JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M010611200 on January 8, 2001

J. Biol. Chem., Vol. 276, Issue 14, 10745-10752, April 6, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/14/10745    most recent
M010611200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Napoli, A.
Right arrow Articles by Ciaramella, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Napoli, A.
Right arrow Articles by Ciaramella, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A Novel Member of the Bacterial-Archaeal Regulator Family Is a Nonspecific DNA-binding Protein and Induces Positive Supercoiling*

Alessandra NapoliDagger , Mamuka Kvaratskelia§, Malcolm F. White§, Mosé RossiDagger , and Maria CiaramellaDagger

From the Dagger  Institute of Protein Biochemistry and Enzymology, Consiglio Nazionale delle Ricerche, Via Marconi 10, 80125 Naples, Italy and the § Centre for Biomolecular Science, St. Andrews University, KY16 9ST, St. Andrews, United Kingdom

Received for publication, November 26, 2000, and in revised form, January 4, 2001



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In hyperthermophilic Archaea genomic DNA is from relaxed to positively supercoiled in vivo because of the action of the enzyme reverse gyrase, and this peculiarity is believed to be related to stabilization of DNA against denaturation. We report the identification and characterization of Smj12, a novel protein of Sulfolobus solfataricus, which is homologous to members of the so-called Bacterial-Archaeal family of regulators, found in multiple copies in Eubacteria and Archaea. Whereas other members of the family are sequence-specific DNA- binding proteins and have been implicated in transcriptional regulation, Smj12 is a nonspecific DNA-binding protein that stabilizes the double helix and induces positive supercoiling. Smj12 is not abundant, suggesting that it is not a general architectural protein, but rather has a specialized function and/or localization. Smj12 is the first protein with the described features identified in Archaea and might participate in control of superhelicity during DNA transactions.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Microorganisms belonging to the domain Archaea, most of which are adapted to life under extreme conditions, display a peculiar melange of prokaryotic and eukaryotic cellular components, in particular in processes pertaining to genome structure and function. For instance, basic transcription apparatus is of eukaryotic type (1, 2), whereas the few transcription regulators studied so far are similar to bacterial helix turn helix regulators (3-7). Such proteins are abundant in bacterial and archaeal genomes but scarce or highly divergent in Eukarya, and therefore the definition of Bacterial-Archaeal (BA)1 regulators has been recently proposed (5).

As for genome structure, a striking difference exists between the two archaeal subdomains Euryarchaeota and Crenarchaeota; true histones, structurally and functionally homologous to eukaryal histones, have been identified in several members of Euryarchaeota (reviewed in Refs. 8 and 9). In contrast, histones have not been found so far in Crenarchaeota. Although several crenarchaeal DNA-binding proteins have been identified, mainly in the thermoacidophilic genus Sulfolobus (10-15), little is known about nucleoid structure and composition in these organisms.

In recent years physical and functional interaction between chromatin and multiprotein complexes performing basic processes like transcription, replication, recombination, and repair has been reported both in eukaryotes and Eubacteria, suggesting that chromatin components have not only structural but also regulative functions (16-21). Eukaryal and archaeal histones, chromatin-associated proteins, and bacterial nucleoid proteins affect DNA structure by inducing compaction, bending, and/or supercoiling (9, 18, 22). DNA supercoiling participates in essential functions in the cell, such as control of gene expression, DNA condensation, decatenation and segregation of replicated DNA molecules, and homologous DNA pairing (see Refs. 23 and 24 and references therein). Whereas negative supercoiling is required to provide melting potential, positive supercoiling stabilizes the double helix; consistently, DNA is negatively supercoiled in mesophiles, both prokaryotes and eukaryotes, whereas it is from relaxed to positively supercoiled in hyperthermophilic Archaea (25, 26). Positive supercoiling is considered a key element of the adaptation to high temperature and correlates with the presence of the enzyme reverse gyrase, which introduces positive superturns into DNA molecules (reviewed in Refs. 27 and 28). On the other hand, hyperthermophilic Archaea also contain classical topoisomerases, such as TopoVI (29) and TopoV (30), which relax positive and negative superturns, and architectural proteins showing unwinding activity (13, 14, 31). As shown for other organisms, rapid changes in DNA topology are associated with cold and heat shock in these organisms (26). These findings suggest that different factors cooperate in achieving careful regulation of general and local DNA topology in hyperthermophilic Archaea; mechanisms and elements taking part in this complex homeostatic process are poorly understood.

Here we report the identification of a novel DNA-binding protein of Sulfolobus solfataricus, named Smj12, which is homologous to the transcription regulator Lrs14, an archaeal repressor belonging to the BA family; however, unlike Lrs14, Smj12 is a nonspecific DNA-binding protein. It is highly basic and thermostable, binds double-stranded DNA, and protects it from thermal denaturation. By using topoisomerase I assays we show that Smj12 induces positive supercoiling of minicircle and plasmid DNA. Whereas abundant proteins inducing negative supercoiling in Sulfolobus have been reported (13, 14, 31), this is the first protein showing the opposite activity described in this organism. Moreover, Smj12 is not abundant as expected for architectural proteins. The possible function of Smj12 in the regulation of DNA conformation is discussed.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Purification of Smj12 from Sulfolobus-- Smj12 was identified while searching for activities able to recognize Holliday junctions (HJ) in Sulfolobus strains. The cells of two archaeal species, S. solfataricus MT4 and S. shibate B12, were supplied by the Center for Extremophile Research, Porton Down, UK. Cell lysis, centrifugation, and chromatography steps were carried out at 4 °C. 50-g cells were thawed in 150 ml of lysis buffer (50 mM Tris-HCl, pH 7.5, 300 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 1 mM benzamidine, 1 mM 4-(2-aminoethyl)benzenesulfonylfluoride, HCl) and immediately sonicated for 5 × 1 min with cooling. The lysate was centrifuged at 40,000 × g for 30 min. The supernatant was diluted 4-fold with Buffer A (50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1 mM dithiothreitol, and 50 mM NaCl) and applied to an SP-Sepharose high performance 26/10 column (Hi-Load; Amersham Pharmacia Biotech) equilibrated with Buffer A. A 500-ml linear gradient comprising 50 to 600 mM NaCl was used to elute cationic proteins. Fractions were assayed for four-way DNA junction-specific binding by gel electrophoresis mobility shift analysis using the 32P-labeled synthetic four-way DNA junction Z28 (32). An activity peak was detected in the fractions eluted from the column at 370 to 400 mM NaCl, and these fractions were pooled and concentrated. The concentrated protein (7 ml) was loaded onto a 26/70 gel filtration column (Superdex 200 Hi Load; Amersham Pharmacia Biotech) and developed with Buffer A containing 300 mM NaCl. Active fractions eluted at 210 to 225 ml were pooled and diluted with an equal volume of Buffer A. The protein was loaded onto a 1-ml HiTrap heparin column (Amersham Pharmacia Biotech) pre-equilibrated with Buffer A. Proteins were eluted with a linear gradient of NaCl (80 ml; 0.05 to 1 M NaCl), and active fractions were pooled and diluted 5-fold with Buffer A. Finally, the enzyme was loaded onto a Mono-S column (Amersham Pharmacia Biotech) pre-equilibrated with Buffer A and eluted with a linear gradient of 100 ml of 50 to 1,000 mM NaCl. The active fractions were analyzed by SDS-PAGE and stored at 4 °C until needed.

Peptide Sequence Analysis-- A sample of the purified Smj12 protein was subjected to SDS-PAGE. The protein band was identified by staining with Coomassie Blue, excised, and destained with 0.1 M ammonium bicarbonate in 50% acetonitrile. The gel piece was cut in 1-mm cubes and digested with 12.5 µg/ml modified trypsin (Roche Molecular Biochemicals) in 20 mM ammonium bicarbonate at 30 °C for 18 h. The gel pieces were removed by centrifugation (at 13,000 rpm for 15 min in a microcentrifuge) and subsequently washed with 50% acetonitrile:1% trifluoroacetic acid in water followed by centrifugation as above. The supernatants were pooled, and an aliquot of the mixture was analyzed by matrix-assisted laser desorption ionization-time of flight mass spectrometry in a Perceptive Biosystems Elite STR mass spectrometer using alpha-cyanocinnamic acid as the matrix. The supernatant was dried and resuspended in 0.1% trifluoroacetic acid in water and subjected to reverse phase HPLC on a 150 × 0.5-mm C18 column (PerkinElmer Life Sciences) coupled to an Applied Biosystems 173A microblotter HPLC system. The column was developed with a gradient of 0.1% trifluoroacetic acid in water versus 70% acetonitrile:30% water in 0.09% trifluoroacetic acid. Peptides were detected at 210 nm, and fractions were collected onto a Problot/ polyvinylidene difluoride membrane fitted to the microblotter. After allowing the membrane to dry, relevant regions of the blot were excised and subjected to Edman sequence analysis in either an Applied Biosystems 492A or 476A protein sequencer.

Protein Expression in Escherichia coli-- A synthetic gene encoding Sulfolobus Smj12 was constructed from the following six oligonucleotides shown below by recursive polymerase chain reaction (33): Oligo 1, CGTCGGATCCCCATGGCCATCGAAATCTCCGAAAAATCCTTCCTGCTGAAACGTTTCCTGATCGTTGCTTACG; Oligo 2, TTTCGCTCGAGACGATTTTGATGAAAGCGTCAACGTCAGCTTCGGACAGACCGTAAGCAACGATCAGGAAACGTTTCAGC; Oligo 3, ATCGTCTCGAGCGAAACCGGTAAAGACGTTGACGCTATCGCTGGTGAACTGGGTATCTCCAAATCCCGTGCTTCCCTGATCC; Oligo 4, CACCTCTAGAAACGGAGGTTTTTTCTTTTTCAACCAGACCAGCGTCAGCCAGTTTTTTCAGGATCAGGGAAGCACGGGATTTGG; Oligo 5, CCGTTTCTAGAGGTGGTCGTCCGAAATTCCTGTACCGTATCAACAAAGAAGAACTGAAAAAGAAACTGATCAAACGTTCCGAAG; and Oligo 6, GGATCCGTCGACTTACAGGAAGGAGGAGATGATGGTGTGCAGGTCTTTGCAGGTTTCTTCGGAACGTTTGATCAGTTTCTTTTTCAG.

Codon bias was optimized for expression in E. coli. The full-length polymerase chain reaction product was cloned into the BamHI site of vector pUC119 (CLONTECH), creating the plasmid pUC119-Smj12, whose insert was sequenced completely to ensure that no errors had been introduced in the amplification process. The Smj12 gene was subcloned from pUC119 into the BamHI and NcoI sites of the expression vector pET19b (Novagen), allowing expression of Smj12 with a native N terminus in BL21 CodonPlus (DE3) RIL cells (Stratagene). Transformed cultures were induced with 0.2 mM isopropyl-1-thio-beta -D-galactopyranoside at 37 °C for 2.5 h; cells were lysed, and total extracts, showing strong expression of an ~12-kDa protein band (data not shown) were heated for 20 min at 70 °C to precipitate E. coli proteins. Smj12 was purified by ion exchange and gel filtration chromatography using SP-Sepharose or heparin columns.

The synthetic gene, amplified with the addition of BglII and HindIII tails at the 5' and 3' ends, respectively, was also cloned in pQE-31 (Qiagen) cut with BamHI and HindIII. The resulting plasmid (after resequencing of the insert) was transformed in E. coli BL21 trx; the recombinant protein, containing a six-histidine tail at the N terminus, was purified by affinity chromatography on nickel-nitrilotriacetic acid (Ni-NTA)-agarose as reported (3). Recovered protein was >95% pure as estimated by SDS-PAGE (not shown).

Nucleotide Sequence Accession Number-- The nucleotide sequence data reported in this paper will appear in the GenBankTM/EBI data bases under accession number AJ133494.

Northern Analysis-- S. solfataricus P2 cultures (200 ml) were grown at different A600 at 80 °C as indicated; total RNA was extracted using the RNAeasy kit (Qiagen). The amount of RNA loaded was normalized by the fluorescence of ribosomal RNAs in ethidium bromide-stained gels and by staining the filters with methylene blue. The same filters were hybridized sequentially with two random-primed probes, a 375-bp fragment containing the Smj12 coding sequence and a 390-bp fragment containing the Lrs14 coding sequence (3).

Band Shift Assays-- Standard reactions (10 µl) contained the following: 1× binding buffer (20 mM Tris-HCl, pH 7.5, 10% glycerol, 50 mM KCl, 0.1 mM dithiothreitol), purified Smj12, cold competitor DNA if appropriate, and 2-5 × 103 cpm of end-labeled probe (0.5 nM). After incubations at indicated temperatures samples were immediately loaded on native 5% polyacrylamide gels in 0.5× Tris borate buffer and run at room temperature. The gels were dried, and the autoradiograms were exposed at -80 °C. The probe BEN (300 bp) contained 280 bp of the upstream region of the Lrs14 gene, amplified by polymerase chain reaction, cloned in pGEM-Teasy (Promega), and cut with EcoRI; the probe AMP contained 221 bp of the ampicillin gene obtained from pGEM3 by AvaII digestion. Probes were prepared by restriction digestion of the appropriate plasmid DNA, gel-purified, dephosphorylated with alkaline phosphatase, and end-labeled using 32P-gamma ATP and T4 polynucleotide kinase. Relaxed circular probes were obtained by ligation of labeled fragments in the absence of any intercalating agents; minicircle probes with different topology were obtained as described below.

Western Analysis-- S. solfataricus P2 cultures were grown at 80 °C until the A600 reached 0.5; cells were collected by centrifugation, resuspended in Buffer E (50 mM phosphate buffer, pH 8.0, 1 mM EDTA, 10 mM MgCl2) containing 500 mM NaCl, and lysed by sonication. Extracts were centrifuged for 5 min at 15,000 rpm to pellet cell debris and dialyzed against 50 mM phosphate buffer, pH 8.0. The protein concentration was determined using a Bio-Rad protein assay kit. Appropriate volumes of extracts were denatured, loaded on polyacrylamide SDS gels, and electroblotted to nitrocellulose membranes. Polyclonal antibodies were raised in rabbit against Lrs14 and Sso7d and in goat against Smj12; secondary anti-rabbit and anti-goat peroxidase-conjugated antibodies were used (Amersham Pharmacia Biotech). Blots were developed using the Amersham ECL-plus kit.

Preparation of Minicircle Topoisomers-- The procedure reported (34) was as follows: a 371-bp DNA fragment isolated from pUC18 by AclI restriction cleavage was dephosphorylated with alkaline phosphatase and 5'-end labeled by T4 polynucleotide kinase with 32P-gamma ATP followed by a chase with cold ATP (1 mM). Labeled DNA fragments were incubated at a DNA concentration of 0.11 µg/ml (final volume 250 µl) in ligase buffer in the presence of 400 units of T4 DNA ligase (New England Biolabs) for 18 h at 16 °C and ethidium bromide at 0, 0.2, 0.6, or 1.2 µg/ml. After incubation 1% SDS and 1 M NaCl were added, and samples were extracted with 1 volume of chloroform (SEVAG extraction) and ethanol-precipitated. Samples were loaded on preparative 5% polyacrylamide gel and run at room temperature in 0.5 × TBE buffer (30 mM Tris borate, 2 mM EDTA, pH 8). Topoisomers were identified by their mobility relative to that of the topoisomer of Delta Lk = 0, which is the slowest (34); minicircles of Delta Lk = -2 and -3, obtained at the highest ethidium bromide concentrations, migrated less than topoisomer -1, suggesting that they deviate from the B form of DNA, as previously reported (34). DNA minicircle molecules were extracted from gel and purified by SEVAG extraction and ethanol precipitation. The identity of each purified topoisomer was confirmed by topoisomerase I assay (35).

TopoI Assay on DNA Minicircles-- Assays were performed as reported (35) with the following modifications: Smj12 minicircles binding reaction mixes containing 0.8 ng of probe (0.33 nM) and indicated Smj12 amounts were incubated with 2 units of DNA topoisomerase I from wheat germ (Promega) for 1 h at 37 °C. After SEVAG extraction and ethanol precipitation, samples were loaded on nondenaturing 5% polyacrylamide gels and run at room temperature in 0.5 × TBE buffer. The gels were dried, and the autoradiograms were exposed at -80 °C.

TopoI Assay on Plasmid DNAs-- Relaxed pGEM3 plasmid DNA was prepared using DNA topoisomerase I (Promega) according to the manufacturer's conditions. Reaction mixture contained 300 ng (11 nM) of relaxed plasmid DNA, 4 units of topoisomerase I, and the indicated amount of Smj12 where appropriate. After incubation at 37 °C for 45 min, the reaction was stopped by adding 1% SDS and by SEVAG extraction followed by ethanol precipitation. Reaction products were analyzed on 1% agarose gel in TBE buffer. Electrophoresis was performed at room temperature. Negatively to positively supercoiled plasmids were separated using no intercalating agent during the first dimension and 10 ng/ml ethidium bromide during the second dimension. Running conditions were 25 mA for 16-17 h and 15 mA for 22 h, respectively. Stained gels were photographed under UV light.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Purification and Identification of Smj12-- In the frame of a project aimed at identification of components of the recombination pathway in archaea, we searched for activities able to recognize HJ in two Sulfolobus strains (S. solfataricus MT4 and S. shibate B2). Starting with a 50-g wet weight of cells, we assayed extracts for HJ-specific binding activity using a synthetic four-way DNA junction substrate (32). The activity was detected in both archaeal species investigated after the fractionation of the cell lysates by cation exchange chromatography. The protein responsible for the activity was purified from S. solfataricus by means of four column chromatography steps, resulting in a 500-fold purification with an overall yield of some 15 µg of protein, which was >95% pure as assessed by SDS-PAGE (Fig. 1). The subunit molecular mass estimated by SDS-PAGE was 15,000 ± 1,000 Da, and the protein was eluted from a calibrated size exclusion column with a retention time consistent with a molecular mass of 31 ± 4,000 Da (data not shown), suggesting a dimeric composition in solution. Although the N terminus was blocked, in gel trypsin digestion after denaturing SDS-PAGE yielded ~20 peptides. Nine were sequenced, and the longest sequence obtained (amino acid sequence IVSSETGKDVDAIAGELGISK) was used to search the S. solfataricus P2 genome sequence.2 A perfect match was found for a single open reading frame encoding a protein of 116 amino acids (GenBankTM/EBI accession number AJ133494). Other tryptic peptide sequences (80 residues in total) were also matched to this protein. The theoretical protein, designated Smj12, has a calculated molecular mass of 12,890 Da and an isoelectric point of 9.3, in agreement with the biochemical properties of the purified protein. The open reading frame annotated in the S. solfataricus data base starts with a TTG codon, which is not unusual in Archaea (36). It was not possible to confirm the authenticity of this initiation codon, because the N terminus of the protein was blocked.



View larger version (64K):
[in this window]
[in a new window]
 
Fig. 1.   Purification of Smj12 from S. solfataricus. A sample of protein was analyzed by SDS-PAGE after the following chromatography steps: 1) high performance SP-Sepharose; 2) size exclusion Superdex 200 26/70; 3) HiTrap heparin-Sepharose; and 4) Mono-S. Molecular weight markers are shown.

Data base searches showed that the predicted Smj12 protein shares significant sequence similarity with the Lrs14 protein of S. solfataricus (3); sequence homologs were found among hypothetical proteins of S. solfataricus and other Archaea whose genomes have been completed. The alignment with the best matches is shown in Fig. 2.



View larger version (72K):
[in this window]
[in a new window]
 
Fig. 2.   Smj12 and its relatives. Alignment of Smj12 with some of the highest hits from a Blast search is shown; it concerns Lrs14 (3) and four sequences of archaeal hypothetical proteins (Ss014 and Ss023 are found in S. solfataricus, MJ1503 in the M. jannaschii, and AF1846 in the A. fulgidus data bases, respectively. Amino acid residues that are identical or similar in at least four sequences are boxed.

Expression of Smj12 in S. solfataricus-- We have analyzed transcription in vivo of the Smj12 gene by Northern blot (Fig. 3A). Total RNA was extracted from S. solfataricus cells at different growth stages and was probed with a DNA fragment corresponding to the Smj12 coding sequence. The probe hybridized to a 0.4 kb-long transcript, accounting for a monocistronic transcription of the gene. This finding suggests that the Smj12 promoter is adjacent to its coding sequence; indeed sequences matching the consensus for the archaeal Tf-B responsive element and TATA elements (37) were found in the region 49-34 upstream of the first TTG (Fig. 3C). Interestingly the steady-state Smj12 RNA was only present during the exponential phase (Fig. 3A, lanes 2 and 3) and declined in later growth stages, a pattern different from that of three members of the Lrp/AsnC family, namely Lrs14, Sa-Lrp from S. acidocaldarius, and the E. coli Lrp, whose levels are sustained in the stationary phase (Fig. 3B; see Refs. 3, 7, and 38).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3.   Expression of Smj12 in vivo. S. solfataricus RNAs were extracted from cultures grown at different optical density as follows: lane 1, 0.2 A600; lane 2, 0.4 A600; lane 3, 0.6 A600; and lane 4, 0.8 A600. The same amount of RNA (2 µg) was loaded in each lane; the filter was hybridized with (A) the 375-bp Smj12 coding sequence and (B) with the 390-bp BamHI-SalI DNA fragment from pGEM-Hom, containing the whole Lrs14 coding sequence (3). C, DNA sequence of the region spanning nucleotides -58/+3 of Smj12 relative to the first TTG, which is indicated by an arrow. The putative Tf-B responsive element and TATA sequences are boxed.

Smj12 Is a Nonspecific DNA-binding Protein-- To obtain suitable amounts of the protein we constructed a synthetic Smj12 gene with codons optimized for expression in E. coli; the gene was cloned both in vector pET9a, for expression from the presumptive first codon, and in vector pQE-31, for expression as a fusion protein with a histidine tag at the N terminus. The two recombinant proteins were identical in thermostability and binding properties (data not shown); unless otherwise specified, the experiments shown were obtained with the His-tailed protein.

To characterize Smj12 binding properties we tested a variety of different fragments as probes in band shift experiments (Fig. 4). The protein was able to bind linear (A and B) or circular (C) fragments and plasmids (not shown) of different length and sequence. In all cases the protein produced ladders of multiple complexes whose mobility decreased with increasing protein concentration; at higher concentrations the complexes hardly entered the gels. The binding affinity was comparable with all probes tested; the Kapp calculated from data in Fig. 4 and data not shown was about 40 nM. Although the protein was identified for its ability to bind synthetic fragments containing HJ, Smj12 did not show higher affinity for such substrates (data not shown). Single-stranded DNA was not bound (data not shown). We conclude that Smj12 is a sequence-nonspecific DNA-binding protein and does not show DNA structure preference.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4.   Band shift analysis. Binding of Smj12 purified from E. coli to the following is shown: A, the linear probe BEN, containing 280 bp of the upstream region of the Lrs14 gene; B, the linear probe AMP, containing 221 bp of the ampicillin gene; and C, the circular probe BEN. All gels contained the following: lane 1, naked probe (0.5 nM); and lanes 2-5, 3.5, 10, 35, and 100 ng of Smj12 (25, 72, 250, and 720 nM), respectively. Binding reactions were incubated at 37 °C for 30' and run on 5% polyacrylamide gels.

Nonspecific DNA-binding proteins often induce compaction of DNA, a conformational change resulting in reduction of the hydrodynamic volume of DNA-protein complexes, which show electrophoretic acceleration rather than retardation; for instance, the archaeal proteins MC1 and Sso7d induce compaction of negative or positively supercoiled DNA molecules, respectively (39).3 Complexes formed by Smj12 with DNA molecules of different nature (plasmids, minicircles of any topology, and linear fragments) were always retarded, and therefore there was no evidence of compaction (Fig. 4 and data not shown).

Smj12 Binding Activity Is Thermostable and Stabilizes DNA against Heat Denaturation-- Because S. solfataricus is a hyperthermophilic organism optimally living at 80-85 °C we tested the effect of temperature on Smj12 binding activity (Fig. 5). Binding efficiency was unchanged in the range 37-75 °C, was reduced above 80 °C, and at 95 °C no stable complex was formed; in reactions performed above 80 °C the fraction of unbound probe was denatured. In contrast, when the protein was preincubated with DNA at 37 °C and then shifted to high temperatures, all the probe was bound up to 85 °C, and a stable complex was formed even at 90 °C. This experiment indicates that Smj12 is intrinsically stable up to 90 °C under the conditions used, and it protects DNA from heat denaturation; in the experiment shown in Fig. 5 the probe Tm is raised by about 10 °C. Protection of DNA from thermal denaturation has been reported for a number of nonspecific DNA-binding proteins from hyperthermophiles (40, 41); in contrast, the sequence-specific factor Lrs14 was not able to protect DNA fragments or plasmids containing its target sequences (data not shown).



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 5.   Smj12 is a thermostable DNA-binding protein and stabilizes DNA against denaturation. Binding of Smj12 to the probe BEN at different temperatures is shown. Lane 1, naked probe (0.5 nM), denatured by incubation at 90 °C for 10 min; lanes 2 and 10, naked probe, double-stranded (ds); lanes 3-8 and 11-17, the double-stranded probe was incubated with Smj12 (100 ng, 720 nM) at the following temperatures for 10 min: lanes 3 and 11, 37 °C; lanes 4 and 12, 50 °C; lanes 5 and 13, 70 °C; lanes 6 and 14, 75 °C; lanes 7 and 15, 80 °C; lanes 8 and 16, 85 °C; and lanes 9 and 17, 90 °C. Samples 10-17 were preincubated at 37 °C for 10 min to allow binding and then shifted to the indicated temperatures for 10 min, after which binding samples were immediately loaded on 5% polyacrylamide gels.

Smj12 and Lrs14 Are Not Abundant Proteins-- To estimate the intracellular abundancy of Smj12 with respect to its homolog Lrs14 and to the architectural dsDNA-binding protein Sso7d, polyclonal antibodies were raised against the three proteins and used in quantitative Western blot experiments using known amounts of the three purified proteins as standards (Fig. 6). As expected from their sequence similarity, Lrs14 and Smj12 cross-reacted with both specific antibodies, although with different affinity, whereas Sso7d reacted only with the specific antibody. Moreover, because Lrs14 and Smj12 also have a very similar molecular weight (12.9 versus 14), they were not distinguishable in cell extracts, and therefore a differential quantitation of the two proteins was impaired. However, we could conclude that together they represent less than 0.1% of total protein and are therefore of far lower abundance than Sso7d (Fig. 6C), which accounts for more than 1% of total cell protein. Similarly, the E. coli Lrp protein is far less abundant than architectural proteins such as HU or Fis (42).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6.   Western blot. A, lanes 1-3, purified His-tailed Lrs14, 1, 0.5, and 0.2 µg, respectively; lane 4, S. solfataricus cell extract, 500 µg; and lanes 5-7, purified His-tailed Smj12, 0.3, 0.2, and 0.1 µg, respectively. B, lanes 1-3, purified His-tailed Lrs14, 0.2, 0.1, and 0.05 µg, respectively; lane 4, S. solfataricus cell extract, 500 µg; and lanes 5-7, purified His-tailed Smj12, 2.5, 1, and 0.4 µg, respectively. C, lanes 1-3, Sso7d, 4, 2, and 1 µg, respectively; and lane 4, S. solfataricus cell extract, 200 µg. Proteins were separated on 12% polyacrylamide SDS gels. Polyclonal antibodies against Smj12 (A), Lrs14 (B), and Sso7d (C) were used. Bands corresponding to purified Lrs14 and Smj12 migrate slower than those in extracts for the presence of the histidine tag in the recombinant proteins (about 3 kDa in Lrs and about 1 kDa in Smj12).

Smj12 Induces Positive Supercoiling-- A feature shared by different classes of nonspecific DNA-binding proteins in Eukarya, Eubacteria, and Archaea is the ability to induce DNA bending and/or supercoiling upon binding. The relationships between Smj12 and DNA conformation were initially addressed using DNA minicircles. Minicircle DNA probes of different topology (Delta Lk = +1, 0, -1, and -2, respectively) were obtained by ligation of a 371-bp DNA fragment in the presence of increasing concentrations of ethidium bromide (34). In band shift assays all topoisomers were bound with comparable efficiency by Smj12 (data not shown).

To analyze DNA conformation in Smj12-DNA complexes we used TopoI assays (35). Binding reactions of Smj12 with different minicircles were incubated with eukaryotic TopoI, which relaxes positive/negative superturns; deproteinated reaction products were analyzed by nondenaturing polyacrylamide gel electrophoresis, allowing for separation of different topoisomers (Fig. 7). We used four different topoisomers of the 371-bp fragment, with Delta Lk = +1, 0, -1, and a mixture of -2/-3. As expected, only the relaxed topoisomer was produced by TopoI alone (lanes 2, 7, 12, and 17); incubation with increasing amounts of Smj12 followed by TopoI action resulted in an increase of the linking number of topoisomers, implying that Smj12 induces local positive supercoiling upon binding, which is compensated in free regions by negative superhelicity, that can be efficiently relaxed by TopoI, resulting in net positive supercoiling. Despite the starting topology, the predominant product of the reaction was a +1 minicircle, which was most evident at the highest concentration used (6 Smj12 dimers/bp); higher Delta Lk values were never observed even at higher protein concentrations (data not shown). This result might indicate that the positive supercoiling activity of Smj12 is weak; however, it is also possible that the DNA fragment used can accommodate only one positive superturn per molecule because of length constraints. Indeed ligation of this 371-bp fragment in the presence of netropsin, an intercalator that induces positive supercoiling, failed to produce topoisomers of higher Delta Lk values (data not shown); this finding is consistent with the notion that, in circles smaller than 500 bp, the energy required to change Lk values by one unit is large, and only one, or at most two, topoisomers are produced (43). Indeed, on a circle of this length a Delta Lk = +1 gives a specific linking difference (sigma ) of +0.028, corresponding to a significant torsional stress similar to that found in vivo (26).



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 7.   Smj12 induces positive supercoiling on minicircle topoisomers. TopoI assay on minicircle DNAs is shown. 371-bp topoisomers of Delta Lk +1, 0, -1, and -2/-3 were obtained (see "Experimental Procedures"). Lanes 1, 6, 11, and 16, topoisomers +1, 0, -1, and -2/-3 (0.33 nM), respectively. Lanes 2, 7, 12, and 17, topoisomer +1, 0, -1, and -2/-3, respectively, incubated with 2 units of TopoIsomerase I. 10, 35, and 100 ng of Smj12 (72, 250, and 720 nM), respectively, were incubated with the following: lanes 3-5, topoisomer +1; lanes 8-10, topoisomer 0; lanes 13-15, topoisomer -1; and lanes 18-20, topoisomer -2/-3. An autoradiogram is shown. Topoisomers -2/-3 deviate from the predicted migration (i.e. are slower than topoisomer -1) suggesting a structural departure from the B form of the double helix in this molecule that may be induced by negative torsional stress (34).

To confirm the DNA positive supercoiling activity of Smj12 we performed a similar experiment using a completely different substrate, a highly negatively supercoiled plasmid DNA, and separated the reaction products by bidimensional gel electrophoresis (Fig. 8A). Only relaxed plasmid was present in the presence of TopoI alone (lane TopoI); when increasing amounts of Smj12 were added, positive topoisomers were produced. The maximum Delta Lk value reached was +5 (sigma  = +0.019), obtained at a protein/DNA ratio of 0.75 Smj12 dimers/bp; higher Smj12 concentrations did not increase the number or Delta Lk value of the products. Similar results were obtained using a relaxed plasmid (Fig. 8B).



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 8.   Smj12 induces positive supercoiling on plasmids. TopoI assay on plasmid DNA is shown. A, negatively supercoiled pGEM3 plasmid DNA (11 nM) was incubated with 2.5 units of TopoI or with the same amount of TopoI plus 0.3 and 0.9 µg of Smj12 (1.4 and 4.2 µM), as indicated. B, relaxed pGEM3 (11 nM) was incubated with 0.3, 0.9, and 1.8 µg of Smj12 (1.4, 4.2, and 8.4 µM), as indicated. Incubation was for 45 min at 37 °C. Deproteinated samples were separated on bidimensional agarose gels with ethidium bromide in the second dimension. Positive topoisomers migrate in the right part of the gels.

We conclude that Smj12 induces positive supercoiling in DNA substrates of any topology upon binding, a conformational change that, in cooperation with the topoisomerase activity, is translated into topological change.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We have identified and characterized Smj12, a novel S. solfataricus member of the BA family of proteins whose prototype is the E. coli Lrp transcriptional regulator (44). Smj12 shares sequence and immunological similarity with the S. solfataricus Lrs14 protein; however, whereas Lrs14 specifically binds to sequences in its own promoter (3, 5), Smj12 shows no sequence specificity and affects DNA structure inducing positive supercoiling.

BA regulators are present in multiple copies in Eubacteria and Archaea; those for which functional data are available are sequence-specific DNA-binding proteins implicated in transcription regulation (5, 6, 44). During the preparation of this manuscript the finding that the Bacillus subtilis LrpC protein is a nonspecific DNA-binding protein affecting DNA supercoiling was reported (45). Therefore in both Archaea and Gram-positive Eubacteria two classes of BA regulators are present that differ in binding specificity and consequently in function. B. subtilis lrpC null strain is viable and has a pleiotropic phenotype (46), but the function of LrpC is still elusive. Interestingly, both B. subtilis and Sulfolobus lack histones, suggesting that nonspecific members of the family might affect chromatin structure in the absence of histones.

Proteins collectively defined as architectural have been found in every organism, and, although unrelated in both structure and function, they usually share the ability to induce DNA bending and/or supercoiling upon binding and/or to preferentially interact with bent, supercoiled, or crossed DNA. They include the HMG1 proteins, members of the HMGI-Y family, histones, the SWI/SNF complex, and a number of eubacterial proteins (reviewed in Ref. 47). Although most of these proteins have a structural role, some of them may have very specific functions.

Most architectural proteins induce negative supercoiling. These include bacterial HU, eukaryal histones, the archaeal MC1, Sso7d, and SacI0b families (13, 14, 31, 39, 48). Positive supercoiling has been reported so far for few proteins, including the euryarchaeal histone homologs HmfB and Htz, for which controversial data are available: whereas they induce positive supercoiling at low salt and high protein concentrations, at physiological salt concentration they wrap DNA into negative supercoils (49, 50). Smj12 induces positive supercoiling at a wide range of concentrations, and the conditions of our assay are, with respect to ionic strength, physiological for Sulfolobus. Complexes formed by Smj12 with DNA molecules of any type are always retarded (Fig. 4 and data not shown), suggesting that Smj12 does not compact DNA; moreover, it does not induce bending nor show preference for cruciform DNA (data not shown) and, most important, is not abundant (Fig. 6), suggesting that it is unlikely to organize higher order structures over the whole chromosome. A specific localization and/or function must be hypothesized.

Recently both positive and negative supercoiling activity has been associated with the Rad51/Rad53 complex during recombination (24), and positive supercoiling activity has been shown for the so-called condensins, multiprotein complexes that contain the evolutionary conserved structural maintenance of chromosome proteins (51). Interestingly, structural maintenance of chromosome proteins show high affinity for cruciform DNA fragments (52) and have been found associated to recombination complexes (53). Smj12 recognizes four-way junctions, although with affinity comparable than double-stranded substrates; whether this ability reflects any physiological activity is currently only a matter for speculation. Cruciform DNAs are intermediates in recombination, as well as in DNA replication; Smj12 might act as an accessory protein in one or both processes, for instance stabilizing such intermediates.

Although the actual DNA topology of hyperthermophilic Archaea is unknown, it has been suggested that these organisms stabilize their DNA through a general linking excess, which is imputable to reverse gyrase activity (54). However, it has been argued that such torsional constraint could not be maintained in the presence of strand breaks introduced during replication, repair, and recombination (55); one fascinating hypothesis is that Smj12 is required to maintain local positive supercoiling during DNA transactions. Unfortunately, it is currently not possible to obtain targeted mutants in Sulfolobus, and therefore the function of the protein cannot be directly addressed. It would be interesting to investigate the possible connection between Smj12 and proteins of the recombination pathway, such as RadA, the archaeal homolog of Rad51/RecA (56), and the Holliday junction resolvases Hjc and Hje (57), as well as the replication complex (58, 59). Physical association and/or functional interaction of Smj12 with one (or more) of these proteins might suggest its involvement in one (or both) of these processes.


    ACKNOWLEDGEMENTS

We are grateful to Neil Raven for supply of the archaeal biomass, to Nick Morrice for mass spectroscopy, to Marco Moracci for useful discussion, and to Ottavio Piedimonte and Giovanni Imperato for technical assistance.


    FOOTNOTES

* This work was partially supported by the European Union project "Extremophiles as cell factories" and by the CNR Special Program "Biomolecole per la salute umana."The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ133494.

To whom correspondence should be addressed. Tel.: 390817257246; Fax: 390812396525; E-mail: ciaramel@dafne.ibpe.na.cnr.it.

Published, JBC Papers in Press, January 8, 2001, DOI 10.1074/jbc.M010611200

2 S. solfataricus P2 genome project, unpublished results.

3 A. Napoli, Y. Zivanovic, C. Bocs, C. Buhler, M. Rossi, P. Forterre, and M. Ciaramella, submitted for publication.


    ABBREVIATIONS

The abbreviations used are: BA, Bacterial-Archaeal; TopoX, topoisomerase X; HJ, Holliday junctions; PAGE, polyacrylamide gel electrophoresis; HPLC, high pressure liquid chromatography; bp, base pair.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES


1. Bell, S. D., and Jackson, S. P. (1998) Trends Microbiol. 6, 222-228
2. Soppa, J. (1999) Mol. Microbiol. 31, 1295-1305
3. Napoli, A., van der Oost, J., Sensen, C. W., Charlebois, R. L., Rossi, M., and Ciaramella, M. (1999) J. Bacteriol. 181, 1474-1480
4. Bell, S. D., Cairns, S. S., Robson, R. L., and Jackson, S. P. (1999) Mol. Cell 4, 971-982
5. Bell, S. D., and Jackson, S. P. (2000) J. Biol. Chem. 275, 31624-31629
6. Brinkman, A. B., Dahlke, I., Tuininga, J. E., Lammers, T., Dumay, V., de Heus, E., Lebbink, J. H., Thomm, M., de Vos, W. M., and van der Oost, J. (2000) J. Biol. Chem. 275, 38160-38169
7. Enoru-Eta, J., Gigot, D., Thia-Toong, T. L., Glansdorff, N., and Charlier, D. (2000) J. Bacteriol. 182, 3661-3672
8. Reeve, J. N., Sandman, K., and Daniels, C. J. (1997) Cell 89, 999-1002
9. Sandman, K., and Reeve, J. N. (2000) Arch. Microbiol. 17, 165-169
10. Choli, T., Wittmann-Liebold, B., and Reinhardt, R. (1988) J. Biol. Chem. 263, 7087-7093
11. Reddy, T. R., and Suryanarayana, T. (1989) J. Biol. Chem. 264, 17298-17308
12. Kulms, D., Schafer, G., and Hahn, U. (1997) Biol. Chem. 378, 545
13. Mai, V. Q., Chen, X., Hong, R., and Huang, L. (1998) J. Bacteriol. 180, 2560-2563
14. Xue, H., Guo, R., Wen, Y., Liu, D., and Huang, L. (2000) J. Bacteriol. 182, 3929-3933
15. Forterre, P., Confalonieri, F., and Knapp, S. (1999) Mol. Microbiol. 32, 669-670
16. Struhl, K. (1999) Cell 98, 1-4
17. Jones, K. A., and Kadonaga, J. T. (2000) Genes Dev. 14, 1992-1996
18. Kornberg, R. D., and Lorch, Y. (1999) Cell 98, 285-294
19. Newlon, C. S. (1997) Cell 91, 717-720
20. Ridgway, P., and Almouzni, G. (2000) J. Cell Sci. 113, 2647-2658
21. Ritzi, M., and Knippers, R. (2000) Gene 245, 13-20
22. Travers, A. A., Ner, S. S., and Churchill, M. E. A. (1994) Cell 77, 167-169
23. Holmes, V. F., and Cozzarelli, N. R. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 1322-1324
24. Van Komen, S., Petukhova, G., Sigurdsson, S., Stratton, S., and Sung, P. (2000) Cell 6, 563-572
25. Charbonnier, F., and Forterre, P. (1994) J. Bacteriol. 176, 1251-1259
26. Lopez-Garcia, P., and Forterre, P. (1997) Mol. Microbiol. 23, 1267-1279
27. Duguet, M. (1995) in Nucleic Acids and Molecular Biology (Eckstein, F. , and Lilley, D. M. J., eds), Vol. 9 , pp. 84-114, Springer-Verlag, Berlin
28. Forterre, P., Bergerat, A., and Lopez-Garcia, P. (1996) FEMS Microbiol. Lett. 18, 237-248
29. Bergerat, A., Gadelle, D., and Forterre, P. (1994) J. Biol. Chem. 269, 27663-27669
30. Slesarev, A. I., Stetter, K. O., Lake, J. A., Gellert, M., Krah, R., and Kozyavkin, S. A. (1993) Nature 364, 735-737
31. Lopez-Garcia, P., Knapp, S., Ladenstein, R., and Forterre, P. (1998) Nucleic Acids Res. 26, 2322-2328
32. Kvaratskhelia, M., Wardleworth, B. N., Norman, D. G., and White, M. F. (2000) J. Biol. Chem. 275, 25540-25546
33. Prodromou, C., and Pearl, L. H. (1992) Protein Eng. 5, 827-829
34. Goulet, I., Zivanovic, Y., and Prunell, A. (1987) Nucleic Acids Res. 15, 2803-2821
35. Zivanovic, Y., Goulet, I., Revet, B., Le Bret, M., and Prunell, A. (1988) J. Mol. Biol. 200, 267-290
36. Dennis, P. P. (1997) Cell 89, 1007-1010
37. Bell, S. D., Kosa, P. L., Sigler, P. B., and Jackson, S. P. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 13662-13667
38. Landgraf, J. R., Wu, J., and Calvo, J. M. (1996) J. Bacteriol. 178, 6930-6936
39. Toulmé, F., Le Cam, E., Teyssier, C., Delain, E., Sautiere, P., Maurizot, J.-C., and Culard, F. (1995) J. Biol. Chem. 270, 6286-6291
40. Baumann, H., Knapp, S., Lundback, T., Ladenstein, R., and Hard, T. (1994) Nat. Struct. Biol. 1, 808-819
41. Ronimus, R. S., and Musgrave, D. (1996) Mol. Microbiol. 20, 77-86
42. Azam, T. A., Iwata, A., Nishimura, A., Ueda, S., and Ishihama, A. (1999) J. Bacteriol. 181, 6361-6370
43. Bates, A. D., and Maxwell, A. (1993) in DNA Topology (Rickwood, D. , and Hale, D., eds) , IRL Press at Oxford University Press, Oxford
44. Calvo, J. M., and Matthews, R. G. (1994) Microbiol. Rev. 58, 466-490
45. Tapias, A., Lopez, G., and Ayora, S. (2000) Nucleic Acids Res. 28, 552-559
46. Beloin, C., Ayora, S., Exley, R., Hirschbein, L., Ogasawara, N., Kasahara, Y., Alonso, J. C., and Hegarat, F. L. (1997) Mol. Gen. Genet. 256, 63-71
47. Zlatanova, J., and van Holde, K. (1998) FASEB J. 12, 421-431
48. Rouviere-Yaniv, J., Yaniv, M., and Germond, J. E. (1979) Cell 17, 265-274
49. Musgrave, D. M., Sandman, K. M., and Reeve, J. N. (1991) Proc. Natl. Acad. Sci U. S. A. 87, 10397-10401
50. Musgrave, D. M., Forterre, P., and Slesarev, A. (2000) Mol. Microbiol. 35, 341-349
51. Kimura, K., Rybenkov, V. V., Crisona, N. J., Hirano, T., and Cozzarelli, N. R. (1999) Cell 98, 239-248
52. Akhmedov, A. T., Frei, C., Tsai-Pflugfelder, M., Kemper, B., Gasser, S. M., and Jessberger, R. (1998) J. Biol. Chem. 273, 24088-24094
53. Jessberger, R., Riwar, B., Baechtold, H., and Akhmedov, A. T. (1996) EMBO J. 15, 4061-4068
54. Lopez-Garcia, P. (1999) J. Mol. Evol. 49, 439-452
55. Grogan, D. W. (1998) Mol. Microbiol. 28, 1043-1049
56. Seitz, E. M., Brockman, J. P., Sandler, S. J., Clark, A. J., and Kowalczykowski, S. C. (1998) Genes Dev. 12, 1248-1253
57. Kvaratskhelia, M., and White, M. F. (2000) J. Mol. Biol. 297, 923-932
58. Pisani, F. M., De Felice, M., Carpentieri, F., and Rossi, M. (2000) J. Mol. Biol. 301, 61-73
59. Pisani, F. M., De Felice, M., Manco, G., and Rossi, M. (1998) Extremophiles 2, 171-177


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
A. Valenti, G. Perugino, A. D'Amaro, A. Cacace, A. Napoli, M. Rossi, and M. Ciaramella
Dissection of reverse gyrase activities: insight into the evolution of a thermostable molecular machine
Nucleic Acids Res., July 9, 2008; (2008) gkn418v1.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Mukherjee, A. O. Sokunbi, and A. Grove
DNA protection by histone-like protein HU from the hyperthermophilic eubacterium Thermotoga maritima
Nucleic Acids Res., July 1, 2008; 36(12): 3956 - 3968.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Peeters, R. Willaert, D. Maes, and D. Charlier
Ss-LrpB from Sulfolobus solfataricus Condenses about 100 Base Pairs of Its Own Operator DNA into Globular Nucleoprotein Complexes
J. Biol. Chem., April 28, 2006; 281(17): 11721 - 11728.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Valenti, A. Napoli, M. C. Ferrara, M. Nadal, M. Rossi, and M. Ciaramella
Selective degradation of reverse gyrase and DNA fragmentation induced by alkylating agent in the archaeon Sulfolobus solfataricus.
Nucleic Acids Res., January 1, 2006; 34(7): 2098 - 2108.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Napoli, A. Valenti, V. Salerno, M. Nadal, F. Garnier, M. Rossi, and M. Ciaramella
Functional interaction of reverse gyrase with single-strand binding protein of the archaeon Sulfolobus
Nucleic Acids Res., January 26, 2005; 33(2): 564 - 576.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Napoli, A. Valenti, V. Salerno, M. Nadal, F. Garnier, M. Rossi, and M. Ciaramella
Reverse Gyrase Recruitment to DNA after UV Light Irradiation in Sulfolobus solfataricus
J. Biol. Chem., August 6, 2004; 279(32): 33192 - 33198.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
V. Salerno, A. Napoli, M. F. White, M. Rossi, and M. Ciaramella
Transcriptional response to DNA damage in the archaeon Sulfolobus solfataricus
Nucleic Acids Res., November 1, 2003; 31(21): 6127 - 6138.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Beloin, J. Jeusset, B. Revet, G. Mirambeau, F. Le Hegarat, and E. Le Cam
Contribution of DNA Conformation and Topology in Right-handed DNA Wrapping by the Bacillus subtilis LrpC Protein
J. Biol. Chem., February 7, 2003; 278(7): 5333 - 5342.
[Abstract] [Full Text] [PDF]