JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M008680200 on January 11, 2001

J. Biol. Chem., Vol. 276, Issue 14, 10824-10831, April 6, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/14/10824    most recent
M008680200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shah, A. M.
Right arrow Articles by Sweasy, J. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shah, A. M.
Right arrow Articles by Sweasy, J. B.

Y265H Mutator Mutant of DNA Polymerase beta

PROPER GEOMETRIC ALIGNMENT IS CRITICAL FOR FIDELITY*

Amit M. ShahDagger §, Shu-Xia LiDagger §||, Karen S. Anderson**, and Joann B. SweasyDagger §DaggerDagger

From the Departments of Dagger  Therapeutic Radiology, § Genetics, and ** Pharmacology, Yale University School of Medicine, New Haven, Connecticut 06520

Received for publication, September 22, 2000, and in revised form, December 19, 2000



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

DNA polymerases have the unique ability to select a specific deoxynucleoside triphosphate from a pool of similarly structured substrates. One of these enzymes, DNA polymerase beta , offers a simple system to relate polymerase structure to the fidelity of DNA synthesis. In this study, a mutator DNA polymerase beta , Y265H, was identified using an in vivo genetic screen. Purified Y265H produced errors at a 40-fold higher frequency than the wild-type protein in a forward mutation assay. At 37 °C, transient kinetic analysis demonstrated that the alteration caused a 111-fold decrease in the maximum rate of polymerization and a 117-fold loss in fidelity for G misincorporation opposite template A. Our data suggest that the maximum rate of polymerization was reduced, because Y265H was dramatically impaired in its ability to perform nucleotidyl transfer in the presence of the correct nucleotide substrate. In contrast, at 20 °C, the mutant protein had a fidelity similar to wild-type enzyme. Both proteins at 20 °C demonstrate a rapid change in protein conformation, followed by a slow chemical step. These data suggest that proper geometric alignment of template, 3'-OH of the primer, magnesium ions, dNTP substrates, and the active site residues of DNA polymerase beta  are important factors in polymerase fidelity and provide the first evidence that Tyr-265 is important for this alignment to occur properly in DNA polymerase beta .



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Accurate synthesis of DNA is essential in maintaining the genome of all organisms. DNA polymerases have the remarkable ability to select and incorporate a single deoxynucleoside triphosphate (dNTP)1 from a pool of structurally similar substrates in a template-dependent manner. During DNA synthesis, polymerases occasionally insert an incorrect dNTP substrate, whereas mutator enzymes incorporate the wrong nucleotides more frequently. Mutations resulting from DNA polymerases may be one of the underlying causes of human disease and cancer (1, 2). Therefore, it is important to identify the mechanisms used by polymerases to discriminate the correct dNTP substrates from incorrect ones.

DNA polymerase beta  (pol beta ) offers a simple model to study fidelity, the ability to copy DNA accurately. This polymerase functions in base excision repair (3) and meiosis (4). Unlike many other polymerases, pol beta  contains 2-deoxyribose-5'-phosphate lyase function (5-7) and no proofreading or exonuclease activities. Consequently, the fidelity of pol beta  can be attributed to the polymerase itself in selecting and incorporating the correct dNTP substrate. The structures of pol beta  complexed with a single-nucleotide-gapped DNA, the physiological substrate of pol beta  (8), and a ternary complex containing the protein, gapped DNA, and dNTP have been solved (9). These structures share a common overall architecture and important conserved motifs with several other polymerases (10, 11). Thus, it appears that pol beta , like other DNA polymerases, catalyzes the nucleotidyl transfer reaction by the two-metal ion mechanism (11). Finally, pol beta  has a minimal kinetic mechanism for DNA synthesis similar to most DNA polymerases (12). In this scenario, the enzyme binds to the DNA template first, followed by binding to the dNTP. After formation of the initial ternary complex of pol beta , DNA, and dNTP, a conformational change occurs to produce a catalytically active complex that can extend a DNA primer. After chemical bond formation, pyrophosphate is released and pol beta  dissociates from the DNA substrate. The latter step is considered to be the rate-limiting step in the reaction pathway.

To study the fidelity of DNA synthesis, a genetic screen was developed to identify mutator mutants of pol beta  (13). This screen is based on the ability of pol beta  to substitute for Escherichia coli DNA polymerase I during DNA replication (14). Several mutator mutants of pol beta  have been identified by this genetic screen (13, 15, 16). One of these mutants, Y265C, displayed a 23-fold increase in base substitution errors over wild-type pol beta  (13, 17). Tyr-265 in the crystal structure of pol beta  (9) is located in a hydrophobic hinge region, which may mediate a conformational change of the polymerase (9, 17, 18).

In this study, the same genetic screen identified another pol beta  mutant containing a His substitution at Tyr-265 (Y265H). To determine the mechanistic basis for the mutator activity of Y265H, we studied the fidelity properties of beta -WT and Y265H at 20 and 37 °C using transient-state kinetic methods, including rapid chemical quench flow and stopped-flow fluorescence. Our results suggest Y265H misincorporates dNTPs at 37 °C, because His in place of Tyr prevents the participation of the hydrophobic hinge in adopting the proper geometric alignment of active site residues, DNA template, 3'-OH terminus of the primer, magnesium ions, and dNTP substrate. Thus, Tyr-265 is an important amino acid residue in maintaining the fidelity of DNA polymerase beta .


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Bacterial Strains and Media-- DH5alpha MCR with the genotype mcrA (mrr-hsdRMS-mcrBC) phi 80Delta lacZ(M15 (lacZYA-argF)U169 deoR recA1 endA1 phoA supE44 thi-1 gyrA96 relA1 was used in cloning experiments. BL21(DE3) with the genotype F-ompT hsdSb (rb- mb-) gal dcm was used for protein expression. The FT334 strain with the genotype recA13 upp tdk was used to detect mutations in the Herpes simplex virus type 1 thymidine kinase (HSV-tk) gene (19).

Luria-Bertani broth or agar supplemented with appropriate antibiotics was used for culturing the DH5alpha or BL21(DE3) bacterial strains. HSV-tk mutant selection medium is described (19).

Chemicals and Reagents-- Deoxynucleoside triphosphates, ATP, and [gamma -32P]ATP were purchased from New England BioLabs, Sigma, and Amersham Pharmacia Biotech, respectively. Oligonucleotides were synthesized by the Keck Molecular Biology Center at Yale University and purified by denaturing polyacrylamide gel electrophoresis.

Purification of beta -WT and Y265H-- The cDNAs of beta -WT and Y265H were subcloned into the pET28a vector (Novagen) to generate a fusion protein containing six histidine residues attached to the amino terminus. These fusion proteins were expressed and purified as described previously (20). Proteins were greater than 90% homogenous based on a Coomassie Blue-stained SDS page gel. Concentrations of pol beta  proteins were based on an epsilon 280 = 21,200 M-1 cm-1 and a molecular weight of 40 kDa for His-tagged pol beta .

HSV-tk Forward Mutational Assay-- To determine whether Y265H has intrinsic mutator activity, purified beta -WT or Y265H was used to fill a 203-nucleotide gap, corresponding to the ATP binding site of the HSV-tk gene. Reactions contained 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 0.2 mM dithiothreitol, 0.2 g/liter bovine serum albumin, 500 µM dNTPs, 10 pmol of gapped DNA, and 100 pmol of beta -WT or Y265H. Reactions were incubated at 37 °C for 1 h before being quenched with 30 mM EDTA (final concentration) and electroporated into FT334 cells. Spontaneous mutation frequency was determined (17, 19).

Single-bp-gapped DNA Preparation-- A single-nucleotide-gapped DNA with a 5'-phosphate on the downstream oligomer was used in all the experiments. The sequences of the DNA substrates are as follows: 45-22-22, 5'-GCCTCGCAGCCGTCCAACCAAC CAACCTCGATCCAATGCCGTCC and 3'-CGGAGCGTCGGCAGGTTGGTTGXGTTGGAGCTAGGTTACGGCAGG; 36-20-15, 5'-GCCTCGCAGCCGTCCAACCAAGTCACCTCAATCCA and 3'-CGGAGCGTCGGCAGGTTGGTXTCAGTGGAGTTAGGT; 36-19-15, 5'-GCCTCGCAGCCGTCCAACCAGTCACCTCAATCCA and 3'-CGGAGCGTCGGCAGGTTGGTXTCAGTGGAGTTAGGT. The X position in the template contained an adenine or 2-aminopurine (2AP). The 20-mer primer terminus of 36-20-15 DNA substrate either contained or lacked the 3'-OH. The dideoxy-terminated primer was obtained by overnight incubation of the 19-mer (0.5 mM) with ddATP (0.5 mM) in manufacturer-supplied buffer (New England BioLabs), containing 0.25 mM CoCl2 and 200 units/ml terminal deoxynucleotide transferase at 37 °C. Unreacted primer and the product were separated by 20% denaturing gel electrophoresis, and the product was purified.

Oligomer hybridization was performed. Briefly, the primer oligomer was labeled at the 5'-end by using T4 polynucleotide kinase (New England BioLabs) and [gamma -32P]ATP or normal ATP. Other oligonucleotides were 5'-end-labeled with the kinase and normal ATP. After purification of phosphorylated oligonucleotides and quantification, annealing was performed by mixing equimolar quantities of each DNA strand in 50 mM Tris-HCl, pH 8.0, containing 0.25 M NaCl. The mixture was incubated sequentially at 95 °C (5 min), slowly cooled to 50 °C (for 30 min) and 50 °C (for 20 min), and immediately transferred to ice. To verify proper hybridization, the product was analyzed on an 18% native polyacrylamide gel followed by autoradiography or ethidium bromide staining.

pol beta -DNA Binding-- The dissociation constant of beta -WT and Y265H for gapped DNA binding was measured using a gel mobility shift assay (21). pol beta  protein (0.1-500 nM) was incubated with 0.05 nM gapped DNA substrate in buffer containing 50 mM Tris, pH 8.0, 100 mM NaCl, 10 mM MgCl2, 10% glycerol, and 0.1% Nonidet P-40 at room temperature (23 °C) for 15 min. Samples were centrifuged for 30 s and loaded onto a 6% native polyacrylamide gel with the current running at 300 V at 4 °C. After loading, the voltage was reduced to 150 V. Bound protein was quantified using a Molecular Dynamics Storm 840 PhosphorImager. The dissociation constant for DNA (Kd) was estimated from fitting the bound protein (Y) versus protein concentration (x) with the equation: Y = [(m × x)/(x + Kd)] + b, where m is a scaling factor and b is the apparent minimum Y value.

Rapid Chemical Quench Flow Experiments-- A KinTek Instruments Model RQF-3 rapid quench flow apparatus thermostatted at 20 or 37 °C was used for rapid chemical quench flow experiments. Unless noted, reactions were conducted in buffer (50 mM Tris-Cl buffer (pH 8.0) containing 2 mM dithiothreitol, 20 mM NaCl, and 10% glycerol). All concentrations given refer to the final concentrations after mixing. For pre-steady-state analysis, reactions were performed in which radiolabeled gapped DNA (300 nM 45-22-22) was in 3-fold excess relative to pol beta  (100 nM). These reactions are referred to as burst experiments. Depending on the temperature and the enzyme used, the concentration of the dTTP solution was at least five times the dissociation constant (Kd) for dTTP (see below for Kd determination). The concentration of dTTP that equals five times the Kd are as follows: at 20 °C, [dTTP] = 1 mM for beta -WT and [dTTP] = 0.05 mM for Y265H, whereas, at 37 °C, [dTTP] = 0.2 mM for beta -WT and [dTTP] = 0.025 mM for Y265H. This ensures that the burst experiment was performed at saturating concentration of dTTP while minimizing any enzyme inhibition, which may occur with excess dTTP. Reactions were initiated by rapid mixing of the pol beta ·DNA and Mg·dTTP solutions (final concentration of MgCl2 = 10 mM). At selected time intervals, the reactions were quenched with 0.3 M EDTA.

To determine the Kd for dNTP and the maximum rate of polymerization (kpol), incorporation of dTTP (correct) and dGTP (incorrect) opposite template A was examined as a function of time for the 45-22-22 DNA substrate. In these experiments, a solution containing a preincubated complex of beta -WT or Y265H (500 nM) and radiolabeled gapped DNA (50 nM) was mixed with a solution of MgCl2 (10 mM) and varying concentrations of a single dNTP. The 10-fold excess concentration of enzyme relative to gapped DNA was determined by performing time courses at 5- and 10-fold enzyme concentrations over 45-22-22 DNA substrate at 50 µM dTTP for Y265H. The two different enzyme concentrations gave the same observed rate constant and amplitude. These conditions allow binding of greater than 95% of the DNA substrate by pol beta . Thus, the rate of a single catalytic turnover of the enzyme is measured. Experiments for dTTP incorporation, which were performed on the KinTek apparatus, and for dGTP misincorporation, which were performed manually, were conducted under identical reaction conditions. For manual kinetics, a solution containing a preincubated beta ·DNA complex was incubated for 3 min at the reaction temperature. This solution was then mixed with a Mg·dGTP solution (0.025-4 mM). Aliquots (0.01 ml) were removed at selected time intervals and quenched into a 0.05-ml solution containing 0.5 M EDTA and 90% formamide, bromphenol dye (EDTA:dye, 7:4, v/v).

Products were resolved by sequencing gel electrophoresis under denaturing conditions (20% acrylamide containing 8 M urea) and quantified using a Molecular Dynamics Storm 840 PhosphorImager.

Fluorescence Emission Spectra-- Emission spectra of beta -WT or Y265H complexed with single-bp-gapped DNA substrate in the absence and presence of dTTP were measured by excitation at 290 nm on an SLM AMINCO spectrofluorometer. Scans were performed in standard reaction buffer at 20 and 37 °C.

Stopped-flow Fluorescence-- A stopped-flow instrument (KinTek Corp.) was used to measure the rate of the polymerization reaction under single turnover conditions. Equal volumes (20 or 30 µl) of a solution containing a premixed complex of pol beta  (1.5 or 3 µM) and 2AP-gapped DNA (0.15 or 0.3 µM) in standard buffer and a solution of Mg·dTTP (saturating concentration; see above section for concentrations) were rapidly mixed. Changes in fluorescence were monitored using a 340-nm interference filter, a 320-nm cutoff filter, or a 305-nm cutoff filter (Corion) after excitation at 290 nm. Three to five traces were averaged. The use of different filters gave similar observed rate constants.

Melting Temperature Studies-- Wild-type or mutant pol beta  (10 µM) in standard buffer was incubated in a 0.2-cm path-length quartz cuvette. The sample was then placed in a thermostatted block in a circular dichroism spectrophotometer (Aviv Model 62DS). Ellipticity was measured at 220 nm as a function of temperature over the range of 10-60 °C in 1 °C increments after the sample was equilibrated for 0.5 min at each temperature. Values were averaged for 15 s. The temperature at which the protein is 50% unfolded (Tm) was determined after the denaturation profile was subtracted by both upper and lower baselines.

Data Analysis-- Data obtained from kinetic assays were analyzed by nonlinear regression using the KaleidaGraph program (Synergy Software). Data from burst experiments were fit to the equation: [product] A × [1 - exp(-kobst)] + ksst, where A is the amplitude of the burst, kobs is observed first-order rate constant for dNTP incorporation, and kss is the observed steady-state rate constant. Single-turnover kinetic data were fit to the single-exponential equation: [product] A × [1 - exp(-kobst)]. Observed rate constants were then plotted against [dNTP], and the data were fit to the hyperbolic equation: kobs = kpol[dNTP]/(Kd + [dNTP]), where kpol is the maximum rate of polymerization and Kd is the equilibrium dissociation constant for dNTP. Fidelity values were calculated using the relationship: fidelity = [(kpol/Kd)c + (kpol/Kd)i]/(kpol/Kd)i], where c and i represent the correct and incorrect dNTPs, respectively. Stopped-flow data were fit to a single- or multiple-exponential equation, F = Sigma An × exp(-kobs, nt) + C, where F is the fluorescence at time t, n is the number of exponential terms, A and kobs are the amplitude and the observed rate constant of the nth term, respectively, and C is the fluorescence intensity at equilibrium.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Y265H Has Intrinsic Mutator Activity-- We compared the ability of beta -WT and Y265H to fill a 203-nucleotide gap in the HSV-tk gene (17, 19). Errors committed by the polymerase during synthesis inactivated the HSV-tk gene. The inactive HSV-tk products confer resistance to 5'-fluoro-2'-deoxyuridine. In this assay, the spontaneous mutation frequencies for beta -WT and Y265H were 9.6 × 10-4 and 380 × 10-4, respectively. Therefore, Y265H has a spontaneous mutation frequency 40 times greater than beta -WT, which suggests that it has intrinsic mutator activity.

Y265H Shows No Burst of Product Formation-- A pre-steady-state burst experiment to monitor dTTP incorporation was performed under conditions where 45-22-22 DNA was in 3-fold excess of pol beta . Fig. 1 demonstrates insertion of dTTP opposite A by beta -WT (open circles) at 37 °C occurs via an initial fast phase (kobs = 7.2 ± 1.6 s-1) followed by a slower, linear phase with a rate constant of 2.1 s-1. In contrast, Y265H (closed circles) shows no initial, rapid product formation using the same conditions. The kobs of the mutant enzyme is 0.034 ± 0.002 s-1. At 20 °C, a burst experiment for beta -WT displayed biphasic reaction kinetics, similar to the kinetics at the higher temperature, whereas Y265H showed a linear rate of product generation (data not shown). The biphasic nature of beta -WT indicates that the rate-limiting step occurs after phosphodiester bond formation at both temperatures. In contrast, the rate-limiting step for Y265H polymerization is most likely before or during the nucleotidyl transfer reaction.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1.   Incorporation of dTTP opposite adenine by pol beta  enzymes. Insertion of dTTP into a gapped DNA substrate was measured using the chemical quench-flow apparatus at 37 °C. A preincubated solution of 100 nM (concentration based on absorbance) beta -WT (open circle ) or Y265H () and gapped DNA (300 nM) was mixed with a solution of dTTP (100 µM for beta -WT and 4 µM for Y265H) containing 10 mM MgCl2. The reactions were terminated by EDTA, and the product, 23-mer, was resolved by denaturing sequencing gel electrophoresis. For beta -WT, the data were fit to the burst equation with a kobs = 7.2 ± 1.6 s-1 and a steady-state rate constant of 2.1 s-1. For Y265H, the data were fit to a single-exponential equation with a kobs = 0.034 ± 0.002 s-1.

Y265H and beta -WT Have Similar Affinity for Gapped DNA-- A gel mobility shift assay was conducted to estimate the affinity of pol beta  for gapped DNA (data not shown). For 45-22-22 DNA substrate, the dissociation constants of beta -WT and Y265H were 6.5 ± 1.3 and 36.6 ± 4.7 nM, respectively, indicating the formation of an E·DNA complex in both cases. Thus, there is a 5-fold loss of affinity for DNA with Y265H. Single-turnover kinetic experiments were performed under conditions where the enzyme concentration greatly exceeds (>10-fold) the Kd for gapped DNA.

Y265H Misincorporates dNTPs-- To understand the role of Tyr-265 in DNA synthesis fidelity, we determined whether the efficiency (kpol/Kd) for misincorporating dNTPs is higher for Y265H than beta -WT. At 20 and 37 °C, experiments were performed where enzyme was in 10-fold excess over the DNA substrate. This approach allows us to measure the ground state binding of the dNTP, Kd, and the maximum rate of polymerization, kpol (22, 23).

The Kd and kpol values were determined by measuring the rate of product formation at varying concentrations of dNTP. Fig. 2A illustrates an example of dTTP incorporation opposite A for Y265H at several concentrations of nucleotide at 37 °C. By fitting each set of data to the single exponential rate equation, the kobs was determined for each dTTP substrate concentration. These values were plotted against the dTTP concentrations to yield the Kd and kpol parameters for Y265H (Fig. 2B) and beta -WT (Fig. 2B, inset). The values for Kd and kpol (Table I) were reduced by 9- (11/1.2) and 111-fold (9.7/0.087), respectively, for Y265H, relative to beta -WT.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2.   Single turnover experiments of correct nucleotide incorporation opposite adenine. A, incorporation of dTTP opposite A for Y265H at 37 °C. A preincubated solution containing enzyme (500 nM) and gapped DNA (50 nM) was mixed with MgCl2 (10 mM) and 0.25 (open circle ), 0.5 (), 0.75 (), 1 (black-square), 2 (triangle ), or 8 (black-triangle) µM dTTP. The reactions were quenched and monitored as described in Fig. 1. Data were fit to the single-exponential equation to obtain kobs. B, secondary kinetic plot of kobs against dTTP concentration for Y265H (). The data were fit to a hyperbolic equation as described under "Experimental Procedures." Inset, dTTP concentration dependence on kobs for beta -WT (open circle ). The solid line represents the best fit of the data to the hyperbolic equation. Values of Kd and kpol are listed in Table I for all the experiments shown.


                              
View this table:
[in this window]
[in a new window]
 
Table I
Single-turnover kinetic constants for beta -WT and Y265H

The kpol and Kd rate constants were used to calculate the fidelities for beta -WT and Y265H. These values are shown in Table I. At 37 °C, a 117-fold loss in fidelity was observed for Y265H relative to beta -WT. This loss is largely due to a reduced ability to discriminate between dTTP versus dGTP at the level of kpol. For beta -WT, the maximum rate of polymerization of the correct dNTP is 860 times faster than the incorrect one, whereas Y265H displays only an 8-fold difference. Thus, substitution of His for Tyr-265 causes a 108-fold (860/8) loss in discrimination at the level of kpol. The affinities for dNTP were higher for Y265H at 37 °C, however, the discrimination factor at the level of ground-state binding was similar for the two proteins.

Surprisingly, the fidelity of Y265H is quite different at 20 °C. At this temperature, the fidelity of Y265H (26,000) was 6-fold higher than beta -WT (4500) with the primary effect in the ability of Y265H to discriminate at the level of kpol. At 20 °C, Y265H has a discrimination factor for kpol that is 49-fold (395/8) higher than at 37 °C. Thus, at 20 °C, Y265H appears to have recovered the ability to discriminate at the level of kpol. At this temperature, Y265H is able to discriminate at the level of ground-state binding (Kd) by a factor of 66, which is quantitatively similar (48) to its ability to discriminate at this level at 37 °C. In contrast, beta -WT continues to discriminate the correct from the incorrect dNTP at 20 °C at the level of kpol but not at the level of Kd. The discrimination provided at the level of ground-state binding for beta -WT is 40-fold (53/1.3) less than at 37 °C.

Y265H Shows No Multiple Changes in Fluorescence-- At 37 °C, Y265H has only an 8-fold discrimination factor at the level of kpol. This parameter encompasses two rates: a protein conformational change and nucleotidyl transfer. To examine these two steps, adenine was replaced with 2AP as the templating base. The DNA structure remains relatively undisturbed with 2AP, because it still forms a Watson-Crick type base pair with thymine (24). To verify incorporation of dTTP, we performed burst experiments using the 2AP-gapped DNA. Similar to the data presented in Fig. 1 with natural DNA substrate, burst experiments show beta -WT exhibits a biphasic kinetic profile with the 2AP-gapped DNA, whereas the initial fast phase is absent for Y265H (data not shown). These patterns were displayed for both proteins at 20 and 37 °C. Thus, the same kinetic profiles for each protein were obtained with the 2AP- and normal DNA substrates in burst experiments. This suggests the enzymes follow the same polymerization mechanism for dTTP incorporation with the 2AP-gapped DNA as they do with the normal gapped DNA substrate.

Stopped-flow fluorescence with 36-20-15 2AP-gapped DNA substrate was used to monitor the rate of DNA polymerization for beta -WT and Y265H at 20 and 37 °C under single-turnover conditions. This sequence context was used, because it was the DNA substrate for earlier studies of stopped-flow fluorescence with beta -WT (25-27). The fluorescence of a single Trp residue in the carboxyl-terminal domain of pol beta  was monitored. The role of 2AP is to enhance the enzyme fluorescence change, possibly through fluorescence energy transfer from Trp to 2AP (25). Fig. 3 shows the rates of the fluorescence changes of beta -WT and Y265H at 20 and 37 °C in the presence of correct dNTP substrate. In the presence of saturating dTTP, beta -WT shows a rapid initial decrease (kobs = 111 ± 9 s-1) followed by a slower increase in fluorescence with a kobs of 10.6 ± 0.1 s-1 at 37 °C (Fig. 3A). Both fluorescence phases demonstrated a dependence on magnesium and dTTP with gapped DNA substrate, similar to results obtained in an earlier study with duplex DNA (25). An observed rate constant of 10.8 ± 0.6 s-1 was obtained with the quench-flow method with the same reaction conditions, indicating that only the second phase of the stopped-flow experiment is measured in the quench-flow instrument. The similar rates observed in the quench-flow and the stopped-flow experiments indicate that the same reaction step is being measured in both assays.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3.   Stopped-flow kinetics of the DNA polymerization reaction. Measurements and data analysis were performed as described under "Experimental Procedures" (excitation = 290 nm; emission > 305 nm). The kinetic traces show the time-dependent changes in intrinsic fluorescence of beta -WT and Y265H, after a solution of pol beta -DNA (1.5 µM pol beta  to 0.15 µM 36-20-15 2AP-gapped DNA; final concentrations) was mixed with an equal volume of 10 mM MgCl2 and saturating concentration of dTTP. The data were fit to a double-exponential equation to yield the observed rate constants. A, beta -WT at 37 °C. The observed rate constants for the fast fluorescence phase and the slow fluorescence phase were 111 ± 9 and 10.6 ± 0.1 s-1, respectively. B, beta -WT at 20 °C. The observed rate constants for the fast fluorescence phase and the slow fluorescence phase were 47 ± 3 and 3.27 ± 0.03 s-1, respectively. C, Y265H at 37 °C. The observed rate constant for the first fluorescence phase was too fast to measure, and the amplitude of the subsequent phase was not substantial to yield an observed rate constant. Inset, the fluorescence changes of Y265H at 37 °C that occurs in the first 0.05 s. D, Y265H at 20 °C. The observed rate constants for the fast fluorescence phase and the slow fluorescence phase were 54 ± 2 and 1.48 ± 0.08 s-1, respectively.

At 37 °C, Y265H shows a very fast initial decrease in fluorescence (Fig. 3C). In fact, the inset of Fig. 3C demonstrates that the decrease in fluorescence intensity is completed during the mixing time of the instrument. Thus, the rate of the initial fluorescence decrease of Y265H is too fast to measure. However, in contrast to beta -WT, there is no significant increase in fluorescence that follows the fast fluorescence phase for Y265H (Fig. 3C). The lack of a detectable amplitude for the second fluorescence phase appears to be consistent with the extremely slow rate of maximum polymerization of 0.078 ± 0.007 s-1 (Table I). However, at 20 °C, Y265H shows biphasic kinetics with a kobs = 54 ± 2 s-1 for the fast phase and kobs = 1.48 ± 0.08 s-1 for the slow phase (Fig. 3D). Fig. 3B shows the same biphasic pattern for beta -WT with the observed rate constants of 47 ± 3 s-1 and 3.27 ± 0.03 s-1 for the fast and slow phases, respectively. The biphasic kinetics seen with 36-20-15-gapped DNA were also observed for the 45-22-22-gapped substrate (data not shown). Thus, we conclude that there are two fluorescence changes observed for pol beta  under single-turnover conditions with a single-nucleotide-gapped DNA substrate as measured by stopped-flow fluorescence. Only the initial, rapid fluorescence change is observed for Y265H, whereas the second change in fluorescence is undetectable at 37 °C.

The Slow Fluorescence Phase Requires a 3'-OH Primer Terminus-- To associate the enzyme fluorescence changes with a step in the reaction pathway, we prepared the 36-20-15 2AP-gapped DNA substrate which contained no 3'-OH on the primer terminus. This substrate prevents any extension of the DNA primer from occurring. To verify that the dideoxy-terminated DNA mimics the normal substrate, the binding of pol beta  to DNA was measured for both types of 36-20-15 2AP-gapped substrates by the gel shift assay. The affinity of beta -WT for the DNA substrate was 8.3 ± 1.8 and 8.2 ± 2.0 nM in the presence and absence of a 3'-OH primer terminus, respectively. This indicates the dideoxy primer terminus does not perturb the binding of pol beta  to single-bp-gapped DNA. Thus, pol beta  forms a stable complex with DNA in the presence and absence of the 3'-OH primer terminus.

Stopped-flow fluorescence was used to monitor conformational changes of pol beta  that may occur when phosphodiester bond formation is eliminated with the dideoxy-terminated DNA substrate. Fig. 4 shows the stopped-flow kinetic trace of beta -WT complexed with dideoxy-terminated DNA substrate after rapid mixing of a saturating concentration of Mg·dTTP solution at 37 °C. These data indicate an initial fast fluorescence phase occurs. The inset of Fig. 4 shows the kinetics of the fast fluorescence phase was measured using a short time range for beta -WT (Fig. 4, inset). An observed rate constant of 440 ± 7 s-1 was obtained for the fast fluorescence phase with dideoxy-terminated DNA. A similar value (511 ± 24 s-1) was obtained for the fast phase with unterminated gapped DNA substrate, when using the short time base approach (data not shown). In contrast to unterminated DNA substrate, there was no significant detectable increase in fluorescence that followed the fast phase with the dideoxy-terminated DNA for beta -WT at 37 °C. A stopped flow experiment was also conducted similar to the one performed by Ahn et al. (27). Here, the beta -WT, 36-19-15 DNA, ddATP, and magnesium were preincubated in one syringe to allow incorporation of ddAMP into the primer. After a 10-min incubation, the stopped-flow reaction was initiated by adding a saturating concentration of dTTP and magnesium from the second syringe. Similar to the result obtained in Fig. 4, only the initial fast fluorescence phase was observed (data not shown). Thus, the slower fluorescence phase (the second phase) depends on the presence of a 3'-OH on the primer.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4.   Stopped-flow fluorescence with dideoxy-terminated DNA substrate. Kinetic traces of polymerization reaction with dideoxy-terminated DNA by stopped-flow fluorescence method (excitation = 290 nm; emission > 320 nm). A solution of beta -WT (1.5 µM; final concentrations) and 36-20ddA-15 2AP-gapped DNA substrate (0.15 µM) was mixed with an equal volume of 10 mM MgCl2 and 100 µM dTTP at 37 °C. Inset, stopped-flow kinetics of the fast fluorescence phase. The fluorescence change of beta -WT incubated with 36-20ddA-15 was monitored after rapid mixing of Mg·dTTP solution using a short time scale. The data were fit to a single-exponential equation to yield an observed rate constant of 440 ± 7 s-1 for the fast fluorescence phase.

To verify the dependence on 3'-OH of the slow fluorescence phase, stopped-flow fluorescence experiments were conducted with different amounts of dideoxy-terminated DNA substrate for beta -WT at 37 °C. In these experiments, the total DNA concentration remained constant, while the concentration of dideoxy gapped-DNA was varied. Fig. 5 shows the amplitude of the slow phase decreases in magnitude with increasing amounts of dideoxy-terminated DNA substrate. In the absence of any dideoxy-terminated DNA substrate, there is a 0.13-unit change in amplitude for beta -WT (Fig. 5, inset). Therefore, the decrease in amplitude of the slow phase with increasing concentrations of dideoxy-terminated DNA substrate confirm our observation that the slow phase depends on the presence of a 3'-OH on the primer. From our results, we conclude that the slower fluorescence phase (the second phase) encompasses the chemical step of the polymerization reaction, and the initial fast fluorescence phase (the first phase) is a step that occurs prior to phosphodiester bond formation, which could be a protein conformational change.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 5.   Dideoxy dependence of the slow fluorescence phase. The kinetics of stopped-flow fluorescence were collected as described under "Experimental Procedures," except the total DNA contained varying concentrations of the dideoxy-terminated DNA substrate (36-20ddA-15). The data were fit to a double-exponential equation to obtain the amplitude change of the slow phase. The amplitude was plotted against the ratio of 36-20ddA-15 over total DNA. Inset, stopped-flow kinetics before the addition of dideoxy-terminated gapped DNA substrate. A solution of beta -WT (1.5 µM; final concentrations) and 36-20-15 2AP-gapped DNA substrate (0.15 µM) was mixed with an equal volume of 10 mM MgCl2 and 100 µM dTTP at 37 °C. The data were fit to a double-exponential equation to obtain the amplitude change of the slow phase. The change in amplitude was 0.13 unit in the absence of dideoxy-terminated gapped DNA for beta -WT.

The dramatically reduced kpol for Y265H at 37 °C appears to result from the decreased ability of the mutant enzyme to perform phosphodiester bond formation, after undergoing a very fast change in protein conformation. The recovery of the Y265H at 20oC to discriminate correct dNTP from incorrect ones at the kpol level results from its ability to perform phosphodiester bond formation similar to the rate of beta -WT. Therefore, it appears that proper geometric alignment of catalytic amino acid residues, the template, magnesium ions, and the 3'-OH of the primer is required for pol beta  to perform efficient phosphodiester bond formation and maintain fidelity.

Global Structure of Y265H Is Identical to beta -WT-- To investigate the possibility of any global structural changes in Y265H, we used circular dichroism spectroscopy to determine the alpha -helical content as a function of temperature. The Tm values for both proteins are nearly identical, 42 °C for beta -WT and 41 °C for Y265H (data not shown). Thus, the amino acid substitution does not appear to have caused any major distortion to the global structure and only perturbations at the local structural environment of residue 265 are assumed. However, there may be changes in Trp fluorescence between the two proteins. To analyze changes in fluorescence between the two proteins, we collected emission spectra of beta -WT and Y265H. The fluorescence scans are similar for both proteins (data not shown). The fluorescence intensity observed in the stopped-flow instrument for both beta -WT and Y265H also indicates very little change in fluorescence properties. Thus, no major loss in fluorescence is evident between the two proteins.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The Y265H pol beta  mutator mutant was identified by a genetic screen (13). In this study, we demonstrate intrinsic mutator activity for Y265H. The molecular basis for the mutator activity exhibited by Y265H appears to be a loss in dNTP discrimination at the level of kpol, the maximum rate of polymerization. Our results indicate nucleotidyl transfer is defective in Y265H, after undergoing a protein conformational change that appears to be faster than beta -WT. The end result is a mutant enzyme with drastically reduced fidelity. Thus, Tyr-265, which is void of any direct contact with the DNA or dNTP substrates, is an important amino acid residue for maintaining the fidelity of pol beta .

Y265H Is a Mutator Polymerase at 37 °C, but Not at 20 °C-- The Y265H mutator mutant is deficient in discriminating between correct and incorrect dNTP substrates at 37 °C. At this temperature, the basis of the large decrease in fidelity of misincorporation of Y265H results from a dramatic decrease in discrimination of correct over incorrect dNTP substrate at the level of kpol for this enzyme, relative to beta -WT. The kpol is defined by both the rates of the conformational change and nucleotidyl transfer. To determine the basis of the kpol loss, we employed stopped-flow fluorescence to measure the changes in the environment of a single Trp residue located in the carboxyl-terminal domain of pol beta  (25, 27). The DNA substrates used in the stopped-flow experiments contained the fluorescent probe, 2AP. However, the fluorescence changes originate largely from protein, because these experiments were carried out at 10-fold molar excess of pol beta  relative to 2AP-gapped DNA. The changes in fluorescence were larger when the samples were excited at 290 nm, which is specific for Trp, than at 310 nm, which is optimal for 2AP. For beta -WT, we observed an initial fast decrease in fluorescence with an observed rate constant of 111 s-1, followed by a slower increase in fluorescence at an observed rate constant of 10.6 s-1, which is consistent with the quench-flow rate constant of 10.8 s-1. Thus, the quench-flow assay measures the second fluorescence phase of the stopped-flow experiment. The same rates indicate the identical reaction step is being measured.

The two fluorescence phases observed for the polymerization reaction of beta -WT with a single-nucleotide-gapped DNA substrate under single-turnover conditions were similar to the results obtained with duplex DNA (25), which shows a fast fluorescence phase followed by a slow one. For Y265H, only the fast fluorescence decrease is observed at 37 °C, which is followed by no significant change in fluorescence. This suggests that the 117-fold reduction in the fidelity of Y265H compared with beta -WT at 37 °C results from a decreased ability of Y265H to undergo the second fluorescence change. The lack of a detectable second fluorescence phase is consistent with the very slow kpol of 0.087 s-1 (Table I). When the temperature is lowered to 20 °C, Y265H is now able to discriminate dNTP substrates at the level of kpol. Stopped-flow experiments of Y265H show a biphasic pattern of fluorescence, with similar rates to beta -WT at 20 °C. Thus, the ending protein conformation of the first fluorescence phase appears to be an important factor for the occurrence of the second fluorescence phase.

The Slow Fluorescence Phase Is the Nucleotidyl Transfer Step-- Our results suggest the slow fluorescence phase measures phosphodiester bond formation. This phase is dependent on the presence of 3'-OH on the primer terminus, because the amplitude of the slow fluorescence change decreases with increasing concentrations of dideoxy-terminated DNA substrate (Fig. 5). Misincorporation of the incorrect nucleotide, dATP, opposite 2AP showed a fast fluorescence phase with a rate constant of 100 s-1, followed by a slow phase with a rate constant of 0.01 s-1 (25). The latter phase is the same rate constant observed for misincorporation of dGTP opposite A for the single-nucleotide-gapped DNA substrate obtained in the quench-flow experiment (Table I). In addition, there is no observable slow fluorescence phase present when chromium is used as the metal ion (26). This suggests the slow phase is specific for magnesium, which is the ion that favors rapid catalysis. Therefore, these data are consistent with the interpretation that the slow fluorescence phase is monitoring the chemical step. Alternatively, the slow phase may represent both phosphodiester bond formation and any conformational changes associated with phosphodiester bond formation.

The Fast Fluorescence Phase Corresponds to the Conformational Change of pol beta -- The initial, fast fluorescence change detected by the stopped-flow instrument is present for Y265H. The rate of this phase appears to be faster than wild-type pol beta , because the fluorescence change is completed during the mixing time of the stopped-flow instrument. Thus, the substitution of His for Tyr-265 does not prevent the fast fluorescence phase from occurring. The initial, fast phase of fluorescence detected also occurs in the absence and presence of the 3'-OH primer terminus, when correct dNTP substrate is present. This suggests that this phase does not depend on phosphodiester bond formation. In addition, the presence of the fast fluorescence phase occurs with correct dNTP substrate (Fig. 3). It also is present with incorrect dNTP substrate, dATP, as shown by Zhong et al. (25). This indicates the fast phase does not seem to be governed by the correct dNTP substrates. In addition, similar to magnesium ions, the fast fluorescence phase also is present with chromium (26). Thus, the fast fluorescence phase appears to be a change in protein conformation that is not associated with phosphodiester bond formation. Crystallographic evidence shows that the structure of the carboxyl-terminal domain of the ternary complex of pol beta  complexed with gapped DNA and ddCTP is in the closed form (9). The same domain is in the open configuration in the pol beta ·DNA complex (18). Thus, our data are consistent with an earlier study (25) where the data suggest the first fluorescence phase, most likely, represents the closing of the carboxyl-terminal region of the polymerase domain of pol beta .

Tyr-265 Is a Component of a Hydrophobic Hinge Region of pol beta -- Tyrosine 265 is located in a hydrophobic hinge region in the carboxyl-terminal domain of pol beta  (9, 18). It is outside of the active site and does not appear to have contact with DNA or the dNTP substrate. Based upon the location of Tyr-265 in the crystal structures of pol beta  (9, 18) and the mutator phenotype of enzymes altered at this amino acid residue (17), we and others have suggested Tyr-265 is important in the conformational change of pol beta . Tyrosine 265, along with Ile-174 and Thr-196, comprise the outside lining of a hydrophobic hinge region. The inner lining of the hinge contains Leu-194, Ile-260, and Phe-272. Structural studies of pol beta  suggest an open conformation in the absence of dNTP substrate, as shown in Fig. 6 (black), and a closed conformation once it associates with the dNTP (Fig. 6, gray). Pelletier, Sawaya, and colleagues observed a rotation closing the entire carboxyl-terminal domain about a hinge axis that is coincident with the axis of helix M, which includes Tyr-265 (9, 18). This rotation results in the movement of main chain residues toward the active site of pol beta  (Fig. 6). In the closed conformation, the dNTP is optimally positioned for nucleophilic attack by the 3'-OH of the primer, the template is ordered, and Asp-192, one of the catalytic amino acid residues, is coordinated by a magnesium ion; this geometric alignment of dNTP, primer, template, and magnesium ions favors rapid catalysis (9, 18).



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 6.   Amino acid residues of the hydrophobic hinge region. The ternary pol beta  complex (gray) of enzyme, gapped-DNA, and nucleotide is superimposed on the binary pol beta  complex of enzyme and gapped-DNA (black) using the amino acid residues of the palm domain. Side chains of Leu-194, Thr-196, Ile-260, Tyr-265, Val-269, and Phe-272 are shown. This figure was produced using Ribbons (30) and Protein Data Bank codes 1bpx (binary) and 1bpy.

Tyr-265 Is Critical for Proper Geometric Alignment-- We have identified two mutator mutants with amino acid substitutions at Tyr-265, one that is altered to Cys and one that is changed to His (13). Both of these alterations reduce the hydrophobic character of the region and result in a strong mutator phenotype. This suggests that the hydrophobic nature of the side chains in the hinge region is important for maintaining fidelity. This proposal is supported further by data showing that mutation of Tyr-265 to Phe, which does not alter the hydrophobic nature of the side chain, does not result in a mutator phenotype (28). Other factors, such as electrostatic and van der Waals interactions, may be required to maintain wild-type fidelity (28). Thus, Tyr-265 appears to be a critical amino acid residue in maintaining the fidelity of DNA synthesis.

As mentioned above, the hydrophobic residues, including Tyr-265, that comprise the hinge region have been suggested to be important in the conformational change of pol beta . A major purpose of the conformational change that precedes catalysis is to align catalytic amino acid residues, the template, magnesium ions, and the 3'-OH of the primer for nucleophilic attack on the dNTP substrate (9, 18). Our results suggest that geometric alignment in the Y265H protein at 37 °C does not occur in an optimal manner to allow nucleotide discrimination, because the rate of incorporation of correct dNTP substrates is only 8-fold different than incorrect one. In contrast, beta -WT shows a 860-fold faster rate of correct incorporation over misincorporation. Thus, we suggest that proper geometric alignment is necessary for efficient dNTP substrate selection, and the alignment occurring with Y265H enzyme allows for increased insertions of mutations in the DNA. However, the substrate alignment with Y265H occurs in a geometry that favors catalysis, because the polymerization efficiency (kpol/Kd) of this enzyme is only 12-fold lower than beta -WT with correct dNTP substrate. The low kpol rate of Y265H appears to be compensated for by a higher affinity for dNTP substrates, because the mutant protein has increased affinity for dNTP substrates relative to the wild-type pol beta . Thus, Y265H has nearly the same beta -WT polymerization efficiency, but it has lost the ability to discriminate between correct and incorrect dNTP substrates at 37 °C. When the temperature is reduced to 20 °C, Y265H recovers the ability to distinguish the right and wrong dNTP substrates. Stopped-flow fluorescence experiments show the mutant protein regains biphasic kinetics that is essentially identical to beta -WT (Fig. 3). Thus, at the lower temperature, the conformational change of beta -WT and Y265H, the first fluorescence phase, properly aligns the geometry of primer, template, dNTP substrate, magnesium, and the enzyme-active site to favor correct nucleotide incorporation over misincorporation.

Alternatively, Y265H may result in a polymerase with an altered structure relative to beta -WT. However, our circular dichroism studies suggest the global structures of Y265H and beta -WT are the same. In addition, the fluorescence properties for both proteins are nearly equal. Thus, the overall structure of Y265H is similar to beta -WT, including the Trp environment for both proteins.

The Rate-limiting Step of Y265H Is Phosphodiester Bond Formation-- pol beta  shows a biphasic kinetic profile during pre-steady-state burst experiments (Fig. 1) (12, 27). This suggests the rate-limiting step in the polymerization reaction occurs after phosphodiester bond formation. Just like many other polymerases (22, 23, 29), the rate-limiting step of pol beta  has been suggested to be polymerase dissociation from the DNA substrate (12, 27). Pre-steady-state burst analysis for Y265H protein shows a linear kinetic profile (Fig. 1). This indicates the rate-limiting step occurs at or before phosphodiester bond formation. Rapid chemical quench flow assays and stopped-flow experiments suggest Y265H to be highly deficient in nucleotidyl transfer. Therefore, we conclude that the slowest step in the polymerization pathway of Y265H is phosphodiester bond formation, most likely, resulting from improper geometric alignment of primer, template, dNTP substrate, magnesium, and the mutant enzyme active site residues due to the conformational change of Y265H. This is also, most likely, the case for the mutant enzyme at 20 °C, because the nucleotidyl transfer step is still slow.

Conclusions-- In summary, we have identified a mutator mutant of pol beta  that is altered at residue 265, from Tyr to His. Because Tyr-265 is located at a distance from the active site of pol beta , our results suggest fidelity processes can be influenced by amino acid residues that are remote from the active site. Our data also suggest that alteration of residue 265 results in less discrimination between the correct and incorrect dNTP at the active site of pol beta  due to an improper geometric alignment of substrates with the polymerase. Therefore, our data suggest a requirement for proper geometric alignment of important catalytic components is critical for maintaining the fidelity of DNA synthesis, and Tyr-265 is an important amino acid residue in retaining the fidelity of pol beta .


    ACKNOWLEDGEMENTS

We kindly acknowledge Ming-Daw Tsai for sharing results prior to publication. We acknowledge Indraneel Ghosh and Lynne Regan for assistance in the CD measurements. We thank Dr. Raymond Devoret for his helpful advice in preparing the manuscript.


    FOOTNOTES

* This work was supported in part by National Institutes of Health (NIH) Grant CA80830 (to J. B. S.), by NIH Grant GM49551 (to K. S. A.), and by NIH Training Grants T32-CA09259 and T32-CA09159.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

This paper is dedicated to the memory of Florence J. Balazs.

Supported by NIH Postdoctoral Fellowship F32-CA83250.

|| Present address: Curagen Corporation, New Haven, CT 06520.

Dagger Dagger To whom correspondence should be addressed: Dept. of Therapeutic Radiology, Yale University School of Medicine, 333 Cedar St., P. O. Box 208240, New Haven, CT 06520. Tel.: 203-737-2626; Fax: 203-785-6309; E-mail: Joann.Sweasy@Yale.edu.

Published, JBC Papers in Press, January 11, 2001, DOI 10.1074/jbc.M008680200


    ABBREVIATIONS

The abbreviations used are: dNTP, deoxynucleoside triphosphate; pol beta , DNA polymerase beta ; Y265H, Y265H mutant of DNA polymerase beta ; beta -WT, wild-type DNA polymerase beta ; 2AP, 2-aminopurine; bp, base pair(s); dda, dideoxyadenosine terminated primer.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES


1. Loeb, L. A., and Christians, F. C. (1996) Mutat. Res. 350, 279-286
2. Loeb, L. A. (1998) Adv. Cancer Res. 72, 25-56
3. Sobol, R. W., Horton, J. K., Kuhn, R., Gu, H., Singhal, R. K., Prasad, R., Rajewsky, K., and Wilson, S. H. (1996) Nature 379, 183-186
4. Plug, A. W., Clairmont, C. A., Sapi, E., Ashley, T., and Sweasy, J. B. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 1327-1331
5. Sobol, R. W., Prasad, R., Evenski, A., Baker, A., Yang, X.-P., Horton, J. K., and Wilson, S. H. (2000) Nature 405, 807-810
6. Feng, J., Crasto, C. J., and Matsumoto, Y. (1998) Biochemistry 37, 9605-9611
7. Matsumoto, Y., and Kim, K. (1995) Science 269, 699-702
8. Chagovetz, A. M., Sweasy, J. B., and Preston, B. D. (1997) J. Biol. Chem. 272, 27501-27504
9. Sawaya, M. R., Prasad, R., Wilson, S. H., Kraut, J., and Pelletier, H. (1997) Biochemistry 36, 11205-11215
10. Joyce, C. M., and Steitz, T. A. (1995) J. Bacteriol. 177, 6321-6329
11. Steitz, T. A. (1999) J. Biol. Chem. 274, 17395-17398
12. Werneburg, B. G., Ahn, J., Zhong, X., Hondal, R. J., Kraynov, V. S., and Tsai, M. D. (1996) Biochemistry 35, 7041-7050
13. Washington, S. L., Yoon, M. S., Chagovetz, A. M., Li, S., Clairmont, C. A., Preston, B. D., Eckert, K. A., and Sweasy, J. B. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 1321-1326
14. Sweasy, J. B., and Loeb, L. A. (1992) J. Biol. Chem. 267, 1407-1410
15. Sweasy, J. B., Chen, M., and Loeb, L. A. (1995) J. Bacteriol. 177, 2923-2925
16. Li, S., Vaccaro, J., and Sweasy, J. B. (1999) Biochemistry 38, 4800-4808
17. Opresko, P. L., Sweasy, J. B., and Eckert, K. A. (1998) Biochemistry 37, 2111-2119
18. Pelletier, H., Sawaya, M. R., Wolfle, W., Wilson, S. H., and Kraut, J. (1996) Biochemistry 35, 12742-12761
19. Eckert, K. A., Hile, S. E., and Vargo, P. L. (1997) Nucleic Acids Res. 25, 1450-1457
20. Kosa, J. L., and Sweasy, J. B. (1999) J. Biol. Chem. 274, 3851-3858
21. Kosa, J. L., and Sweasy, J. B. (1999) J. Biol. Chem. 274, 35866-35872
22. Kati, W. M., Johnson, K. A., Jerva, L. F., and Anderson, K. S. (1992) J. Biol. Chem. 267, 25988-25997
23. Johnson, K. A. (1993) Annu. Rev. Biochem. 62, 685-713
24. Sowers, L. C., Fazackerly, G. V., Eritja, R., Kaplan, B. E., and Goodman, M. F. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 5434-5438
25. Zhong, X., Patel, S. S., Werneburg, B. G., and Tsai, M. D. (1997) Biochemistry 36, 11891-11900
26. Zhong, X. J., Patel, S. S., and Tsai, M. D. (1998) J. Am. Chem. Soc. 120, 235-236
27. Ahn, J. W., Kraynov, V. S., Zhong, X. J., Werneburg, B. G., and Tsai, M. D. (1998) Biochem. J. 331, 79-87
28. Opresko, P. L., Shiman, R., and Eckert, K. A. (2000) Biochemistry 39, 11399-11407
29. Patel, S. S., Wong, I., and Johnson, K. A. (1991) Biochemistry 30, 511-525
30. Carson, M. (1991) J. Appl. Crystallogr. 24, 958-961


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
T. Lang, S. Dalal, A. Chikova, D. DiMaio, and J. B. Sweasy
The E295K DNA Polymerase Beta Gastric Cancer-Associated Variant Interferes with Base Excision Repair and Induces Cellular Transformation
Mol. Cell. Biol., August 1, 2007; 27(15): 5587 - 5596.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
G. C. Lin, J. Jaeger, and J. B. Sweasy
Loop II of DNA polymerase beta is important for polymerization activity and fidelity
Nucleic Acids Res., May 14, 2007; 35(9): 2924 - 2935.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. W. Duym, K. A. Fiala, N. Bhatt, and Z. Suo
Kinetic Effect of a Downstream Strand and Its 5'-Terminal Moieties on Single Nucleotide Gap-filling Synthesis Catalyzed by Human DNA Polymerase {lambda}
J. Biol. Chem., November 24, 2006; 281(47): 35649 - 35655.
[Abstract]