|
Originally published In Press as doi:10.1074/jbc.M007375200 on January 18, 2001
J. Biol. Chem., Vol. 276, Issue 15, 11838-11843, April 13, 2001
Identification and Characterization of an
Entamoeba histolytica Upstream Regulatory Element 3 Sequence-specific DNA-binding Protein Containing EF-hand Motifs*
Carol A.
Gilchrist ,
Chris F.
Holm§,
Molly A.
Hughes ,
Joanna
M.
Schaenman§,
Barbara J.
Mann §, and
William A.
Petri Jr. §¶
From the Departments of Internal Medicine,
§ Microbiology, and ¶ Pathology, University of
Virginia, Charlottesville, Virginia 22908
Received for publication, August 14, 2000, and in revised form, January 16, 2001
 |
ABSTRACT |
The hgl5 gene of Entamoeba
histolytica is negatively regulated through the upstream
regulatory element 3 (URE3) DNA motif TATTCTATT. This motif is also
present and significant in the function of the E. histolytica
fdx gene promoter. A yeast one-hybrid screen was used to identify
an E. histolytica cDNA encoding a protein (URE3-BP)
that recognized this DNA motif. Analysis of the predicted amino acid
sequence demonstrated the presence of two EF-hand motifs but identified
no canonical DNA binding motifs. URE3-BP, expressed in bacteria,
demonstrated Ca2+-dependent and
sequence-specific recognition of the URE3 DNA sequence as assessed by
electrophoretic mobility shift assays. Antibodies raised against
URE3-BP blocked the formation of the URE3 DNA-protein complex by
native nuclear extracts. The URE3-BP protein was present in the
E. histolytica nucleus and cytoplasm with an apparent
molecular mass of 22.6 kDa. Our results represent the first use
of a yeast genetic screen to identify, on the basis of function, a
DNA-binding protein of an early branching eukaryote. Since the URE3 DNA
can modulate gene expression in both a positive and negative manner, this protein may have more than one mechanism of interaction with transcriptional machinery. Characterization of URE3-BP should provide
insight into transcription regulation and virulence control in this parasite.
 |
INTRODUCTION |
The eukaryotic parasite Entamoeba histolytica is a
major cause of morbidity and mortality worldwide. There are an
estimated 50 million cases of invasive amebiasis annually, with an
estimated 40,000-110,000 deaths each year (1). The most common illness from E. histolytica infection is amebic dysentery, but
amebic abscesses in liver, lung, and brain also occur. Disease occurs in only a minority of infections and requires parasite invasion of the
intestinal epithelium. The factors responsible for the E. histolytica trophozoite invasion of the host gut cell wall, subsequent entry into the blood stream, and the formation of
life-threatening tissue abscesses are not well understood. Changes in
E. histolytica virulence could be mediated by changes in the
transcription of genes encoding proteins involved in the pathogenicity
of the organism.
A well characterized virulence factor of E. histolytica, the
galactose- and
N-acetyl-D-galactosamine-inhibitable lectin
(Gal/GalNAc-inhibitable lectin), is essential for parasite
adherence and contact-mediated cytolysis. One of the genes encoding the
lectin heavy subunit (hgl5), contains five major
regulatory regions (upstream regulatory elements 1-5
(URE1-5))1 upstream of the
core promoter (2). Mutation of the URE3 sequence TATTCTATT ( 80 to
89 base pairs upstream of the site of transcription initiation)
within the 5' hgl5 DNA results in an increase in relative promoter activity (2). In contrast, mutation of this sequence ( 60 to
51 base pairs relative to site of transcription initiation) in the
E. histolytica ferredoxin (fdx) promoter results
in a decrease in promoter activity (3), indicating that this sequence
can mediate both positive and negative control depending on the
promoter context. We have previously shown that E. histolytica nuclear protein(s) exhibit sequence-specific binding
to the URE3 motif in electrophoretic mobility shift assays (EMSA).
Amebic nuclear proteins had a higher affinity for oligonucleotides
containing the URE3 motif, TATTCTATT, than oligonucleotides of
identical base composition but in which this sequence had been altered
(3).
Identification of the protein(s) that bind to the URE3 DNA is important
not only for the elucidation of the mechanism of regulation of
virulence but also for the insight this may provide into
transcriptional regulation in an early branching eukaryote. The
E. histolytica core promoter for protein-encoding genes is
unusual in that it consists of a novel "GAAC" element in addition
to a TATA and INR (2, 4, 5). E. histolytica UREs differ in
whether they regulate transcription via the TATA or the GAAC elements;
URE3 appears to utilize
GAAC.2 The protein(s) binding
to URE3 therefore may be particularly interesting due to potential
interaction with the most divergent portion of the amebic core promoter.
Here we present the first application of a yeast one-hybrid screen to
identify E. histolytica sequence-specific DNA-binding proteins. The URE3 DNA sequence was used as the "bait" to identify amebic cDNAs encoding proteins capable of binding to this DNA motif. Validation of the screen was accomplished by characterization of
the binding specificity of the recombinantly expressed cDNA. The
novel structure of the URE3-binding protein is discussed.
 |
EXPERIMENTAL PROCEDURES |
Cultivation of E. histolytica and Nuclear Extract
Preparation--
E. histolytica strain HM1:IMSS trophozoites were
grown at 37 °C in TYI-S-33 medium containing penicillin (100 units/ml) (Life Technologies, Inc.) and streptomycin (100 µg/ml)
(Life Technologies) (6). Amebas in logarithmic phase growth (~6 × 104 trophozoites/ml) were used for nuclear extract
preparation. Crude nuclear extracts were prepared by the method
previously described (3) with the following modifications: the protease
inhibitors 2 mM
(2S,3S)-trans-epoxysuccinyl-L-leucylamido-3-methylbutane and 2 mM 4-(2-aminoethyl) benzenesulfonylfluoride, HCl were
added to both cell and nuclear lysis buffers, and dithiothreitol was omitted from the nuclear lysis buffer.
Yeast Transformation, Bait Construction, and Yeast One-hybrid
Screen of an E. histolytica cDNA Library--
Yeast one-hybrid
screening for DNA sequence-specific binding proteins was used to
identify proteins recognizing the URE3 motif, as previously
described (7). In brief, three URE3 DNA motifs (underlined)
AGCTTATATTCTATTGATATATTCTATTGATATATTCTATTGA
were cloned between the EcoRI and XbaI
restriction sites of pHIS-1 (CLONTECH), placing
them upstream of the yeast HIS3 gene minimal promoter to
generate the plasmid p3×URE3. This vector was linearized and
integrated into the yeast strain YM4271 (MATa, ura3-52,
his3-200, ade2-101, lys2-801, leu2-3, 112, trp1-903, tyr1-501,
gal4- 512, gal80 538,
ade5::hisG) (CLONTECH) by homologous
recombination with the yeast genomic copy of the mutant HIS3
gene to generate the URE3-bait yeast strain 1.4. A Gal4-cDNA fusion
expression library was generated from E. histolytica
cDNA. The cDNA was synthesized by the ZAP-cDNA Synthesis
Kit (Stratagene) from E. histolytica mRNA isolated using
the PolyATtract® 1000 system (Promega). The cDNA was then ligated
via EcoRI and XhoI linkers into the HybriZAP-2.1 vector, placing it in frame with and downstream of the Gal4 activation domain in this construct. The primary library was then amplified and converted by in vivo mass excision into a pAD-GAL4-2.1
library according to the manufacturer's directions (Stratagene). This plasmid expression library of Gal4 activation domain-E.
histolytica fusion proteins was transformed into the yeast bait
strain 1.4 by the methods of Agatep et al. (8). The
transformed yeast were plated on his , leu ,
ura minimal selective medium (Difco) supplemented with 10 mM 3-aminotriazole (3-AT) (Sigma). Transformation
efficiency was determined by plating an aliquot of transformed yeast on
the his , leu , ura minimal
selective plates in the absence of 3-AT. Approximately 1.5 × 105 cDNA clones (three E. histolytica genome
equivalents) were screened. Plasmid DNA was isolated by the
"smash-n-grab" method (9) from positive colonies, amplified via
transformation of plasmid (10) into Escherichia coli MC1061
(F araD139 (ara-leu)7696
galE-15 galK16 (lac)X74 rpsL (Strr)
hsdR2
(rk-mk+)
mcrA mcrB1), and reintroduced into both the URE3-yeast strain 1.4 and the parent strain YM4271 by transformation (8). Clones that
conferred the ability to grow on 10 mM 3-AT in the bait
strain and not in the parent strain that lacked the p3×URE3 construct were further analyzed.
Cloning and Expression of Recombinant URE3--
The
His6-tagged fusion protein expression vectors were
constructed by subcloning the insert of pGAD-E. histolytica
cDNA into the pRSETA vector (Invitrogen) via the linker restriction
sites BamHI and XhoI. Synthesis of the
recombinant His-tagged URE3-BP (URE3-binding protein) was induced in
E. coli BL21(DE3) (F ompT gal
[dcm] [lon] hsdSB, (rB-mB-)) cells grown in Luria-Bertani medium with 100 µM isopropyl-thio- -galactopyranose.
The recombinant protein was affinity-purified by use of nickel-chelate
resin according to the manufacturer's directions (Qiagen) and then
dialyzed against DNA binding buffer (10 mM Tris-HCl, pH
7.9, 50 mM NaCl, 1 mM EDTA, 20% glycerol). The
GST fusion protein was generated by subcloning the E. histolytica fragment via the linker EcoRI and
XhoI restriction sites into a modified version of the vector
pGEX-4X (Amersham Pharmacia Biotech) vector pGst-Parallel 1 (11). This
vector contains a tobacco etch virus (TEV) protease recognition site between the glutathione S-transferase (GST) tag and the
inserted protein. Expression of the recombinant protein was induced
using 10 µM isopropyl-thio- -galactopyranose and
purified from E. coli MC1061 cultures by
glutathione-conjugated agarose affinity chromatography according to the
manufacturer's directions (Amersham Pharmacia Biotech). For mouse
immunizations, the GST-URE3-BP fusion protein was allowed to remain
bound to glutathione-conjugated beads in the final purification step,
and URE3-BP was released by overnight incubation with 100 units of
polyhistidine-tagged TEV protease (Life Technologies). Protease was
removed by a 1-h incubation at room temperature with 50 µl of
nickel-chelate affinity resin (Qiagen).
Electrophoretic Mobility Shift Assay--
The oligonucleotides
hgl5-URE3, hgl5-MUT, and Olig-1 have all been
previously described (3) and are listed in Table
I. Electrophoretic mobility shift assays
were performed as described previously (3). In brief, to create the
radiolabeled probe, complementary oligonucleotides were annealed and
then labeled with the large DNA polymerase I subunit (Klenow) and
[ -32P]dATP. Reactions contained 0.003 pmol of
radiolabeled probe, 2 µg of poly(dI·dC), and 2 µg of protein from
E. histolytica crude nuclear extract (3) or 1 µg of
protein purified from bacterial lysates (Qiagen). The protein-DNA
interactions occurred in band shift buffer (10 mM Tris-HCl,
pH 7.9, 50 mM NaCl, 1 mM EDTA, 0.05% nonfat
milk powder (Carnation), 3% glycerol, 0.05 mg of bromphenol blue). The
reaction was incubated at room temperature (20 °C) for 20 min prior
to electrophoresis on a nondenaturing polyacrylamide gel for 2-3 h.
The gel was then fixed, dried, and quantitated by PhosphorImager
analysis (Molecular Dynamics, Inc., Sunnyvale, CA).
Northern Blot Analysis--
Total RNA from HMI:IMSS
trophozoites was isolated using the total RNA isolation system
(Promega). Ten micrograms of RNA was separated on a
formaldehyde-containing agarose gel (12) and transferred to
Zeta-probe GT Genomic blotting membrane (Bio-Rad). Prehybridization, hybridization, and washes were performed according to
the manufacturer's instructions. DNA probes were labeled using random
primers, [ 32P]dATP, and the Klenow fragment of DNA
polymerase I (Life Technologies). Message levels were determined by
PhosphorImager exposure.
Immunization and Immunodetection--
A female BALB/c-strain
mouse was immunized intraperitoneally with 100 µg of TEV
protease-cleaved URE3-BP emulsified in complete Freund's adjuvant. Two
weeks and 4 weeks later, the mouse was boosted with 100 µg of
TEV-cleaved URE3-BP in incomplete Freund's adjuvant. One week after
the last boost, ~0.2 ml of blood was obtained by retro-orbital
puncture. Nonimmune serum was obtained from a BALB/c mouse that had not
been immunized.
Immunoblots were performed by first electrophoresing 5 ng of
recombinant protein or 60 µg of amebic nuclear or cytoplasmic extracts through a 12% SDS-polyacrylamide gel. Proteins were
transferred to a PVDF membrane (Millipore Corp.), incubated for 1 h at room temperature in 5% nonfat dry milk in blot wash buffer (50 mM Tris, pH 7.4, 200 mM NaCl, 0.1% Tween 20).
The blot was then incubated for 1 h at room temperature with mouse
antiserum diluted 1:750 in 2% nonfat dry milk in blot wash
buffer. After three 5-min washes, the membranes were incubated for
1 h with sheep anti-mouse IgG horseradish peroxidase-conjugated
antibody (Amersham Pharmacia Biotech) at a dilution of 1:1000. The
secondary antibody was detected using the ECL Western blotting
detection system according to the manufacturer's directions (Amersham
Pharmacia Biotech) and was visualized by exposure of the blot to BioMax
MR-1 film (Eastman Kodak Co.).
Immunofluorescence and confocal laser microscopy were performed on
E. histolytica trophozoites by the methods of Voigt et al. (13) and Vines et al. (14). Approximately 2 × 105 amebas/sample were washed in M199S medium (M199
medium (Life Technologies, Inc.) supplemented with 25 mM
HEPES, pH 6.8, 5 mM L-cysteine, and 0.5%
bovine serum albumin) and allowed to adhere onto acetone-washed
coverslips for 15 min at 37 °C. Amebas were washed with warmed
phosphate-buffered saline once, fixed in 3.75% paraformaldehyde for 30 min at 37 °C, and permeabilized with 0.2% Triton X-100 for 60 s at room temperature. Samples were washed twice with
phosphate-buffered saline and once with 50 mM ammonium chloride. Amebas were incubated with blocking agent (5% bovine serum
albumin with 20% goat serum (Sigma) in phosphate-buffered saline) for
60 min. Mouse anti-URE3-BP serum was used at a dilution of 1:100 and
incubated for 60 min. Bound antibody was detected using a 1:64 dilution
of fluorescein isothiocyanate-conjugated goat anti-mouse IgG antibody
(Sigma). Nonimmune serum used as a negative control was also used at a
1:100 dilution. As a positive control, rabbit polyclonal antibodies
raised against the E. histolytica Gal/GalNAc-inhibitable
lectin were diluted 1:100 and detected by CyTM3-conjugated
donkey anti-rabbit IgG (Jackson Immunoresearch Laboratories). Amebas
were washed twice with phosphate-buffered saline and mounted on glass
slides using Gel/MountTM (BioMeda). Amebas were visualized
using a Zeiss LSM 410 laser-scanning confocal microscope equipped with
an argon/krypton laser. To generate final images, four averages at
4 s each were compiled using a Zeiss × 63 plan-apochromat
objective (numeric aperture, 1.40) with laser excitation at 488 nm
appropriate for fluorescein isothiocyanate and 568 nm appropriate for
CyTM3.
Sequence Analysis Software--
The sequence was compared with
the GenBankTM sequence library using the FASTA program on
the ExPASy (Expert Protein Analysis System) proteomics server of the
Swiss Institute of Bioinformatics (SIB) (15) and the Basic Local
Alignment Search Tool (BLAST) (16) at the National Center for
Biotechnology Information. Sequences were otherwise analyzed using the
Wisconsin Package, version 10.0, Genetics Computer Group (GCG) software.
 |
RESULTS |
Isolation of the cDNA Clone Encoding a URE3 DNA-binding
Protein--
To use the yeast one-hybrid system to identify a
URE3-binding protein, we first inserted an oligonucleotide containing
three copies of the URE3 DNA motif upstream of the yeast minimal
promoter that controls the expression of the HIS3 gene in
the plasmid pHis-1. The oligonucleotide containing the trimer had been
shown to compete for URE3-specific binding in crude E. histolytica nuclear extracts with an affinity at least equal to
the URE3 monomer (data not shown). We integrated the new construct into
the genome of the histidine (His) auxotrophic strain YM4271 to create
the bait yeast strain 1.4. An increase in minimal promoter activity due
to binding of a protein to the 5' URE3 sequences that contains the Gal4
activation domain was monitored on plates containing the competitive
inhibitor (3-AT) of the product of the HIS3 gene His3p. The
yeast Gal4 activation domain-E. histolytica cDNA fusion
proteins were introduced into strain 1.4, and approximately three
genome equivalents of E. histolytica (1.5 × 105 fusion constructs) were screened for proteins that can
bind to the URE3 DNA trimer. In the first screen, 281 positive clones were identified, but only four were capable of reconferring the selectable phenotype (growth on his , leu ,
ura minimal selective medium supplemented with 10 mM 3-AT) upon retransformation of the bait strain. Only one
of the four candidates (pGAL4-URE3-BP; Fig.
1) was independently positive for URE3
binding in other assays (see below). The plasmid pGAL4-URE3-BP required
the URE3 DNA "bait" to confer growth on 3-AT, since the parental
yeast strain YM4271 transfected with pGAL-URE3-BP did not grow on
leu minimal selective medium supplemented with 10 mM 3-AT (data not shown).

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 1.
Yeast one-hybrid assay of the URE3-BP
cDNA and URE3 DNA motif. Growth of yeast bait strain URE3 1.4 transformants expressing either the Gal4 activation
domain-URE3-BP fusion protein (pGAD-URE3-BP) or the Gal4 activation
domain (control plasmid pGAD424) on his ,
leu , ura with or without 10 mM
3-AT (as indicated).
|
|
DNA and Deduced Amino Acid Sequence of URE3-BP--
The complete
sequence of the 0.7-kilobase insert contained in pGAL4-URE3-BP
is shown in Fig. 2. We found considerable
identity (98%) between 512 base pairs of URE3-BP and an E. histolytica expressed sequence tag entry AB002727 (Fig. 2,
underlined region), previously identified by
Tanaka et al. (17) during analysis of E. histolytica cDNA.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 2.
Sequence of the URE3-BP cDNA and the
derived protein. The sequence of the GenBankTM
expressed sequence tag entry AB002727 is underlined. The two
EF-hand protein motifs are in boldface type.
Potential targets for tyrosine (#) and serine ( ) phosphorylation are
indicated.
|
|
An open reading frame of 670 base pairs encoded a protein with a
calculated mass of 25.8 kDa. The presence of EF-hand motifs (Fig. 2,
boldface type) was identified by use of the
ExPASy ScanProsite Program (15). The presence of this motif has been
strongly correlated with calcium binding activity (18). A potential
tyrosine kinase phosphorylation site (19-21) and serine
phosphorylation sites (22, 23) were also recognized by this program
(Fig. 2). Northern blot analysis of E. histolytica total
RNA with URE3-BP probes identified a unique message of 0.67 kilobases in size (Fig. 3A). The close agreement between the observed mRNA size and the size predicted from the E. histolytica URE3-BP cDNA clone
(0.7 kilobases) were consistent with the cDNA clone being
full-length. The short 5'- and 3'-untranslated regions of the URE3-BP
mRNA are a characteristic of E. histolytica mRNAs
(2, 24).

View larger version (55K):
[in this window]
[in a new window]
|
Fig. 3.
Northern and Western blots of URE3-BP
mRNA and native protein. A, total E. histolytica RNA (10 µg) was separated on a 1%
formaldehyde-agarose gel and probed with the full-length radiolabeled
URE3-BP cDNA. B, recombinant URE3-BP protein
(L-URE3-BP) (5 ng/lane) and amebic nuclear and cytoplasmic
extracts (60 µg/lane) were analyzed by SDS-polyacrylamide gel
electrophoresis followed by Western blotting with anti-URE3-BP
antibodies and visualized using horseradish peroxidase-conjugated IgG
and ECL reagents (Amersham Pharmacia Biotech).
|
|
Cellular Location of URE3-BP--
The URE3-binding protein
(URE3-BP) was synthesized in E. coli with an amino-terminal
GST fusion protein. TEV cleavage of the purified protein removed the
GST domain; the remaining 1.49 kDa of linker peptide increased the
calculated protein mass to 27.2 kDa. The observed molecular mass of
this protein in both Coomassie Blue-stained gels (data not shown) and
Western blots was 24.3 kDa (L-URE3-BP, Fig. 3B).
Serum raised against this URE3-BP fusion protein identified a
protein of ~22.6 kDa in both nuclear and cytoplasmic extracts of
E. histolytica proteins (Fig. 3B). A comparison of band intensities of a known amount of synthesized URE3-BP protein with those that resulted after loading a known quantity of nuclear extract permitted the rough estimation that URE3-BP constituted 0.01%
of the protein present in nuclear extracts.
Since the method used to prepare the nuclear extracts does not
completely exclude cytoplasmic protein contamination,
immunofluorescence techniques were used to confirm the location of
URE3-BP within the cell. The Gal/GalNac-inhibitable lectin, which is
located on both the cell surface and the cytoplasm but not in the
trophozoite nucleus (14), was used as a positive control (Fig.
4B). The URE3-BP (Fig.
4A) was present in both the cytoplasm and the nucleus. URE3-BP also appeared to be membrane-associated (Fig.
4D).

View larger version (118K):
[in this window]
[in a new window]
|
Fig. 4.
Cellular location of the URE3-BP as
determined by confocal microscopy of fixed, permeabilized E. histolytica trophozoites. A, mouse
anti-URE3-BP polyclonal primary antibody and fluorescein
isothiocyanate-conjugated secondary antibody
(green). B, rabbit anti-Gal/GalNAc lectin
polyclonal antibody and Cy3-conjugated secondary antibody
(red). C, laser-generated light microscopy image
of the amebas. D, overlay of confocal images from
A and B. Staining with secondary antibodies alone
was undetectable (data not shown). Nuclei (N) are indicated
by an arrow in B and D.
|
|
Synthesized URE3-BP Binds to the hgl5 URE3 Motif--
EMSA was
used to determine whether the E. coli-expressed URE3-BP
could bind in vitro to DNA containing the URE3 sequence
(Fig. 5). The URE3-BP protein was
incubated with a double-stranded radiolabeled oligonucleotide
containing the DNA sequence spanning the URE3 binding motif present
within the hgl5 promoter. Increasing concentrations (10×
and 60×) of unlabeled hgl5-URE3, hgl5-MUT, or a
nonspecific oligonucleotide (Olig-1) were added as competitors to the
binding reactions as indicated. Competition with unlabeled self was
demonstrated at a 10-fold excess of radiolabeled oligonucleotide (Fig.
5, lane 3). The URE3-mutated oligonucleotides, in which the
sequence TTAGAATTC replaced the URE3 motif TTATCTTAT, competed less
well and had to be added at higher concentrations to interfere with the
formation of the specific protein complex (lane 6). The
amount of DNA-protein complex formed was dependent on the concentration
of recombinant URE3-BP added to the assay (data not shown). The
addition of an irrelevant oligonucleotide control (Olig-1) (Fig. 5,
lanes 7 and 8) did not affect the
formation of the DNA-protein complex. Control extracts identically
prepared from bacteria transformed with either pRSET-Eh1 (an irrelevant
pRSETA-E. histolytica cDNA construct) or vector alone
had no gel shift ability (data not shown). The results from these
experiments indicated that URE3-BP exhibited sequence-specific binding
to the URE3 DNA motif.

View larger version (68K):
[in this window]
[in a new window]
|
Fig. 5.
Electrophoretic mobility shift assay of the
recombinant His6-URE3-BP protein. Electrophoretic
mobility shift assays were performed with radioactively labeled
hgl5-URE3 double-stranded DNA. The lane with probe alone is
indicated; all other reactions included 1 µg of purified
His6-URE3-BP protein. Increasing concentrations (10× and
60×) of unlabeled hgl5-URE3, hgl5-MUT, or a
nonspecific oligonucleotide (Olig-1) were added as competitors to the
binding reactions as indicated. The image was generated with the
PhosphorImager (Molecular Dynamics model 425) in conjunction with the
Adobe PhotoShop software program.
|
|
Since analysis of the URE3-BP protein had revealed the presence of two
EF-hand domains (Fig. 2), we next examined the effect of
Ca2+ on the ability of URE3-BP to form DNA-protein
complexes. Electrophoretic mobility shift analysis performed in buffer
containing 50 mM NaCl, 3 mM MgCl2,
and 1 mM EDTA showed that the addition of Ca2+
markedly decreased the formation of the recombinant DNA-protein complex (Fig. 6).

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 6.
Effect of Ca2+ on URE3-BP
protein-DNA complex formation. Electrophoretic mobility shift
assays were performed with radioactively labeled hgl5-URE3
double-stranded DNA. All lanes included 1 µg of purified
His6-URE3-BP protein in the absence (left
lane) or presence of increasing (0.05, 0.5, and 5 mM) concentrations of CaCl2. The image was
generated with a PhosphorImager (Molecular Dynamics model 425) in
conjunction with the Adobe PhotoShop software program.
|
|
URE3-BP Is a Component of the URE3 Binding Activity Present in E. histolytica Nuclear Extracts--
To determine whether URE3-BP was a
component of the gel shift complex of URE3 DNA with native E. histolytica nuclear protein(s), antibodies raised against URE3-BP
were incubated with the hgl5-URE3 DNA-E.
histolytica nuclear extract complex. An antibody binding to the
transcription factor may form a larger antibody-protein-DNA complex and
hence a more highly retarded "supershift" in the EMSA, or it may
prevent or destabilize the DNA/protein interaction, resulting in an
inhibition EMSA. The addition of increasing concentrations (0.25 and 1 µl) of antiserum from mice immunized with URE3-BP but not with
nonimmune serum interfered with the formation of URE3-DNA-E. histolytica nuclear protein complexes (Fig.
7). (For these gel shifts, dithiothreitol
was excluded from the gel shift buffer, so as not to reduce and
denature the antibodies. This resulted in two DNA-protein
complexes on EMSA as opposed to the single complex seen in previous
work (3).

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 7.
Effect of anti-URE3-BP antibodies on binding
of native E. histolytica nuclear proteins to URE3
DNA. Electrophoretic mobility shift assays were performed with
radioactively labeled hgl5-URE3 double-stranded DNA.
All reactions included 2 µg of E. histolytica
nuclear extract. Nonimmune serum (1 µl) was added to the reaction run
in the first lane, unlabeled hgl5-URE3
(10×) was added to the second lane, and increasing
concentrations (0.25 and 1 µl) of serum from mice immunized with
URE3-BP were added to reactions run in the third and
fourth lanes, as indicated. See Table I for the
hgl5-URE3 oligonucleotide sequence. The image was generated
with the PhosphorImager (Molecular Dynamics model 425) in conjunction
with the Adobe PhotoShop software program.
|
|
 |
DISCUSSION |
The main conclusion of this paper is that URE3-BP, an E. histolytica protein, binds specifically to the TATTCTATT (URE3)
DNA motif. This sequence is important in the regulation of at least two
E. histolytica genes, the hgl5 encoding the heavy
subunit of the Gal/GalNAc-inhibitable lectin (2) and the fdx
gene encoding ferredoxin (3). We have tested and validated the use of a
genetic approach to identify the E. histolytica proteins
that bind to a target sequence. We have also confirmed that URE3-BP is
present in the trophozoite nucleus, and therefore its sequence-specific DNA binding activity is of biological significance.
Proof that URE3-BP bound to the URE3 sequence was determined by 1) the
ability of the Gal4-URE3-BP fusion protein to reconfer the selectable
phenotype (growth on 3-AT-containing media in the yeast bait strain);
2) the ability of recombinant URE3-BP to bind to URE3 DNA in
vitro in electrophoretic mobility shift assays; and 3) the ability
of antibodies raised against URE3-BP to block the electrophoretic
mobility shift of native protein. Recent examples of antibody-inhibited
DNA-protein complex formation include the effect of anti-GABP
antibodies (25), anti-YY antibodies (26) and anti-dioxin receptor
antibodies (27) on their respective DNA-protein complexes. The URE3-BP
antibody interference result is therefore consistent with URE3-BP being
the major nuclear protein recognizing URE3.
The amino acid sequence deduced for URE3-BP has little similarity to
other known DNA-binding proteins. It has potential phosphorylation sites that may be important in its function. The EF-hand protein motifs
that occur in URE3-BP are present in the calcium-binding human
transcription factor, downstream regulatory element antagonist modulator (DREAM) (28). DREAM, like URE3-BP, is a DNA-binding protein that does not contain an easily recognized consensus DNA binding motif. There are, however, no other significant regions of
similarity between the two proteins that might suggest the location of
a new DNA binding motif in EF-hand-containing proteins.
Fluxes in the amount of intracellular ions are important signals and
determinants of gene expression in later branching eukaryotes. DNA
binding of the DREAM transcription factor is blocked by calcium. Calcium also decreased the affinity of recombinant URE3-BP for DNA as
measured by EMSA. Relatively high concentrations of Ca2+
were required to block the binding of DNA by URE3-BP in comparison with
DREAM (100-500 µM versus 5-10
µM). Electrophoretic mobility shift analysis of native
nuclear extracts showed that ~500 µM Ca2+
was also required to block binding of the nuclear protein to URE3 DNA
(data not shown), consistent with the recombinant His-tagged URE3-BP
protein behaving in a manner similar to the nuclear URE3 binding
complex. Calcium fluxes have been observed in E. histolytica (29) and therefore could regulate URE3-BP possibly via direct binding
to the EF-hand motifs or, as in later branching eukaryotes, by
calcium-dependent phosphorylation of the URE3-BP protein
(30, 31).
The in situ localization of URE3-BP indicated that this
protein was located not only in the nucleus and cytoplasm but also associated with the trophozoite membrane (indicated by the
colocalization of the lectin and URE3-BP staining (Fig.
4D)). The presence of URE3-BP in the cytoplasm and cell
membrane may enable it to act as an intracellular messenger and
transcription factor. Examples of transcription factors with this dual
function include the estrogen receptor transcription factor ERF,
membrane-associated transcription factor K (32),
and the sterol regulatory element-binding protein (33). Cytoplasm to
nuclear translocation of transcription factors can be regulated by
several different mechanisms, such as proteolytic processing
( K and sterol regulatory element-binding protein (32,
33)), phosphorylation or dephosphorylation (NF-AT4 (34)), and
association with cofactors (NF- B (35)). Because transcriptional
activation mediated through the URE3 DNA motif in the fdx
promoter is modulated by serum deprivation (3), it is possible that the
activity of the URE3-BP may be controlled by environmental and
intracellular factors. It is tempting to speculate that URE3-BP
activity may be regulated in part by its location within the cell. The
elucidation of URE3-BP regulation promises to provide some of the first
insights into the transcriptional regulation of virulence in this early branching eukaryote.
 |
ACKNOWLEDGEMENTS |
We are grateful for the help of Lauren
Lockhart and Gina Wimer in the preparation of immune
serum and Sharon Lee and Emily DeGuzman for mRNA
preparation. We thank members of Dr. Michael Christman's laboratory
and Drs. Michael Smith, Joel Hockensmith, Michael Kinter, Nicholas E. Sherman, and Jim Musoko for advice and helpful discussions.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant AI 37941.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF291721.
A Burroughs Wellcome Fund Scholar in Molecular Parasitology.
To whom correspondence should be addressed: W. A. Petri, Jr., Univeristy of Virginia Health System, MR4 Bldg., Rm. 2115, P.O. Box
801340, Charlottesville, VA 22908-1340. Tel.: 804-924-5621; Fax:
804-924-0075; E-mail: wap3g@virginia.edu.
Published, JBC Papers in Press, January 18, 2001, DOI 10.1074/jbc.M007375200
2
C. A. Gilchrist, U. Singh, and W. A. Petri, Jr., unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
URE, upstream
regulatory element;
URE3-BP, URE3-binding protein;
EMSA, electrophoretic mobility shift assay(s);
3-AT, 3-aminotriazole;
GST, glutathione S-transferase;
TEV, tobacco etch virus;
DREAM, downstream regulatory element antagonist modulator.
 |
REFERENCES |
| 1.
|
Petri, W. A., Jr.,
Vines, R. R.,
Lyerly, D.,
and Haque, R.
(2000)
Parasitol. Today
16,
320-321
|
| 2.
|
Purdy, J. E.,
Pho, L. T.,
Mann, B. J.,
and Petri, W. A., Jr.
(1996)
Mol. Biochem. Parasitol.
78,
91-103
|
| 3.
|
Gilchrist, C. A.,
Mann, B. J.,
and Petri, W. A., Jr.
(1998)
Infect. Immun.
66,
2383-2386
|
| 4.
|
Singh, U.,
Rogers, J. B.,
Mann, B. J.,
and Petri, W. A., Jr.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
8812-8817
|
| 5.
|
Singh, U.,
and Rogers, J. B.
(1998)
J. Biol. Chem.
273,
21663-21668
|
| 6.
|
Diamond, L. S.,
Harlow, D. R.,
and Cunnick, C.
(1978)
Trans. R. Soc. Trop. Med. Hyg.
72,
431-432
|
| 7.
|
Wang, M. M.,
and Reed, R. R.
(1993)
Nature
364,
121-126
|
| 8.
| Agatep, R., Kirkpatrick, R. D., Parchaliuk, D. L., Woods,
R. A., and Gietz, R. D. (1998) Technical Tips
Online, http://tto.trends.com
|
| 9.
|
Hoffman, C. S.,
and Winston, F.
(1987)
Gene (Amst.)
57,
267-272
|
| 10.
|
Seidman, C. E.,
Struhl, K.,
Sheen, J.,
and Jessen, T.
(1997)
in
Current Protocols in Molecular Biology
(Ausubel, F. M.
, Brent, R.
, Kingston, R. E.
, Moore, D. D.
, Seidman, J. G.
, Smith, J. A.
, Strhl, K.
, Albright, L. M.
, Coen, D. M.
, and Varki, A., eds)
, pp. 1.8.1-1.8.10, John Wiley & Sons, Inc., New York
|
| 11.
|
Sheffield, P. J.,
Derewenda, U.,
Taylor, J.,
Parsons, T. J.,
and Derewenda, Z. S.
(1999)
Acta Crystallogr.
55,
356-359
|
| 12.
|
Brown, T.,
and Mackey, K.
(1997)
in
Current Protocols in Molecular Biology
(Ausubel, F. M.
, Brent, R.
, Kingston, R. E.
, Moore, D. D.
, Seidman, J. G.
, Smith, J. A.
, Strhl, K.
, Albright, L. M.
, Coen, D. M.
, and Varki, A., eds)
, pp. 4.9.1-4.9.13, John Wiley & Sons, Inc., New York
|
| 13.
|
Voigt, H.,
Olivo, J. C.,
Sansonetti, P.,
and Guillen, N.
(1999)
J. Cell Sci.
112,
1191-1201
|
| 14.
|
Vines, R. R.,
Ramakrishnan, G.,
Rogers, J. B.,
Lockhart, L. A.,
Mann, B. J.,
and Petri, W. A., Jr.
(1998)
Mol. Biol. Cell
9,
2069-2079
|
| 15.
|
Appel, R. D.,
Bairoch, A.,
and Hochstrasser, D. F.
(1994)
Trends Biochem. Sci.
19,
258-260
|
| 16.
|
Altschul, S. F.,
Gish, W.,
Miller, W.,
Myers, E. W.,
and Lipman, D. J.
(1990)
J. Mol. Biol.
215,
403-410
|
| 17.
|
Tanaka, T.,
Tanaka, M.,
and Mitsui, Y.
(1997)
Biochem. Biophys. Res. Commun.
236,
611-615
|
| 18.
|
Kawasaki, H.,
and Kretsinger, R. H.
(1995)
Protein Profile
2,
297-490
|
| 19.
|
Patschinsky, T.,
Hunter, T.,
Esch, F. S.,
Cooper, J. A.,
and Sefton, B. M.
(1982)
Proc. Natl. Acad. Sci. U. S. A.
79,
973-977
|
| 20.
|
Cooper, J. A.,
Esch, F. S.,
Taylor, S. S.,
and Hunter, T.
(1984)
J. Biol. Chem.
259,
7835-7841
|
| 21.
|
Woodgett, J. R.,
Gould, K. L.,
and Hunter, T.
(1986)
Eur. J. Biochem.
161,
177-184
|
| 22.
|
Kishimoto, A.,
Nishiyama, K.,
Nakanishi, H.,
Uratsuji, Y.,
Nomura, H.,
Takeyama, Y.,
and Nishizuka, Y.
(1985)
J. Biol. Chem.
260,
12492-12499
|
| 23.
|
Pinna, L. A.
(1990)
Biochim. Biophys. Acta
1054,
267-284
|
| 24.
|
Bruchhaus, I.,
Leippe, M.,
Lioutas, C.,
and Tannich, E.
(1993)
DNA Cell Biol.
12,
925-933
|
| 25.
|
Li, X. R.,
Chong, A. S.-F.,
Wu, J.,
Roebuck, K. A.,
Kumar, A.,
Parrillo, J. E.,
Rapp, U. R.,
Kimberly, R. P.,
Williams, J. W.,
and Xu, X.
(1999)
J. Biol. Chem.
274,
35203-35210
|
| 26.
|
Bakalkin, G.,
Yakovleva, T.,
and Terenius, L.
(1997)
Biochem. Biophys. Res. Commun.
231,
135-139
|
| 27.
|
Mason, G. G.,
Witte, A. M.,
Whitelaw, M. L.,
Antonsson, C.,
McGuire, J.,
Wilhelmsson, A.,
Poellinger, L.,
and Gustafsson, J. A.
(1994)
J. Biol. Chem.
269,
4438-44349
|
| 28.
|
Carrion, A. M.,
Link, W. A.,
Ledo, F.,
Mellstrom, B.,
and Naranjo, J. R.
(1999)
Nature
398,
80-84
|
| 29.
|
Carbajal, M. E.,
Manning-Cela, R.,
Pina, A.,
Franco, E.,
and Meza, I.
(1996)
Exp. Parasitol.
82,
11-20
|
| 30.
|
Mao, Z.,
and Wiedmann, M.
(1999)
J. Biol. Chem.
274,
31102-31107
|
| 31.
|
Cowley, D. O.,
and Graves, B. J.
(2000)
Genes Dev.
14,
366-376
|
| 32.
|
Stragier, P.,
and Losick, R.
(1996)
Annu. Rev. Genet.
30,
297-241
|
| 33.
|
Brown, M. S.,
and Goldstein, J. L.
(1997)
Cell
89,
331-340
|
| 34.
|
Zhu, J.,
Shibasaki, F.,
Price, R.,
Guillemot, J. C.,
Yano, T.,
Dotsch, V.,
Wagner, G.,
Ferrara, P.,
and McKeon, F.
(1998)
Cell
93,
851-861
|
| 35.
|
Huang, T. T.,
Kudo, N.,
Yoshida, M.,
and Miyamoto, S.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
1014-1019
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. Kushwaha, A. Singh, and S. Chattopadhyay
Calmodulin7 Plays an Important Role as Transcriptional Regulator in Arabidopsis Seedling Development
PLANT CELL,
July 1, 2008;
20(7):
1747 - 1759.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Hackney, G. M. Ehrenkaufer, and U. Singh
Identification of putative transcriptional regulatory networks in Entamoeba histolytica using Bayesian inference
Nucleic Acids Res.,
April 1, 2007;
35(7):
2141 - 2152.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Chakrabarty, D. K. Sethi, N. Padhan, K. J. Kaur, D. M. Salunke, S. Bhattacharya, and A. Bhattacharya
Identification and Characterization of EhCaBP2: A SECOND MEMBER OF THE CALCIUM-BINDING PROTEIN FAMILY OF THE PROTOZOAN PARASITE ENTAMOEBA HISTOLYTICA
J. Biol. Chem.,
March 26, 2004;
279(13):
12898 - 12908.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Gilchrist, M. Leo, C. G. Line, B. J. Mann, and W. A. Petri Jr.
Calcium Modulates Promoter Occupancy by the Entamoeba histolytica Ca2+-binding Transcription Factor URE3-BP
J. Biol. Chem.,
February 7, 2003;
278(7):
4646 - 4653.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Aubry, S. Mattei, B. Blot, R. Sadoul, M. Satre, and G. Klein
Biochemical Characterization of Two Analogues of the Apoptosis-linked Gene 2 Protein in Dictyostelium discoideum and Interaction with a Physiological Partner in Mammals, Murine Alix
J. Biol. Chem.,
June 7, 2002;
277(24):
21947 - 21954.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|