![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 14, 10817-10823, April 6, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
-DEPENDENT ACTIVATION*
,
§¶,
,
, and
§**
From the Departments of
Psychiatry and Behavioral
Sciences and § Pharmacology and Cancer Biology, Duke
University Medical Center, Durham, North Carolina 27710 and
Centre de Recherche sur l'Endocrinologie Moléculaire et
le Developpement, Centre National de la Recherche Scientifique,
UPR 9078, Meudon, 92190 France
Received for publication, November 22, 2000, and in revised form, January 5, 2001
| |
ABSTRACT |
|---|
|
|
|---|
Uncoupling protein-2 (UCP2) is present in
many tissues with relevance to fuel metabolism, and its expression is
increased in fat and muscle in response to elevated circulating free
fatty acids resulting from fasting and high fat feeding. We proposed a
role for peroxisome proliferator-activated receptor- Uncoupling protein-2
(UCP2)1 was discovered in
1997 as a homologue of the brown fat UCP (UCP1) (2). Like UCP1, which
is able to dissipate caloric energy as heat by uncoupling mitochondrial respiration from ATP production, UCP2 can similarly uncouple
respiration, at least in vitro (2). This fact, coupled with
other significant features, including tissue distribution and genetic
location in a strong quantitative trait locus for hyperinsulinemia and
leptin levels, made UCP2 an attractive candidate for regulation
of resting metabolic rate and as an obesity/diabetes susceptibility
gene. However, we recently reported that targeted disruption of the UCP2 gene does not lead to spontaneous or diet-induced obesity and
diabetes (3), but changes in sensitivity to glucose-stimulated insulin
secretion are observed.2
Thus, the relationship between energy metabolism and UCP2
remains unclear.
Transcripts and protein expression of UCP2 are found in many tissues
with relevance to fuel metabolism such as pancreatic Although these findings provide compelling evidence for the involvement
of fatty acids in regulation of UCP2 expression, the molecular
mechanisms remain unknown. However, a PPAR-dependent pathway is one of the possible mechanisms that can be considered to
mediate the response of UCP2 to fatty acids, because it has been shown
that at least some fatty acids can bind PPAR PPAR Cloning of Mouse UCP2 Promoter and Construction of Deletion and
Point Mutants in Luciferase Reporter Plasmids--
A mouse genomic
library (129 SVJ mouse DNA digested by Sau3A DNA and inserted into
lambda FIX II vector, catalog number 946306; Stratagene, Palo Alto, CA)
was screened using a 1,304-bp PCR probe encompassing intron 1 and exon
II of the mouse UCP2 gene. The PCR probe was generated using sense
5'-TGCACTCCTGTGTTCTCCTG-3' and reverse 5'-GACTCTGGAGTTTCGTCGGA-3'
primers and corresponding to intron 1 and exon II. The cloned genomic
fragment (made of 7,452 bp) was inserted into the NotI site
of pSPORT plasmid (Life Technologies, Inc.) and entirely
sequenced (18). Based upon this sequence from the 129 SVJ mouse gene,
the same region was isolated from the A/J, C57BL/6J, and C57Ks/J
strains and entirely sequenced. To construct luciferase reporter
plasmids, fragments of the A/J mouse UCP2 promoter
(GenBankTM accession number AF115319) were cloned
into pGL2-Basic (Promega) using restriction fragments or amplified by
PCR and cloned using the primer-introduced MluI and
NheI restriction sites. Point mutations were made by direct
cloning of chemically synthesized oligonucleotides or by PCR. The
integrity and fidelity of all promoter-reporter constructs thus made
were verified by DNA sequencing.
Cell Culture Transfections and Reporter Gene
Assays--
C3H10T1/2 (ATCC number CCL-226) and HIB-1B preadipocytes
(gift from Dr. Reed Graves) and C2C12 (ATCC number CRL-1772)
myoblasts were maintained in Dulbecco's modified Eagle's medium and
D1 preadipocytes (19) on RPMI 1640 medium supplemented with 10%
fetal calf serum, 100 units/ml penicillin, and 100 µg/ml streptomycin
(Life Technologies, Inc.) at 37 °C in a humidified 5%
CO2 atmosphere. For transfection experiments cells
were plated into 6-well dishes and grown overnight to 50-60% of
confluence. In cotransfection experiments plasmid pGEM3z was used to
equalize amount of DNA per well. All transfections included a reporter
plasmid containing a 2-kb promoter region of human Electrophoretic Mobility Shift Assay--
Nuclear extracts were
prepared from cultured cells according to the method of Dignam et
al. (21) with some modifications. Briefly, cells were washed twice
in ice-cold phosphate-buffered saline, collected into microtubes, and
centrifuged for 15 s in a microcentrifuge. The cell pellet was
then resuspended in 1 ml of ice-cold, low salt buffer (10 mM HEPES, pH 7.9, 1 mM EDTA, 10 mM
KCl, 1 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, and protease inhibitors). After
incubation on ice for 20 min, Nonidet P-40 was added to a final
concentration of 0.5%. The cell suspension was vigorously vortexed for
20 s followed by centrifugation for 30 s in a microcentrifuge
to collect the nuclei. The nuclei were resuspended in 10 volumes of
high salt buffer (10 mM HEPES, pH 7.9, 1 mM
EDTA, 0.42 M NaCl, 10% glycerol, and protease
inhibitors) and incubated on ice for 20 min followed by a 10-min
centrifugation in a microcentrifuge at 4 °C. The supernatants were
collected and stored in aliquots at Isolation and Analysis of RNA--
Total cellular RNA was
prepared by the Tri reagent method according to the manufacturer's
protocol (Molecular Research Center, Inc). For Northern blot
hybridization, RNA was denatured by the glyoxal procedure, fractionated
through 1.2% agarose gels, and blotted onto Biotrans (ICN)
nylon membranes (22). Radiolabeled probes were prepared by random
primer extension (Prime-It RmT; Stratagene) of the purified DNA
fragments in the presence of [ PPAR
To analyze the mechanisms responsible for the transcriptional
regulation of the mouse UCP2 gene, and to test whether PPAR The Region between Identification of the Transcription Elements Located in the
To determine whether these putative elements were capable of binding
transcription factors we performed a series of gel shift assay
experiments with in vitro-translated transcription factors or nuclear extracts. The results in Fig.
5A show that the
The transcription factor ADD1/SREBP1 has been shown to have the unique
ability to bind two distinct regulatory elements, SRE and E-Box (31).
The SRE (consensus sequence, 5'-TCACNCCAC-3'; reviewed in Ref. 30) is
found in the promoter regions of several genes involved in lipid
metabolism, including fatty acid synthase and the low density
lipoprotein receptor (see Fig. 4). The
Having shown that these three motifs are capable of binding their
factors in gel shift experiments, we next proceeded to determine which
of these regions might be important for transcriptional activity of the
UCP2 enhancer. Therefore, we introduced further deletions, as well as
point mutations, in the
Given our results in Table I that PPAR PPAR Our results demonstrate that PPAR Our point mutation analysis showed that the E-Box motif is required for
PPAR Finally, coactivators must also be considered as candidate mediators of
the PPAR
(PPAR
) as a
mediator of these physiological changes in UCP2, because thiazolidinediones also increase expression of UCP2 in these cell types
(1). To determine the molecular basis for this regulation, we isolated
the 7.3-kilobase promoter region of the mouse UCP2 gene. The
7.3-kilobase/+12-base pair fragment activates transcription of a
reporter gene by 50-100-fold. Deletion and point mutation analysis,
coupled with gel shift assays, indicate the presence of a 43-base pair
enhancer (
86/
44) that is responsible for the majority of both basal
and PPAR
-dependent transcriptional activity. The distal
(
86/
76) part of the enhancer specifically binds Sp1, Sp2, and Sp3
and is indistinguishable from a consensus Sp1 element in
competition experiments. Point mutation in this sequence reduces basal activity by 75%. A second region (
74/
66) is identical to the
sterol response element consensus and specifically binds ADD1/SREBP1.
However, deletion of this sequence does not affect basal
transcriptional activity or the response to PPAR
. The proximal portion of the enhancer contains a direct repeat of two E-Box motifs,
which contributes most strongly to basal and
PPAR
-dependent transcription of the UCP2 promoter.
Deletion of this region results in a 10-20-fold reduction of
transcriptional activity and complete loss of PPAR
responsiveness.
Point mutations in either E-Box, but not in the spacer region between
them, eliminate the stimulatory response to PPAR
. However, gel shift
assays show that PPAR
does not bind to this region. Taken together,
these data indicate that PPAR
activates the UCP2 gene indirectly by
altering the activity or expression of other transcription factors that
bind to the UCP2 promoter.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-cells, white
and brown fat, skeletal muscle, and hypothalamus. In response to high
fat diets, we have previously reported adipose-specific increases in
expression of UCP2 in obesity-resistant mouse strains such as A/J and
C57BL/Kalis, which are absent from the obesity-prone C57BL/6J strain of
mice (2, 4). Of mechanistic importance, blockade by nicotinic acid of
both the fasting-induced rise in free fatty acids, as well as fatty
acid transport into mitochondria (5), prevented the fasting-induced
increase in UCP2 mRNA in muscle. The importance of changes in fat
metabolism for regulation of UCP2 expression was further supported by
the observation that fasting-induced increases in circulating free
fatty acids led to a stimulation of UCP2 expression in adipose tissue
and muscle, whereas subsequent refeeding suppressed UCP2 expression
(6-8). However, this down-regulation of UCP2 was not observed when the post-fasting diet contained a high percentage of calories from fat
(9).
specifically and may
act as natural ligands for this transcription factor (10, 11). It also
has been shown that treatment with PPAR
agonists increases UCP2
mRNA levels in vivo and in vitro (1, 12).
plays an important role in the control of the expression of
many genes involved in energy metabolism by binding specific elements
consisting of a direct repeat (DR-1) of a consensus sequence (AGGTCA)
separated by one base, although functional peroxisome proliferator-responsive elements (PPREs) can deviate significantly from
the consensus (13). The presence of functional PPREs in the regulatory
sequences of such genes as the adipocyte fatty acid-binding protein,
aP2 (14), phosphoenolpyruvate carboxykinase (15), acyl coenzyme A
synthetase (16), and lipoprotein lipase (17) is consistent with the
crucial role attributed to PPAR
in lipid metabolism. To further
understand the mechanisms regulating transcription of the UCP2 gene, as
well as a role of PPAR
in its regulation, we report here cloning and
analysis of the transcriptional activity of a 7.3-kb fragment of mouse
UCP2 promoter.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-actin and
chloramphenicol acetyltransferase (CAT) as an internal control (20).
Prior to transfection, cells were washed twice with calcium-free
phosphate-buffered saline and then incubated with 1 ml/well of
transfection mixture, which contained 4 µl of LipofectAMINE (Life
Technologies, Inc.) and 1.5 µg of total amount of DNA prepared in
serum-free, antibiotic-free F-12 medium according to the
manufacturer's protocol (Life Technologies, Inc.). After 5 h of
incubation, transfection mixture was removed, and cells were
supplemented with fresh medium containing 10% fetal bovine serum. For
CAT and luciferase assays cells were harvested 48 h after
transfection. Whole cell extracts were prepared according to CAT
enzyme-linked immunosorbent assay kit protocol (Roche Molecular Biochemicals) and used in both CAT and luciferase assays. Luciferase activity of the UCP2 reporter constructs is normalized for CAT activity
of the control plasmid. Where indicated, cells were treated with
BRL49653 (GL237310x).
70 °C. Oligonucleotides for
electrophoretic mobility shift assay were end-labeled with
[
-32P]ATP (PerkinElmer Life Sciences) by T4
polynucleotide kinase New England Biolabs and purified with MicroSpin
G-25 columns (Amersham Pharmacia Biotech). Approximately 0.2 ng (50,000 cpm) of the oligonucleotide probe and 0.5 µg of nuclear extract were
routinely used in the binding reaction in buffer containing 20 mM HEPES, pH 7.9, 50 mM NaCl, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride,
and 10% glycerol. To minimize nonspecific binding, 1 µg of
poly(dI-dC) and 0.2 µg of salmon sperm DNA were included in the
reaction. The binding reactions were carried out at room temperature
for 25 min. To determine specificity and relative affinity, the
reactions may contain a 100-fold molar excess of unlabeled
oligonucleotides as competitors. DNA-protein complexes were separated
by 6% nondenaturing polyacrylamide gel electrophoresis at room
temperature in 0.5× Tris-borate EDTA, dried, and exposed to
PhosphorImager plates for imaging (Storm680; Molecular Dynamics).
-32P]dCTP to a specific
activity > 2 × 109 dpm/µg DNA. The DNA
fragments that were used as probes were obtained from the following
sources. A fragment specific for the mouse UCP2 was prepared as
described in Ref. 2. A rat cDNA probe for cyclophilin was used as
an internal hybridization/quantitation standard. Blots were hybridized
and washed as previously described (23, 24). The intensity of
hybridization signals was quantified by a phosphorimager
(ImageQuant/Storm) and normalized to the values for cyclophilin.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
Stimulates Expression and Promoter Activity of
UCP2--
We and others have previously shown that PPAR
agonists
are able to increase UCP2 mRNA levels in adipocytes and muscle
cells (1, 12, 25). Fig. 1A
shows that UCP2 mRNA is present at relatively high levels in HIB-1B
brown and D1 white preadipocyte and C2C12 myoblast cell lines.
Treatment of these cells for 24 h with the thiazolidinedione
BRL49653, a PPAR
ligand, and agonist (26) results in a 2-fold
increase of UCP2 mRNA in all cell lines. Note that these results in
HIB-1B cells recapitulate our previously reported findings (1).

View larger version (47K):
[in a new window]
Fig. 1.
Activation of the UCP2 promoter by
PPAR
correlates with the increase of mRNA
levels. A, Northern blot. Cells were treated for
24 h with 1 µM the PPAR
-specific agonist
BRL49653. Total RNA was isolated and probed with labeled fragment of
the coding region of the mouse UCP2 gene. D1, white preadipocyte cell
line; C3H10T1/2, white preadipocyte cell line; C2C12, myoblast cell
line; HIB-1B, brown preadipocyte cell line. B, activity of
the 7.3-kb mouse UCP2 promoter-luciferase reporter construct.
Bars from left to right for each cell
line show basal activity, cotransfection with PPAR
expression
vector, treatment with BRL49653 (1 µM, 24 h),
combination of PPAR
cotransfection, and BRL49653. Luciferase
activity is normalized to activity of
-actin-CAT. Data are from
three to five independent experiments and presented as the -fold
increase relative to basal activity ± S.E.
affects
the activity of the UCP2 promoter, a fragment of the mouse UCP2
promoter region from position
7359 to +12 was isolated, sequenced,
and subcloned into a luciferase reporter vector. This DNA fragment
spans the entire region between the last exon of UCP3 and the first
exon of UCP2 (4). As shown in Fig. 1B, and consistent with
the Northern blot data of Fig. 1A, BRL49653 was able to
stimulate transcriptional activity of the 7.3-kb fragment of the UCP2
promoter in all cell lines tested. Moreover, cotransfection of the
7.3-kb UCP2 promoter construct with an expression vector containing
PPAR
(Fig. 1B) led to a similar 2-fold increase in UCP2
promoter activity. However, simultaneous agonist treatment and
cotransfection with PPAR
-expressing vector did not produce a
significant cumulative effect, possibly indicating saturation of
PPAR
-dependent stimulatory activity on the UCP2
promoter. Such agonist-independent responses to PPAR
have been
observed by others (27).
86 and
44 Nucleotides of the UCP2 Promoter
Is Important for Basal Transcriptional Activity and PPAR
Responsiveness--
To identify regulatory sequences that are
important for transcriptional control of the UCP2 gene, including the
response to PPAR
, we created a series of deletion constructs of the
UCP2 promoter as shown in Fig.
2A. The transcriptional
activity of these constructs was analyzed by transient transfection in
D1, HIB-1B, and C2C12 cells (Fig. 2, B-D). Fig. 2 shows
that the largest fragment of the UCP2 promoter (
7.3 kb/+12 bp) is
able to increase luciferase activity of the reporter construct by
50-150-fold depending on the cell line, whereas the activity of a
minimal promoter (
44/+12 bp) is only 1.5-2-fold above empty vector.
Deletion of the region between
7.3 and
5 kb reduces promoter
activity by 2-3-fold in HIB-1B and C2C12 (Fig. 2, B and
D) but had no effect in D1 cells (Fig. 2C) or in
C3H10T1/2 cells (data not shown). Although further deletions between
positions
5 kb and
86 bp had no significant effect on activity,
deletion of the region between positions
86 and
44 led to a
dramatic 25-50-fold depression of activity, indicating that this
region is indeed a major contributor to the overall expression of the
UCP2 gene in all cell lines. Having established the pattern of basal
activity of these deletion fragments, we next examined the activity of
these regions in cells treated with BRL49653, as well as
cotransfected with PPAR
. As shown in Table I, deletion of the sequence up to
86 bp
still retained PPAR
-dependent stimulation of UCP2
promoter activity equivalent to the
7.3-kb fragment. However,
deletion of the region between
86 and
44 bp resulted in a total
loss of PPAR
-dependent activity, indicating that this
region of the UCP2 gene is necessary not only for basal activity but
also for regulation by PPAR
.

View larger version (19K):
[in a new window]
Fig. 2.
The
86/
44 region plays a major role in
transcriptional activity of the mouse UCP2 promoter. Cells were
maintained and transfected with various deletion mutant constructs of
the UCP2 promoter as described under "Experimental Procedures."
Luciferase (Luc) activity of the UCP2 mutant constructs was
normalized to CAT activity of the
-actin-CAT plasmid. A,
deletion mutant constructs of the UCP2 promoter. B-D,
transcriptional activity of deletion constructs in HIB-1, D1, and C2C12
cell lines, respectively. Bars represent a summary of three
to five independent transfection experiments ± S.E.
vect, vector.
Effect of thiazolidinediones and PPAR
on UCP2 promoter deletions
86/
44 Region of the Mouse UCP2 Promoter--
Because our data
establish that the
86/
44 region of the mouse UCP2 promoter is a
major locus of control in cell lines of fat and muscle origin, in this
series of experiments we focused on identifying the elements and
transcription factors involved in regulation of this region.
Examination of the sequence of the
86/
44 region of the UCP2
promoter of mouse revealed that this region has no significant homology
with any known PPAR
response element (see Fig. 4). Moreover, as
shown in Fig. 3, PPAR
does not bind to
the
86/
44 fragment in HIB-1B nuclear extracts, and this region does
not compete for PPAR
binding versus a bona
fide PPRE from the acyl-CoA oxidase promoter (AGGACAAAGGTCA) (28). The inability of this
86/
44 UCP2 region to bind PPAR
indicates that stimulation of the UCP2 promoter by PPAR
must be indirect, utilizing other transcription factors or/and cofactors interacting with
this region. As Fig. 4 shows, the
86/
44 region of the mouse UCP2 promoter contains several putative
regulatory elements that are also found in active promoter regions of
other genes involved in energy metabolism. These elements include Sp1
(
86/CTCCGCCTC/
76), sterol response element (SRE)
(
74/TCACGCCAC/
66), and a double E-Box-like motif (CACGCC) separated
by 5 bases found in several genes critical for energy metabolism
(reviewed in Ref. 29) and that can also be recognized by SRE-binding
proteins (SREBPs) (30).

View larger version (71K):
[in a new window]
Fig. 3.
PPAR
does not bind
to the
86/
44 region of the mouse UCP2 promoter. Nuclear
extracts were prepared from HIB-1B cells as described under
"Experimental Procedures." In gel shift assays
[32P]-radiolabeled oligonucleotides containing PPRE of
the ACOX gene (GGACCAGGACAAAGGTCACG) or the
86/
44 region of the UCP2 promoter (see Fig. 4) were incubated with
HIB-1B nuclear extract for 25 min at room temperature. Anti-PPAR
antibody (PPAR-AB) (SC-7196X; Santa Cruz) or 100-fold molar
excess of unlabeled competitor oligonucleotides were added to the
reaction at the same time as labeled probe. The dark arrow
shows the PPAR
-specific band, and the open arrow shows
antibody supershift. Lanes 1-4 contain radiolabeled ACOX
PPRE, and lanes 5-8 contain the radiolabeled
86/
44
region of the UCP2 promoter.

View larger version (20K):
[in a new window]
Fig. 4.
Comparison of the
86/
44 UCP2 enhancer
region with active regions of the genes involved in energy
metabolism. The consensus SRE is described in Ref. 30, and
specific SRE from 3-hydroxy-3-methylglutaryl-CoA synthase
(
256/
248) (42), fatty acid synthesase (
71/
62) (43), and low
density lipoprotein (LDL) receptor gene (44) are shown. The
double E-Box element is reviewed in Ref. 29. E-Box motifs shown are
from liver-specific pyruvate kinase (L-PK) (
167/
148),
rS14 (
1441/
1422) (45), and mS14 (
1444/
1425) (38).
84/
76 element has transcription factor binding activity similar to an Sp1
consensus element. An oligonucleotide containing this region (
86/GGCTCCGCCTCGTCACG/
70) is able to compete
efficiently with an Sp1 consensus oligonucleotide
(CGCCCCGCCCCGATCGA), whereas mutation of the core region
(
86/GGCTCTACCTCGTCACG/
70) disrupts this binding. Fig.
5B shows that antibodies against Sp1, Sp2, and Sp3 are able
to supershift bound proteins, and a mixture of all three antisera
resulted in complete supershift of this major binding species.

View larger version (54K):
[in a new window]
Fig. 5.
The region
86/
70 is a functional Sp1
binding element. A, comparison of transcription factor
binding activity of the
86/
70 region of the UCP2 promoter
(GGCTCCGCCTCGTCACG) and an Sp1 consensus (Sp1
cons) oligonucleotide (CGCCCCGCCCC- GATCGA) in
HIB-1B nuclear extract. Lanes 1-4 contain labeled
86/
70
oligonucleotide. Lanes 5-8 contain the labeled Sp1
consensus oligonucleotide (Promega). All competing oligonucleotides
were used in 100-fold molar excess. The oligonucleotide
86/
70M
(GGCTCTACCTCGTCACG) contains the same mutation that is in
the 86M1 reporter construct (see Table II) used for transfection
experiments in Fig. 8. B, gel supershift assay of the
86/
70 region with antibodies against members of the Sp1 family of
transcription factors in HIB-1B nuclear extract. Arrows
indicate bands specific for Sp1, Sp2 (filled), and Sp3
(striped) transcription factors. The open arrow
shows supershift with antibodies.
78/
62 region of the mouse
UCP2 promoter, containing a putative SRE (
74/TCACGCCAC/
66), is able
to specifically bind ADD1/SREBP1 as confirmed by the ability of
anti-SREBP1 antibody to supershift the binding species (Fig. 6B). Surprisingly, the region
71/
44 containing two E-Box motifs does not show significant
affinity for ADD1/SREBP1. Several studies have established that double
E-Box elements are associated with the so-called insulin/glucose
response region of such genes as spot 14 (S14) and liver-specific
pyruvate kinase and are recognized by upstream stimulatory factor (USF)
family transcription factors (29). As shown in Fig.
7, an oligonucleotide comprising this region of the UCP2 promoter (
71/
44) specifically binds in
vitro-translated USF1 and USF2 transcription factors and binds
USF1 protein in the nuclear extracts from HIB-1B cells.

View larger version (29K):
[in a new window]
Fig. 6.
Region
78/
62 specifically binds the
ADD1/SREBP1 transcription factor. A, schematic
presentation of oligonucleotides used in the gel shift assay.
B, comparison of the different parts of the
86/
44 region for their ability to bind in
vitro-translated ADD1/SREBP1 in gel shift assay. The ADD1/SREBP1
(nuclear form, amino acids 1-403) was in vitro-translated
using the TnT® coupled transcription/translation system
(Promega). The oligonucleotides corresponding to the indicated regions
(A) were incubated with 2 µl of the ADD1/SREBP1c reaction
mix. Lane 1 shows the
86/
44 fragment incubated with
in vitro translation reaction mix containing no template.
Lane 6 contains antibody against ADD1/SREBP1 (sc-8984X;
Santa Cruz). The filled arrow indicates the
ADD1/SREBP1-specific band. The open arrow shows anti-SREBP1
antibody supershift.

View larger version (67K):
[in a new window]
Fig. 7.
Region
71/
44 specifically binds USF1 and
USF2 transcription factors. A, USF1 and USF2 were
in vitro-translated with the TnT® coupled
transcription/translation system (Promega). Radiolabeled
oligonucleotide containing the
71/
44 region of the UCP2 promoter
was incubated with 2 µl of in vitro-translated
transcription factors USF1, USF2, or both for 25 min. Ab,
antibody. B, the
86/
44 and
71/
44 oligonucleotides
bind USF1 in HIB-1B nuclear extract. Specified oligonucleotides were
incubated with HIB-1B nuclear extract as described under
"Experimental Procedures." For supershift analysis antibodies
against USF1 (sc-8983X; Santa Cruz) or USF2 (sc-861X; Santa Cruz) were
added to the reaction, together with the labeled probe.
Arrows indicate USF1- and USF2-specific bands
(filled) or antibody supershift (open).
86/
44 region of the UCP2 promoter and used
these constructs in transient transfection assays. Table
II depicts the specific mutations made,
and Fig. 8A presents these
schematically. When transfected into all cell lines, deletion of the
sequence between positions
86 and
76, containing the Sp1 motif, or
a point mutation of two bases in this region (
86M1) reduces activity
of the reporter gene by 70% (Fig. 8B). Further deletion of
five more bases to position
71 disrupts SRE located between
76 and
67, but this mutation did not affect transcriptional activity of the
UCP2 promoter. The region between
71 and
44 contains a direct
repeat of two imperfect E-Boxes separated by five bases (see Fig. 4).
Fig. 8 shows that point mutations in either the upstream or downstream
E-Box motifs result in a significant loss of transcriptional activity.
Complete deletion of the upstream E-Box to position
58 reduced
activity to the level of the minimal UCP2 promoter (
44/+12)
indicating that both E-Boxes are necessary for promoter activity.
Interestingly, mutations replacing two bases in the spacer region
between the E-Boxes do not affect transcriptional activity. However,
insertion of three additional bases between E-Boxes again reduces
promoter activity, highlighting the importance of the precise
positioning of the two parts of the repeat relative to each other.
Deletion and point mutations in the
86/
44 enhancer region of the
UCP2 promoter

View larger version (15K):
[in a new window]
Fig. 8.
Sp1 and E-boxes are required for
transcriptional activity of the UCP2 promoter. A,
schematic representation of mutant constructs of the
86/
44 region
of the UCP2 promoter used in transfection experiments. B,
transient transfection of the mutant constructs into HIB-1B cells was
performed as described under "Experimental Procedures." Each
transfection reaction included 0.7 µg of mutant construct and 0.3 µg of
-actin-CAT as control of transfection efficiency.
LUC, luciferase.
responsiveness is retained
within this small proximal promoter region, and the complex multipartite character of this enhancer, we next sought to narrow down
which of these sequences might be important for
PPAR
-dependent stimulation. We again used our series of
point mutations and deletions of the
86/
44 region. Fig.
9 demonstrates that despite deletion of
the
86/
72 region, PPAR
-dependent stimulation was
retained, indicating that PPAR
acts through elements in the
71/
44 region. However, point mutations disrupting either of the
E-Boxes (mutants M1 and M2) led to a complete loss of UCP2 promoter
responsiveness to PPAR
. Identical results were obtained when the
activity of these deletions was examined in the absence/presence of
BRL49653 (data not shown). Thus, from these data we conclude that
stimulation of the UCP2 gene by PPAR
requires transcription factors
or coactivators interacting with the double E-Box-containing
region.

View larger version (19K):
[in a new window]
Fig. 9.
The paired E-boxes, but not the Sp1 site, are
required for UCP2 promoter activity in response to
PPAR
. Transient transfection of the
UCP2
86/
44 mutant constructs into HIB-1B cells was performed as in
Fig. 8 and as described under "Experimental Procedures." To test
the effect of PPAR
on these mutants, 0.3 µg of PPAR
expression
vector was included in transfection reaction. Luciferase
(LUC) activity of the mutant constructs was normalized to
CAT activity of
-actin-CAT. Bars represent three
independent experiments performed in triplicate as average ± S.D.
*, p < 0.001; significantly different from basal
activity by one-way analysis of variance and a post-hoc Newman-Keuls
test.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
is best known as a key transcriptional regulator of
adipocyte differentiation, stimulating transcription of many genes involved in glucose and lipid metabolism. Adipocyte differentiation is
considered to be regulated by the interplay of three families of
transcription factors, PPAR
, C/EBP
, and ADD1/SREBP1 (32), and
like most tissues (33) it is characterized by a cascade activation of
genes that includes other transcription factors and their targets.
However, the powerful role of PPAR
to regulate other transcription
factors is highlighted by the fact that PPAR
-specific agonists alone
can induce adipose differentiation and the expression of C/EBPs even in
fibroblasts ectopically expressing PPAR
(34, 35).
activation leads to increased UCP2
expression, and we defined the
86/
44 region of the promoter as
responsible for stimulation by PPAR
. However, as we show, PPAR
does not bind to this
86/
44 region, suggesting that its role is
indirect and likely involves other transcription factors.
Parenthetically, PPAR
lacking its DNA-binding domain was unable to
stimulate UCP2 promoter activity (data not shown), indicating that at
some level DNA binding of PPAR
is required. Instead, the
86/
44
region is composed of three overlapping putative elements, Sp1, SRE,
and a double E-Box. Each of these sequences is capable of binding
multiple proteins in nuclear extracts, including Sp1 members, SREBP,
and the USFs, respectively.
responsiveness. The ability of USF1 and USF2 to bind to the
E-Box-containing region (
71/
44) in our experiments makes these
transcription factors likely candidates for mediating the effect of
PPAR
on the UCP2 gene. However, we cannot rule out a role for SREBP
because of the known dual specificity of SREBP to interact with both
the SRE and E-Boxes (30). Another possibility that we must consider in
future work is that the SRE frequently requires the presence of other
active elements such as Sp1 or NF-Y in close proximity. For example,
mutation of the Sp1 element, positioned next to the SRE site in the low
density lipoprotein receptor promoter, abolished the response of this gene to sterol regulation (36, 37). It has also been suggested that the
double E-Box element of the mouse S14 gene is regulated by glucose
through as yet unidentified factor(s) that were clearly not USFs
(38).
response on the UCP2 gene. Wu et al. (41) showed
that over-expression of PGC1 led to increased expression of endogenous
UCP2, along with increased oxygen consumption and uncoupled
respiration. In the cells we have studied, expression of PGC1 is
rapidly increased in response to PPAR
stimulation. Our preliminary
studies, together with the data of Monsalve et al. (39),
indicate that PGC1 increases expression of the UCP2 promoter.
Considering the ability of PGC-1 to interact with a number of other
nuclear receptors and coactivators (40, 41) it is possible that PGC1,
together with (an)other transcription factor(s), serves to mediate the
PPAR
response on the UCP2 promoter. All of these possibilities
remain to be explored.
| |
ACKNOWLEDGEMENTS |
|---|
We thank the following individuals for gifts
of plasmids and reagents: Michele Sawadogo for USF1 and USF2,
Steve Kliewer and Jurgen Lehmann for human and mouse PPAR
and
RXR
, Tim Willson for GL237310x, Bruce Spiegelman for ADD1/SREBP1c,
and Reed Graves for HIB-1B cells. We thank Kiefer Daniel for
technical assistance and members of the Collins laboratory for reading
the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported in part by National Institutes of Health Grants R01-DK54024 (to S. C.) and F31-DK09812 (to S. K. S. and S. C.), Center National de la Recherche Scientifique (to D. R.), Human Frontier Science Program RG 0307 (to D. R.), Institut de Recherche Servier (to D. R.), and Institut National de la Santé et de la Recherche Médicale Grant 4P007E (to D. R.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF115319
¶ Supported by National Institutes of Health Predoctoral Fellowship F31-DK09812.
** To whom correspondence should be addressed: Duke University Medical Center, Box 3557, Durham, NC 27710. Tel.: 919-684-8991; Fax: 919-684-3071; E-mail: colli008@mc.duke.edu.
Published, JBC Papers in Press, January 9, 2001, DOI 10.1074/jbc.M010587200
2 H. Onuma, R. S. Surwit, S. Collins, unpublished observations.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: UCP, uncoupling protein; PPAR, peroxisome proliferator-activated receptor; PPRE(s), peroxisome proliferator-responsive element(s); kb, kilobase; bp, base pair; PCR, polymerase chain reaction; CAT, chloramphenicol acetyltransferase; SRE, sterol response element; SREBP(s), SRE-binding proteins; S14, spot 14; USF, upstream stimulatory factor.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Aubert, J., Champigny, O., Saint-Marc, P., Negrel, R., Collins, S., Ricquier, D., and Ailhaud, G. (1997) Biochem. Biophys. Res. Comm. 238, 606-611 |
| 2. | Fleury, C., Neverova, M., Collins, S., Raimbault, S., Champigny, O., Levi-Meyrueis, C., Bouillaud, F., Seldin, M. F., Surwit, R. S., Ricquier, D., and Warden, C. H. (1997) Nature Genetics 15, 269-272 |
| 3. | Arsenijevic, D., Onuma, H., Pecqueur, C., Raimbault, S., Manning, B. S., Miroux, B., Couplan, E., Alves-Guerra, M.-C., Surwit, R., Bouillaud, F., Richard, D., Collins, S., and Ricquier, D. (2000) Nat. Genet. 26, 435-439 |
| 4. | Surwit, R. S., Wang, S., Petro, A. E., Sanchis, D., Raimbault, S., Ricquier, D., and Collins, S. (1998) Proc. Natl. Acad. Sci., U. S. A. 95, 4061-4065 |
| 5. | Samec, S., Seydoux, J., and Dulloo, A. G. (1998) Diabetes 47, 1693-1698 |
| 6. | Boss, O., Samec, S., Dulloo, A., Seydoux, J., Muzzin, P., and Giacobino, J. (1997) FEBS Lett. 142, 111-114 |
| 7. | Millet, L., Vidal, H., Andreelli, F., Larrouy, D., Riou, J., Ricquier, D., Laville, M., and Langin, D. (1997) J. Clin. Invest. 100, 2665-2670 |
| 8. | Samec, S., Seydoux, J., and Dulloo, A. G. (1998) FASEB J. 12, 715-724 |
| 9. | Samec, S., Seydoux, J., and Dulloo, A. G. (1999) Diabetes 48, 436-441 |
| 10. | Kliewer, S. A., Sundseth, S. S., Jones, S. A., Brown, P. J., Wisely, G. B., Koble, C. S., Devchand, P., Wahli, W., Willson, T. M., Lenhard, J. M., and Lehmann, J. M. (1997) Proc. Natl. Acad. Sci. 94, 4318-4323 |
| 11. | Forman, B. M., Chen, J., and Evans, R. M. (1997) Proc. Natl. Acad. Sci. 94, 4312-4317 |
| 12. | Camirand, A., Marie, V., Rabelo, R., and Silva, J. E. (1998) Endocrinology 139, 428-431 |
| 13. | Brun, R., Kim, J., Hu, E., and Spiegelman, B. (1997) Curr. Opin. Lipidol. 8, 212-218 |
| 14. | Tontonoz, P., Hu, E., Graves, R. A., Budavari, A. I., and Spiegelman, B. M. (1994) Genes Dev. 8, 1224-1234 |
| 15. | Tontonoz, P., Hu, E., Devine, J., Beale, E. G., and Spiegelman, B. M. (1995) Mol. Cell. Biol. 15, 351-357 |
| 16. | Schoonjans, K., Watanabe, M., Suzuki, H., Mahfoudi, A., Krey, G., Wahli, W., Grimaldi, P., Staels, B., Yamamoto, T., and Auwerx, J. (1995) J. Biol. Chem. 270, 19269-19276 |
| 17. | Schoonjans, K., Peinado-Onsurbe, J., Lefebvre, A. M., Heyman, R. A., Briggs, M., Deeb, S., Staels, B., and Auwerx, J. (1996) EMBO J. 15, 5336-5348 |
| 18. | Pecqueur, C., Cassard-Doulcier, A. M., Raimbault, S., Miroux, B., Fleury, C., Gelly, C., Bouillaud, F., and Ricquier, D. (1999) Biochem. Biophys. Res. Commun. 255, 40-46 |
| 19. | Austin, S., Medvedev, A., Yan, Z. H., Adachi, H., Hirose, T., and Jetten, A. M. (1998) Cell Growth Differ. 9, 267-276 |
| 20. | Miyamoto, N. G. (1987) Nucleic Acids Res. 15, 9095 |
| 21. | Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475-1489 |
| 22. | Collins, S., Caron, M. G., and Lefkowitz, R. J. (1988) J. Biol. Chem. 263, 9067-9070 |
| 23. | Thomas, P. S. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 5201-5205 |
| 24. | Collins, S., Daniel, K. W., Rohlfs, E. M., Ramkumar, V., Taylor, I. L., and Gettys, T. W. (1994) Mol. Endocrinol. 8, 518-527 |
| 25. | Kelly, L. J., Vicario, P. P., Thompson, G. M., Candelore, M. R., Doebber, T. W., Ventre, J., Wu, M. S., Meurer, R., Forrest, M. J., Conner, M. W., Cascieri, M. A., and Moller, D. E. (1998) Endocrinology 139, 4920-4927 |
| 26. | Lehmann, J. M., Moore, L. B., Smith-Oliver, T. A., Wilkison, W. O., Willson, T. M., and Kliewer, S. A. (1995) J. Biol. Chem. 270, 12953-12956 |
| 27. | Werman, A., Hollenberg, A., Solanes, G., Bjorbaek, C., Vidal-Puig, A. J., and Flier, J. S. (1997) J. Biol. Chem. 272, 20230-20235 |
| 28. | Tugwood, J. D., Issemann, I., Anderson, R. G., Bundell, K. R., McPheat, W. L., and Green, S. (1992) EMBO J. 11, 433-439 |
| 29. | Vaulont, S., Vasseur-Cognet, M., and Kahn, A. (2000) J. Biol. Chem. 275, 31555-31558 |
| 30. | Osborne, T. F. (2000) J. Biol. Chem. 275, 32379-32382 |
| 31. | Kim, J. B., Spotts, G. D., Halvorsen, Y. D., Shih, H. M., Ellenberger, T., Towle, H. C., and Spiegelman, B. M. (1995) Mol. Cell. Biol. 15, 2582-2588 |
| 32. | Rosen, E. D., Walkey, C. J., Puigserver, P., and Spiegelman, B. M. (2000) Genes Dev. 14, 1293-1307 |
| 33. | Arnone, M. I., and Davidson, E. H. (1997) Development 124, 1851-1864 |
| 34. | Tontonoz, P., Hu, E., and Spiegelman, B. M. (1994) Cell 79, 1147-1156 |
| 35. | El-Jack, A. K., Hamm, J. K., Pilch, P. F., and Farmer, S. R. (1999) J. Biol. Chem. 274, 7946-7951 |
| 36. | Bennett, M. K., Ngo, T. T., Athanikar, J. N., Rosenfeld, J. M., and Osborne, T. F. (1999) J. Biol. Chem. 274, 13025-13032 |
| 37. | Bennett, M. K., and Osborne, T. F. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 6340-6344 |
| 38. | Koo, S. H., and Towle, H. C. (2000) J. Biol. Chem. 275, 5200-5207 |
| 39. | Monsalve, M., Wu, Z., Adelmant, G., Puigserver, P., Fan, M., and Spiegelman, B. M. (2000) Mol Cell 6, 307-316 |
| 40. | Puigserver, P., Wu, Z., Park, C., Graves, R., Wright, M., and Spiegelman, B. (1998) Cell 92, 829-839 |
| 41. | Puigserver, P., Adelmant, G., Wu, Z., Fan, M., Xu, J., O'Malley, B., and Spiegelman, B. M. (1999) Science 286, 1368-1371 |
| 42. | Dooley, K. A., Millinder, S., and Osborne, T. F. (1998) J. Biol. Chem. 273, 1349-1356 |
| 43. | Bennett, M. K., Lopez, J. M., Sanchez, H. B., and Osborne, T. F. (1995) J. Biol. Chem. 270, 25578-25583 |
| 44. | Smith, J. R., Osborne, T. F., Goldstein, J. L., and Brown, M. S. (1990) J. Biol. Chem. 265, 2306-2310 |
| 45. | Casado, M., Vallet, V. S., Kahn, A., and Vaulont, S. (1999) J. Biol. Chem. 274, 2009-2013 |
This article has been cited by other articles:
![]() |
V. Poitout and R. P. Robertson Glucolipotoxicity: Fuel Excess and {beta}-Cell Dysfunction Endocr. Rev., May 1, 2008; 29(3): 351 - 366. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, Y. Zhang, E. Yehuda-Shnaidman, A. V. Medvedev, N. Kumar, K. W. Daniel, J. Robidoux, M. P. Czech, D. J. Mangelsdorf, and S. Collins Liver X Receptor {alpha} Is a Transcriptional Repressor of the Uncoupling Protein 1 Gene and the Brown Fat Phenotype Mol. Cell. Biol., April 1, 2008; 28(7): 2187 - 2200. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Tordjman, S. Leroyer, G. Chauvet, J. Quette, C. Chauvet, C. Tomkiewicz, C. Chapron, R. Barouki, C. Forest, M. Aggerbeck, et al. Cytosolic Aspartate Aminotransferase, a New Partner in Adipocyte Glyceroneogenesis and an Atypical Target of Thiazolidinedione J. Biol. Chem., August 10, 2007; 282(32): 23591 - 23602. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Z. Vatamaniuk, R. K. Gupta, K. A. Lantz, N. M. Doliba, F. M. Matschinsky, and K. H. Kaestner Foxa1-Deficient Mice Exhibit Impaired Insulin Secretion due to Uncoupled Oxidative Phosphorylation. Diabetes, October 1, 2006; 55(10): 2730 - 2736. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Borniquel, I. Valle, S. Cadenas, S. Lamas, and M. Monsalve Nitric oxide regulates mitochondrial oxidative stress protection via the transcriptional coactivator PGC-1{alpha} FASEB J, September 1, 2006; 20(11): 1889 - 1891. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Oberkofler, K. Klein, T. K. Felder, F. Krempler, and W. Patsch Role of Peroxisome Proliferator-Activated Receptor-{gamma} Coactivator-1{alpha} in the Transcriptional Regulation of the Human Uncoupling Protein 2 Gene in INS-1E Cells Endocrinology, February 1, 2006; 147(2): 966 - 976. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Cao, Q. F. Collins, T. C. Becker, J. Robidoux, E. G. Lupo Jr., Y. Xiong, K. W. Daniel, L. Floering, and S. Collins p38 Mitogen-activated Protein Kinase Plays a Stimulatory Role in Hepatic Gluconeogenesis J. Biol. Chem., December 30, 2005; 280(52): 42731 - 42737. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bispham, D. S. Gardner, M. G. Gnanalingham, T. Stephenson, M. E. Symonds, and H. Budge Maternal Nutritional Programming of Fetal Adipose Tissue Development: Differential Effects on Messenger Ribonucleic Acid Abundance for Uncoupling Proteins and Peroxisome Proliferator-Activated and Prolactin Receptors Endocrinology, September 1, 2005; 146(9): 3943 - 3949. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Takahashi, K. Motomura, T. Kato, T. Yoshikawa, Y. Nakagawa, N. Yahagi, H. Sone, H. Suzuki, H. Toyoshima, N. Yamada, et al. Transgenic Mice Overexpressing Nuclear SREBP-1c in Pancreatic {beta}-Cells Diabetes, February 1, 2005; 54(2): 492 - 499. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Barazzoni, A. Bosutti, M. Stebel, M. R. Cattin, E. Roder, L. Visintin, L. Cattin, G. Biolo, M. Zanetti, and G. Guarnieri Ghrelin regulates mitochondrial-lipid metabolism gene expression and tissue fat distribution in liver and skeletal muscle Am J Physiol Endocrinol Metab, January 1, 2005; 288(1): E228 - E235. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ostrowski, K. Klimek-Tomczak, L. S. Wyrwicz, M. Mikula, D. S. Schullery, and K. Bomsztyk Heterogeneous Nuclear Ribonucleoprotein K Enhances Insulin-induced Expression of Mitochondrial UCP2 Protein J. Biol. Chem., December 24, 2004; 279(52): 54599 - 54609. [Abstract] [Full Text] [PDF] |
||||