|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 276, Issue 14, 11055-11061, April 6, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Institut für Biotechnologie 1, Forschungszentrum
Jülich GmbH, P. O. Box 1913, D-52425 Jülich, Germany
Received for publication, September 4, 2000, and in revised form, November 22, 2000
We have cloned an open reading frame from the
Escherichia coli K-12 chromosome that had been assumed
earlier to be a transaldolase or a transaldolase-related protein,
termed MipB. Here we show that instead a novel enzyme activity,
fructose-6-phosphate aldolase, is encoded by this open reading frame,
which is the first report of an enzyme that catalyzes an aldol cleavage
of fructose 6-phosphate from any organism. We propose the name FSA (for
fructose-six phosphate aldolase; gene name fsa). The recombinant
protein was purified to apparent homogeneity by anion exchange and gel
permeation chromatography with a yield of 40 mg of protein from 1 liter
of culture. By using electrospray tandem mass spectroscopy, a molecular
weight of 22,998 per subunit was determined. From gel filtration
a size of 257,000 (± 20,000) was calculated. The enzyme most likely
forms either a decamer or dodecamer of identical subunits. The purified
enzyme displayed a Vmax of 7 units
mg Aldolases are lyases that typically catalyze a stereoselective
addition of a keto donor on an aldehyde acceptor molecule (1). Aldol
condensation and cleavage reactions play crucial roles in the central
sugar metabolic pathways of all organisms. For instance in glycolysis,
fructose 1,6-bisphosphate is reversibly cleaved into the triose
dihydroxyacetone phosphate and glyceraldehyde 3-phosphate, whereas in
gluconeogenesis, the bisphosphate is formed through action of aldolase
(fructose-1,6-bisphosphate or FBP
aldolase,1 EC 4.1.2.13). FBP
aldolases and other aldolases can be broadly divided into two groups
according to their reaction mechanisms. Class I aldolases are
characterized by a covalent intermediate, which is a protonated Schiff
base formed between a lysine residue and the carbonyl carbon of the
substrate (2-4). Class II aldolases have an absolute requirement for a
divalent metal ion that stabilizes the reaction intermediates by
polarization of the substrate carbonyl (5). Class I and II aldolases
vary in other criteria such as subunit structure, pH profile, and
substrate affinity. They share little if any sequence homology and are
apparently of different evolutionary origins (2). Class II aldolases
prevail in bacteria, in fungi, and algae (4). Class I FBP aldolases are
mainly distributed in higher eukaryotes including animals, plants,
protozoa, and algae; they generally are tetramers (4). Bacterial class
I FBP aldolases are known from Staphylococcus carnosus (6),
Escherichia coli (7), or from the archaeon
Halobacterium vallismortis (4, 8). They either form monomers
(S. carnosus; see Ref. 6) or homodecamers (H. vallismortis; see Ref. 8). Recently, a class I aldolase
(dhnA; see Ref. 7) has been described for E. coli
in addition to the well known class II FBP aldolase of glycolysis
(9).
Microbial FBP aldolases are known to split fructose 1,6-bisphosphate
only. In higher eukaryotes, fructose 1-phosphate is a lesser substrate
of aldolase (2, 10), whereas fructose 6-phosphate is either an
inhibitor of FBP aldolase (11) or a very weak substrate (less than
0.01% relative activity compared with FBP); however, no aldol
formation from dihydroxyacetone and glyceraldehyde-3-P was reported
(12). Muscle and plant chloroplast FBP aldolases are reported to split
sedoheptulose 1,7-bisphosphate (13, 14). To our best knowledge, no
aldol cleavage of fructose 6-phosphate has been reported so far from
any organism (1).
Transaldolases (EC 2.2.1.2) are class I aldolases that serve in
transfer reactions in the pentose phosphate cycle. Transaldolases use
fructose-6-P as donor and transfer a dihydroxyacetone group to acceptor
compounds as erythrose-4-P or glyceraldehyde-3-P (3, 15-18). As a side
reaction, formation of fructose-6-P from dihydroxyacetone and
glyceraldehyde-3-P is known, but the corresponding aldol cleavage reaction has not been documented (3). Recently, a group of gene
sequences presumably encoding transaldolase-like proteins (19) has been
reported as outcome of total genome analyses of various Eubacteria and
Archaebacteria. We have cloned two of these sequences (mipB
and talC) from the genome of E. coli K-12. During the course of characterization of the gene products, however, we
noticed that the corresponding proteins did not act as transaldolases. Instead, they perform a novel reaction, cleavage, or formation of
fructose 6-phosphate as shown in Reaction 1.
Here we present results in the characterization of
fructose-6-phosphate aldolase encoded by the gene fsa
(formerly termed mipB).
Materials--
Sugar phosphates, antibiotics, and other fine
chemicals were purchased from Sigma unless indicated otherwise.
Aldehydes and erythrose were from Fluka (Neu-Ulm, Germany). Auxiliary
enzymes (triose-phosphate isomerase/glycerol-3-phosphate dehydrogenase, phosphoglucose isomerase, and glucose-6-phosphate dehydrogenase), restriction endonucleases, Taq DNA polymerase and T4 DNA
ligase, were from Roche Molecular Biochemicals. SDS was from Serva
(Heidelberg, Germany); acrylamide/bisacrylamide was from Roth
(Karlsruhe, Germany); chromatographic standards (Combithek) were from
Roche Molecular Biochemicals; and Q-Sepharose HP was from Amersham
Pharmacia Biotech. Glycylglycine, NADH, and NADP(H) were purchased from
Biomol (Hamburg, Germany). Bacterial media were from Difco.
Bacterial Strains and Growth Conditions--
The
bacterial strains and plasmids used in this study are listed in
Table I. The strains were grown
under aeration at 37 °C in LB medium (20) with appropriate
antibiotics added. Ampicillin was used in a concentration of 100 mg/liter.
DNA Techniques--
Chromosomal DNA of E. coli strain
MC4100 (21) was prepared and used as template for
oligonucleotide-directed DNA amplification (22). Standard techniques
for cloning (20) and transformation (23) were applied. The E. coli mipB gene was amplified by polymerase chain reaction
using primers MipB5 (5' GATGTGCGTCGACTGTTCAGAGAGTTTTCCC 3')
and MipB3 (5' GAGGCTGCAGAACGTCCGGTTAAATCGACG 3')
corresponding to base pairs 862,865 to 862,896 (5'-end) and
863,497 to 863,527 bps (3'-end), respectively, of the sequence
deposited at EMBL/GenBankTM (Isomura and
coworkers,2
GenBankTM accession number ECD188; see Ref. 24); the
underlined sequences denote the engineered restriction sites for
SalI and PstI, respectively. 20 pmol of each
primer were used with template chromosomal DNA (500 ng). The resulting
0.7-kilobase pair PCR fragment was purified, cleaved with
PstI plus SalI, and ligated with pUC18 which had been opened likewise. Strain JM109 was used for transformations; resulting clones were checked for their integrity by restriction analyses and DNA sequencing using an automatic nonradioactive system
(LI-COR, MWG Biotech, Ebersberg, Germany). Site-directed mutagenesis
was carried out using the Chameleon Double-stranded Site-directed
Mutagenesis kit from Stratagene. Mutagenesis primers were 5'
GGCGGTCACCGGAACGCGCACCACGATATCCGC 3' and 5' CATCATTGGAAAACGCTCTTCGGGGCG 3'. Data bank searches were done using the NCBI Blast server with the program of Altschul et al. (25). Preliminary sequence
data were obtained from The Institute for Genomic Research.
Purification of the New Enzyme from a Recombinant
Strain--
FSA (formerly MipB) aldolase from recombinant strain
JM109/pUC18fsa was purified by the following procedure; all
operations were carried out at 4 °C in glycylglycine buffer (50 mM; pH 8.0; 1 mM dithiothreitol). A single
colony was inoculated into 50 ml of LB + ampicillin and incubated
overnight at 37 °C with shaking. This culture served as starter for
the main culture that was performed in three 2-liter Erlenmeyer flasks
(400 ml of LB + ampicillin medium each) with shaking at 37 °C. Cells
were collected by centrifugation (yield of 24 g wet weight). After
washing with glycylglycine buffer, pellets were broken by ultrasonic
treatment (Branson Sonifier, Danbury, CT) eight times for 30 s at
40 watts under cooling in an ethanol/ice bath. After centrifugation at
20,000 × g, the supernatant was used as cell-free
extract. Cell-free extract was dissolved in 240 ml of buffer and
directly applied onto a Q-Sepharose HP anion exchange column (XK 26/20;
26 × 200 mm). At a flow rate of 1 ml/min, FSA was eluted in a
linear NaCl gradient at a concentration of 352-380 mM
NaCl. Active fractions were pooled, diluted 4-fold with buffer, and
passed over a gel filtration column (Superdex G-200, Amersham Pharmacia
Biotech). SDS-polyacrylamide gel electrophoresis (PAGE) was carried out
in the presence of 1% SDS on 12% vertical polyacrylamide gels using
the buffer system of Laemmli (26). Gels were run at room temperature in
a Bio-Rad MiniProteanII chamber with a LKB 2297 Macrodrive 5 power
supply at a constant voltage of 100 V. For native polyacrylamide gel
electrophoresis, gradient gels were run for 6 h with a constant
voltage of 125 V. Protein bands were visualized by staining with
Coomassie Brilliant Blue R-250. By using different reference
marker proteins, the subunit mass of the FSA was calculated from a plot
of the log of the molecular mass versus the relative
mobility on SDS-polyacrylamide gels. Purified FSA was blotted onto
polyvinylidene difluoride membranes (Immobilon-P from Millipore) in a
semi-dry blot apparatus and stained with Amido Black. The protein band
was cut out and subjected to N-terminal sequenation. Electrospray
tandem mass spectroscopy was carried out as described (27) using a
Q-TOF (Micromass, Manchester, UK).
Aldolase Assays--
Two different assays for
fructose-6-phosphate aldolase activity were used (all at 30 °C in a
Shimadzu UV160A spectrophotometer with a thermostated cuvette holder at
a wavelength of 340 nm).
(i) Cleavage of fructose 6-phosphate (Fru-6-P, 50 mM) was
followed using the auxiliary enzymes triose-phosphate isomerase and
glycerol-3-phosphate dehydrogenase to detect formation of D-glyceraldehyde 3-phosphate. The oxidation of NADH (0.5 mM) was monitored and 1 µmol of NADH oxidized was set
equivalent to 1 µmol of Fru-6-P cleaved. Enzyme activities are given
in units (µmol/min). The standard buffer was glycylglycine (50 mM, pH 8.5) including 1 mM dithiothreitol in a
total volume of 1 ml.
(ii) By using the same buffer system as in i, the formation of Fru-6-P
from glyceraldehyde 3-phosphate and dihydroxyacetone (3 and 50 mM, respectively) was monitored by the combined enzymes phosphoglucose isomerase and glucose-6-phosphate dehydrogenase. The
reduction of NADP (0.5 mM) was followed. A prereaction of glyceraldehyde 3-phosphate with the auxiliary enzymes and NADP was run
until no further NADPH formation occurred. Influence of possible
inhibitors of aldolase activity was measured by aldolase assays I and
II. Glycerol was added at different concentrations up to 230 mM; inorganic phosphate was added up to 5 mM,
and EDTA was added at 10 mM. Transaldolase activity was
determined as described earlier (16). A dye-binding method (28) was
used to estimate the concentration of protein in solution.
Cloning of the fsa (mipB) Gene and Expression of the
Plasmid-encoded Aldolase--
During a data bank search for
transaldolase-like proteins in the genome of E. coli K-12
strain MG1655 (Ref. 24; GenBankTM accession number U00096),
we found two open reading frames (ORFs) that showed a degree of
identical amino acid residues in the range of 25% to the derived
peptide sequence of talB (Table II; see Ref. 16). One of the putative
ORFs ("talC") had been classified earlier by Saier and
co-workers (19) as a transaldolase, albeit without experimental
evidence. The other (mipB) was originally proposed as a
transaldolase-like protein (29).2
In our efforts to understand the transaldolase activities of E. coli (16, 17, 30), we amplified the mipB-containing region with a PCR method (22) using chromosomal DNA of strain MC4100 as
template and by using specific primers with engineered unique
restriction sites (see Fig. 1 and
"Experimental Procedures" for details). The amplification product
(about 700 bp of DNA) was cloned into the expression vector pUC18. In
crude extracts from strains carrying the gene on high copy number
vectors, an extra protein band at 24,000 Da (± 1000) appeared on
SDS-PAGE. This protein band could be further augmented by addition of
the inducer IPTG to recombinant cells in the exponential phase and was
estimated to constitute up to 10% of the total soluble protein content
of the crude extract (Fig. 2); thus a
rapid and high yield enzyme purification could be undertaken. The
purification strategy using recombinant strain
JM109/pUC18fsa is described under "Experimental Procedures." A total of about 40 mg of pure enzyme was obtained from
1 liter of culture, with an overall yield of 38% corresponding to a
purification factor of 5.2 (Table III).
The degree of purity was monitored with polyacrylamide gel
electrophoresis (26).
Contrary to our expectation that mipB encoded a new
transaldolase species, no such activity was enriched concomitantly with the new protein species. Instead, we noticed that a fructose
6-phosphate cleaving activity was present and further enriched by
subsequent steps of protein purification. In the homogeneous state, a
fructose-6-phosphate aldolase activity (at 30 °C in glycylglycine
buffer, pH 8.5) of 7 units per mg of protein was found (Table
IV). No fructose-1,6-bisphosphate aldolase or transaldolase activity could be detected in the gel filtration fractions (data not shown). As a literature search did not
reveal evidence for a previous description of a fructose-6-phosphate aldolase from any organism, we like to term the novel activity as
fructose-6-phosphate aldolase. Furthermore, we propose to rename the
corresponding gene (formerly mipB) as fsa
(mnemonic for fructose-six phosphate
aldolase); the enzyme is abbreviated as FSA.
To verify that the novel enzyme activity was the true product of the
fsa (mipB) gene, the purified protein was
subjected to SDS-PAGE, blotted onto a polyvinylidene difluoride
membrane, and stained with Amido Black. The first 10 amino acid
residues were determined by an automated Edman degradation and analyzed
by reversed phase high performance liquid chromatography. The sequence
was determined as
H2N-(Met)-Glu-Leu-Tyr-Leu-Asp-Thr-Ser-Asp-Val. The formyl
methionine was cleaved off in a portion of the sample. The N-terminal
amino acid sequence was in full agreement with the sequence submitted
by Isomura and co-workers2 (EMBL entry ECD188; SwissProt
entry P78,055).
Properties of the Novel Aldolase--
Examination of the
comparative SDS-gel electrophoretic mobility of the
novel E. coli recombinant aldolase with a number
of known reference proteins indicated a subunit mass for the purified protein of 24,000 ± 1,000 (Fig. 2). By using a Q-TOF electrospray tandem mass spectrometer, the molecular mass of FSA was determined to
22,998 (Fig. 3). This was in excellent
agreement with the mass calculated from the deduced protein sequence
(including the initial f-Met) of 22,997 Da (SwissProt entry P78,055).
The molecular mass of native E. coli recombinant aldolase
was judged by gel filtration with reference proteins of known molecular
masses ranging from 12 to 400 kDa. Active aldolase was eluted at a
volume of 152 ml of buffer. In a logarithmic plot of elution volume
versus molecular mass an average mass of 257,000 ± 20,000 Da was calculated. This points to either a decameric or
dodecameric structure of E. coli Fru-6-P aldolase,
consisting of 10 or 12 identical subunits, respectively.
The influence of different buffer substances, pH values, and
temperature on the activity of the enzyme as well as the storage stability were analyzed using enzyme assay I (see "Experimental Procedures"). The auxiliary enzymes were first checked for activity under the different reaction conditions and were added to the reaction
mixture in excess. As buffer substances, Tris, glycylglycine, Hepes,
imidazole, 3-(cyclohexylamino)-1-propanesulfonic acid, or
phosphate were used. Of these, glycylglycine (50 mM) was
the best buffer compound. Optimal activity was found around pH 8.5, with a broad range of activity in buffers from pH 6.0-12.0.
FSA displayed a broad temperature optimum and was active in the range
from 20 to 75 °C. Although no significant loss of activity was
detected after 600 h of incubation at 45 °C (in glycylglycine buffer, pH 8.0), the respective half-lives of the enzyme were 200 h at 55 °C, 30 h at 65 °C, and 16 h at 75 °C. A
significant loss in activity was found in Tris buffers at
concentrations higher than 10 mM pointing to a reaction of
Tris with the enzyme. The purified protein could be stored frozen at
FSA was inhibited by glycerol, inorganic phosphate, and arabinose
5-phosphate but not by EDTA (at 10 mM). Rapid loss of
activity was seen if kept in contact with glycerol (see Fig.
4a). After 10 min of
incubation in the presence of 20% glycerol, a decrease of more than
70% of enzyme activity was found. This inhibition was fully reversible
(by dilution or removal through ultrafiltration) and appeared to be of
the uncompetitive type. Inorganic phosphate was a competitive inhibitor
with an apparent Ki value of 0.22 mM
(see Fig. 4b). Arabinose 5-phosphate was a competitive inhibitor (Ki of 0.07 mM; data not
shown).
Kinetic Studies on Aldolase Substrates--
The kinetic constants
Km and Vmax were determined
in 50 mM glycylglycine buffer, at pH 8.5 and 30 °C. The
cleavage of fructose 6-phosphate was monitored by enzyme assay I (see
"Experimental Procedures"). When aldolase activities with different
donor and acceptor compounds were compared, the
Vmax values of the standard reaction with
Fru-6-P were determined each time as a control and were set 100%. No
cleavage products were obtained from fructose, fructose 1-phosphate,
glucose 6-phosphate, sedoheptulose 1,7-bisphosphate, xylulose
5-phosphate, ribulose 5-phosphate, and fructose 1,6-bisphosphate (up to
100 mM final concentrations). Neither were these compounds inhibitors of the standard reactions at concentrations up to 20 mM (data not shown).
Aldol forming activity of FSA (dihydroxyacetone as donor,
glyceraldehyde-3-P as standard acceptor) was followed by measuring NADPH formation in the presence of phosphoglucose-isomerase and glucose-6-phosphate dehydrogenase (assay II). Aldol formation took
place at a faster rate than the cleavage reaction
(Vmax was calculated to be at 45 units/mg). By
using high pressure liquid chromatography measurements, we checked
whether other donor compounds are used by FSA. Dihydroxyacetone served
as standard donor compound for comparison. Hydroxyacetone (acetol)
served as donor but at reduced rates; erythrose and glycolaldehyde were
weak acceptors (data not shown). Dihydroxyacetone phosphate did
not serve as donor compound nor was D-glyceraldehyde used
as acceptor (i.e. no fructose was formed).
Occurrence of FSA Homologs in Other Organisms--
Data bank
searches with total genome sequences from various eu- and
archaebacterial microorganisms revealed sequences with apparent
homology to FSA. Data bank searches were done using the NCBI Blast
server (25). Preliminary sequence data were obtained from The Institute
for Genomic Research. In E. coli, another sequence is
present (talC, see above) which shared 68% identical (79%
similar) residues with FSA. fsa-related genes with prominent
similarity were only found in prokaryotic genomes such as in
Clostridium beijerinckii (31), as well as in the total
genomes of Yersinia pestis, Bacillus subtilis,
and Bacillus stearothermophilus, in the extreme thermophilic
eubacteria Aquifex aeolicus and Thermotoga maritima, and in the archaebacterium Methanococcus
jannaschii. Fig. 5 shows an alignment
of sequences with the highest similarity to FSA. Bona fide
transaldolases (transaldolases A and B from E. coli, the two
isozymes from S. cerevisiae, or the human transaldolase) showed less pronounced similarity to FSA and are therefore excluded from Fig. 5.
All sequences in Fig. 5 have in common that no function has been
experimentally assigned to them. They are in a size range of about
23-24 kDa (average of about 220 amino acid residues) per subunit. 24 of these residues are invariantly present in all 15 sequences of the
alignment. As FSA was not inhibited by EDTA, it was likely that this
novel aldolase does not belong to class II (metal-dependent
aldolases) and instead is a new member of class I aldolases. Therefore,
a reactive lysine residue should be prominent. Indeed, among the 24 invariant residues of the alignment in Fig. 5, only 1 lysine residue
appeared (at position 85 of FSA).
To test whether this conserved lysyl residue indeed fulfills a function
in enzyme activity, we changed the Lys-85 residue to an arginine
residue by site-directed mutagenesis (see Fig. 1 and "Experimental
Procedures" for details). The K85R mutein was expressed at good
quantity and was purified through the same procedure as wild-type FSA.
The K85R mutein nearly lacked enzyme activity (less than 0.03 units/ mg
of protein), both for cleavage of fructose 6-phosphate or its
formation. We propose that FSA is therefore likely to be a class I
aldolase with a reactive lysine residue (Lys-85).
Are All FSA Homologs Also Fructose-6-phosphate Aldolases?--
As
the talC gene from E. coli showed striking
similarity to the fsa gene, we tested whether it also
encoded an aldolase activity. Recombinant strains of E. coli
carrying a high copy number plasmid with the PCR-amplified
talC gene, indeed showed fructose-6-phosphate aldolase
activity in the crude extracts. The purified protein lacked
transaldolase activity and is thus the second example of a
fructose-6-phosphate aldolase (although with reduced specific activities when compared with FSA; data not shown). To find whether other related proteins included in Fig. 5 display transaldolase or the
novel fructose 6-P aldolase activities, we cloned the corresponding genes from the Gram-positive bacterium B. subtilis (where no
transaldolase gene had been functionally assigned so far) and from the
hyperthermophilic bacterium T. maritima. TM0295 was
amplified as a 680-bp PstI-SalI fragment and
ywjH as a 790-bp PstI-SalI
fragment (Table I). Both genes were amplified by
PCR,3 cloned into suitable
expression vectors, and transformed in E. coli strain JM109.
Both genes led to formation of extra protein bands visible in SDS-PAGE
(subunit size ~24 kDa). Crude extracts from the recombinant strains
showed elevated transaldolase activities but no fructose-6-P aldolase
activity.4 To our best
knowledge, this is the first proof for a transaldolase gene and enzyme
function in B. subtilis as well as in T. maritima.
We have cloned an open reading frame from the E. coli
chromosome that had been assumed earlier to be a transaldolase or a transaldolase-related protein (19).2 Here we show that this
gene encodes a novel enzyme activity, fructose-6-phosphate aldolase.
This activity was found in cell-free extracts of
fsa-recombinant E. coli strains and could be
purified to apparent homogeneity with a yield of about 40 mg (38% of
initial total activity). We propose the gene name fsa
instead of mipB (whose true function is unknown so far).
Enzyme purification was accelerated by the availability of the cloned
gene from this organism on a high copy number vector and was enhanced
by adding IPTG to derepress an IPTG-responsive promoter, leading to
elevated activities already in the crude extracts. Evidence for the
purity of the recombinant protein was provided the following:
(a) by visual inspection of Coomassie-stained SDS-PAGE,
(b) by the unanimous determination of the N-terminal amino
acid residues, and (c) by electrospray tandem mass
spectrometry. The preparation was suitable for
crystallization,5 underlining
the purity of the preparation. The enzyme most likely forms either a
decamer or dodecamer of identical subunits with a
Mr of 22,998.
FSA is not inhibited by EDTA which points to a metal-independent mode
of action. The lysine 85 residue is essential for its action as its
exchange to arginine (K85R) resulted in complete loss of activity; this
could be best interpreted if the reaction mechanism involves a Schiff
base formation through this lysine residue. This we take for evidence
that FSA is a class I aldolase.
To our knowledge, this is the first report on a genuine
fructose-6-phosphate aldolase from any source. As we show here, the gene talC of E. coli, also encodes a
fructose-6-phosphate aldolase and not a transaldolase as proposed
earlier (19). The gene product shows a high degree of similarity with
FSA. Two other genes (from B. subtilis and T. maritima) with high similarity to fsa were cloned but
were shown to encode true transaldolase functions. From our data it
becomes obvious that these clearly homologous sequences do not encode
same functions. Both new transaldolase genes are members of a novel
class of transaldolases as they show limited similarity to classical
transaldolases from man, yeast, or E. coli (average size
about 35 kDa; see Ref. 16) or from plants and cyanobacteria (average
size about 42 kDa; see Ref. 36). In this context it may be of interest
that muscle FBP aldolase, when truncated at the C terminus by treatment
with carboxypeptidase, displays a distinct transaldolase activity,
e.g. transfer of the enzyme-bound dihydroxyacetone
phosphate to an aldehyde (32). Thus, the limits between the two enzyme
activities (aldolase versus transaldolase) may be shifted by
exchange of amino acid residues.
The substrate specificity of the E. coli FSA appeared to be
narrow with fructose 6-phosphate being the only substrate for aldol
cleavage from all tested compounds which were at our hands. Although we
cannot exclude the possibility that another sugar phosphate is the
cognate substrate of this novel aldolase, we wish to emphasize that the
common building block fructose 6-phosphate has not been reported to be
a substrate for aldolase to our best knowledge.
We do not yet know the true physiological function of FSA in E. coli. By using FSA-specific polyclonal antibodies, we were unable
to detect immunologically active material against FSA in crude extracts
of E. coli (grown either in LB or defined mineral salts
media with various carbon sources; data not shown). It needs to be
established under what circumstances fsa and talC
are transcribed (if at all) and to what amounts. Experiments to
elucidate the structure and function of FSA are under way.
We were not able to determine the reaction equilibrium constants due to
the rapid chemical degradation of one of the cleavage products,
glyceraldehyde 3-phosphate (data not shown). However, we estimated a
standard free energy change of reaction We thank William J. Griffiths at the Protein
Analysis Center, Department of Medical Biochemistry and Biophysics
Karolinska Institute, Stockholm, Sweden, for carrying out the mass
spectroscopy. We thank Rainer Kappes from our institute for chromosomal
DNA of Bacillus subtilis; Wolfgang Liebl (University of
Göttingen, Germany) for the kind donation of T. maritima chromosomal DNA; Gunter Schneider for critically reading
the manuscript; and Hermann Sahm for continuous support.
*
This work was supported by Grant SFB380/B21 of the Deutsche
Forschungsgemeinschaft.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Published, JBC Papers in Press, December 18, 2000, DOI 10.1074/jbc.M008061200
2
M. Isomura, T. Oqino, and T. Mizuno, personal communication.
3
We established that our DNA sequence of the
B. subtilis ywjH gene is in conflict with the deposited
sequence in the data banks; the corrected derived YwjH peptide sequence
is therefore longer at its C terminus.
4
M. Schürmann and G. A. Sprenger,
manuscript in preparation.
5
M. Schürmann, S. Thorell, G. Schneider, Y. Lindqvist, and G. A. Sprenger, unpublished observations.
The abbreviations used are:
FBP aldolase, fructose-1,6-bisphosphate aldolase;
FBP, fructose 1,6-bisphosphate;
Fru-6-P, D-fructose 6-phosphate;
FSA, fructose-6-phosphate
aldolase;
ORFs, open reading frames;
bp, base pair;
PAGE, polyacrylamide gel electrophoresis;
PCR, polymerase chain
reaction;
IPTG, isopropyl-1-thio-
Fructose-6-phosphate Aldolase Is a Novel Class I Aldolase
from Escherichia coli and Is Related to a Novel Group
of Bacterial Transaldolases*
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1 of protein for fructose 6-phosphate
cleavage (at 30 °C, pH 8.5 in 50 mM glycylglycine
buffer). For the aldolization reaction a Vmax
of 45 units mg1 of protein was found;
Km values for the substrates were 9 mM
for fructose 6-phosphate, 35 mM for dihydroxyacetone, and 0.8 mM for glyceraldehyde 3-phosphate. FSA did not utilize
fructose, fructose 1-phosphate, fructose 1,6-bisphosphate, or
dihydroxyacetone phosphate. FSA is not inhibited by EDTA which
points to a metal-independent mode of action. The lysine 85 residue is
essential for its action as its exchange to arginine (K85R) resulted in
complete loss of activity in line with the assumption that the reaction
mechanism involves a Schiff base formation through this lysine residue
(class I aldolase). Another fsa-related gene,
talC of Escherichia coli, was shown to also
encode fructose-6-phosphate aldolase activity and not a transaldolase
as proposed earlier.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (12K):
[in a new window]
Reaction 1.
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
Strains and plasmids used in this study
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
Sequence relationships of transaldolases and FSA-related proteins
View larger version (11K):
[in a new window]
Fig. 1.
Features of the cloned fsa
gene from E. coli. PCR primer sites MipB5 and MipB3
(including the engineered SalI and PstI
restriction sites) are denoted as well as the site of site-directed
mutagenesis of the critical Lys-85 residue. The putative ribosome
binding site is underlined.
View larger version (53K):
[in a new window]
Fig. 2.
SDS-PAGE analysis of the E. coli
aldolase purification. The gel was run as described under
"Experimental Procedures" with the following reference marker
proteins in lane D: phosphorylase b, 97,400 Da;
bovine serum albumin, 66,200 Da; fructose-bisphosphate aldolase, 39,200 Da; triose-phosphate isomerase, 26,600 Da; and trypsin inhibitor,
21,500 Da. In the lanes A-C, samples of the purification
steps were applied, and FSA appears in all lanes at a molecular mass of
24,000 Da. Lane C, crude extract after ultrasonication and
centrifugation; in lane B, after chromatography on
Q-Sepharose, HP. Lane A, after gel filtration on Superdex
G-200 column.
Purification scheme for E. coli fructose-6-phosphate aldolase
Kinetics of fructose-6-P aldolase FSA
View larger version (8K):
[in a new window]
Fig. 3.
Electrospray tandem mass spectroscopy of
FSA. 5 µl of purified FSA solution at a concentration of 10 mg/ml was used according to "Experimental Procedures."
20 °C in the presence of 1 mM dithiothreitol with a
loss of activity of about 20-40%. At 4 °C in glycylglycine buffer,
the loss of activity was 20% per month. Alternatively, the enzyme
could be lyophilized and stored at 20 °C for several months.
View larger version (36K):
[in a new window]
Fig. 4.
Inhibitory effects of glycerol and inorganic
phosphate. a, inhibitory effect of glycerol at various
inhibitor concentrations, shown as a double-reciprocal Lineweaver-Burk
plot. 
, without inhibitor; 
, 20 mM glycerol; 
, 59 mM glycerol; ×, 118 mM glycerol; 
, 230 mM glycerol. b, inhibition by inorganic
phosphate at final concentrations 0.5 mM (), 1 mM (), and 5 mM (×) compared without
phosphate (). Fru-6-P was added in concentrations up to 50 mM.
View larger version (117K):
[in a new window]
Fig. 5.
Alignment of E. coli
FSA with related derived protein sequences. Residues in
bold face (red) are conserved in at least 50% of
the sequences. # denotes residues that are conserved throughout all
sequences. The * above residue 85 denotes the putative reactive lysyl
residue of the novel aldolase. Abbreviations are as follows:
Ecofsa, E. coli fructose-6-phosphate aldolase FSA
(MipB); Ypestis, Yersinia pestis (unfinished
genome; SANGER-Institute); EcotalC, E. coli
"transaldolase C"; Styphi, Salmonella typhi
(unfinished genome; SANGER); Smutans, Streptococcus
mutans (unfinished genome, OU-AGCT); Entfaec,
Enterococcus faecalis (TIGR); Clobeij,
Clostridium beijerinckii (gut cluster gene; see
Ref. 31); BsutalC, B. subtilis "transaldolase
C," GenBankTM accession number AL009126;
Bstearo, B. stearothermophilus (unfinished
genome; OU-ACGT); Rhodoca, Rhodobacter capsulatus
(ORF M3.gl379 start, 347190; end, 346540, unfinished genome, TITAN);
Deinora, Deinococcus radiodurans R1,
GenBankTM accession numbers AE000513 and AE001825;
Caucres, Caulobacter crescentus (TIGR);
Methja, M. jannaschii, L77117;
Aquiaeo, A. aeolicus, GenBankTM
accession number AE000657; Thermot, T. maritima,
GenBankTM accession number AE000512.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
G0'of + 32 kJ mol1, which is about 10 kJ
mol1 more endergonic than the
fructose-bisphosphate cleavage reaction (33). If the subsequent
reactions cannot compensate for this strongly endergonic reaction, it
is not likely that the cleavage reaction contributes much to the
in vivo function of the FSA enzyme, and the aldol
condensation reaction might prevail in the cell. However,
phosphorylation of one cleavage product, dihydroxyacetone, by an
ATP-dependent kinase or by
phosphoenolpyruvate-dependent phosphorylation
through a phosphotransferase system might help the cells to circumvent
this activation problem. As well, an NADH-dependent glycerol dehydrogenase could withdraw dihydroxyacetone from the reaction. A glycerol dehydrogenase is known from E. coli,
and in this context, it is of interest that the encoding
gldA gene (34, 35) lies immediately downstream (overlapping
for 28 bp in the 3' region) of the talC gene of E. coli that encodes this second fructose-6-P aldolase. This
chromosomal location indicates that both talC and
gldA are part of an operon and may serve in a metabolic
pathway that handles dihydroxyacetone. No such glycerol dehydrogenase
gene, however, is found adjacent to the fsa (formerly mipB) gene in the chromosome. The function of both new
aldolases remains to be unveiled.
ACKNOWLEDGEMENTS
FOOTNOTES
To whom correspondence should be addressed. Tel.: 49-2461-616205;
Fax: 49-2461-612710; E-mail: g.sprenger@fz-juelich.de.
ABBREVIATIONS
-D-
galactopyranoside.
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Machajewski, T. D.,
and Wong, C.-H.
(2000)
Angew. Chem. Intl. Ed. Engl.
39,
1352-1375
2.
Rutter, W. J.
(1964)
Fed. Proc.
23,
1248-1257
3.
Horecker, B. L.,
Tsolas, O.,
and Lai, C. Y.
(1972)
in
The Enzymes
(Boyer, P. D., ed), 3rd Ed., Vol. 7
, pp. 213-258, Academic Press, New York
4.
Marsh, J. J.,
and Lebherz, H. G.
(1992)
Trends Biochem. Sci.
17,
110-113
5.
Mildvan, A. S.,
Kobes, R. D.,
and Rutter, W. J.
(1971)
Biochemistry
10,
1191-1204
6.
Witke, C.,
and Götz, F.
(1993)
J. Bacteriol.
175,
7495-7499
7.
Thomson, G. J.,
Howlett, G. J.,
Ashcroft, A. E.,
and Berry, A.
(1998)
Biochem. J.
331,
437-445
8.
Krishnan, G.,
and Altekar, W.
(1991)
Eur. J. Biochem.
195,
343-350
9.
Alefounder, P. R.,
Baldwin, S. A.,
Perham, R. N.,
and Short, N. J.
(1989)
Biochem. J.
257,
529-534
10.
Gefflaut, T.,
Blonski, C.,
Perie, J.,
and Willson, M.
(1995)
Prog. Biophys. Mol. Biol.
63,
301-340
11.
Crans, D. C.,
Sudhakar, K.,
and Zamborelli, T. J.
(1992)
Biochemistry
31,
6812-6821
12.
Richards, O. C.,
and Rutter, W. J.
(1961)
J. Biol. Chem.
236,
3185-3192
13.
Horecker, B. L.,
Smyrniotis, P. Z.,
Hiatt, H. H.,
and Marks, P. A.
(1955)
J. Biol. Chem.
212,
827-836
14.
Flechner, A.,
Gross, W.,
Martin, W. F.,
and Schnarrenberger, C.
(1999)
FEBS Lett.
447,
200-202
15.
Bonsignore, A.,
Pontremoli, S.,
Grazi, E.,
and Mangiarotti, M.
(1959)
Biochem. Biophys. Res. Commun.
1,
79-82
16.
Sprenger, G. A.,
Schörken, U.,
Sprenger, G.,
and Sahm, H.
(1995)
J. Bacteriol.
177,
5930-5936
17.
Jia, J.,
Huang, W.,
Schörken, U.,
Sahm, H.,
Sprenger, G. A.,
Lindqvist, Y.,
and Schneider, G.
(1996)
Structure
4,
715-724
18.
Jia, J.,
Schörken, U.,
Lindqvist, Y.,
Sprenger, G. A.,
and Schneider, G.
(1997)
Protein Sci.
6,
119-124
19.
Reizer, J.,
Reizer, A.,
and Saier, M. H.
(1995)
Microbiology
141,
961-971
20.
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd Ed.
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
21.
Casadaban, M. J.
(1976)
J. Mol. Biol.
104,
541-555
22.
Mullis, K. B.,
and Faloona, F. A.
(1987)
Methods Enzymol.
155,
335-350
23.
Hanahan, D.
(1983)
J. Mol. Biol.
166,
557-580
24.
Blattner, F. R.,
Plunkett, G., III,
Bloch, C. A.,
Perna, N. T.,
Burland, V.,
Riley, M.,
Collado-Vides, J.,
Glasner, J. D.,
Rode, C. K.,
Mayhew, G. F.,
Gregor, J.,
Davis, N. W.,
Kirkpatrick, H. A.,
Goeden, M. A.,
Rose, D. J.,
Mau, B.,
and Shao, Y.
(1997)
Science
277,
1453-1474
25.
Altschul, S. F.,
Madden, T. L.,
Schaffer, A. A.,
Zhang, J.,
Zhang, Z.,
Miller, W.,
and Lipman, D. J.
(1997)
Nucleic Acids Res.
25,
3389-3402
26.
Laemmli, U. K.
(1970)
Nature
227,
680-685
27.
Rai, D. K.,
Alvelius, G.,
Landin, B.,
and Griffiths, W. J.
(2000)
Rapid Commun. Mass Spectrom.
14,
1184-1194
28.
Bradford, M. M.
(1976)
Anal. Biochem.
72,
248-254
29.
Thorell, S.,
Gergely, P., Jr.,
Banki, K.,
Perl, A.,
and Schneider, G.
(2000)
FEBS Lett.
475,
205-208
30.
Schörken, U.,
Jia, J.,
Sahm, H.,
Sprenger, G. A.,
and Schneider, G.
(1998)
FEBS Lett.
441,
247-250
31.
Tangney, M.,
Brehm, J. K.,
Minton, N. P.,
and Mitchell, W. J.
(1998)
Appl. Environ. Microbiol.
64,
1612-1619
32.
Rose, I. A.,
O'Connell, E. L.,
and Mehler, A. H.
(1965)
J. Biol. Chem.
240,
1758-1765
33.
Kröger, A.
(1999)
in
The Biology of the Prokaryotes
(Lengeler, J. W.
, Schlegel, H. G.
, and Drews, G., eds)
, pp. 48-58, Thieme Verlag, Stuttgart, ; Blackwell Science Inc., Malden, MA
34.
Sprenger, G. A.,
Hammer, B. A.,
Johnson, E. A.,
and Lin, E. C. C.
(1989)
J. Gen. Microbiol.
135,
1255-1262
35.
Truniger, V.,
and Boos, W.
(1994)
J. Bacteriol.
176,
1796-1800
36.
Köhler, U.,
Cerff, R.,
and Brinkmann, H.
(1996)
Plant Mol. Biol.
30,
213-218
37.
Yanisch-Perron, C.,
Vieira, J.,
and Messing, J.
(1985)
Gene (Amst.)
33,
103-119
38.
Vieira, J.,
and Messing, J.
(1982)
Gene (Amst.)
19,
259-268
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  S. Schneider, T. Sandalova, G. Schneider, G. A. Sprenger, and A. K. Samland Replacement of a Phenylalanine by a Tyrosine in the Active Site Confers Fructose-6-phosphate Aldolase Activity to the Transaldolase of Escherichia coli and Human Origin J. Biol. Chem., October 31, 2008; 283(44): 30064 - 30072. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Alcantara, L. A. Sarmiento-Rubiano, V. Monedero, J. Deutscher, G. Perez-Martinez, and M. J. Yebra Regulation of Lactobacillus casei Sorbitol Utilization Genes Requires DNA-Binding Transcriptional Activator GutR and the Conserved Protein GutM Appl. Envir. Microbiol., September 15, 2008; 74(18): 5731 - 5740. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Frottin, A. Martinez, P. Peynot, S. Mitra, R. C. Holz, C. Giglione, and T. Meinnel The Proteomics of N-terminal Methionine Cleavage Mol. Cell. Proteomics, December 1, 2006; 5(12): 2336 - 2349. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. L. Grochowski, H. Xu, and R. H. White Ribose-5-Phosphate Biosynthesis in Methanocaldococcus jannaschii Occurs in the Absence of a Pentose-Phosphate Pathway J. Bacteriol., November 1, 2005; 187(21): 7382 - 7389. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Siebold, I. Arnold, L. F. Garcia-Alles, U. Baumann, and B. Erni Crystal Structure of the Citrobacter freundii Dihydroxyacetone Kinase Reveals an Eight-stranded {alpha}-Helical Barrel ATP-binding Domain J. Biol. Chem., November 28, 2003; 278(48): 48236 - 48244. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Siebold, L. F. Garcia-Alles, B. Erni, and U. Baumann A mechanism of covalent substrate binding in the x-ray structure of subunit K of the Escherichia coli dihydroxyacetone kinase PNAS, July 8, 2003; 100(14): 8188 - 8192. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |