter J. Brophy (University of Edinburgh) for providing antibodies to the cytoplasmic domain of neurofascin, Michael Hortsch (University of Michigan, Ann Arbor, MI) for the cDNA clones encoding Drosophila neuroglian, and Peter Sonderegger (University of Zürich) for the NgCAM cDNA.
| |
FOOTNOTES |
|---|
* These studies were supported by grants from the Deutsche Forschungsgemeinschaft (SFB515) and the European Union (BIO4-CT96-0450 (to F. G. R.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ292243, AJ292244, and AJ292245.
§ Present address: Naturwissenschaftliches und Medizinisches Institut, Markwiesenstrasse 55, Reutlingen D-72770, Germany.
To whom correspondence should be addressed: Tel.: 49-30-9406-3709;
Fax: 49-30-9406-3730; E-mail: Rathjen@mdc-berlin.de.
Published, JBC Papers in Press, January 4, 2001, DOI 10.1074/jbc.M010647200
2 M. Koroll, and F. G. Rathjen, unpublished data.
3 M. Koroll and F. G. Rathjen, unpublished observations.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
NgCAM, neuron-glia
CAM;
FNIII, fibronectin type III;
CAM, cell adhesion molecule;
NrCAM, NgCAM-related CAM;
CHL1, close homologue of L1;
pro-TGF-
, protransforming growth factor
;
AD, GAL4 activation domain;
BD, GAL4
DNA-binding domain;
ST, syntenin;
MBP, maltose-binding protein;
GST, glutathione S-transferase;
EGFP, enhanced green fluorescence
protein;
GPI, glycosylphosphatidylinositol;
PCR, polymerase chain
reaction;
bp, base pair(s);
kb, kilobase(s);
PBS, phosphate-buffered
saline;
PAGE, polyacrylamide gel electrophoresis;
PVDF, polyvinylidene
difluoride.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Brummendorf, T., Kenwrick, S., and Rathjen, F. G. (1998) Curr. Opin. Neurobiol. 8, 87-97 |
| 2. | Kamiguchi, H., and Lemmon, V. (2000) Curr. Opin. Cell Biol. 12, 598-605 |
| 3. | Hortsch, M. (2000) Mol. Cell. Neurosci. 15, 1-10 |
| 4. | Dahme, M., Bartsch, U., Martini, R., Anliker, B., Schachner, M., and Mantei, N. (1997) Nat. Genet. 17, 346-349 |
| 5. | Cohen, N. R., Taylor, J. S., Scott, L. B., Guillery, R. W., Soriano, P., and Furley, A. J. (1998) Curr. Biol. 8, 26-33 |
| 6. | Demyanenko, G. P., Tsai, A. Y., and Maness, P. F. (1999) J. Neurosci. 19, 4907-4920 |
| 7. | Moulding, H. D., Martuza, R. L., and Rabkin, S. D. (2000) J. Neurosci. 20, 5696-5702 |
| 8. | De Angelis, E., MacFarlane, J., Du, J. S., Yeo, G., Hicks, R., Rathjen, F. G., Kenwrick, S., and Brummendorf, T. (1999) EMBO J. 18, 4744-4753 |
| 9. | Hassel, B., Rathjen, F. G., and Volkmer, H. (1997) J. Biol. Chem. 272, 28742-28749 |
| 10. | Volkmer, H., Zacharias, U., Norenberg, U., and Rathjen, F. G. (1998) J. Cell Biol. 142, 1083-1093 |
| 11. | Volkmer, H., Leuschner, R., Zacharias, U., and Rathjen, F. G. (1996) J. Cell Biol. 135, 1059-1069 |
| 12. | Davis, J. Q., Lambert, S., and Bennett, V. (1996) J. Cell Biol. 135, 1355-1367 |
| 13. | Tait, S., Gunn, M. F., Collinson, J. M., Huang, J., Lubetzki, C., Pedraza, L., Sherman, D. L., Colman, D. R., and Brophy, P. J. (2000) J. Cell Biol. 150, 657-666 |
| 14. | Lambert, S., Davis, J. Q., and Bennett, V. (1997) J. Neurosci. 17, 7025-7036 |
| 15. | Davis, J. Q., and Bennett, V. (1994) J. Biol. Chem. 269, 27163-27166 |
| 16. | Dubreuil, R. R., Macvicar, G., Dissanayake, S., Liu, C. H., Homer, D., and Hortsch, M. (1996) J. Cell Biol. 133, 647-655 |
| 17. | Malhotra, J. D., Tsiotra, P., Karagogeos, D., and Hortsch, M. (1998) J. Biol. Chem. 273, 33354-33359 |
| 18. | Jefford, G., and Dubreuil, R. R. (2000) J. Biol. Chem. 275, 27726-27732 |
| 19. | Garver, T. D., Ren, Q., Tuvia, S., and Bennett, V. (1997) J. Cell Biol. 137, 703-714 |
| 20. | Zhang, X., Davis, J. Q., Carpenter, S., and Bennett, V. (1998) J. Biol. Chem. 273, 30785-30794 |
| 21. | Tuvia, S., Garver, T. D., and Bennett, V. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 12957-12962 |
| 22. | Ren, Q., and Bennett, V. (1998) J. Neurochem. 70, 1839-1849 |
| 23. | Kamiguchi, H., Long, K. E., Pendergast, M., Schaefer, A. W., Rapoport, I., Kirchhausen, T., and Lemmon, V. (1998) J. Neurosci. 18, 5311-5321 |
| 24. | Kamiguchi, H., and Lemmon, V. (1998) J. Neurosci. 18, 3749-3756 |
| 25. | Schaefer, A. W., Kamiguchi, H., Wong, E. V., Beach, C. M., Landreth, G., and Lemmon, V. (1999) J. Biol. Chem. 274, 37965-37973 |
| 26. | Fanning, A. S., and Anderson, J. M. (1999) J. Clin. Invest. 103, 767-772 |
| 27. | Grootjans, J. J., Zimmermann, P., Reekmans, G., Smets, A., Degeest, G., Durr, J., and David, G. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 13683-13688 |
| 28. | Grootjans, J. J., Reekmans, G., Ceulemans, H., and David, G. (2000) J. Biol. Chem. 275, 19933-19941 |
| 29. | Fernandez, L. J., Merlos, S. A., Urena, J. M., Baselga, J., and Arribas, J. (1999) Mol. Cell 3, 423-433 |
| 30. | Cowan, C. A., Yokoyama, N., Bianchi, L. M., Henkemeyer, M., and Fritzsch, B. (2000) Neuron. 26, 417-430 |
| 31. | Torres, R., Firestein, B. L., Dong, H., Staudinger, J., Olson, E. N., Huganir, R. L., Bredt, D. S., Gale, N. W., and Yancopoulos, G. D. (1998) Neuron. 21, 1453-1463 |
| 32. | Lin, D., Gish, G. D., Songyang, Z., and Pawson, T. (1999) J. Biol. Chem. 274, 3726-3733 |
| 33. | Volkmer, H., Hassel, B., Wolff, J. M., Frank, R., and Rathjen, F. G. (1992) J. Cell Biol. 118, 149-161 |
| 34. | Brummendorf, T., Wolff, J. M., Frank, R., and Rathjen, F. G. (1989) Neuron 2, 1351-1361 |
| 35. | Rathjen, F. G., Wolff, J. M., Chang, S., Bonhoeffer, F., and Raper, J. A. (1987) Cell. 51, 841-849 |
| 36. | Rathjen, F. G., Wolff, J. M., Frank, R., Bonhoeffer, F., and Rutishauser, U. (1987) J. Cell Biol. 104, 343-353 |
| 37. | Kiselyov, V. V., Berezin, V., Maar, T. E., Soroka, V., Edvardsen, K., Schousboe, A., and Bock, E. (1997) J. Biol. Chem. 272, 10125-10134 |
| 38. | Songyang, Z., Fanning, A. S., Fu, C., Xu, J., Marfatia, S. M., Chishti, A. H., Crompton, A., Chan, A. C., Anderson, J. M., and Cantley, L. C. (1997) Science. 275, 73-77 |
| 39. | Hortsch, M., Bieber, A. J., Patel, N. H., and Goodman, C. S. (1990) Neuron 4, 697-709 |
| 40. | Ponting, C. P., Phillips, C., Davies, K. E., and Blake, D. J. (1997) Bioessays 19, 469-479 |
| 41. | Hock, B., Bohme, B., Karn, T., Yamamoto, T., Kaibuchi, K., Holtrich, U., Holland, S., Pawson, T., Rubsamen, W. H., and Strebhardt, K. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 9779-9784 |
| 42. | Fanning, A. S., and Anderson, J. M. (1999) Curr. Opin. Cell Biol. 11, 432-439 |
| 43. | Garner, C. C., Kindler, S., and Gundelfinger, E. D. (2000) Curr. Opin. Neurobiol. 10, 321-327 |
| 44. | Garner, C. C., Nash, J., and Huganir, R. L. (2000) Trends Cell Biol. 10, 274-280 |
| 45. | Kamiguchi, H., and Lemmon, V. (2000) J. Neurosci. 20, 3676-3686 |
| 46. | Fialka, I., Steinlein, P., Ahorn, H., Bock, G., Burbelo, P. D., Haberfellner, M., Lottspeich, F., Paiha, K., Pasquali, C., and Huber, L. A. (1999) J. Biol. Chem. 274, 26233-26239 |