![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 14, 10824-10831, April 6, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
§¶,
§
,
§
From the Departments of
Therapeutic Radiology,
§ Genetics, and ** Pharmacology, Yale University School of
Medicine, New Haven, Connecticut 06520
Received for publication, September 22, 2000, and in revised form, December 19, 2000
| |
ABSTRACT |
|---|
|
|
|---|
DNA polymerases have the unique ability to select
a specific deoxynucleoside triphosphate from a pool of similarly
structured substrates. One of these enzymes, DNA polymerase Accurate synthesis of DNA is essential in maintaining the genome
of all organisms. DNA polymerases have the remarkable ability to select
and incorporate a single deoxynucleoside triphosphate (dNTP)1 from a pool of
structurally similar substrates in a template-dependent manner. During DNA synthesis, polymerases occasionally insert an
incorrect dNTP substrate, whereas mutator enzymes incorporate the wrong
nucleotides more frequently. Mutations resulting from DNA polymerases
may be one of the underlying causes of human disease and cancer (1, 2).
Therefore, it is important to identify the mechanisms used by
polymerases to discriminate the correct dNTP substrates from incorrect ones.
DNA polymerase To study the fidelity of DNA synthesis, a genetic screen was developed
to identify mutator mutants of pol In this study, the same genetic screen identified another pol Bacterial Strains and Media--
DH5
Luria-Bertani broth or agar supplemented with appropriate antibiotics
was used for culturing the DH5 Chemicals and Reagents--
Deoxynucleoside triphosphates, ATP,
and [ Purification of HSV-tk Forward Mutational Assay--
To determine whether Y265H
has intrinsic mutator activity, purified Single-bp-gapped DNA Preparation--
A single-nucleotide-gapped
DNA with a 5'-phosphate on the downstream oligomer was used in all the
experiments. The sequences of the DNA substrates are as follows:
45-22-22, 5'-GCCTCGCAGCCGTCCAACCAAC CAACCTCGATCCAATGCCGTCC and
3'-CGGAGCGTCGGCAGGTTGGTTGXGTTGGAGCTAGGTTACGGCAGG; 36-20-15, 5'-GCCTCGCAGCCGTCCAACCAAGTCACCTCAATCCA and
3'-CGGAGCGTCGGCAGGTTGGTXTCAGTGGAGTTAGGT; 36-19-15, 5'-GCCTCGCAGCCGTCCAACCAGTCACCTCAATCCA and
3'-CGGAGCGTCGGCAGGTTGGTXTCAGTGGAGTTAGGT. The
X position in the template contained an adenine or
2-aminopurine (2AP). The 20-mer primer terminus of 36-20-15 DNA
substrate either contained or lacked the 3'-OH. The dideoxy-terminated
primer was obtained by overnight incubation of the 19-mer (0.5 mM) with ddATP (0.5 mM) in
manufacturer-supplied buffer (New England BioLabs), containing 0.25 mM CoCl2 and 200 units/ml terminal
deoxynucleotide transferase at 37 °C. Unreacted primer and the
product were separated by 20% denaturing gel electrophoresis, and the
product was purified.
Oligomer hybridization was performed. Briefly, the primer oligomer was
labeled at the 5'-end by using T4 polynucleotide kinase (New England
BioLabs) and [ pol Rapid Chemical Quench Flow Experiments--
A KinTek Instruments
Model RQF-3 rapid quench flow apparatus thermostatted at 20 or 37 °C
was used for rapid chemical quench flow experiments. Unless noted,
reactions were conducted in buffer (50 mM Tris-Cl buffer
(pH 8.0) containing 2 mM dithiothreitol, 20 mM
NaCl, and 10% glycerol). All concentrations given refer to the final
concentrations after mixing. For pre-steady-state analysis, reactions
were performed in which radiolabeled gapped DNA (300 nM
45-22-22) was in 3-fold excess relative to pol
To determine the Kd for dNTP and the maximum rate of
polymerization (kpol), incorporation of dTTP
(correct) and dGTP (incorrect) opposite template A was examined as a
function of time for the 45-22-22 DNA substrate. In these experiments,
a solution containing a preincubated complex of
Products were resolved by sequencing gel electrophoresis under
denaturing conditions (20% acrylamide containing 8 M urea) and quantified using a Molecular Dynamics Storm 840 PhosphorImager.
Fluorescence Emission Spectra--
Emission spectra of Stopped-flow Fluorescence--
A stopped-flow instrument (KinTek
Corp.) was used to measure the rate of the polymerization reaction
under single turnover conditions. Equal volumes (20 or 30 µl) of a
solution containing a premixed complex of pol Melting Temperature Studies--
Wild-type or mutant pol Data Analysis--
Data obtained from kinetic assays were
analyzed by nonlinear regression using the KaleidaGraph program
(Synergy Software). Data from burst experiments were fit to the
equation: [product] = A × [1 Y265H Has Intrinsic Mutator Activity--
We compared the ability
of Y265H Shows No Burst of Product Formation--
A pre-steady-state
burst experiment to monitor dTTP incorporation was performed under
conditions where 45-22-22 DNA was in 3-fold excess of pol Y265H and Y265H Misincorporates dNTPs--
To understand the role of Tyr-265
in DNA synthesis fidelity, we determined whether the efficiency
(kpol/Kd) for
misincorporating dNTPs is higher for Y265H than
The Kd and kpol values were
determined by measuring the rate of product formation at varying
concentrations of dNTP. Fig.
2A illustrates an example of
dTTP incorporation opposite A for Y265H at several
concentrations of nucleotide at 37 °C. By fitting each set of data
to the single exponential rate equation, the
kobs was determined for each dTTP substrate
concentration. These values were plotted against the dTTP
concentrations to yield the Kd and
kpol parameters for Y265H (Fig. 2B)
and
The kpol and Kd rate
constants were used to calculate the fidelities for
Surprisingly, the fidelity of Y265H is quite different at 20 °C. At
this temperature, the fidelity of Y265H (26,000) was 6-fold higher than
Y265H Shows No Multiple Changes in Fluorescence--
At 37 °C,
Y265H has only an 8-fold discrimination factor at the level of
kpol. This parameter encompasses two rates: a
protein conformational change and nucleotidyl transfer. To examine
these two steps, adenine was replaced with 2AP as the templating base. The DNA structure remains relatively undisturbed with 2AP, because it
still forms a Watson-Crick type base pair with thymine (24). To verify
incorporation of dTTP, we performed burst experiments using the
2AP-gapped DNA. Similar to the data presented in Fig. 1 with natural
DNA substrate, burst experiments show
Stopped-flow fluorescence with 36-20-15 2AP-gapped DNA substrate was
used to monitor the rate of DNA polymerization for
At 37 °C, Y265H shows a very fast initial decrease in fluorescence
(Fig. 3C). In fact, the inset of Fig.
3C demonstrates that the decrease in fluorescence intensity
is completed during the mixing time of the instrument. Thus, the rate
of the initial fluorescence decrease of Y265H is too fast to measure.
However, in contrast to The Slow Fluorescence Phase Requires a 3'-OH Primer
Terminus--
To associate the enzyme fluorescence changes with a step
in the reaction pathway, we prepared the 36-20-15 2AP-gapped DNA substrate which contained no 3'-OH on the primer terminus. This substrate prevents any extension of the DNA primer from occurring. To
verify that the dideoxy-terminated DNA mimics the normal substrate, the
binding of pol
Stopped-flow fluorescence was used to monitor conformational changes of
pol
To verify the dependence on 3'-OH of the slow fluorescence phase,
stopped-flow fluorescence experiments were conducted with different
amounts of dideoxy-terminated DNA substrate for
The dramatically reduced kpol for Y265H at
37 °C appears to result from the decreased ability of the mutant
enzyme to perform phosphodiester bond formation, after undergoing a
very fast change in protein conformation. The recovery of the Y265H at
20oC to discriminate correct dNTP from incorrect ones at
the kpol level results from its ability to
perform phosphodiester bond formation similar to the rate of Global Structure of Y265H Is Identical to The Y265H pol Y265H Is a Mutator Polymerase at 37 °C, but Not at
20 °C--
The Y265H mutator mutant is deficient in discriminating
between correct and incorrect dNTP substrates at 37 °C. At this
temperature, the basis of the large decrease in fidelity of
misincorporation of Y265H results from a dramatic decrease in
discrimination of correct over incorrect dNTP substrate at the level of
kpol for this enzyme, relative to
The two fluorescence phases observed for the polymerization reaction of
The Slow Fluorescence Phase Is the Nucleotidyl Transfer
Step--
Our results suggest the slow fluorescence phase measures
phosphodiester bond formation. This phase is dependent on the presence of 3'-OH on the primer terminus, because the amplitude of the slow
fluorescence change decreases with increasing concentrations of
dideoxy-terminated DNA substrate (Fig. 5). Misincorporation of the
incorrect nucleotide, dATP, opposite 2AP showed a fast fluorescence
phase with a rate constant of 100 s The Fast Fluorescence Phase Corresponds to the Conformational
Change of pol Tyr-265 Is a Component of a Hydrophobic Hinge Region of pol
Tyr-265 Is Critical for Proper Geometric Alignment--
We have
identified two mutator mutants with amino acid substitutions at
Tyr-265, one that is altered to Cys and one that is changed to His
(13). Both of these alterations reduce the hydrophobic character of the
region and result in a strong mutator phenotype. This suggests that the
hydrophobic nature of the side chains in the hinge region is important
for maintaining fidelity. This proposal is supported further by data
showing that mutation of Tyr-265 to Phe, which does not alter the
hydrophobic nature of the side chain, does not result in a mutator
phenotype (28). Other factors, such as electrostatic and van der Waals
interactions, may be required to maintain wild-type fidelity (28).
Thus, Tyr-265 appears to be a critical amino acid residue in
maintaining the fidelity of DNA synthesis.
As mentioned above, the hydrophobic residues, including Tyr-265, that
comprise the hinge region have been suggested to be important in the
conformational change of pol
Alternatively, Y265H may result in a polymerase with an altered
structure relative to The Rate-limiting Step of Y265H Is Phosphodiester Bond
Formation--
pol Conclusions--
In summary, we have identified a mutator mutant
of pol
, offers
a simple system to relate polymerase structure to the fidelity of DNA
synthesis. In this study, a mutator DNA polymerase
, Y265H, was
identified using an in vivo genetic screen. Purified Y265H
produced errors at a 40-fold higher frequency than the wild-type
protein in a forward mutation assay. At 37 °C, transient kinetic
analysis demonstrated that the alteration caused a 111-fold decrease in
the maximum rate of polymerization and a 117-fold loss in fidelity for
G misincorporation opposite template A. Our data suggest that the
maximum rate of polymerization was reduced, because Y265H was
dramatically impaired in its ability to perform nucleotidyl transfer in
the presence of the correct nucleotide substrate. In contrast, at
20 °C, the mutant protein had a fidelity similar to wild-type
enzyme. Both proteins at 20 °C demonstrate a rapid change in protein
conformation, followed by a slow chemical step. These data suggest that
proper geometric alignment of template, 3'-OH of the primer,
magnesium ions, dNTP substrates, and the active site residues of DNA
polymerase
are important factors in polymerase fidelity and provide
the first evidence that Tyr-265 is important for this alignment to occur properly in DNA polymerase
.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
(pol
) offers a simple model to study fidelity,
the ability to copy DNA accurately. This polymerase functions in base
excision repair (3) and meiosis (4). Unlike many other polymerases, pol
contains 2-deoxyribose-5'-phosphate lyase function (5-7)
and no proofreading or exonuclease activities. Consequently, the
fidelity of pol
can be attributed to the polymerase itself in
selecting and incorporating the correct dNTP substrate. The structures
of pol
complexed with a single-nucleotide-gapped DNA, the
physiological substrate of pol
(8), and a ternary complex
containing the protein, gapped DNA, and dNTP have been solved (9).
These structures share a common overall architecture and important
conserved motifs with several other polymerases (10, 11). Thus, it
appears that pol
, like other DNA polymerases, catalyzes the
nucleotidyl transfer reaction by the two-metal ion mechanism (11).
Finally, pol
has a minimal kinetic mechanism for DNA synthesis
similar to most DNA polymerases (12). In this scenario, the
enzyme binds to the DNA template first, followed by binding to the
dNTP. After formation of the initial ternary complex of pol
, DNA,
and dNTP, a conformational change occurs to produce a catalytically
active complex that can extend a DNA primer. After chemical bond
formation, pyrophosphate is released and pol
dissociates from the
DNA substrate. The latter step is considered to be the rate-limiting
step in the reaction pathway.
(13). This screen is based on
the ability of pol
to substitute for Escherichia coli
DNA polymerase I during DNA replication (14). Several mutator mutants
of pol
have been identified by this genetic screen (13, 15, 16).
One of these mutants, Y265C, displayed a 23-fold increase in base
substitution errors over wild-type pol
(13, 17). Tyr-265 in the
crystal structure of pol
(9) is located in a hydrophobic hinge
region, which may mediate a conformational change of the polymerase (9,
17, 18).
mutant containing a His substitution at Tyr-265 (Y265H). To determine
the mechanistic basis for the mutator activity of Y265H, we studied the
fidelity properties of
-WT and Y265H at 20 and 37 °C using
transient-state kinetic methods, including rapid chemical quench flow
and stopped-flow fluorescence. Our results suggest Y265H
misincorporates dNTPs at 37 °C, because His in place of Tyr prevents
the participation of the hydrophobic hinge in adopting the proper
geometric alignment of active site residues, DNA template, 3'-OH
terminus of the primer, magnesium ions, and dNTP substrate. Thus,
Tyr-265 is an important amino acid residue in maintaining the fidelity
of DNA polymerase
.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
MCR with the
genotype mcrA (mrr-hsdRMS-mcrBC)
80
lacZ(M15 (lacZYA-argF)U169 deoR
recA1 endA1 phoA supE44 thi-1 gyrA96 relA1 was used in cloning
experiments. BL21(DE3) with the genotype F
ompT
hsdSb (rb
mb
) gal
dcm was used for protein expression. The FT334 strain with the
genotype recA13 upp tdk was used to detect mutations in the
Herpes simplex virus type 1 thymidine kinase (HSV-tk)
gene (19).
or BL21(DE3) bacterial strains.
HSV-tk mutant selection medium is described (19).
-32P]ATP were purchased from New England BioLabs,
Sigma, and Amersham Pharmacia Biotech, respectively. Oligonucleotides
were synthesized by the Keck Molecular Biology Center at Yale
University and purified by denaturing polyacrylamide gel electrophoresis.
-WT and Y265H--
The cDNAs of
-WT
and Y265H were subcloned into the pET28a vector (Novagen) to generate a
fusion protein containing six histidine residues attached to the amino
terminus. These fusion proteins were expressed and purified as
described previously (20). Proteins were greater than 90% homogenous
based on a Coomassie Blue-stained SDS page gel. Concentrations of pol
proteins were based on an
280 = 21,200 M
1 cm
1 and a molecular weight
of 40 kDa for His-tagged pol
.
-WT or Y265H was used to
fill a 203-nucleotide gap, corresponding to the ATP binding site of the
HSV-tk gene. Reactions contained 50 mM Tris-HCl
(pH 8.0), 10 mM MgCl2, 0.2 mM
dithiothreitol, 0.2 g/liter bovine serum albumin, 500 µM
dNTPs, 10 pmol of gapped DNA, and 100 pmol of
-WT or Y265H.
Reactions were incubated at 37 °C for 1 h before being quenched
with 30 mM EDTA (final concentration) and electroporated
into FT334 cells. Spontaneous mutation frequency was determined (17,
19).
-32P]ATP or normal ATP. Other
oligonucleotides were 5'-end-labeled with the kinase and normal ATP.
After purification of phosphorylated oligonucleotides and
quantification, annealing was performed by mixing equimolar quantities
of each DNA strand in 50 mM Tris-HCl, pH 8.0, containing
0.25 M NaCl. The mixture was incubated sequentially at
95 °C (5 min), slowly cooled to 50 °C (for 30 min) and 50 °C (for 20 min), and immediately transferred to ice. To verify
proper hybridization, the product was analyzed on an 18% native
polyacrylamide gel followed by autoradiography or ethidium bromide staining.
-DNA Binding--
The dissociation constant of
-WT and
Y265H for gapped DNA binding was measured using a gel mobility shift
assay (21). pol
protein (0.1-500 nM) was incubated
with 0.05 nM gapped DNA substrate in buffer containing 50 mM Tris, pH 8.0, 100 mM NaCl, 10 mM
MgCl2, 10% glycerol, and 0.1% Nonidet P-40 at room
temperature (23 °C) for 15 min. Samples were centrifuged for 30 s and loaded onto a 6% native polyacrylamide gel with the current
running at 300 V at 4 °C. After loading, the voltage was reduced to
150 V. Bound protein was quantified using a Molecular Dynamics Storm
840 PhosphorImager. The dissociation constant for DNA
(Kd) was estimated from fitting the bound protein
(Y) versus protein concentration (x)
with the equation: Y = [(m × x)/(x + Kd)] + b,
where m is a scaling factor and b is the apparent
minimum Y value.
(100 nM). These reactions are referred to as burst experiments.
Depending on the temperature and the enzyme used, the concentration of
the dTTP solution was at least five times the dissociation constant (Kd) for dTTP (see below for Kd
determination). The concentration of dTTP that equals five times the
Kd are as follows: at 20 °C, [dTTP] = 1 mM for
-WT and [dTTP] = 0.05 mM for Y265H,
whereas, at 37 °C, [dTTP] = 0.2 mM for
-WT and
[dTTP] = 0.025 mM for Y265H. This ensures that the burst
experiment was performed at saturating concentration of dTTP while
minimizing any enzyme inhibition, which may occur with excess dTTP.
Reactions were initiated by rapid mixing of the pol
·DNA
and Mg·dTTP solutions (final concentration of MgCl2 = 10 mM). At selected time intervals, the reactions were
quenched with 0.3 M EDTA.
-WT or Y265H (500 nM) and radiolabeled gapped DNA (50 nM) was
mixed with a solution of MgCl2 (10 mM) and
varying concentrations of a single dNTP. The 10-fold excess
concentration of enzyme relative to gapped DNA was determined by
performing time courses at 5- and 10-fold enzyme concentrations over
45-22-22 DNA substrate at 50 µM dTTP for Y265H. The two
different enzyme concentrations gave the same observed rate constant
and amplitude. These conditions allow binding of greater than 95% of
the DNA substrate by pol
. Thus, the rate of a single catalytic turnover of the enzyme is measured. Experiments for dTTP incorporation, which were performed on the KinTek apparatus, and for dGTP
misincorporation, which were performed manually, were conducted under
identical reaction conditions. For manual kinetics, a solution
containing a preincubated
·DNA complex was incubated for 3 min at
the reaction temperature. This solution was then mixed with a Mg·dGTP
solution (0.025-4 mM). Aliquots (0.01 ml) were removed at
selected time intervals and quenched into a 0.05-ml solution containing
0.5 M EDTA and 90% formamide, bromphenol dye (EDTA:dye,
7:4, v/v).
-WT or
Y265H complexed with single-bp-gapped DNA substrate in the absence and
presence of dTTP were measured by excitation at 290 nm on an SLM AMINCO
spectrofluorometer. Scans were performed in standard reaction buffer at
20 and 37 °C.
(1.5 or 3 µM) and 2AP-gapped DNA (0.15 or 0.3 µM) in
standard buffer and a solution of Mg·dTTP (saturating concentration;
see above section for concentrations) were rapidly mixed. Changes in
fluorescence were monitored using a 340-nm interference filter, a
320-nm cutoff filter, or a 305-nm cutoff filter (Corion) after
excitation at 290 nm. Three to five traces were averaged. The use of
different filters gave similar observed rate constants.
(10 µM) in standard buffer was incubated in a 0.2-cm
path-length quartz cuvette. The sample was then placed in a
thermostatted block in a circular dichroism spectrophotometer (Aviv
Model 62DS). Ellipticity was measured at 220 nm as a function of
temperature over the range of 10-60 °C in 1 °C increments after the sample was equilibrated for 0.5 min at each temperature. Values were averaged for 15 s. The temperature at which the protein is 50% unfolded (Tm) was determined after the
denaturation profile was subtracted by both upper and lower baselines.
exp(
kobst)] + ksst, where A is the
amplitude of the burst, kobs is observed
first-order rate constant for dNTP incorporation, and
kss is the observed steady-state rate constant.
Single-turnover kinetic data were fit to the single-exponential
equation: [product] = A × [1
exp(
kobst)]. Observed rate
constants were then plotted against [dNTP], and the data were fit to
the hyperbolic equation: kobs = kpol[dNTP]/(Kd + [dNTP]),
where kpol is the maximum rate of polymerization
and Kd is the equilibrium dissociation constant for
dNTP. Fidelity values were calculated using the relationship: fidelity = [(kpol/Kd)c + (kpol/Kd)i]/(kpol/Kd)i], where c and i represent the correct and incorrect dNTPs, respectively. Stopped-flow data were fit to a single- or multiple-exponential equation, F =
An × exp(
kobs, nt) + C, where F is the fluorescence at time
t, n is the number of exponential terms,
A and kobs are the amplitude and the
observed rate constant of the nth term, respectively, and
C is the fluorescence intensity at equilibrium.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-WT and Y265H to fill a 203-nucleotide gap in the
HSV-tk gene (17, 19). Errors committed by the polymerase
during synthesis inactivated the HSV-tk gene. The inactive
HSV-tk products confer resistance to
5'-fluoro-2'-deoxyuridine. In this assay, the spontaneous mutation
frequencies for
-WT and Y265H were 9.6 × 10
4 and
380 × 10
4, respectively. Therefore, Y265H has a
spontaneous mutation frequency 40 times greater than
-WT, which
suggests that it has intrinsic mutator activity.
. Fig.
1 demonstrates insertion of dTTP opposite
A by
-WT (open circles) at 37 °C occurs via
an initial fast phase (kobs = 7.2 ± 1.6 s
1) followed by a slower, linear phase with a rate
constant of 2.1 s
1. In contrast, Y265H (closed
circles) shows no initial, rapid product formation using the same
conditions. The kobs of the mutant enzyme is
0.034 ± 0.002 s
1. At 20 °C, a burst experiment
for
-WT displayed biphasic reaction kinetics, similar to the
kinetics at the higher temperature, whereas Y265H showed a linear rate
of product generation (data not shown). The biphasic nature of
-WT
indicates that the rate-limiting step occurs after phosphodiester
bond formation at both temperatures. In contrast, the
rate-limiting step for Y265H polymerization is most likely before or
during the nucleotidyl transfer reaction.

View larger version (13K):
[in a new window]
Fig. 1.
Incorporation of dTTP opposite adenine by
pol
enzymes. Insertion of dTTP into a
gapped DNA substrate was measured using the chemical quench-flow
apparatus at 37 °C. A preincubated solution of 100 nM
(concentration based on absorbance)
-WT (
) or Y265H (
) and
gapped DNA (300 nM) was mixed with a solution of dTTP (100 µM for
-WT and 4 µM for Y265H)
containing 10 mM MgCl2. The reactions were
terminated by EDTA, and the product, 23-mer, was resolved by denaturing
sequencing gel electrophoresis. For
-WT, the data were fit to the
burst equation with a kobs = 7.2 ± 1.6 s
1 and a steady-state rate constant of 2.1 s
1. For Y265H, the data were fit to a single-exponential
equation with a kobs = 0.034 ± 0.002 s
1.
-WT Have Similar Affinity for Gapped DNA--
A gel
mobility shift assay was conducted to estimate the affinity of pol
for gapped DNA (data not shown). For 45-22-22 DNA substrate, the
dissociation constants of
-WT and Y265H were 6.5 ± 1.3 and
36.6 ± 4.7 nM, respectively, indicating the formation of an E·DNA complex in both cases. Thus, there is a 5-fold loss of
affinity for DNA with Y265H. Single-turnover kinetic experiments were
performed under conditions where the enzyme concentration greatly
exceeds (>10-fold) the Kd for gapped DNA.
-WT. At 20 and
37 °C, experiments were performed where enzyme was in 10-fold excess
over the DNA substrate. This approach allows us to measure the ground
state binding of the dNTP, Kd, and the maximum rate
of polymerization, kpol (22, 23).
-WT (Fig. 2B, inset). The values for
Kd and kpol (Table
I) were reduced by 9- (11/1.2) and
111-fold (9.7/0.087), respectively, for Y265H, relative to
-WT.

View larger version (21K):
[in a new window]
Fig. 2.
Single turnover experiments of correct
nucleotide incorporation opposite adenine. A,
incorporation of dTTP opposite A for Y265H at 37 °C. A
preincubated solution containing enzyme (500 nM) and gapped
DNA (50 nM) was mixed with MgCl2 (10 mM) and 0.25 (
), 0.5 (
), 0.75 (
), 1 (
), 2 (
), or 8 (
) µM dTTP. The reactions were quenched
and monitored as described in Fig. 1. Data were fit to the
single-exponential equation to obtain kobs.
B, secondary kinetic plot of kobs
against dTTP concentration for Y265H (
). The data were fit to a
hyperbolic equation as described under "Experimental Procedures."
Inset, dTTP concentration dependence on
kobs for
-WT (
). The solid line
represents the best fit of the data to the hyperbolic equation. Values
of Kd and kpol are listed in
Table I for all the experiments shown.
Single-turnover kinetic constants for
-WT and Y265H
-WT and Y265H.
These values are shown in Table I. At 37 °C, a 117-fold loss in
fidelity was observed for Y265H relative to
-WT. This loss is
largely due to a reduced ability to discriminate between dTTP
versus dGTP at the level of kpol. For
-WT, the maximum rate of polymerization of the correct dNTP is 860 times faster than the incorrect one, whereas Y265H displays only an
8-fold difference. Thus, substitution of His for Tyr-265 causes a
108-fold (860/8) loss in discrimination at the level of
kpol. The affinities for dNTP were higher for
Y265H at 37 °C, however, the discrimination factor at the level of
ground-state binding was similar for the two proteins.
-WT (4500) with the primary effect in the ability of Y265H to
discriminate at the level of kpol. At 20 °C,
Y265H has a discrimination factor for kpol that
is 49-fold (395/8) higher than at 37 °C. Thus, at 20 °C, Y265H
appears to have recovered the ability to discriminate at the level of
kpol. At this temperature, Y265H is able to
discriminate at the level of ground-state binding (Kd) by a factor of 66, which is quantitatively
similar (48) to its ability to discriminate at this level at 37 °C.
In contrast,
-WT continues to discriminate the correct from the incorrect dNTP at 20 °C at the level of kpol
but not at the level of Kd. The discrimination
provided at the level of ground-state binding for
-WT is 40-fold
(53/1.3) less than at 37 °C.
-WT exhibits a biphasic
kinetic profile with the 2AP-gapped DNA, whereas the initial fast phase
is absent for Y265H (data not shown). These patterns were displayed for
both proteins at 20 and 37 °C. Thus, the same kinetic profiles for
each protein were obtained with the 2AP- and normal DNA substrates in
burst experiments. This suggests the enzymes follow the same
polymerization mechanism for dTTP incorporation with the 2AP-gapped DNA
as they do with the normal gapped DNA substrate.
-WT and Y265H at
20 and 37 °C under single-turnover conditions. This sequence context
was used, because it was the DNA substrate for earlier studies of
stopped-flow fluorescence with
-WT (25-27). The fluorescence of a
single Trp residue in the carboxyl-terminal domain of pol
was
monitored. The role of 2AP is to enhance the enzyme fluorescence
change, possibly through fluorescence energy transfer from Trp to 2AP
(25). Fig. 3 shows the rates of the fluorescence changes of
-WT and Y265H at 20 and 37 °C in the presence of correct dNTP substrate. In the presence of saturating dTTP,
-WT shows a rapid initial decrease (kobs = 111 ± 9 s
1) followed by a slower increase in
fluorescence with a kobs of 10.6 ± 0.1 s
1 at 37 °C (Fig. 3A). Both fluorescence
phases demonstrated a dependence on magnesium and dTTP with gapped DNA
substrate, similar to results obtained in an earlier study with duplex
DNA (25). An observed rate constant of 10.8 ± 0.6 s
1 was obtained with the quench-flow method with the same
reaction conditions, indicating that only the second phase of the
stopped-flow experiment is measured in the quench-flow instrument. The
similar rates observed in the quench-flow and the stopped-flow
experiments indicate that the same reaction step is being measured in
both assays.

View larger version (23K):
[in a new window]
Fig. 3.
Stopped-flow kinetics of the DNA
polymerization reaction. Measurements and data analysis were
performed as described under "Experimental Procedures"
(excitation = 290 nm; emission > 305 nm). The kinetic
traces show the time-dependent changes in
intrinsic fluorescence of
-WT and Y265H, after a solution of pol
-DNA (1.5 µM pol
to 0.15 µM 36-20-15 2AP-gapped DNA; final concentrations) was mixed with an equal volume of
10 mM MgCl2 and saturating concentration of
dTTP. The data were fit to a double-exponential equation to yield the
observed rate constants. A,
-WT at 37 °C. The observed
rate constants for the fast fluorescence phase and the slow
fluorescence phase were 111 ± 9 and 10.6 ± 0.1 s
1, respectively. B,
-WT at 20 °C. The
observed rate constants for the fast fluorescence phase and the slow
fluorescence phase were 47 ± 3 and 3.27 ± 0.03 s
1, respectively. C, Y265H at 37 °C. The
observed rate constant for the first fluorescence phase was too fast to
measure, and the amplitude of the subsequent phase was not substantial
to yield an observed rate constant. Inset, the fluorescence
changes of Y265H at 37 °C that occurs in the first 0.05 s.
D, Y265H at 20 °C. The observed rate constants for the
fast fluorescence phase and the slow fluorescence phase were 54 ± 2 and 1.48 ± 0.08 s
1, respectively.
-WT, there is no significant increase in
fluorescence that follows the fast fluorescence phase for Y265H (Fig.
3C). The lack of a detectable amplitude for the second
fluorescence phase appears to be consistent with the extremely slow
rate of maximum polymerization of 0.078 ± 0.007 s
1
(Table I). However, at 20 °C, Y265H shows biphasic kinetics with a
kobs = 54 ± 2 s
1 for the
fast phase and kobs = 1.48 ± 0.08 s
1 for the slow phase (Fig. 3D). Fig.
3B shows the same biphasic pattern for
-WT with the
observed rate constants of 47 ± 3 s
1 and 3.27 ± 0.03 s
1 for the fast and slow phases, respectively.
The biphasic kinetics seen with 36-20-15-gapped DNA were also observed
for the 45-22-22-gapped substrate (data not shown). Thus, we conclude
that there are two fluorescence changes observed for pol
under
single-turnover conditions with a single-nucleotide-gapped DNA
substrate as measured by stopped-flow fluorescence. Only the initial,
rapid fluorescence change is observed for Y265H, whereas the second
change in fluorescence is undetectable at 37 °C.
to DNA was measured for both types of 36-20-15 2AP-gapped substrates by the gel shift assay. The affinity of
-WT
for the DNA substrate was 8.3 ± 1.8 and 8.2 ± 2.0 nM in the presence and absence of a 3'-OH primer terminus,
respectively. This indicates the dideoxy primer terminus does not
perturb the binding of pol
to single-bp-gapped DNA. Thus, pol
forms a stable complex with DNA in the presence and absence of the
3'-OH primer terminus.
that may occur when phosphodiester bond formation is eliminated
with the dideoxy-terminated DNA substrate. Fig. 4 shows the stopped-flow kinetic trace of
-WT complexed with dideoxy-terminated DNA substrate after rapid
mixing of a saturating concentration of Mg·dTTP solution at 37 °C.
These data indicate an initial fast fluorescence phase occurs. The
inset of Fig. 4 shows the kinetics of the fast fluorescence
phase was measured using a short time range for
-WT (Fig. 4,
inset). An observed rate constant of 440 ± 7 s
1 was obtained for the fast fluorescence phase with
dideoxy-terminated DNA. A similar value (511 ± 24 s
1) was obtained for the fast phase with unterminated
gapped DNA substrate, when using the short time base approach (data not
shown). In contrast to unterminated DNA substrate, there was no
significant detectable increase in fluorescence that followed the fast
phase with the dideoxy-terminated DNA for
-WT at 37 °C. A stopped
flow experiment was also conducted similar to the one performed by Ahn
et al. (27). Here, the
-WT, 36-19-15 DNA, ddATP, and
magnesium were preincubated in one syringe to allow incorporation of
ddAMP into the primer. After a 10-min incubation, the stopped-flow
reaction was initiated by adding a saturating concentration of dTTP and magnesium from the second syringe. Similar to the result obtained in
Fig. 4, only the initial fast fluorescence phase was observed (data not
shown). Thus, the slower fluorescence phase (the second phase) depends
on the presence of a 3'-OH on the primer.

View larger version (21K):
[in a new window]
Fig. 4.
Stopped-flow fluorescence with
dideoxy-terminated DNA substrate. Kinetic traces of
polymerization reaction with dideoxy-terminated DNA by stopped-flow
fluorescence method (excitation = 290 nm; emission > 320 nm). A solution of
-WT (1.5 µM; final concentrations)
and 36-20ddA-15 2AP-gapped DNA substrate (0.15 µM)
was mixed with an equal volume of 10 mM MgCl2
and 100 µM dTTP at 37 °C. Inset,
stopped-flow kinetics of the fast fluorescence phase. The fluorescence
change of
-WT incubated with 36-20ddA-15 was monitored after rapid
mixing of Mg·dTTP solution using a short time scale. The data were
fit to a single-exponential equation to yield an observed rate constant
of 440 ± 7 s
1 for the fast fluorescence
phase.
-WT at 37 °C. In
these experiments, the total DNA concentration remained constant, while the concentration of dideoxy gapped-DNA was varied. Fig. 5 shows the amplitude of the slow
phase decreases in magnitude with increasing amounts of
dideoxy-terminated DNA substrate. In the absence of any
dideoxy-terminated DNA substrate, there is a 0.13-unit change in
amplitude for
-WT (Fig. 5, inset). Therefore, the
decrease in amplitude of the slow phase with increasing concentrations of dideoxy-terminated DNA substrate confirm our observation that the
slow phase depends on the presence of a 3'-OH on the primer. From our
results, we conclude that the slower fluorescence phase (the second
phase) encompasses the chemical step of the polymerization reaction,
and the initial fast fluorescence phase (the first phase) is a step
that occurs prior to phosphodiester bond formation, which could be a
protein conformational change.

View larger version (22K):
[in a new window]
Fig. 5.
Dideoxy dependence of the slow fluorescence
phase. The kinetics of stopped-flow fluorescence were collected as
described under "Experimental Procedures," except the total DNA
contained varying concentrations of the dideoxy-terminated DNA
substrate (36-20ddA-15). The data were fit to a double-exponential
equation to obtain the amplitude change of the slow phase. The
amplitude was plotted against the ratio of 36-20ddA-15 over total DNA.
Inset, stopped-flow kinetics before the addition of
dideoxy-terminated gapped DNA substrate. A solution of
-WT (1.5 µM; final concentrations) and 36-20-15 2AP-gapped DNA
substrate (0.15 µM) was mixed with an equal volume of 10 mM MgCl2 and 100 µM dTTP at
37 °C. The data were fit to a double-exponential equation to obtain
the amplitude change of the slow phase. The change in amplitude was
0.13 unit in the absence of dideoxy-terminated gapped DNA for
-WT.
-WT.
Therefore, it appears that proper geometric alignment of catalytic
amino acid residues, the template, magnesium ions, and the 3'-OH of the
primer is required for pol
to perform efficient phosphodiester bond
formation and maintain fidelity.
-WT--
To
investigate the possibility of any global structural changes in Y265H,
we used circular dichroism spectroscopy to determine the
-helical
content as a function of temperature. The Tm values for
both proteins are nearly identical, 42 °C for
-WT and 41 °C
for Y265H (data not shown). Thus, the amino acid substitution does not
appear to have caused any major distortion to the global structure and
only perturbations at the local structural environment of residue 265 are assumed. However, there may be changes in Trp fluorescence between
the two proteins. To analyze changes in fluorescence between the two
proteins, we collected emission spectra of
-WT and Y265H. The
fluorescence scans are similar for both proteins (data not shown). The
fluorescence intensity observed in the stopped-flow instrument for both
-WT and Y265H also indicates very little change in fluorescence
properties. Thus, no major loss in fluorescence is evident between the
two proteins.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
mutator mutant was identified by a genetic
screen (13). In this study, we demonstrate intrinsic mutator activity
for Y265H. The molecular basis for the mutator activity exhibited by
Y265H appears to be a loss in dNTP discrimination at the level of
kpol, the maximum rate of polymerization. Our results indicate nucleotidyl transfer is defective in Y265H, after undergoing a protein conformational change that appears to be faster
than
-WT. The end result is a mutant enzyme with drastically reduced
fidelity. Thus, Tyr-265, which is void of any direct contact with the
DNA or dNTP substrates, is an important amino acid residue for
maintaining the fidelity of pol
.
-WT. The
kpol is defined by both the rates of the
conformational change and nucleotidyl transfer. To determine the basis
of the kpol loss, we employed stopped-flow fluorescence to measure the changes in the environment of a single Trp
residue located in the carboxyl-terminal domain of pol
(25, 27).
The DNA substrates used in the stopped-flow experiments contained the
fluorescent probe, 2AP. However, the fluorescence changes originate
largely from protein, because these experiments were carried out at
10-fold molar excess of pol
relative to 2AP-gapped DNA. The changes
in fluorescence were larger when the samples were excited at 290 nm,
which is specific for Trp, than at 310 nm, which is optimal for 2AP.
For
-WT, we observed an initial fast decrease in fluorescence with
an observed rate constant of 111 s
1, followed by a slower
increase in fluorescence at an observed rate constant of 10.6 s
1, which is consistent with the quench-flow rate
constant of 10.8 s
1. Thus, the quench-flow assay measures
the second fluorescence phase of the stopped-flow experiment. The same
rates indicate the identical reaction step is being measured.
-WT with a single-nucleotide-gapped DNA substrate under
single-turnover conditions were similar to the results obtained with
duplex DNA (25), which shows a fast fluorescence phase followed by a
slow one. For Y265H, only the fast fluorescence decrease is observed at
37 °C, which is followed by no significant change in fluorescence.
This suggests that the 117-fold reduction in the fidelity of Y265H
compared with
-WT at 37 °C results from a decreased ability of
Y265H to undergo the second fluorescence change. The lack of a
detectable second fluorescence phase is consistent with the very slow
kpol of 0.087 s
1 (Table I). When
the temperature is lowered to 20 °C, Y265H is now able to
discriminate dNTP substrates at the level of
kpol. Stopped-flow experiments of Y265H show a
biphasic pattern of fluorescence, with similar rates to
-WT at
20 °C. Thus, the ending protein conformation of the first
fluorescence phase appears to be an important factor for the occurrence
of the second fluorescence phase.
1, followed by a slow
phase with a rate constant of 0.01 s
1 (25). The latter
phase is the same rate constant observed for misincorporation of dGTP
opposite A for the single-nucleotide-gapped DNA substrate
obtained in the quench-flow experiment (Table I). In addition, there is
no observable slow fluorescence phase present when chromium
is used as the metal ion (26). This suggests the slow phase is specific
for magnesium, which is the ion that favors rapid catalysis. Therefore,
these data are consistent with the interpretation that the slow
fluorescence phase is monitoring the chemical step. Alternatively, the
slow phase may represent both phosphodiester bond formation and any
conformational changes associated with phosphodiester bond formation.
--
The initial, fast fluorescence change detected
by the stopped-flow instrument is present for Y265H. The rate of this
phase appears to be faster than wild-type pol
, because the
fluorescence change is completed during the mixing time of the
stopped-flow instrument. Thus, the substitution of His for Tyr-265 does
not prevent the fast fluorescence phase from occurring. The initial, fast phase of fluorescence detected also occurs in the absence and
presence of the 3'-OH primer terminus, when correct dNTP substrate is
present. This suggests that this phase does not depend on
phosphodiester bond formation. In addition, the presence of the fast
fluorescence phase occurs with correct dNTP substrate (Fig. 3). It also
is present with incorrect dNTP substrate, dATP, as shown by Zhong et al. (25). This indicates the fast phase does not seem to be governed by the correct dNTP substrates. In addition,
similar to magnesium ions, the fast fluorescence phase also
is present with chromium (26). Thus, the fast fluorescence phase
appears to be a change in protein conformation that is not associated with phosphodiester bond formation. Crystallographic evidence shows
that the structure of the carboxyl-terminal domain of the ternary
complex of pol
complexed with gapped DNA and ddCTP is in the closed
form (9). The same domain is in the open configuration in the pol
·DNA complex (18). Thus, our data are consistent with an earlier
study (25) where the data suggest the first fluorescence phase, most
likely, represents the closing of the carboxyl-terminal region of the
polymerase domain of pol
.
--
Tyrosine 265 is located in a hydrophobic hinge region in the
carboxyl-terminal domain of pol
(9, 18). It is outside of the
active site and does not appear to have contact with DNA or the dNTP
substrate. Based upon the location of Tyr-265 in the crystal structures
of pol
(9, 18) and the mutator phenotype of enzymes altered at this
amino acid residue (17), we and others have suggested Tyr-265 is
important in the conformational change of pol
. Tyrosine 265, along
with Ile-174 and Thr-196, comprise the outside lining of a hydrophobic
hinge region. The inner lining of the hinge contains Leu-194, Ile-260,
and Phe-272. Structural studies of pol
suggest an open conformation
in the absence of dNTP substrate, as shown in Fig.
6 (black), and a closed
conformation once it associates with the dNTP (Fig. 6,
gray). Pelletier, Sawaya, and colleagues observed a rotation
closing the entire carboxyl-terminal domain about a hinge axis that is
coincident with the axis of helix M, which includes Tyr-265 (9, 18).
This rotation results in the movement of main chain residues toward the
active site of pol
(Fig. 6). In the closed conformation, the dNTP
is optimally positioned for nucleophilic attack by the 3'-OH of the
primer, the template is ordered, and Asp-192, one of the catalytic
amino acid residues, is coordinated by a magnesium ion; this geometric alignment of dNTP, primer, template, and magnesium ions favors rapid
catalysis (9, 18).

View larger version (46K):
[in a new window]
Fig. 6.
Amino acid residues of the hydrophobic hinge
region. The ternary pol
complex (gray) of enzyme,
gapped-DNA, and nucleotide is superimposed on the binary pol
complex of enzyme and gapped-DNA (black) using the amino
acid residues of the palm domain. Side chains of Leu-194, Thr-196,
Ile-260, Tyr-265, Val-269, and Phe-272 are shown. This figure was
produced using Ribbons (30) and Protein Data Bank codes 1bpx (binary)
and 1bpy.
. A major purpose of the conformational
change that precedes catalysis is to align catalytic amino acid
residues, the template, magnesium ions, and the 3'-OH of the primer for
nucleophilic attack on the dNTP substrate (9, 18). Our results suggest
that geometric alignment in the Y265H protein at 37 °C does not
occur in an optimal manner to allow nucleotide discrimination, because
the rate of incorporation of correct dNTP substrates is only 8-fold
different than incorrect one. In contrast,
-WT shows a 860-fold
faster rate of correct incorporation over misincorporation. Thus, we
suggest that proper geometric alignment is necessary for efficient dNTP
substrate selection, and the alignment occurring with Y265H enzyme
allows for increased insertions of mutations in the DNA.
However, the substrate alignment with Y265H occurs in a geometry that
favors catalysis, because the polymerization efficiency
(kpol/Kd) of this enzyme is
only 12-fold lower than
-WT with correct dNTP substrate. The low
kpol rate of Y265H appears to be compensated for
by a higher affinity for dNTP substrates, because the mutant protein
has increased affinity for dNTP substrates relative to the wild-type
pol
. Thus, Y265H has nearly the same
-WT polymerization efficiency, but it has lost the ability to discriminate between correct
and incorrect dNTP substrates at 37 °C. When the temperature is
reduced to 20 °C, Y265H recovers the ability to distinguish the
right and wrong dNTP substrates. Stopped-flow fluorescence experiments
show the mutant protein regains biphasic kinetics that is essentially
identical to
-WT (Fig. 3). Thus, at the lower temperature, the
conformational change of
-WT and Y265H, the first fluorescence
phase, properly aligns the geometry of primer, template, dNTP
substrate, magnesium, and the enzyme-active site to favor
correct nucleotide incorporation over misincorporation.
-WT. However, our circular dichroism studies suggest the global structures of Y265H and
-WT are the same.
In addition, the fluorescence properties for both proteins are nearly
equal. Thus, the overall structure of Y265H is similar to
-WT,
including the Trp environment for both proteins.
shows a biphasic kinetic profile during
pre-steady-state burst experiments (Fig. 1) (12, 27). This suggests the rate-limiting step in the polymerization reaction occurs after phosphodiester bond formation. Just like many other polymerases (22,
23, 29), the rate-limiting step of pol
has been suggested to be
polymerase dissociation from the DNA substrate (12, 27). Pre-steady-state burst analysis for Y265H protein shows a linear kinetic profile (Fig. 1). This indicates the rate-limiting step occurs
at or before phosphodiester bond formation. Rapid chemical quench flow
assays and stopped-flow experiments suggest Y265H to be highly
deficient in nucleotidyl transfer. Therefore, we conclude that the
slowest step in the polymerization pathway of Y265H is phosphodiester
bond formation, most likely, resulting from improper geometric
alignment of primer, template, dNTP substrate, magnesium, and the
mutant enzyme active site residues due to the conformational change of
Y265H. This is also, most likely, the case for the mutant enzyme at
20 °C, because the nucleotidyl transfer step is still slow.
that is altered at residue 265, from Tyr to His. Because
Tyr-265 is located at a distance from the active site of pol
, our
results suggest fidelity processes can be influenced by amino acid
residues that are remote from the active site. Our data also suggest
that alteration of residue 265 results in less discrimination between the correct and incorrect dNTP at the active site of pol
due to an
improper geometric alignment of substrates with the polymerase. Therefore, our data suggest a requirement for proper geometric alignment of important catalytic components is critical for maintaining the fidelity of DNA synthesis, and Tyr-265 is an important amino acid
residue in retaining the fidelity of pol
.
| |
ACKNOWLEDGEMENTS |
|---|
We kindly acknowledge Ming-Daw Tsai for sharing results prior to publication. We acknowledge Indraneel Ghosh and Lynne Regan for assistance in the CD measurements. We thank Dr. Raymond Devoret for his helpful advice in preparing the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported in part by National Institutes of Health (NIH) Grant CA80830 (to J. B. S.), by NIH Grant GM49551 (to K. S. A.), and by NIH Training Grants T32-CA09259 and T32-CA09159.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
This paper is dedicated to the memory of Florence J. Balazs.
¶ Supported by NIH Postdoctoral Fellowship F32-CA83250.
Present address: Curagen Corporation, New Haven, CT 06520.

To whom correspondence should be addressed: Dept. of
Therapeutic Radiology, Yale University School of Medicine, 333 Cedar St., P. O. Box 208240, New Haven, CT 06520. Tel.: 203-737-2626; Fax:
203-785-6309; E-mail: Joann.Sweasy@Yale.edu.
Published, JBC Papers in Press, January 11, 2001, DOI 10.1074/jbc.M008680200
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
dNTP, deoxynucleoside triphosphate;
pol
, DNA polymerase
;
Y265H, Y265H
mutant of DNA polymerase
;
-WT, wild-type DNA polymerase
;
2AP, 2-aminopurine;
bp, base pair(s);
dda, dideoxyadenosine terminated
primer.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Loeb, L. A., and Christians, F. C. (1996) Mutat. Res. 350, 279-286 |
| 2. | Loeb, L. A. (1998) Adv. Cancer Res. 72, 25-56 |
| 3. | Sobol, R. W., Horton, J. K., Kuhn, R., Gu, H., Singhal, R. K., Prasad, R., Rajewsky, K., and Wilson, S. H. (1996) Nature 379, 183-186 |
| 4. | Plug, A. W., Clairmont, C. A., Sapi, E., Ashley, T., and Sweasy, J. B. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 1327-1331 |
| 5. | Sobol, R. W., Prasad, R., Evenski, A., Baker, A., Yang, X.-P., Horton, J. K., and Wilson, S. H. (2000) Nature 405, 807-810 |
| 6. | Feng, J., Crasto, C. J., and Matsumoto, Y. (1998) Biochemistry 37, 9605-9611 |
| 7. | Matsumoto, Y., and Kim, K. (1995) Science 269, 699-702 |
| 8. | Chagovetz, A. M., Sweasy, J. B., and Preston, B. D. (1997) J. Biol. Chem. 272, 27501-27504 |
| 9. | Sawaya, M. R., Prasad, R., Wilson, S. H., Kraut, J., and Pelletier, H. (1997) Biochemistry 36, 11205-11215 |
| 10. | Joyce, C. M., and Steitz, T. A. (1995) J. Bacteriol. 177, 6321-6329 |
| 11. | Steitz, T. A. (1999) J. Biol. Chem. 274, 17395-17398 |
| 12. | Werneburg, B. G., Ahn, J., Zhong, X., Hondal, R. J., Kraynov, V. S., and Tsai, M. D. (1996) Biochemistry 35, 7041-7050 |
| 13. | Washington, S. L., Yoon, M. S., Chagovetz, A. M., Li, S., Clairmont, C. A., Preston, B. D., Eckert, K. A., and Sweasy, J. B. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 1321-1326 |
| 14. | Sweasy, J. B., and Loeb, L. A. (1992) J. Biol. Chem. 267, 1407-1410 |
| 15. | Sweasy, J. B., Chen, M., and Loeb, L. A. (1995) J. Bacteriol. 177, 2923-2925 |
| 16. | Li, S., Vaccaro, J., and Sweasy, J. B. (1999) Biochemistry 38, 4800-4808 |
| 17. | Opresko, P. L., Sweasy, J. B., and Eckert, K. A. (1998) Biochemistry 37, 2111-2119 |
| 18. | Pelletier, H., Sawaya, M. R., Wolfle, W., Wilson, S. H., and Kraut, J. (1996) Biochemistry 35, 12742-12761 |
| 19. | Eckert, K. A., Hile, S. E., and Vargo, P. L. (1997) Nucleic Acids Res. 25, 1450-1457 |
| 20. | Kosa, J. L., and Sweasy, J. B. (1999) J. Biol. Chem. 274, 3851-3858 |
| 21. | Kosa, J. L., and Sweasy, J. B. (1999) J. Biol. Chem. 274, 35866-35872 |
| 22. | Kati, W. M., Johnson, K. A., Jerva, L. F., and Anderson, K. S. (1992) J. Biol. Chem. 267, 25988-25997 |
| 23. | Johnson, K. A. (1993) Annu. Rev. Biochem. 62, 685-713 |
| 24. | Sowers, L. C., Fazackerly, G. V., Eritja, R., Kaplan, B. E., and Goodman, M. F. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 5434-5438 |
| 25. | Zhong, X., Patel, S. S., Werneburg, B. G., and Tsai, M. D. (1997) Biochemistry 36, 11891-11900 |
| 26. | Zhong, X. J., Patel, S. S., and Tsai, M. D. (1998) J. Am. Chem. Soc. 120, 235-236 |
| 27. | Ahn, J. W., Kraynov, V. S., Zhong, X. J., Werneburg, B. G., and Tsai, M. D. (1998) Biochem. J. 331, 79-87 |
| 28. | Opresko, P. L., Shiman, R., and Eckert, K. A. (2000) Biochemistry 39, 11399-11407 |
| 29. | Patel, S. S., Wong, I., and Johnson, K. A. (1991) Biochemistry 30, 511-525 |
| 30. | Carson, M. (1991) J. Appl. Crystallogr. 24, 958-961 |
This article has been cited by other articles:
![]() |
T. Lang, S. Dalal, A. Chikova, D. DiMaio, and J. B. Sweasy The E295K DNA Polymerase Beta Gastric Cancer-Associated Variant Interferes with Base Excision Repair and Induces Cellular Transformation Mol. Cell. Biol., August 1, 2007; 27(15): 5587 - 5596. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Lin, J. Jaeger, and J. B. Sweasy Loop II of DNA polymerase beta is important for polymerization activity and fidelity Nucleic Acids Res., May 14, 2007; 35(9): 2924 - 2935. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. W. Duym, K. A. Fiala, N. Bhatt, and Z. Suo Kinetic Effect of a Downstream Strand and Its 5'-Terminal Moieties on Single Nucleotide Gap-filling Synthesis Catalyzed by Human DNA Polymerase {lambda} J. Biol. Chem., November 24, 2006; 281(47): 35649 - 35655. [Abstract] |