![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 15, 12113-12119, April 13, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Pharmacology and Molecular Toxicology, University of Massachusetts Medical School, Worcester, Massachusetts 01655
Received for publication, August 30, 2000, and in revised form, November 30, 2000
| |
ABSTRACT |
|---|
|
|
|---|
Site-directed mutagenesis was performed on
several areas of MutH based on the similarity of MutH and
PvuII structural models. The aims were to identify
DNA-binding residues; to determine whether MutH has the same mechanism
for DNA binding and catalysis as PvuII; and to localize the
residues responsible for MutH stimulation by MutL. No DNA-binding
residues were identified in the two flexible loop regions of MutH,
although similar loops in PvuII are involved in DNA
binding. Two histidines in MutH are in a similar position as two
histidines (His-84 and His-85) in PvuII that signal
for DNA binding and catalysis. These MutH histidines (His-112 and His-115) were changed to alanines, but the mutant proteins had wild-type activity both in vivo and in vitro.
The results indicate that the MutH signal for DNA binding and catalysis
remains unknown. Instead, a lysine residue (Lys-48) was found in the
first flexible loop that functions in catalysis together with the three
presumed catalytic amino acids (Asp-70, Glu-77, and Lys-79). Two
deletion mutations (MutH MutH is the endonuclease in the methyl-directed mismatch repair
system (1), which, along with MutS and MutL (and bound ATP), initiates
the repair process (2). MutS binds specifically to mismatched bases or
deletion/insertion loops of one to four nucleotides (3-5). MutL
appears to be a helper protein; it interacts with other proteins to
increase their DNA binding or converts them to the active form (6).
MutL appears to activate MutH for DNA binding and cutting the
unmethylated strand of hemimethylated DNA based on endonuclease assays
(7, 8). In Escherichia coli, mismatch repair takes place
shortly after replication before the DNA becomes fully methylated (the
newly synthesized daughter strand is unmethylated). MutH in the ternary
complex binds to a hemimethylated d(GATC) site, recognizes the
asymmetry of the unmethylated N6 position of the d(A) (9, 10), and
cleaves 5' to the d(G) in the unmethylated strand leaving
ligatable ends. If both strands are unmethylated, MutH is able
to cleave both sites independently (dissociating after the first
d(GATC) cut, with a second binding and cleavage event) leaving a
four-base overhang (2). Although MutS is thought to bind heteroduplex DNA first, followed by MutL and MutH, it is unclear what the binding order is for these proteins. It is also unclear in the ternary complex
whether MutH acts as a monomer or (like restriction endonucleases) as a
dimer. The purified protein with a calculated molecular mass of
25.5 kDa is a monomer in solution.
Recently, the structure of the MutH protein was solved (11). It was
described as resembling a clamp with a large cleft dividing the protein
into two subdomains. From the three structures analyzed, it was shown
that the two subdomains adopt multiple conformations that correlate
with movement in the C-terminal end of the protein. This suggests that
the C-terminal-exposed helix is a possible site through which MutL
stimulation occurs. It was postulated that DNA lies in the bottom of
the cleft in close proximity to residues Asp-70, Glu-77, and Lys-79,
which would constitute the active site for catalysis. The catalytic
sequence of D(X)6-30(E/D)XK was
proposed for MutH based on the close resemblance to the structure of
the restriction endonuclease PvuII (with a root mean square deviation of 2.3 over 83 pairs of C Strains, Plasmids, and Media--
KM54
(
Plasmid pMQ402 is a pBAD18 (17) derivative containing the
mutH gene with an N-terminal polyhistidine sequence from the
plasmid TX417 (18). The ~1-kb mutH fragment was obtained
by digestion of pTX417 with the restriction enzymes XbaI and
HindIII. The fragment also contains several hundred base
pairs of chromosomal DNA distal to the mutH gene. pTX417 was
kindly provided by M. Winkler (University of Texas Medical School,
Houston TX). Plasmid pMQ393 contains the wild-type His-tagged
mutL gene in a pACYC184 backbone (6).
The Luria-Bertani (LB) medium was made with 10 g of tryptone,
5 g of yeast extract, 5 g of NaCl, and 1 ml of 1 M sodium hydroxide per liter of water. The YT medium and
TAE buffer were made according to Sambrook et al. (19).
Ampicillin (Amp), chloramphenicol (Cam), and rifampicin (Rif) were
added to media at 100, 30, and 100 µg/ml, respectively.
Site-directed Mutagenesis--
Two-stage PCR-mediated
mutagenesis was carried out essentially as described by Murphy (14).
After each PCR reaction, the products were electrophoresed on a 1%
agarose gel and purified using the QIAquick gel extraction kit
(Qiagen). The full-length product was cut with BglII and
HindIII for 1 h at 37 °C and electrophoresed on a
1% agarose gel and purified before ligation to the similarly cut
pMQ402 backbone. The ligation was carried out overnight at 14 °C,
and the mixture was transformed into CC106 (14) for recovery. Transformant colonies were streaked out several times, and a single colony was inoculated in L ampicillin broth for overnight growth. Plasmid DNA was isolated using QIAprep Spin Miniprep (Qiagen) and
sequenced to identify the mutations. When secondary mutations were
present, the sequence containing the correct mutation was removed by
restriction enzyme digestion and religated to a similarly cut pMQ402
backbone. The mutH gene of the resulting plasmid was then
sequenced to confirm the mutational change. The two outside flanking
primers for PCR and sequencing were MM247 (5'-CATCACAGCAGCGGCCTGG-3') (Operon Technologies) for the forward reactions and MM248
(5'-CAGACCGCTTCTGCG-3') (Operon Technologies) for the reverse reactions.
Amber stop codons were placed into the mutH sequence at
codons 215 and 225 using the Sculpture mutagenesis kit (Amersham
Pharmacia Biotech). In addition, the plasmid containing the 215 mutation also incorporated an A to C change within codon 213, changing the amino acid at this position from leucine to valine. The MutH DNA Sequencing--
All DNA sequencing was carried out by the
DNA Sequencing Facility at Iowa State University. Both strands of
wild-type MutH and the promoter region were sequenced. We used the
mutH sequence in GenBankTM, accession number U16361. The
site-directed PCR mutants were identified by sequencing with the
outside flanking primers used in the PCR reactions. Both strands and
the promoter region of all mutant plasmids were sequenced.
Preparation of Histidine-tagged MutH--
The wild-type and all
mutant proteins were purified in the same manner. For each strain, a
20-ml LB-Amp culture was grown overnight from a single colony. One
liter of LB-Amp medium was inoculated with the 20-ml overnight culture
and allowed to grow with shaking at 37 °C to an
A600 of 1.0. Arabinose (Difco) was added to a
final concentration of 0.2%, and the culture was induced for 2 h
at 37 °C. Cells were harvested by centrifugation for 20 min at 5000 rpm, washed with water, and stored frozen ( Preparation of Histidine-tagged MutL--
The His-tagged MutL
protein was purified as described previously (6), except that the
transformation mixture of GM5862 with pMQ393 was incubated for 90 min after heat shock and then added to 50 ml of YT-Cam medium for
overnight incubation at 37 °C. The step fractions used for elution
from the Sepharose column were one 100 mM, two 150 mM, and one 400 mM Imidazole (10 ml each). The
400 mM fraction contained the MutL protein, which was
dialyzed against two changes of 20 mM Hepes (pH 7.4), 300 mM NaCl, and 0.1 mM EDTA. The concentration of
MutL was determined by measuring the A280 (1 A = 1.24 mg/ml). The protein was at least 90% pure as
determined by a Coomassie Brilliant Blue-stained SDS-PAGE gel. Native
MutL was graciously provided by Dr. Paul Modrich and Dr. Claudia
Spampinato (Duke University).
In Vivo Screen--
The in vivo screen is based on
the mutator phenotype, which occurs when the cells lack one or more of
the Mut proteins (21). The bacteria accumulate mutations at a greater
frequency than wild-type, and this can be monitored by selection on
plates with rifampicin. The vector plasmid (pBAD18) and the wild-type
MutH plasmid (pMQ402) were transformed into strains GM4244 and GM7586 and used as controls. The mutant plasmids were transformed into GM7586
for complementation testing and GM4244 for dominant-negative screening.
A single colony was inoculated into 1 ml of L-Amp broth, grown
overnight at 37 °C, diluted 10 Endonuclease Assay--
Bacteriophage MR1 is a derivative of
phage f1R229 that contains only one d(GATC) site (22). The covalently
closed replicative form (RF) of this phage was purified as previously
described from chloramphenicol-treated infected GM2807
(dam-16::Kan) cells (9). The MR1 phage was
provided by Dr. R. Lahue (University of Nebraska). Enzyme activity
(amounts are indicated in the figures) was tested at 37 °C in a
10-µl reaction containing 20 mM Tris·HCl (pH 7.7), 5 mM MgCl2, and 25 fmol of MR1 for 1 h. MutL
and ATP were added at 71 pmol and 1.25 mM, respectively, in
the MutH endonuclease stimulation assays. The assays were carried out
with native MutL or His-tagged MutL. The reaction was stopped with 5 µl of a 50% glycerol solution containing 50 mM EDTA, 1%
SDS, 0.05% bromphenol blue, and 0.05% Xylene Cyanol. The reactions
were electrophoresed on a 1% agarose gel at 5 V/cm for 3 h. The
gels were stained with Vistra Green (Amersham Pharmacia Biotech)
following the manufacturer's instructions (1:10,000 dilution) for
1 h with shaking. The gels were then scanned on a PhosphorImager
(Storm, Molecular Dynamics), and the amount of nicking was quantitated
using the ImageQuaNT (Molecular Dynamics) software. Any nicked
substrate detected in the negative control was subtracted from the
amount seen with the proteins added.
Preparation of Labeled Homoduplex--
A 36-base pair (bp) DNA
oligonucleotide, MM40,
5'-GCATACGGAAGTTAAAGTGCGGATCATCTCTAGCCA-3'
(Operon Technologies) containing a single, centrally located
d(GATC) site, was labeled using T4 polynucleotide kinase (PNK) (New
England BioLabs). A concentration, 2 µM, of the
oligonucleotide was used in a 12-µl reaction with 1.2 µl of PNK
buffer, 1 µl of PNK enzyme, 1 µl of [ Band Shift Assay--
MutH binding to DNA was assayed using the
labeled homoduplex prepared as described previously (4). In a 5-µl
reaction volume, there was 22.5 fmol of the labeled homoduplex (1 µl
of the 5× reaction mixture) and MutH, which was added in varying
concentrations (water makes up the remainder of the reaction volume).
MutL and ATP were added at 9 pmol and 1.25 mM,
respectively, in the stimulation assays. The mixture was incubated for
30 min on ice, followed by the addition of 1.6 µl of a 50% sucrose
solution and loaded on a prerun (10 min) 6% native polyacrylamide gel
in TAE buffer (pH 7.5) and electrophoresed at 50 mA for 2.5 h. The
gel was then laid on a PhosphorImager screen overnight for scanning on
the Storm Imager (Molecular Dynamics). The free DNA and shifted
band intensities were quantitated to determine binding ability using ImageQuaNT software. Apparent dissociation constants
(Kd) were determined by fitting the quantitated
experimental data to the equation 1/r = 1 + Kd /[C]total
(f = 1-r, where f is the
degree of dissociation) with the program KaleidaGraph (Synergy
Software). The degree of binding or association is r and
[C]total is the protein concentration in the reaction.
Construction of the Mutant Plasmids--
After a comparison of the
MutH and PvuII structural models, areas in MutH were found
that resembled functional areas of PvuII (Fig.
1). There were three areas targeted for
mutagenesis in MutH. The first area was the flexible loop between the
second and third
Based on the MutH crystal structure, it was suggested that the
C-terminal tail region is contacted by MutL to stimulate the MutH
endonuclease activity (7, 11). To test this possibility, two deletion
mutants were made with the creation of amber stop codons.
MutH In Vivo Screening of the Mutant Plasmids--
After checking that
there were no secondary mutations in each of the mutant MutH plasmids,
they were transformed into strains GM4244 (wild-type) and GM7586
(
The mutant MutH plasmids in GM4244 were tested for a dominant-negative
phenotype (mutator phenotype in a wild-type strain) by the same method
as the in vivo screen described under "Experimental Procedures." None of the mutant plasmids gave a dominant-negative phenotype (data not shown).
For the complementation testing in strain GM7586, the controls (GM7586
versus pMQ402 in GM7586) show that the wild-type MutH protein causes a 200-fold reduction in the frequency to rifampicin resistance, indicating efficient complementation of the chromosomal
The steady-state level of MutH produced by wild-type and mutant
constructs was determined by Western blotting (New England BioLabs).
All of the mutant plasmids produced comparable amounts of MutH to the
wild-type plasmid in strain GM3856 (data not shown).
Endonuclease Assay--
This assay tests for the endonuclease
function of the MutH protein. The product of the reaction is a nick in
the MR1 covalently closed circular molecule, which has only one d(GATC)
site. In the absence of MutL, increasing amounts of the wild-type MutH protein were added to the duplex until complete nicking was achieved (Fig. 2A and Fig.
3A). The addition of 2.5-3.0
pmol of wild-type protein resulted in complete nicking of the
substrate. The results of the endonuclease assay for the remaining
three mutants (K48A, G49A, and
In the presence of MutL and ATP, 1000-fold less MutH is needed to
achieve the same results as without MutL (Figs. 2B and
3B). The cleavage of mutants K48A and G49A are shown below
the wild-type in Fig. 2B. Although G49A is partially
stimulated by MutL (it is increased 10-fold from the unstimulated
activity), its activity is reduced about 200-fold compared with the
stimulated wild-type protein (Fig. 3B). K48A shows the most
dramatic increase in MutL-stimulated nicking and is reduced only 3-fold
relative to the wild-type protein (Fig. 3C). MutL is unable
to increase the activity of the G49A mutant as much as that for K48A.
There was no MutL stimulation seen for Band Shift Assay--
In this assay the specific binding of the
MutH protein to DNA is tested. The substrate is a linear 36-mer duplex
of DNA with one d(GATC) site. The MutH binding is specific, because it
is not seen with the same linear substrate that has a d(GGTC) site in
place of the d(GATC) site (data not shown). Without MutL, the wild-type
protein gives a complete band shift with the appearance of a transient
band between the free DNA and bound DNA (Fig.
4A). Both mutant proteins,
K48A and G49A, gave results similar to the wild-type (data not shown).
The
The band shift assay for MutH in the presence of MutL was complicated,
because MutL shows nonspecific DNA binding at concentrations above 9 pmol to approximately the same position in the gel as the MutH band.
The amount of MutL, therefore, was lowered until it no longer shifted
the DNA substrate. The assay with MutL and wild-type MutH caused the
band shift to start a little sooner (compare at 38 pmol), but it
finished at the same concentration as without MutL (Fig.
4B). The K48A mutant was like wild-type and the G49A
mutant bound a little tighter than wild-type. The
From these experiments, the apparent dissociation constants
(Kd) for the proteins and the substrate were
calculated (Fig. 5). The binding affinity
for the wild-type MutH protein increased at least 16-fold when the MutL
protein was present (Fig. 5B). K48A was as proficient as the
wild-type protein in binding ability, but the activity in the
endonuclease assay was reduced, so it has a catalytic defect that MutL
is able to overcome. G49A bound 2- to 4-fold tighter than wild-type,
which may or may not be a significant contribution to the overall
ability of the protein to function. Because Methyl-directed mismatch repair is initiated by a mismatch
in the DNA followed by formation of a ternary complex containing the
MutS (with bound ATP), MutL, and MutH proteins. A defect in the ability
to function correctly of any one of these three proteins causes a
mutator phenotype. In this paper, that phenotype was used as a screen
to identify defective MutH proteins after site-directed mutagenesis.
The in vivo results indicated that only three of the
site-directed mutations, K48A, G49A, and The qualitative results between the biochemical and in vivo
assays agree fairly well. Mutant Although the stimulation of MutH activity by MutL has been shown at the
endonuclease level (7), the ability of MutL to stimulate the DNA
binding ability of MutH has not been demonstrated. The amount of MutL
(9 pmol) in the band shift assay appears to be adequate for binding all
of the MutH (0.1 pmol) monomers present. Yet the amounts of MutH needed
to achieve a full band shift remain the same (Fig. 4). One conclusion
from the data is that the MutL contribution to MutH DNA binding is
marginal. The differences in the Kd values (Table
II) were about 16-fold. This is significant, but it adds very little
compared with the 1000-fold difference MutL makes in catalysis. MutL's
presence makes it a little easier for MutH to start binding to the DNA,
but overall binding isn't affected that much.
The mutational changes made in MutH were based upon a comparison with
the PvuII enzyme where detailed structure-function data are
available. Mutational analysis of the amino acids in the flexible arms
would show whether or not MutH has any functional similarity to
PvuII (Fig. 1). In PvuII there are a few residues
present that are involved in DNA binding or the recognition of the
binding site, such as an aspartate (Asp-34) that would be comparable to Asp-47 in MutH (23). No one residue in the flexible arms of MutH was
found to make an important base recognition DNA contact so that, when
it is disrupted, a mutator phenotype results. Minor contacts in the DNA
such as phosphate binding residues may not result in a mutator
phenotype and therefore may not be seen through this in vivo
screen. The amino acids chosen for this study are shown in the
structure of MutH (Fig. 6).
224 and MutH
214) in the C-terminal end of
the protein, localized the MutL stimulation region to five amino acids (Ala-220, Leu-221, Leu-222, Ala-223, and Arg-224).
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
atoms) (11). Both enzymes share
a common core motif with a number of other restriction enzymes (BamHI, EcoRV, and EcoRI) (12, 13).
These restriction enzymes are grouped according to their similarity in
structure as well as function (PvuII and EcoRV
are in one group and BamHI and EcoRI are in
another). It was surprising that MutH is closer in structure to
PvuII than BamHI, because PvuII
approaches DNA from the minor groove and makes contacts in the major
groove by reaching around the DNA with flexible loops to produce blunt
ends. BamHI, however, approaches DNA from the major groove
where the base-specific contacts are made to produce cuts with a
four-base overhang. In addition, BamHI has a recognition
site with d(GATC) as the central bases and cuts 5' to the d(G). There
is no structure available of MutH complexed with its cognate DNA, so it
is not known from which direction MutH approaches the DNA and whether
it acts as a monomer or dimer in the repair complex. Given the close
similarity in structure between MutH and PvuII, we altered
amino acids in MutH based on the corresponding functional regions of
PvuII.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
mutH461::Cam) was constructed by
electroporation of strain KM22 (
(recC ptr recB
recD)::Plac red Kan) (20) with a
recombinant PCR1 product as
described by Murphy et al. (14), using the following oligonucleotides: muthU2, ATCATCGAGCTCCACCAGCTGCAAGAGAAACCATTT; muthN2, TGCCGATCAACGTCTCATGCGGCCGCTTGGGACATGTCATGATACCTTGA; muthC2, AATGGCAGAAATTCGAAAGCGGCCGCT TTTCTGATCCAGTAGCCATCGCTTT; muthD2, TCATCAGCATGCCCGAAGGATGGCGTTCGACAAAAT. GM7586 was generated by P1
transduction of GM4244 (CC106 (15)) with a lysate grown on KM54 and
selecting for chloram phenicol resistance. Isogenic strains GM4244
and GM7586 (GM4244
mutH461::Cam) were used for
the in vivo screen. Strain GM3856 (hsdR17 endA1 thi-1
spoT1 rfbO1 supE44 mutH471::Tn5) was also
used for the overexpression of wild-type MutH and the mutant proteins.
Strain GM5862 (16) was used for the overexpression of wild-type MutL.
224 mutant has the last 5 amino acids of the C terminus removed (HFLIQ) and
the MutH
214 mutant has the last 15 amino acids of the C terminus removed (KNFTSALLARHFLIQ).
80 °C). The pellet was
thawed and resuspended with 4 ml of reconstitution buffer (20 mM Hepes (pH 7.4), 300 mM NaCl, and 1 mM phenylmethylsulfonyl fluoride), and the cells were lysed
using a French pressure cell. The extract was then sonicated (20 pulses
from a Tekmar sonicator) and centrifuged for 30 min at 15,000 rpm to remove cell debris. The supernatant was applied to a 4-ml Fast
Flow Chelating Sepharose (Amersham Pharmacia Biotech) column charged
with 100 mM NiCl2 and equilibrated with the
reconstitution buffer. Step fractions of 100, 150, 250, and 400 mM imidazole (10 ml each) were used to elute the MutH
protein. The 250 mM fraction contained the MutH protein and
was dialyzed against two changes of 20 mM Hepes (pH 7.4),
300 mM NaCl, and 0.1 mM EDTA. The MutH
concentration was determined by measuring the
A280 (1 A = 0.67 mg/ml). MutH
was at least 95% pure as determined by a SDS-PAGE Coomassie Brilliant Blue-stained gel.
6, and 50 µl was
spread on L plates with and without ampicillin. The rifampicin plates
were spread with 200 µl of undiluted wild-type culture (GM4244), 100 µl of undiluted mutant culture (GM7586) and 50 µl of undiluted
mutH plasmid mutant cultures. Two cultures (from two
separate colonies) were grown for each test and each culture was plated
twice. The plates were incubated at 37 °C overnight, and colonies
were counted the next day. The L plates were used to monitor loss of
plasmids due to high cellular amounts of MutH. No arabinose was
included in the plates, because this leads to loss of viability. The
plasmid produces enough MutH protein to compliment the mutH
strain without adding arabinose to the plates.
-32P]ATP
(Amersham Pharmacia Biotech), and water to a final concentration of 0.5 µM oligonucleotide. The reaction was incubated for 1 h at 37 °C and then 10 min at 75 °C. 2 µM cold
complementary oligonucleotide (containing the N6-methyl adenine in the
d(GATC) site) was added with water to a final volume of 100 µl. This
was incubated for 5 min at 95 °C, 30 min at 37 °C, and 30 min at
room temperature. The unincorporated and single-strand DNA were removed
using a MicroSpin G-25 column (Amersham Pharmacia Biotech) and the
labeled homoduplex DNA resuspended in a final volume of 100 µl of
water. A 5× reaction mixture with 50 µl of the labeled homoduplex
and 50 µl of 10× AR buffer (200 mM Tris-HCl (pH 7.6), 50 mM MgCl2, 1 mM dithiothreitol, and
0.1 mM EDTA) was made for the band shift assay.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
helices (loop BC). The second was the C1 loop
between the third
helix and the first
sheet (where the
catalytic residues start). These areas target flexible loops of
PvuII that make contact with DNA backbone phosphates and
recognition bases (23, 24). MutH could make the same contacts if it
approaches DNA from the minor groove. Loop BC residues Pro-41 to Gly-49
and loop C1 residues Leu-59 to Gln-69 (except for Ala-61 and Ala-63) in
MutH were changed to alanines by site-directed mutagenesis. The third
area of PvuII contains conserved histidines (His-84 and
His-85) that signal binding of the DNA to allow catalysis to take place
and serve as protein-protein contacts (25). These histidines are also present in MutH (His-112 and His-115) and may serve as the same signal
for MutH. Histidine112 and histidine 115 were also changed to alanines
to test this possibility.

View larger version (46K):
[in a new window]
Fig. 1.
Comparison of MutH and PvuII
structures for the construction of MutH mutants. The ribbon
diagram of MutH was made from the B monomer with the
coordinates submitted by W. Yang (Protein Data Bank code 2AZO) using
MIDAS. The ribbon diagram of PvuII was made from
the B monomer with the coordinates submitted by X. Cheng (Protein Data
Bank code 1PVI) using MIDAS. Six N termini residues from the
PvuII monomer have been deleted for clarity. The
magenta-colored areas of each protein represent structurally
similar areas. The two loops and histidines highlighted in
green for each model show similar areas that were targeted for
mutagenesis in MutH (residues 41-49, residues 59-69, His-112, and
His-115).
214 and MutH
224 (the number of the last residue present in
the protein) were made to narrow down the area where MutL might
stimulate MutH activity.
mutH::Cam). The null mutation in
mutH was constructed, because the commonly used
mutH471::Tn5 mutation is not completely
defective in our
assays.2
mutH::Cam allele (Table
I). The vector plasmid (pBAD18) causes a
small reduction in the mutation frequency and doesn't interfere with
the complementation testing. No alterations in mutation frequency were
seen in GM4244 with the control plasmids (pBAD18 and pMQ402). Very few
of the MutH site-directed mutants showed a mutator phenotype. Plasmid
214-containing cells show a strong mutator phenotype along with
mutants K48A and G49A. These three were chosen for further biochemical
studies. A few others were also chosen to validate the screen and for
the following specific reasons. The D47A mutant was used because of the
Asp-34 analogous position in the PvuII structure that
recognizes the d(A) in the recognition sequence for PvuII
(23). The H115A and H112A mutants were used because of the signaling
properties of the PvuII histidines (His-84 and His-85)
described earlier. The
224 mutant was used to test the hypothesis
that the C-terminal end is where MutL stimulation of MutH activity
occurs.
In vivo complementation screen for mutant MutH proteins
214) are shown below the wild-type in
Fig. 2A. K48A has no detectable endonuclease activity and
G49A activity is decreased ~30-fold (Fig. 3A). D47A,
H112A, H115A, and
224 MutH proteins gave the same result as
wild-type and were not tested further (data not shown). These results
were in agreement with the in vivo screen, because the
mutation frequencies in cells with these proteins (D47A, H112A, and
H115A) were similar to the mutation frequency of the wild-type MutH
protein in strain GM7586
(
mutH::Cam). A circular dichroism
experiment was performed on the K48A mutant protein because of the lack
of activity without MutL present in the endonuclease assay. The results
showed that the K48A mutant protein was folded similarly to the
wild-type MutH protein (data not shown). A circular dichroism
experiment was also performed on the
214 mutant protein, because the
entire last helix had been removed and may have resulted in large
structural changes for the protein. The results showed that the
214
mutant protein was folded similarly to the wild-type MutH protein with
the curve exhibiting more of the expected
sheet-like properties due
to the loss of the large
helix in the protein (data not shown).

View larger version (55K):
[in a new window]
Fig. 2.
Endonuclease activity of the wild-type and
mutant MutH proteins. The endonuclease assays were performed as
described under "Experimental Procedures." Increasing amounts of
MutH (indicated at the top of each lane) were
incubated with the MR1 DNA substrate. The DNA products were separated
in a 1% agarose gel before staining and scanning for quantitation.
A, all reactions are without MutL and contained 25 fmol of
homoduplex DNA substrate. The 0 lane represents unreacted
homoduplex DNA substrate. +, control for mutants K48A and
214
containing 2.5 fmol of wild-type MutH protein in the reaction.
B, all reactions contain 71 pmol of MutL, 1.25 mM ATP, and 25 fmol of homoduplex DNA substrate. The
0 lane represents unreacted homoduplex DNA.
ccDNA is the closed circular substrate used in the
reaction.

View larger version (15K):
[in a new window]
Fig. 3.
Comparison of wild-type and mutant MutH
endonuclease activity. These graphs represent the quantitation of
the data from the endonuclease assays. A, this graph is the
activity of the wild-type and mutant MutH proteins without MutL
added. The wild-type MutH protein (
), the G49A mutant (
),
and the K48A mutant (
) are shown together. B, the
activity of the wild-type and G49A mutant MutH proteins with 9 pmol of
MutL added in the reaction. The wild-type MutH protein (
) and G49A
mutant (
) are shown. C, the activity of the wild-type and
K48A mutant MutH proteins with 9 pmol of MutL added in the reaction.
The wild-type MutH protein (
), and K48A mutant (
) are shown
together. D,
214 mutant. The
214 mutant with 9 pmol of
MutL added to the reaction (
) and the
214 mutant without MutL in
the reaction (
) are plotted. This shows the lack of stimulation by
MutL for this mutant. Each point on all graphs represents
the average of at least three independent measurements.
214 in this assay, and its
activity is decreased about 15-fold from the unstimulated wild-type
MutH protein (Fig. 3D). It would appear then to have a
15,000-fold decrease in activity compared with the stimulated MutH
protein. Because the reduction in endonuclease activity of the mutant
proteins could be due to decreased binding ability, binding assays
were done as described below.
214 mutant protein appeared to initiate a binding-like activity
but failed to achieve a final shifted position (Fig.
4A).

View larger version (52K):
[in a new window]
Fig. 4.
Binding abilities of the wild-type and mutant
MutH proteins. The binding ability of the wild-type and mutant
MutH proteins were measured by a band shift assay using a
32P-labeled oligonucleotide as described under
"Experimental Procedures." The DNA was incubated with increasing
amounts of the MutH protein (indicated above each lane) in
the reaction and separated by a 6% PAGE gel followed by scanning
(Storm) for quantitation. A, all reactions contain 22 fmol
of homoduplex DNA, 1.25 mM ATP, and do not contain MutL.
The 0 lanes are without MutH and represent 22 fmol of
unreacted homoduplex DNA. B, all reactions contain 22 fmol
of homoduplex DNA, 1.25 mM ATP and 9 pmol MutL (except the
+ lane). The L lanes do not contain MutH. The
+ control lane contains 135.0 pmol of MutH, 1.25 mM ATP, and 22 fmol of homoduplex DNA.
214 mutant was not
stimulated by MutL and gave the same result as without the added
protein (not shown).
214 did not achieve the
full band shift position, the apparent dissociation constant was not
calculated. Although MutL has an effect on MutH binding to the DNA
(about 16-fold), the greatest effect is on catalysis (1000-fold
stimulation). The apparent Kd values of the
wild-type and mutant proteins and their substrate are given in Table
II.

View larger version (11K):
[in a new window]
Fig. 5.
Dependence of complex formation on the
concentration of the MutH protein. The graphs were plotted
by fitting the experimental data from the band shift assay to the
equation described under "Experimental Procedures." This allows the
calculation of an apparent Kd. A, the
data plotted from the band shift assays without MutL present. The
wild-type protein (
) and the G49A mutant (
) are shown.
B, the data plotted from the band shift assay containing
MutL. The wild-type protein (
) and the G49A mutant (
) are shown.
r is the degree of binding and [C] the MutH
concentration in the reaction. Each point represents the
average of at least three independent measurements.
Apparent equilibrium dissociation constants for wild-type and
mutant MutH proteins
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
214, exhibited a mutant
phenotype in mutH E. coli. Subsequent biochemical assays confirm a defect in MutH activity in these mutant proteins. Four site-directed mutants having a wild-type mutation frequency to rifampicin resistance (D47A, H112A, H115A, and
224) displayed normal
MutH activity in vitro. These results indicate that the in vivo screen was sensitive enough to detect defective MutH
proteins. It takes very few copies of the protein (estimated at 34 monomers per cell) to achieve full repair activity (26). The copies of protein from the plasmid are probably much higher than those normally in the cell. Under these conditions an impaired protein might do much
better in the in vivo screen than in the in vitro
testing. Therefore an estimated 10-fold reduction in activity of MutH
would probably not have been detected.
214 had the highest mutation frequency of the mutants tested in the in vivo screen and
had the highest reduction in endonuclease activity in the presence of
MutL. Mutants G49A and K48A somewhat follow this pattern with G49A
having the lower mutation frequency and achieving complete nicking in
the endonuclease assay (with increased protein amounts).

View larger version (57K):
[in a new window]
Fig. 6.
Location of the mutated residues in the MutH
structure. The ribbon diagram of MutH was made from the
B monomer with the coordinates submitted by W. Yang (Protein Data Bank
code 2AZO) using MIDAS. The N and C termini are labeled. The residues
tested from the site-directed mutagenesis (Asp-47, Lys-48, Gly-49,
His-112, His-115) are displayed in red. Also, the last
residue remaining from each of the deletion mutants is shown in
red (Lys-214 and Arg-224).
The conserved histidines found in both PvuII (His-84 and His-85) and MutH (His-112 and His-115) do not appear to have the same function. Changing the histidines (His-84 and His-85) in PvuII results in a loss of catalysis but not binding (25). Their movement upon DNA binding brings the catalytic residues into proper alignment for catalysis. When the DNA is methylated, the excess movement of these histidines ensures the catalytic residues cannot function. No loss of binding or catalysis resulted when the histidines were substituted with alanines in MutH. Therefore, from this work, the signal (for DNA binding and state of methylation) for MutH is unknown. The DNA binding domain for MutH is clearly not similar to the one in PvuII.
A lysine (Lys-48) was found in MutH that functions in catalysis. The lysine to alanine mutation (K48A) in MutH resulted in a protein devoid of activity in the absence of MutL. MutL may have a lysine or other residue that is able to give the ternary complex partial function. The function of lysine 48 in MutH is unclear. It is positioned within the BC loop ~13.9 Å from the lysine (Lys-79) presumed to be the catalytic amino acid. Upon the subsequent movement of MutH associated with DNA binding and activation of the protein, lysine 48 could be positioned within the catalytic core of the protein at the time of catalysis. This lysine may coordinate a critical water molecule for catalysis, be structurally important for the placement of the catalytic amino acids, be important for the placement of the metal binding residue of the protein, or may be the catalytic lysine in catalysis. The last possibility is very remote and a crystal structure with bound DNA and Mg2+ would be needed to confirm one of these hypotheses.
The G49A mutant may have defects in catalysis because of its proximity to lysine 48. The extra methyl group may cause slight structural changes in the lysine 48 side chain that slows catalysis. When MutL is present, the mutant is able to achieve full nicking of the substrate with larger amounts of protein than the wild-type MutH. The DNA binding of this glycine mutant is slightly tighter than the wild-type. The methyl group of G49A may be able to reach the phosphates of the DNA. If lysine 48 next to it is working in catalysis, then the DNA may be very close to these residues. This mutational change interferes with the proper functioning of the protein but is not informative about the mechanism of action.
Two C-terminal deletion mutations (
214 and
224) were made to help
identify the residues that contact and cause the stimulation of MutH by
MutL. This idea is based on predictions from the structural model of
MutH (11). The
224 functions similarly to the wild-type protein
in vivo as well as in vitro, indicating that
residues 225-229 at the C-terminal end of the protein are not required for MutL stimulation. The mutation frequency of the
214 mutant is
elevated in vivo and shows decreased cleavage activity with some initial DNA binding capabilities in vitro. However, it
is not able to be stimulated by MutL. This places the residues between 215 and 224 as being involved in activation by MutL. It has been shown
that a deletion of 10 amino acids in the C-terminal region of MutH
(
219) prevents MutL stimulation (7). That leaves the amino acids 220 through 224 (sequence: ALLAR) as contacting MutL and stimulating MutH
activity. Comparing the amino acid sequence of E. coli and
Hemophilus influenzae MutH, there is one conserved amino
acid: the leucine at position 222. Site-directed mutagenesis at each of
the five positions (220) could reveal the most important residues
for stimulation.
| |
ACKNOWLEDGEMENT |
|---|
We thank Dr. Te Wu for helpful advice and discussions.
| |
FOOTNOTES |
|---|
* This work was supported by Grant RPG-97-127-01-GMC from the American Cancer Society.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Pharmacology
and Molecular Toxicology, University of Massachusetts Medical School,
55 Lake Ave. North, Worcester, MA 01655. Tel.: 508-856-3330; Fax:
508-856-5080; E-mail: martin.marinus@umassmed.edu.
Published, JBC Papers in Press, December 21, 2000, DOI 10.1074/jbc.M007935200
2 T. Loh, K. C. Murphy, and M. G. Marinus, unpublished data..
| |
ABBREVIATIONS |
|---|
The abbreviations used are: PCR, polymerase chain reaction; kb, kilobase(s); Amp, ampicillin; Cam, chloramphenicol; Rif, rifampicin; PAGE, polyacrylamide gel electrophoresis; bp, base pair(s); PNK, T4 polynucleotide kinase.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Modrich, P., and Lahue, R. S. (1996) Annu. Rev. Biochem. 65, 101-133 |
| 2. | Au, K. G., Welsh, K., and Modrich, P. (1992) J. Biol. Chem. 267, 12142-12148 |
| 3. | Su, S. S., and Modrich, P. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 5057-5061 |
| 4. | Parker, B. O., and Marinus, M. G. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 1730-1734 |
| 5. | Su, S. S., Lahue, R. S., Au, K. G., and Modrich, P. (1988) J. Biol. Chem. 263, 6829-6835 |
| 6. | Drotschmann, K., Aronshtam, A., Fritz, H. J., and Marinus, M. G. (1998) Nucleic Acids Res. 26, 948-953 |
| 7. | Hall, M. C., and Matson, S. W. (1999) J. Biol. Chem. 274, 1306-1312 |
| 8. | Ban, C., and Yang, W. (1998) Cell 95, 541-552 |
| 9. | Lu, A. L., Clark, S., and Modrich, P. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 4639-4643 |
| 10. | Pukkila, P. J., Peterson, J., Herman, G., Modrich, P., and Meselson, M. (1983) Genetics 104, 571-582 |
| 11. | Ban, C., and Yang, W. (1998) EMBO J. 17, 1526-1534 |
| 12. | Aggarwal, A. K. (1995) Curr. Opin. Struct. Biol. 5, 11-19 |
| 13. | Pingoud, A., and Jeltsch, A. (1997) Eur. J. Biochem. 246, 1-22 |
| 14. | Murphy, K. C., Campellone, K. G., and Poteete, A. R. (2000) Gene 246, 321-330 |
| 15. | Horst, J. P., Wu, T. H., and Marinus, M. G. (1999) Trends Microbiol. 7, 29-36 |
| 16. | Aronshtam, A., and Marinus, M. G. (1996) Nucleic Acids Res. 24, 2498-2504 |
| 17. | Guzman, L., Belin, D., Carson, M., and Beckwith, J. (1995) J. Bacteriol. 177, 4121-4130 |
| 18. | Feng, G., and Winkler, M. E. (1995) BioTechniques 19, 956-965 |
| 19. | Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd. Ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY |
| 20. | Murphy, K. C. (1998) J. Bacteriol. 180, 2063-2071 |
| 21. | Wu, T.-H., and Marinus, M. G. (1994) J. Bacteriol. 176, 5393-5400 |
| 22. | Lahue, R. S., Su, S. S., and Modrich, P. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 1482-1486 |
| 23. | Horton, N. C., Nastri, H. G., Riggs, P. D., and Cheng, X. (1998) J. Mol. Biol. 284, 1491-1504 |
| 24. | Nastri, H. G., Evans, P. D., Walker, I. H., and Riggs, P. D. (1997) J. Biol. Chem. 272, 25761-25767 |
| 25. | Horton, N. C., Bonventre, J., and Cheng, X. (1998) Biol. Chem. 379, 451-458 |
| 26. | Harris, R. S., Feng, G., Ross, K. J., Sidhu, R., Thulin, C., Longerich, S., Szigety, S. K., Winkler, M. E., and Rosenberg, S. M. (1997) Genes Dev. 11, 2426-2437 |
This article has been cited by other articles:
![]() |
G. Plotz, C. Welsch, L. Giron-Monzon, P. Friedhoff, M. Albrecht, A. Piiper, R. M. Biondi, T. Lengauer, S. Zeuzem, and J. Raedle Mutations in the MutS{alpha} interaction interface of MLH1 can abolish DNA mismatch repair Nucleic Acids Res., December 2, 2006; 34(22): 6574 - 6586. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Manelyte, C. Urbanke, L. Giron-Monzon, and P. Friedhoff Structural and functional analysis of the MutS C-terminal tetramerization domain Nucleic Acids Res., October 6, 2006; 34(18): 5270 - 5279. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ahrends, J. Kosinski, D. Kirsch, L. Manelyte, L. Giron-Monzon, L. Hummerich, O. Schulz, B. Spengler, and P. Friedhoff Identifying an interaction site between MutH and the C-terminal domain of MutL by crosslinking, affinity purification, chemical coding and mass spectrometry Nucleic Acids Res., June 13, 2006; 34(10): 3169 - 3180. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Calmann, J. E. Evans, and M. G. Marinus MutS inhibits RecA-mediated strand transfer with methylated DNA substrates Nucleic Acids Res., June 22, 2005; 33(11): 3591 - 3597. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Giron-Monzon, L. Manelyte, R. Ahrends, D. Kirsch, B. Spengler, and P. Friedhoff Mapping Protein-Protein Interactions between MutL and MutH by Cross-linking J. Biol. Chem., November 19, 2004; 279(47): 49338 - 49345. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. H. Toedt, R. Krishnan, and P. Friedhoff Site-specific protein modification to identify the MutL interface of MutH Nucleic Acids Res., February 1, 2003; 31(3): 819 - 825. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-h. Wu, T. Loh, and M. G. Marinus The function of Asp70, Glu77 and Lys79 in the Escherichia coli MutH protein Nucleic Acids Res., February 1, 2002; 30(3): 818 - 822. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||