Originally published In Press as doi:10.1074/jbc.M007237200 on January 23, 2001
J. Biol. Chem., Vol. 276, Issue 15, 12440-12448, April 13, 2001
Peroxisome Proliferator-activated Receptor
Ligands Suppress
the Transcriptional Activation of Cyclooxygenase-2
EVIDENCE FOR INVOLVEMENT OF ACTIVATOR PROTEIN-1 AND CREB-BINDING
PROTEIN/p300*
Kotha
Subbaramaiah
§¶,
Derrick T.
Lin
,
Janice C.
Hart
, and
Andrew J.
Dannenberg
§
From the
Department of Medicine (Division of
Gastroenterology and Hepatology), New York Presbyterian Hospital and
Weill Medical College of Cornell University, the § Strang
Cancer Prevention Center, and the
Department of Surgery (Head
and Neck Service), Memorial Sloan-Kettering Cancer Center,
New York, New York 10021
Received for publication, August 9, 2000, and in revised form, January 22, 2001
 |
ABSTRACT |
We investigated whether peroxisome
proliferator-activated receptor
(PPAR
) ligands
(ciglitazone, troglitazone, and 15-deoxy-
12,14
prostaglandin J2) inhibited cyclooxygenase-2 (COX-2)
induction in human epithelial cells. Ligands of PPAR
inhibited
phorbol ester (phorbol 12-myristate 13-acetate, PMA)-mediated induction of COX-2 and prostaglandin E2 synthesis. Nuclear run-offs
revealed increased rates of COX-2 transcription after
treatment with PMA, an effect that was inhibited by PPAR
ligands.
PMA-mediated induction of COX-2 promoter activity was
inhibited by PPAR
ligands; this suppressive effect was prevented by
overexpressing a dominant negative form of PPAR
or a PPAR response
element decoy oligonucleotide. The stimulatory effects of PMA were
mediated by a cyclic AMP response element in the COX-2
promoter. Treatment with PMA increased activator protein-1 (AP-1)
activity and the binding of c-Jun, c-Fos, and ATF-2 to the cyclic AMP
response element, effects that were blocked by PPAR
ligands. These
findings raised questions about the mechanism underlying the anti-AP-1
effect of PPAR
ligands. The induction of c-Jun by PMA was blocked by
PPAR
ligands. Overexpression of either c-Jun or CREB-binding
protein/p300 partially relieved the suppressive effect of PPAR
ligands. When CREB-binding protein and c-Jun were overexpressed
together, the ability of PPAR
ligands to suppress PMA-mediated
induction of COX-2 promoter activity was essentially
abrogated. Bisphenol A diglycidyl ether, a compound that binds to
PPAR
but lacks the ability to activate transcription, also inhibited
PMA-mediated induction of AP-1 activity and COX-2. Taken together,
these findings are likely to be important for understanding the
anti-inflammatory and anti-cancer properties of PPAR
ligands.
 |
INTRODUCTION |
COX1 catalyzes the synthesis of prostaglandins from
arachidonic acid. There are two isoforms
of COX. COX-1 is constitutively expressed in most tissues and appears
to be responsible for various physiologic functions (1, 2). COX-2 is an
immediate, early response gene that is rapidly induced by phorbol
esters, growth factors, cytokines, and oncogenes (3-9).
COX-2 is an important therapeutic target for preventing or treating
arthritis and cancer (10-12). Selective COX-2 inhibitors decrease
inflammation and are widely used to treat arthritis (13). COX-2 is
overexpressed in transformed cells (8, 14, 15) and in malignant tumors
(16-20). COX-2 knockout mice are protected against both
intestinal (21) and skin tumors (22). Moreover, selective COX-2
inhibitors suppress the formation and growth of tumors in experimental
animals (23-27) and decrease the number of colorectal polyps in
patients with familial adenomatous polyposis (28). Because targeted
inhibition of COX-2 is a promising approach to treating inflammation
and preventing cancer, it is important to elucidate the signaling
mechanisms that regulate COX-2 expression.
Peroxisome proliferator-activated receptor
(PPAR
) is a member of
a nuclear hormone receptor superfamily that can modulate gene
expression upon ligand binding. When PPAR
is activated by ligand
binding, it is able to heterodimerize with the retinoid X receptor and
activate gene expression by binding to PPAR response elements (29, 30).
PPAR
ligands can also block both AP-1 and NF
B-mediated gene
expression (31-34). Ligand-mediated activation of PPAR
has been
linked to glucose homeostasis (35), cellular differentiation (36, 37),
apoptosis (38-40), and anti-inflammatory responses (31, 32, 41).
Currently, thiazolidinediones, a class of PPAR
ligands, are used to
treat type II diabetes mellitus. Additionally, there is experimental
evidence that PPAR
ligands possess both anti-inflammatory (31, 32,
41) and anti-neoplastic properties (36-39, 42-46). The precise
mechanisms underlying these effects of PPAR
ligands are unknown.
In the current study, we show that PPAR
ligands inhibited
AP-1-mediated transcriptional activation of COX-2 in human
epithelial cells. The anti-AP-1 activity of PPAR
ligands was a
consequence of inhibition of c-Jun expression and competition for
limiting amounts of the general coactivator CREB-binding protein (CBP). These results may help to explain the ability of PPAR
ligands to
suppress carcinogenesis and arthritis.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Minimal essential medium, Opti-MEM, and
LipofectAMINE were from Life Technologies, Inc. Keratinocyte basal and
growth media were from Clonetics Corp. (San Diego, CA). Phorbol
12-myristate 13-acetate, taxol, sphingomyelinase, sodium arachidonate,
3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide
(thiazolyl blue), lactate dehydrogenase diagnostic kits, epinephrine,
epidermal growth factor, hydrocortisone, poly(dI·dC), and
o-nitrophenyl-
-D-galactopyranoside were from
Sigma. Ciglitazone and 15-deoxy-
12,14 prostaglandin
J2 (15d-PGJ2) were from Biomol Research Labs
Inc. (Plymouth Meeting, PA). Troglitazone and its M metabolite were generously provided by Dr. A. Saltiel (Parke-Davis). Bisphenol A
diglycidyl ether (BADGE) was obtained from Fluka (Milwaukee, WI).
Enzyme immunoassay reagents for PGE2 assays were from
Cayman Co. (Ann Arbor, MI). Western blotting detection reagents,
[32P]ATP, [32P]CTP, and
[32P]UTP were from PerkinElmer Life Sciences. Random
priming kits were from Roche Molecular Biochemicals. Nitrocellulose
membranes were from Schleicher & Schuell. Reagents for the luciferase
assay were from PharMingen (San Diego, CA). The 18 S rRNA cDNA was
from Ambion, Inc. (Austin, TX). T4 polynucleotide kinase was from New England Biolabs (Beverly, MA). Antisera to PPAR
, COX-2, c-Jun, c-Fos, and ATF-2 were purchased from Santa Cruz Biotechnology, Inc.
(San Diego). Plasmid DNA was prepared using a kit from Promega Corp.
(Madison, WI). Oligonucleotides were synthesized by Genosys (The
Woodlands, TX).
Tissue Culture--
The 184B5/HER and 184B5 cell lines have been
described previously (47). Cells were maintained in minimum essential
medium/keratinocyte basal medium mixed in a ratio of 1:1 (basal medium)
containing epidermal growth factor (10 ng/ml), hydrocortisone (0.5 µg/ml), transferrin (10 µg/ml), gentamicin (5 µg/ml), and insulin
(10 µg/ml) (growth medium). Cells were grown to 60% confluence,
trypsinized with 0.05% trypsin, 2 mM EDTA, and plated for
experimental use. MSK Leuk1 cells have been described previously (48).
Cells were routinely maintained in keratinocyte growth medium and
passaged using 0.125% trypsin, 2 mM EDTA. In all
experiments, 184B5/HER and MSK Leuk1 cells were grown in basal medium
for 24 h prior to treatment. Treatment with vehicle (0.2%
Me2SO), PPAR
ligands, or PMA was always carried out in
basal medium. Cellular cytotoxicity was assessed by measurements of
cell number, release of lactate dehydrogenase, and the
3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide assay,
which was performed according to the method of Denizot and Lang (49).
Lactate dehydrogenase assays were performed according to the
manufacturer's instructions. There was no evidence of toxicity in any
of our experiments.
PGE2 Production by Cells--
5 × 104 cells/well were plated in 6-well dishes and grown to
60% confluence in growth medium. Levels of PGE2 released
by the cells were measured by enzyme immunoassay. Production of
PGE2 was normalized to protein concentrations.
Western Blotting--
Cell lysates were prepared by treating
cells with lysis buffer (150 mM NaCl, 100 mM
Tris (pH 8.0), 1% Tween 20, 50 mM diethyldithiocarbamate, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride,
10 µg/ml aprotinin, 10 µg/ml trypsin inhibitor, and 10 µg/ml
leupeptin). Lysates were sonicated for 20 s on ice and centrifuged
at 10,000 × g for 10 min to sediment the particulate
material. The protein concentration of the supernatant was measured by
the method of Lowry et al. (50). SDS-polyacrylamide gel
electrophoresis was performed under reducing conditions on 10%
polyacrylamide gels as described by Laemmli (51). The resolved proteins
were transferred onto nitrocellulose sheets as detailed by Towbin
et al. (52). The nitrocellulose membrane was then incubated
with primary antisera. Secondary antibody to IgG conjugated to
horseradish peroxidase was used. The blots were probed with Renaissance
Western blot detection system according to the manufacturer's instructions.
Northern Blotting--
Total cellular RNA was isolated from cell
monolayers using an RNA isolation kit from Qiagen Inc. 10 µg of total
cellular RNA per lane were electrophoresed in a formaldehyde-containing
1.2% agarose gel and transferred to nylon-supported membranes. After baking, membranes were prehybridized overnight in a solution containing 50% formamide, 5× sodium chloride/sodium phosphate/EDTA buffer (SSPE), 5× Denhardt's solution, 0.1% SDS, and 100 µg/ml
single-stranded salmon sperm DNA and then hybridized for 12 h at
42 °C with radiolabeled cDNA probes for human COX-2 and 18 S
rRNA. COX-2 and 18 S rRNA probes were labeled with
[32P]CTP by random priming. After hybridization,
membranes were washed twice for 20 min at room temperature in 2× SSPE,
0.1% SDS, twice for 20 min in the same solution at 55 °C, and twice
for 20 min in 0.1 × SSPE, 0.1% SDS at 55 °C. Washed membranes
were then subjected to autoradiography.
Nuclear Run-off Assay--
2.5 × 105 cells
were plated in four T150 dishes for each condition. Cells were grown in
growth medium until ~60% confluent. Nuclei were isolated and stored
in liquid nitrogen. For the transcription assay, nuclei (1.0 × 107) were thawed and incubated in reaction buffer (10 mM Tris (pH 8), 5 mM MgCl2, and 0.3 M KCl) containing 100 µCi of uridine
5'-[32P]triphosphate and 1 mM unlabeled
nucleotides. After 30 min, labeled nascent RNA transcripts were
isolated. The human COX-2 and 18 S rRNA cDNAs were immobilized
onto nitrocellulose and prehybridized overnight in hybridization
buffer. Hybridization was carried out at 42 °C for 24 h using
equal cpm/ml of labeled nascent RNA transcripts for each treatment
group. The membranes were washed twice with 2× SSC buffer for 1 h
at 55 °C and then treated with 10 mg/ml RNase A in 2× SSC at
37 °C for 30 min, dried, and autoradiographed.
Plasmids--
The PPRE3-tk-luciferase construct was provided by
Dr. Mitchell Lazar (University of Pennsylvania, Philadelphia). The
dominant negative PPAR
expression vector was kindly provided by Dr.
V. K. K. Chatterjee (University of Cambridge, Cambridge, UK)
(53). The COX-2 promoter constructs (
1432/+59,
327/+59,
220/+59,
124/+59,
52/+59, KBM, ILM, CRM, and CRM-ILM) were a gift
of Dr. Tadashi Tanabe (National Cardiovascular Center Research
Institute, Osaka, Japan) (6). The human COX-2 cDNA was generously
provided by Dr. Stephen M. Prescott (University of Utah, Salt Lake
City, UT). RSV-c-Jun was a gift from Dr. Tom Curran (Roche Molecular Biochemicals). The AP-1 reporter plasmid (2xTRE-luciferase), composed of two copies of the consensus TRE ligated to luciferase, was kindly
provided by Dr. Joan Heller Brown (University of California, La Jolla).
P300/CBP expression vector was obtained from Dr. Robert Weinberg
(Massachusetts Institute of Technology, Cambridge). The expression
vector for CREB was kindly provided by Dr. James Leonard (Strang Cancer
Prevention Center, New York). The expression vector for CEBP
was a
gift from Dr. Steven McKnight (University of Texas Southwestern Medical
Center, Dallas). pSV-
-Galactosidase was obtained from Promega.
Oligonucleotides--
The PPRE decoy, scrambled and missense
oligonucleotide sequences were as follows: PPRE decoy
(ACTTGATCCCGTTTCAACTC), scrambled (TTAGGGAATCAGCAAGAGGT), and missense
(ACTTGCGCCCGTTTCAACTC) (38). In addition, the following
oligonucleotides containing the CRE of the COX-2 promoter
were synthesized: 5'-AAACAGTCATTTCGTCACATGGGCTTG-3' (sense) and
5'-CAAGCCCATGTGACGAAATGACTGTTT-3' (antisense).
Transient Transfection Assays--
184B5/HER cells were seeded
at a density of 5 × 104 cells/well in 6-well dishes
and grown to 50-60% confluence. For each well, 2 µg of plasmid DNA
were introduced into cells using 8 µg of LipofectAMINE as per the
manufacturer's instructions. After 7 h of incubation, the medium
was replaced with basal medium. The activities of luciferase and
-galactosidase were measured in cellular extract as described previously (55).
Electrophoretic Mobility Shift Assay--
Cells were harvested,
and nuclear extracts were prepared. For binding studies, an
oligonucleotide containing the CRE of the COX-2 promoter was
used. The complementary oligonucleotides were annealed in 20 mM Tris (pH 7.6), 50 mM NaCl, 10 mM
MgCl2, and 1 mM dithiothreitol. The annealed
oligonucleotide was phosphorylated at the 5'-end with
[
-32P]ATP and T4 polynucleotide kinase. The binding
reaction was performed by incubating 5 µg of nuclear protein in 20 mM HEPES (pH 7.9), 10% glycerol, 300 µg of bovine serum
albumin, and 1 µg of poly(dI·dC) in a final volume of 10 µl for
10 min at 25 °C. The labeled oligonucleotide was added to the
reaction mixture and allowed to incubate for an additional 20 min at
25 °C. The samples were electrophoresed on a 4% nondenaturing
polyacrylamide gel. The gel was then dried and subjected to
autoradiography at
80 °C.
Statistics--
Comparisons between groups were made with the
Student's t test. A difference between groups of
p < 0.05 was considered significant.
 |
RESULTS |
PPAR
Ligands Inhibit the Induction of COX-2 in Human Epithelial
Cells--
We determined the expression of PPAR
in human breast and
oral epithelial cells. Western blotting analysis revealed that PPAR
was expressed in 184B5, 184B5/HER (Fig.
1A), and premalignant oral
epithelial cells (data not shown). The receptor was also detected in
human breast cancer (Fig. 1B). To investigate if the PPAR
receptor expressed in cell lines was transcriptionally active, 184B5/HER and MSK Leuk1 cells were transfected with a PPAR response element cloned upstream of luciferase (PPRE3-tk-luciferase). Treatment of 184B5/HER (Fig. 1C) or MSK Leuk1 cells (data not shown)
with PPAR
ligands (ciglitazone, 15d-PGJ2) caused a
dose-dependent increase in promoter activity. Similar
effects were observed with troglitazone.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 1.
PPAR is expressed in
human mammary epithelial cells and breast cancers. Immunoblot
analysis was performed on lysates from human mammary epithelial cells
(A) and breast cancers (B). Equal amounts of
protein (100 µg/lane) were loaded onto a 10% SDS-polyacrylamide gel,
electrophoresed, and subsequently transferred onto nitrocellulose.
Immunoblots were probed with an antibody specific for PPAR .
A, lysate protein was from 184B5 (lane 2) and
184B5/HER (lane 3) cells; lane 1 represents a
PPAR standard. B, lysate protein from human breast
cancers (lanes 2-5); lane 1 represents a PPAR
standard. C, 184B5/HER cells were transfected with 1.8 µg
of a PPRE3-tk-luciferase construct and 0.2 µg of
pSV- -galactosidase. After transfection, cells were treated with
0-40 µM ciglitazone (open columns) or 0-40
µM 15d-PGJ2 (black columns).
Reporter activities were measured in cellular extract 24 h later.
Luciferase activity represents data that have been normalized with
-galactosidase activity. Columns, means; bars,
S.D.; n = 6.
|
|
The possibility that PPAR
ligands inhibited PMA-mediated induction
of PGE2 synthesis was investigated. Treatment of 184B5/HER cells with PMA led to a severalfold increase in PGE2
production. This effect was suppressed by PPAR
ligands in a
dose-dependent manner (Fig.
2). PPAR
ligands also inhibited
PMA-mediated induction of PGE2 synthesis in MSK Leuk1 cells
(data not shown). To determine whether the above effects on production
of PGE2 could be related to differences in amounts of
COX-2, Western blotting of cell lysate protein was carried out. PMA
induced COX-2 protein (Fig. 3,
A-D and G). Treatment with PPAR
ligands
(ciglitazone, Fig. 3A; 15d-PGJ2, Fig.
3B; troglitazone, Fig. 3, C and G)
caused a dose-dependent decrease in PMA-mediated induction
of COX-2. In contrast, the M metabolite of troglitazone, a compound
that cannot transactivate PPAR
, did not block the induction of COX-2
by PMA (Fig. 3D). In addition to PMA, sphingomyelinase and
taxol are known to induce COX-2 (56, 57). Hence, we also determined
whether PPAR
ligands could suppress sphingomyelinase- and
taxol-mediated induction of COX-2. Ciglitazone caused
dose-dependent suppression of the induction of COX-2 by
sphingomyelinase (Fig. 3E) and taxol (Fig. 3F).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 2.
PPAR
ligands suppress PMA-mediated induction of PGE2
synthesis. 184B5/HER cells were treated with vehicle, PMA (50 ng/ml), or PMA (50 ng/ml) plus ciglitazone (0-40 µM,
A) or 15d-PGJ2 (0-40 µM,
B) for 4.5 h. The medium was then replaced with basal
medium and 10 µM sodium arachidonate. 30 min later, the
medium was collected to determine the synthesis of PGE2.
Production of PGE2 was determined by enzyme
immunoassay. Columns, means; bars, S.D.;
n = 6. *; p < 0.001 compared with
PMA.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 3.
COX-2 induction is blocked by
PPAR ligands. 184B5/HER cells
(A-F) and MSK Leuk1 cells (G) were treated for
4.5 h. Cellular lysate protein (25 µg/lane) was loaded onto a
10% SDS-polyacrylamide gel, electrophoresed, and subsequently
transferred onto nitrocellulose. Immunoblots were probed with antibody
specific for COX-2. A, lysate protein was from cells treated
with vehicle (lane 2), PMA (50 ng/ml, lane 3), or
PMA and ciglitazone (10, 15, 20, 25, 30 µM; lanes
4-8, respectively). B, lysate protein was from cells
treated with vehicle (lane 2), PMA (50 ng/ml, lane
3), or PMA and 15d-PGJ2 (10, 15, 20, 25, and 30 µM; lanes 4-8, respectively). C,
lysate protein was from cells treated with vehicle (lane 2),
PMA (50 ng/ml, lane 3), or PMA and troglitazone (25, 50 µM; lanes 4 and 5, respectively).
D, lysate protein was from cells treated with vehicle
(lane 2), PMA (50 ng/ml, lane 3), or PMA and the
M metabolite of troglitazone (25, 50 µM; lanes
4 and 5, respectively). E, lysate protein
was from cells treated with vehicle (lane 2),
sphingomyelinase (10 milliunits/ml, lane 3), or
sphingomyelinase and ciglitazone (10, 20, 30 µM;
lanes 4-6, respectively). F, lysate protein was
from cells treated with vehicle (lane 2), taxol (10 µM, lane 3), or taxol and ciglitazone (15, 20, 25, 30 µM; lanes 4-7, respectively).
G, MSK Leuk1 cells were treated with vehicle (lane
2), PMA (50 ng/ml, lane 3), or PMA and troglitazone
(12.5, 15, 17.5, 20 µM; lanes 4-7,
respectively). In A-G, lane 1, represents a COX-2
standard.
|
|
Transcriptional Activation of COX-2 Is Inhibited by PPAR
Ligands--
To elucidate further the mechanism responsible for the
changes in amounts of COX-2 protein, we determined steady state levels of COX-2 mRNA by Northern blotting. As shown in Fig.
4, A and B,
treatment with PMA enhanced levels of COX-2 mRNA, an effect that
was suppressed by ciglitazone or troglitazone in a
concentration-dependent manner. Comparable effects were
observed with 15d-PGJ2 (data not shown). Nuclear run-off
assays were performed to determine whether differences in amounts of
COX-2 mRNA reflected altered rates of transcription. We detected a
marked increase in rates of synthesis of nascent COX-2 mRNA after
treatment with PMA consistent with the differences observed by Northern
blotting (Fig. 4C). This effect was suppressed by
ciglitazone (Fig. 4C) and 15d-PGJ2 (data not
shown).

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 4.
PPAR ligands inhibit
PMA-mediated induction of COX-2 transcription. A,
184B5/HER cells were treated with vehicle (lane 1), PMA (50 ng/ml, lane 2), or PMA (50 ng/ml) and ciglitazone (10, 15, 20, 25 and 35 µM; lanes 3-7, respectively)
for 3 h. B, MSK Leuk1 cells were treated with vehicle
(lane 1), PMA (50 ng/ml, lane 2), or PMA (50 ng/ml) and troglitazone (1, 10 and 25 µM; lanes
3-5, respectively) for 3 h. Total cellular RNA was isolated;
10 µg of RNA was added to each lane. The Northern blot was probed for
COX-2 mRNA and 18 S rRNA. C, 184B5/HER cells were
treated with vehicle (lane 1), PMA (50 ng/ml, lane
2), or PMA (50 ng/ml) and ciglitazone (10, 25, and 30 µM, lane 3-5) for 30 min. Nuclear run-offs
were performed as described under "Experimental Procedures." The
COX-2 and 18 S rRNA cDNAs were immobilized onto nitrocellulose
membranes and hybridized with labeled nascent RNA transcripts.
|
|
Transient transfections were performed to elucidate further the effects
of PMA and PPAR
ligands on COX-2 transcription. PMA stimulated COX-2 promoter activity, an effect that was
blocked by both ciglitazone (Fig.
5A) and 15d-PGJ2
(Fig. 5B). The suppressive effects of ciglitazone and
15d-PGJ2 were blocked by overexpressing a dominant negative
form of PPAR
. In addition to blocking transcriptional activation by
endogenous PPAR
, the dominant negative form of PPAR
lacks the
ability to recruit CBP (53). Additional transient transfections were
performed to confirm the role of PPAR
in mediating the inhibitory
effects of ciglitazone and 15d-PGJ2. We examined the
ability of a PPRE decoy oligonucleotide to prevent the inhibitory effects of ciglitazone and 15d-PGJ2 on PMA-mediated
stimulation of COX-2 promoter activity. As shown in Fig.
6, the PPRE decoy oligonucleotide
relieved the suppressive effects of both ciglitazone (Fig.
6A) and 15d-PGJ2 (Fig. 6B). In
contrast, neither scrambled nor missense PPRE decoy oligonucleotides
had any effect.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 5.
A dominant negative form of
PPAR inhibits the suppressive effects of
PPAR ligands. 184B5/HER cells were
transfected with 0.9 µg of a human COX-2 promoter
construct ligated to luciferase ( 327/+59) and 0.2 µg pSV gal.
PPAR WT bars represent cells that
received 0.9 µg of expression vector for wild-type PPAR ;
PPAR DN bars represent cells that received 0.9 µg of expression vector for a dominant negative form of PPAR . The
total amount of DNA in each reaction was kept constant at 2 µg by
using corresponding empty expression vectors. Following transfection,
cells were treated with vehicle (control), PMA (50 ng/ml), PMA plus 25 µM ciglitazone (A), or PMA plus 25 µM 15d-PGJ2 (B). Luciferase
activity represents data that have been normalized to -galactosidase
activity. Columns, means; bars, S.D.;
n = 6.
|
|

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 6.
Decoy PPRE relieves the suppressive effects
of PPAR ligands on COX-2. 184B5/HER cells
were transfected with 0.9 µg of a human COX-2 promoter
construct ligated to luciferase ( 327/+59) or COX-2
promoter plus decoy PPRE (0.4 µg) or COX-2 promoter plus
scrambled PPRE (0.4 µg) or COX-2 promoter plus missense
PPRE (0.4 µg). All cells received 0.2 µg of pSV gal. The total
amount of DNA in each reaction was kept constant at 2.0 µg by using
empty vector. Cells were treated with vehicle (control), PMA (50 ng/ml), or PMA (50 ng/ml) plus either 20 µM ciglitazone
(A) or 20 µM 15d-PGJ2
(B). Luciferase activity represents data that have been
normalized to -galactosidase activity. Columns, means;
bars, S.D.; n = 6.
|
|
To define the region of the COX-2 promoter (Fig.
7A) that responded to PMA and
PPAR
ligands, transient transfections were performed with a series
of human COX-2 promoter deletion constructs. As shown in
Fig. 7B, PMA treatment caused nearly a 4-fold increase in
COX-2 promoter (
1432/+59) activity, an effect that was
suppressed by ciglitazone. Both the inductive effect of PMA and the
suppressive effect of ciglitazone were detected with all
COX-2 promoter deletion constructs except the
52/+59
construct. A CRE is present between nucleotides
59 and
53,
suggesting that this element may be responsible for mediating the
effects of PMA. To test this notion, transient transfections were
performed using COX-2 promoter constructs in which specific
enhancer elements including the CRE were mutagenized. As shown in Fig.
7C, mutagenizing the CRE site caused a decrease in basal
promoter activity and a loss of responsiveness to PMA. By contrast,
mutagenizing the NF-IL6 or NF
B sites had little effect on
COX-2 promoter function.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 7.
Localization of region of COX-2 promoter that
mediates the effects of PMA and PPAR
ligands. A, shown is a schematic of the human
COX-2 promoter. B, 184B5/HER cells were
transfected with 1.8 µg of a series of human COX-2
promoter deletion constructs ligated to luciferase ( 1432/+59,
327/+59, 220/+59, 124/+59, and 52/+59) and 0.2 µg of
pSV gal. C, 184B5/HER cells were transfected with 1.8 µg
of a series of human COX-2 promoter-luciferase constructs
( 327/+59; KBM, ILM, CRM, and CRM-ILM) and 0.2 µg of pSV gal. KBM represents the 327/+59
COX-2 promoter construct in which the NF B site was
mutagenized; ILM represents the 327/+59 COX-2
promoter construct in which the NF-IL6 site was mutagenized;
CRM refers to the 327/+59 COX-2 promoter
construct in which the CRE was mutagenized; CRM-ILM
represents the 327/+59 COX-2 promoter construct in which
both the NF-IL6 element and CRE were mutagenized. After transfection,
cells were treated with vehicle (open columns), PMA (50 ng/ml, black columns), or PMA (50 ng/ml) plus ciglitazone
(25 µM, stippled columns). Reporter activities
were measured in cellular extract 6 h later. Luciferase activity
represents data that have been normalized with -galactosidase
activity. Columns, means; bars, S.D.;
n = 6.
|
|
PPAR
Ligands Inhibit COX-2 Expression via an Anti-AP-1
Mechanism--
Electrophoretic mobility shift assays were performed to
identify the transcription factor that mediated the induction of COX-2 by PMA. PMA caused increased binding to the CRE site of the
COX-2 promoter, an effect that was suppressed by ciglitazone
(Fig. 8A) or
15d-PGJ2 (Fig. 8B). By contrast, PMA did not
increase binding when the CRE site was mutagenized (data not shown).
Supershift analyses identified c-Jun, c-Fos, and ATF-2 in the binding
complex (Fig. 8C). Taken together, these results indicate
that PMA stimulates the binding of the AP-1 transcription factor
complex to the CRE of the COX-2 promoter; this effect was
blocked by treatment with PPAR
ligands.

View larger version (58K):
[in this window]
[in a new window]
|
Fig. 8.
PPAR ligands inhibit
PMA-induced binding of AP-1 to the CRE of the COX-2 promoter. 5 µg of nuclear protein from 184B5/HER cells was incubated with a
32P-labeled oligonucleotide containing the CRE of COX-2.
A, 184B5/HER cells were treated with vehicle (lane
1), PMA (50 ng/ml, lane 2), or PMA plus ciglitazone
(10, 20, and 30 µM, lanes 3-5) for 4.5 h. B, 184B5/HER cells were treated with vehicle (lane
1), PMA (50 ng/ml, lane 2), or PMA plus
15d-PGJ2 (10, 15, 20, 25, and 30 µM,
lanes 3-7) for 4.5 h. C, 184B5/HER cells
were treated with vehicle (lane 1) or PMA (50 ng/ml,
lane 2) for 4.5 h. Lanes 3-5 represent
nuclear extract from PMA-treated cells incubated with antibodies to
c-Jun (lane 3), c-Fos (lane 4), and ATF-2
(lane 5). In A-C, the protein DNA complex that
formed was separated on a 4% polyacrylamide gel.
|
|
Additional experiments were done to define further the mechanism(s) by
which PPAR
ligands inhibit PMA-mediated induction of AP-1 activity.
As shown in Fig. 9A,
ciglitazone caused dose-dependent suppression of
PMA-mediated activation of an AP-1 reporter plasmid (2xTRE-luciferase).
Similar results were obtained with 15d-PGJ2 (data not
shown). Moreover, PMA induced c-Jun, a component of the AP-1
transcription factor complex; this effect was also inhibited by
ciglitazone (Fig. 9B) or 15d-PGJ2 (data not
shown). To determine whether PPAR
ligands blocked PMA-mediated
induction of COX-2 solely via effects on c-Jun, transient transfections
were performed. As shown in Fig.
10A, ciglitazone blocked
PMA-mediated stimulation of COX-2 promoter activity, an
effect that was partially reversed by overexpressing c-Jun. In addition
to suppressing the expression of c-Jun, ligands of nuclear receptors
can potentially inhibit AP-1 activity by other mechanisms. There is
growing evidence, for example, that CREB-binding protein (CBP/p300) is
important for optimal AP-1-dependent transcription (58).
Addition of a PPAR
ligand stimulates the interaction between PPAR
and CBP/p300 (59, 60). Hence, PPAR
ligand-mediated inhibition of
AP-1 activity could also be a consequence of competition for limiting amounts of CBP/p300. To evaluate this possibility, transfection experiments were performed with a CBP/p300 expression vector. As shown
in Fig. 10A, overexpression of CBP also partially relieved the suppressive effect of ciglitazone. Interestingly, when CBP and
c-Jun were overexpressed together, the inhibitory effect of ciglitazone
was essentially abrogated. By contrast, overexpressing NF
B,
CEBP-
, or CREB did not relieve the inhibitory effects of ciglitazone
(Fig. 10B).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 9.
Ciglitazone inhibits PMA-mediated induction
of AP-1 activity. A, 184B5/HER cells were cotransfected
with 1.8 µg of 2xTRE-luciferase and 0.2 µg of pSV gal. The AP-1
reporter plasmid (2xTRE-luciferase) is composed of two copies of the
consensus TRE (TPA/PMA-responsive element) ligated to luciferase. After
transfection, cells were treated with vehicle (control), PMA (50 ng/ml), or PMA (50 ng/ml) plus ciglitazone (0-40 µM) for
6 h. Luciferase activity represents data that have been normalized
with -galactosidase activity. Columns, means;
bars, S.D.; n = 6. B, 184B5/HER
cells were treated with vehicle (lane 1), PMA (50 ng/ml,
lane 2), or PMA plus ciglitazone (15, 20, 25, 30 µM, lanes 3-6) for 4.5 h. Cellular
lysate protein (100 µg/lane) was loaded onto a 10%
SDS-polyacrylamide gel, electrophoresed, and subsequently transferred
onto nitrocellulose. The immunoblot was probed with an antibody
specific for c-Jun.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 10.
Ligands of PPAR
suppress PMA-mediated induction of COX-2 via effects on c-Jun and
CBP. 184B5/HER cells were transfected with 0.9 µg of a human
COX-2 promoter construct ligated to luciferase ( 327/+59)
and 0.2 µg of pSV gal. A, c-Jun bar
represents cells that received 0.45 µg of expression vector for
c-Jun; the CBP bar received 0.45 µg of expression vector
for CBP; the c-Jun + CBP bar received 0.45 µg each of
expression vectors for c-Jun and CBP. B, the
NF- B, CREB, and CEBP-
bars received 0.9 µg each of expression vectors for
NF B, CREB, and CEBP- , respectively. The total amount of DNA in
each reaction was kept constant at 2 µg by using the corresponding
empty expression vectors. Following transfection, cells
were treated with vehicle (control), PMA (50 ng/ml), or PMA plus 25 µM ciglitazone for 7 h. Luciferase activity
represents data that have been normalized with -galactosidase
activity. Columns, means; bars, S.D.;
n = 6.
|
|
BADGE, a synthetic ligand for PPAR
, was recently identified
(61). Although this compound binds to PPAR
, it has no apparent transactivation function (61). In fact, unlike ciglitazone or 15d-PGJ2, BADGE did not stimulate PPRE3-tk-luciferase
activity in 184B5/HER cells (data not shown). We wondered
whether this compound would still possess anti-AP-1 activity and
thereby block PMA-mediated induction of COX-2. Interestingly, BADGE
caused dose-dependent suppression of PMA-mediated
induction of COX-2 (Fig.
11A). To confirm that BADGE
did possess anti-AP-1 activity, transient transfections were performed.
As shown in Fig. 11B, BADGE caused
concentration-dependent suppression of PMA-mediated
activation of an AP-1 reporter plasmid.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 11.
BADGE, a synthetic antagonist for
PPAR , inhibits PMA-mediated induction of
COX-2. A, 184B5/HER cells were treated with vehicle
(lane 2), PMA (50 ng/ml, lane 3), or PMA plus
BADGE (100, 200, 300, 400, and 500 µM BADGE, lanes
4-8) for 4.5 h. Lane 1 represents a COX-2
standard. Cellular lysate protein (25 µg/lane) was loaded onto a 10%
SDS-polyacrylamide gel, electrophoresed, and subsequently transferred
onto nitrocellulose. The immunoblot was probed with antibody for COX-2.
B, 184B5/HER cells were cotransfected with 1.8 µg of
2xTRE-luciferase and 0.2 µg of pSV gal. Following transfection,
cells were treated with vehicle (control), PMA (50 ng/ml), or PMA plus
BADGE (0-500 µM) for 7 h. Luciferase activity
represents data that have been normalized with -galactosidase
activity. Columns, means; bars, S.D.;
n = 6.
|
|
 |
DISCUSSION |
PPAR
ligands, like ligands of other nuclear receptors, modulate
gene expression by multiple mechanisms. In the current study, we showed
that PPAR
ligands suppressed the induction of COX-2 by an anti-AP-1
mechanism. The AP-1 transcription factor complex consists of a
collection of dimers of members of the Jun, Fos, and ATF cAMP-response
element-binding protein bZip families. Little is known about the
potential of PPAR
ligands to interfere with AP-1-mediated gene
expression. Transient transfection analyses indicated that the CRE site
of the COX-2 promoter was important for the inductive
effects of PMA. Electrophoretic mobility gel shift analyses showed that
treatment with PMA augmented binding to the CRE of the COX-2
promoter; c-Jun, c-Fos, and ATF-2 were identified in the DNA binding
complex. These findings are consistent with previous reports in which
both AP-1 and the CRE were found to be important for the induction of
COX-2 in human epithelial cells (57, 62, 63). The results are also
consistent with the observations of Xie and Herschman (64, 65) who were
the first to demonstrate the importance of c-Jun and the CRE site for
mediating the induction of COX-2. Importantly, several different results support the idea that ligands of PPAR
block the induction of
COX-2 by antagonizing AP-1. First, PPAR
ligands blocked PMA-, taxol-, and sphingomyelinase-mediated induction of COX-2 (Fig. 2); each
of these inducers has been reported to stimulate AP-1-mediated induction of COX-2 transcription (56, 57, 62, 63). Second, PPAR
ligands inhibited PMA-mediated increases in AP-1 binding to the
CRE of the COX-2 promoter. Finally, ligands of PPAR
suppressed PMA-mediated activation of an AP-1 reporter plasmid.
Ligands of nuclear receptors, e.g. retinoids, have been
reported to antagonize AP-1-mediated transcription by a variety of mechanisms (66, 67). Hence, additional experiments were performed to
elucidate the mechanism(s) by which PPAR
ligands inhibited AP-1-mediated induction of COX-2. We found that ligands of PPAR
blocked PMA-mediated induction of c-Jun, a component of the AP-1 transcription factor complex. The functional significance of this effect was confirmed by the finding that overexpressing c-Jun partially
relieved the suppressive effects of ciglitazone on PMA-mediated induction of COX-2 promoter activity. Recent studies also
suggest that transcriptional activation by AP-1 requires the
coactivators CBP/p300 (68). Ligands of PPAR
stimulate the
interaction between PPAR
and CBP (59, 60). Hence, competition for
limiting amounts of these proteins represents a mechanism for
transrepression by nuclear receptors including PPAR
. In fact, CBP
was recently implicated in PPAR
-dependent repression of
the inducible nitric-oxide synthase gene (33). Transient transfections
were performed to investigate the potential of CBP to regulate
COX-2 transcription. Overexpressing CBP partially reversed
the suppressive effects of PPAR
ligands; this suggests that PPAR
ligands inhibited the stimulation of COX-2 promoter
activity, in part, via a squelching mechanism. In support of this idea,
overexpressing a dominant negative form of PPAR
that cannot bind CBP
prevented the suppressive effect of PPAR
ligands (Fig. 5). When
c-Jun and CBP were overexpressed simultaneously, the inhibitory effects
of PPAR
ligands were essentially abrogated. To our knowledge, these
findings represent the first evidence that PPAR
ligands can
antagonize AP-1-mediated gene expression by multiple mechanisms (Fig.
12). Moreover, we are unaware of any
prior work demonstrating that CBP is important for regulating COX-2 gene expression. Retinoids and dexamethasone, known
ligands of nuclear receptors, can block the activation of
COX-2 gene expression (55, 69). A potential role for
CBP/p300 in mediating these suppressive effects is suggested by the
findings of the current study.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 12.
Schematic of proposed mechanism by which
PPAR ligands inhibit AP-1-mediated activation
of COX-2 transcription. CBP/p300 links AP-1 with components of the
basal transcription machinery. TBP, TATA-box-binding
protein; TFIIB, transcription factor IIB; RNA Pol
II, RNA polymerase II. Treatment with PMA increases the binding of
AP-1 to the CRE site of the COX-2 promoter thereby enhancing
transcription. This stimulatory effect of PMA is blocked by cotreatment
with a PPAR ligand. PPAR ligands inhibit PMA-mediated induction
of COX-2 by two mechanisms as follows: 1) induction of c-Jun, a
component of the AP-1 transcription factor complex, is blocked; 2)
binding of a PPAR ligand to its receptor enhances the interaction
between CBP/p300 and PPAR . This results in less CBP/p300 being
available for AP-1-mediated activation of COX-2, a process known as
squelching.
|
|
Overexpressing a dominant negative form of PPAR
or a PPRE decoy
oligonucleotide relieved the suppressive effect of PPAR
ligands on
COX-2 expression. Both treatments suppress PPAR
-mediated transactivation of gene expression (38, 53) suggesting that PPAR
ligands could mediate their inhibitory effects on COX-2 induction by
modulating the transcription of an unknown PPAR
-responsive gene.
This might contribute, in turn, to the observed anti-AP-1 effect of
PPAR
ligands. Recently, PPAR
ligands were found to suppress the
induction of COX-2 in PPAR
(
/
) macrophages (70); this suggested
that this class of compounds could act via a PPAR
-independent mechanism. By contrast, in our epithelial cell model, overexpressing a
dominant negative form of PPAR
blocked the inhibitory effects of
PPAR
ligands on COX-2 expression. Thus, PPAR
is required for
mediating the suppressive effects of PPAR
ligands on COX-2 expression in this cell system.
Clearly, PPAR
can induce transcriptional activation through specific
DNA sites or inhibit the transcription factor AP-1. A pharmacological
approach was used to determine whether these two types of receptor
actions were mechanistically distinct. As noted above, BADGE is a
synthetic ligand that binds to the receptor but is unable to
transactivate genes via PPAR
(61). We investigated whether this
functionally restricted PPAR
ligand blocked the induction of COX-2
or AP-1 activity like other PPAR
ligands. Importantly, although
BADGE did not activate PPAR
, it suppressed PMA-mediated induction of
AP-1 activity and COX-2 expression. This finding suggests that it may
be feasible to develop a class of PPAR
ligands that selectively
inhibit AP-1 activity without stimulating transcription. There is
precedent for this idea. AP-1-selective retinoids have been developed
(71); these retinoids inhibit AP-1 activity but are unable to stimulate
transcription (71). AP-1-selective PPAR
ligands would be anticipated
to have different therapeutic properties and toxicity than traditional
PPAR
ligands.
Selective COX-2 inhibitors possess both chemopreventive and
anti-inflammatory properties. Compounds that interfere with the signaling mechanisms that stimulate COX-2 transcription
should also inhibit carcinogenesis and decrease inflammation. In
support of this idea, PPAR
ligands can inhibit carcinogenesis
(44-46) and reduce inflammation (32, 41). Several of the known
anti-neoplastic properties of PPAR
ligands may be explained, in
part, by their ability to inhibit COX-2 expression and PG biosynthesis.
For example, overexpression of COX-2 promotes angiogenesis (72) and
inhibits apoptosis (73), whereas PPAR
ligands inhibit both of these effects (38-40, 42). Both selective COX-2 inhibitors and PPAR
ligands protect against breast cancer in experimental animals (27, 46).
Local production of estrogen in breast adipose tissue, a reaction
catalyzed by aromatase, has been implicated in the development of
breast cancer. Interestingly, the synthesis of aromatase is stimulated
by PGE2 (74) and inhibited by PPAR
ligands (75). Our
finding that PPAR
ligands block the induction of COX-2 and
PGE2 synthesis may be important, therefore, for
understanding how PPAR
ligands inhibit mammary carcinogenesis
(46).
Finally, the results of this study may provide additional insights into
the mechanisms underlying the anti-diabetic effects of PPAR
ligands.
COX-2 is constitutively expressed in pancreatic islet cells (76).
Prostaglandin E2 negatively modulates glucose-induced insulin secretion, an effect that can be blocked by inhibitors of COX
(54). The discovery that PPAR
ligands inhibit the production of
COX-2-derived PGE2 may help to explain the hypoglycemic
effects of this class of agents.
 |
FOOTNOTES |
*
This work was supported in part by National Institutes of
Health Grants P01 CA29502, 1 R01 CA89578, and T32 CA09685, the Cancer Research Foundation of America, and the James E. Olson Foundation.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: New York
Presbyterian Hospital-Cornell Campus, Division of Gastroenterology and Hepatology, 1300 York Ave., Rm. F-203A, New York, NY 10021. Tel.: 212-746-4402; Fax: 212-746-4885; E-mail: ksubba@med.cornell.edu.
Published, JBC Papers in Press, January 23, 2001, DOI 10.1074/jbc.M007237200
 |
ABBREVIATIONS |
The abbreviations used are:
COX, cyclooxygenase;
AP-1, activator protein-1;
CRE, cyclic AMP response element;
PG, prostaglandin;
15d-PGJ2, 15-deoxy-
12,14
prostaglandin J2;
PMA, phorbol 12-myristate 13-acetate;
PPAR, peroxisome proliferator-activated receptor;
CBP, CREB-binding
protein;
PPRE, PPAR response element.
 |
REFERENCES |
| 1.
|
Smith, W. L.,
Garavito, R. M.,
and DeWitt, D. L.
(1996)
J. Biol. Chem.
271,
33157-33160
|
| 2.
|
Smith, W. L.,
and DeWitt, D. L.
(1995)
Semin. Nephrol.
15,
179-194
|
| 3.
|
Kujubu, D. A.,
Fletcher, B. S.,
Varnum, B. C.,
Lim, R. W.,
and Herschman, H. R.
(1991)
J. Biol. Chem.
266,
12866-12872
|
| 4.
|
Jones, D. A.,
Carlton, D. P.,
McIntyre, T. M.,
Zimmerman, G. A.,
and Prescott, S. M.
(1993)
J. Biol. Chem.
268,
9049-9054
|
| 5.
|
DuBois, R. N.,
Awad, J.,
Morrow, J.,
Roberts, L. J.,
and Bishop, P. R.
(1994)
J. Clin. Invest.
93,
493-498
|
| 6.
|
Inoue, H.,
Yokoyama, C.,
Hara, S.,
Tone, Y.,
and Tanabe, T.
(1995)
J. Biol. Chem.
270,
24965-24971
|
| 7.
|
Simmons, D. L.,
Levy, D. B.,
Yannoni, Y.,
and Erikson, R. L.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
1178-1182
|
| 8.
|
Subbaramaiah, K.,
Telang, N.,
Ramonetti, J. T.,
Araki, R.,
DeVito, B.,
Weksler, B. B.,
and Dannenberg, A. J.
(1996)
Cancer Res.
56,
4424-4429
|
| 9.
|
Mestre, J. R.,
Subbaramaiah, K.,
Sacks, P. G.,
Schantz, S. P.,
Tanabe, T.,
Inoue, H.,
and Dannenberg, A. J.
(1997)
Cancer Res.
57,
2890-2895
|
| 10.
|
Anderson, G. D.,
Hauser, S. D.,
McGarity, K. L.,
Bremer, M. E.,
Isakson, P. C.,
and Gregory, S. A.
(1996)
J. Clin. Invest.
97,
2672-2679
|
| 11.
|
Lipsky, P. E.,
and Isakson, P. C.
(1997)
J. Rheumatol.
24 Suppl. 49,
9-14
|
| 12.
|
Dannenberg, A. J.,
and Zakim, D.
(1999)
Semin. Oncol.
26,
499-504
|
| 13.
|
Simon, L. S.,
Weaver, A. L.,
Graham, D. Y.,
Kivitz, A. J.,
Lipsky, P. E.,
Hubbard, R. C.,
Isakson, P. C.,
Verburg, K. M., Yu, S. S.,
Zhao, W. W.,
and Geis, G. S.
(1999)
J. Am. Med. Assoc.
282,
1921-1928
|
| 14.
|
Kutchera, W.,
Jones, D. A.,
Matsunami, N.,
Groden, J.,
McIntyre, T. M.,
Zimmerman, G. A.,
White, R. L.,
and Prescott, S. M.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
4816-4820
|
| 15.
|
Sheng, G. G.,
Shao, J.,
Sheng, H.,
Hooton, E. B.,
Isakson, P. C.,
Morrow, J. D.,
Coffey, R. J.,
DuBois, R. N.,
and Beauchamp, R. D.
(1997)
Gastroenterology
113,
1883-1891
|
| 16.
|
Kargman, S. L.,
O'Neil, G. P.,
Vickers, P. J.,
Evans, J. F.,
Mancini, J. A.,
and Jothy, S.
(1995)
Cancer Res.
55,
2556-2559
|
| 17.
|
Ristimaki, A.,
Honkanen, N.,
Jankala, H.,
Sipponen, P.,
and Harkonen, M.
(1997)
Cancer Res.
57,
1276-1280
|
| 18.
|
Parett, M. L.,
Harris, R. E.,
Joarder, F. S.,
Ross, M. S.,
Clausen, K. P.,
and Robertson, F. M.
(1997)
Int. J. Oncol.
10,
503-507
|
| 19.
|
Chan, G.,
Boyle, J. O.,
Yang, E. K.,
Zhang, F.,
Sacks, P. G.,
Shah, J. P.,
Edelstein, D.,
Soslow, R. A.,
Koki, A. T.,
Woerner, B. M.,
Masferrer, J. L.,
and Dannenberg, A. J.
(1999)
Cancer Res.
59,
991-994
|
| 20.
|
Tucker, O. N.,
Dannenberg, A. J.,
Yang, E. K.,
Zhang, F.,
Teng, L.,
Daly, J. M.,
Soslow, R. A.,
Masferrer, J. L.,
Woerner, B. M.,
Koki, A. T.,
and Fahey, T. J.
(1999)
Cancer Res.
59,
987-990
|
| 21.
|
Oshima, M.,
Dinchuk, J. E.,
Kargman, S. L.,
Oshima, H.,
Hancock, B.,
Kwong, E.,
Trzaskos, J. M.,
Evans, J. F.,
and Taketo, M. M.
(1996)
Cell
87,
803-809
|
| 22.
|
Tiano, H.,
Chulada, P.,
Spalding, J.,
Lee, C.,
Loftin, C.,
Mahler, J.,
Morham, S.,
and Langenbach, R.
(1997)
Proc. Am. Assoc. Cancer Res.
38,
1727
|
| 23.
|
Kawamori, T.,
Rao, C. V.,
Seibert, K.,
and Reddy, B. S.
(1998)
Cancer Res.
58,
409-412
|
| 24.
|
Fischer, S. M.,
Lo, H.-H.,
Gordon, G. B.,
Seibert, K.,
Kelloff, G.,
Lubet, R. A.,
and Conti, C. C.
(1999)
Mol. Carcinog.
25,
231-240
|
| 25.
|
Sheng, H.,
Shao, J.,
Kirkland, S. C.,
Isakson, P.,
Coffey, R. J.,
Morrow, J.,
Beauchamp, R. D.,
and DuBois, R. N.
(1997)
J. Clin. Invest.
99,
2254-2259
|
| 26.
|
Sawaoka, H.,
Kawano, S.,
Tsuji, S.,
Tsujii, M.,
Gunawan, E. S.,
Takei, Y.,
Nagano, K.,
and Hori, M.
(1998)
Am. J. Physiol.
274,
G1061-G1067
|
| 27.
|
Harris, R. E.,
Alshafie, G. A.,
Abou-Issa, H.,
and Seibert, K.
(2000)
Cancer Res.
60,
2101-2103
|
| 28.
|
Steinbach, G.,
Lynch, P. M.,
Phillips, R. K. S.,
Wallace, M. H.,
Hawk, E.,
Gordon, G. B.,
Wakabayashi, N.,
Saunders, B.,
Shen, Y.,
Fujimura, T.,
Su, L. K.,
and Levin, B.
(2000)
N. Engl. J. Med.
342,
1946-1952
|
| 29.
|
Kerstein, S.,
Desvergne, B.,
and Wahli, W.
(2000)
Nature
405,
421-424
|
| 30.
|
Meade, E. A.,
McIntyre, T. M.,
Zimmerman, G. A.,
and Prescott, S. M.
(1999)
J. Biol. Chem.
274,
8328-8334
|
| 31.
|
Ricote, M.,
Li, A. C.,
Willson, T. M.,
Kelly, C. J.,
and Glass, C. K.
(1998)
Nature
391,
79-82
|
| 32.
|
Su, C. G.,
Wen, X.,
Bailey, S. T.,
Jiang, W.,
Rangwala, S. M.,
Keilbaugh, S. A.,
Flanigan, A.,
Murthy, S.,
Lazar, M. A.,
and Wu, G.
(1999)
J. Clin. Invest.
104,
383-389
|
| 33.
|
Li, M.,
Pascual, G.,
and Glass, C. K.
(2000)
Mol. Cell. Biol.
20,
4699-4707
|
| 34.
|
Inoue, H.,
Tanabe, T.,
and Umesono, K.
(2000)
J. Biol. Chem.
275,
28028-28032
|
| 35.
|
Nolan, J. J.,
Ludvik, B.,
Beerdsen, P.,
Joyce, M.,
and Olefsky, J.
(1994)
N. Engl. J. Med.
331,
1188-1193
|
| 36.
|
Tontonoz, P.,
Singer, S.,
Forman, B. M.,
Sarraf, P.,
Fletcher, J. A.,
Fletcher, C. D. M.,
Brun, R. P.,
Mueller, E.,
Altiok, A.,
Oppenheim, H.,
Evans, R. M.,
and Spiegelman, B. M.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
237-241
|
| 37.
|
Mueller, E.,
Sarraf, P.,
Tontonoz, P.,
Evans, R. M.,
Martin, K. J.,
Zhang, M.,
Fletcher, C.,
Singer, S.,
and Spiegelman, B. M.
(1998)
Mol. Cell
1,
465-470
|
| 38.
|
Bishop-Bailey, D.,
and Hla, T.
(1999)
J. Biol. Chem.
274,
17042-17048
|
| 39.
|
Chang, T.-H.,
and Szabo, E.
(2000)
Cancer Res.
60,
1129-1138
|
| 40.
|
Tsubouchi, Y.,
Sano, H.,
Kawahito, Y.,
Mukai, S.,
Yamada, R.,
Kohno, M.,
Inoue, K.,
Hla, T.,
and Kondo, M.
(2000)
Biochem. Biophys. Res. Commun.
270,
400-405
|
| 41.
|
Kawahito, Y.,
Kondo, M.,
Tsubouchi, Y.,
Hashiramoto, A.,
Bishop-Bailey, D.,
Inoue, K.-I.,
Kohno, M.,
Yamada, R.,
Hla, T.,
and Sano, H.
(2000)
J. Clin. Invest.
106,
189-197
|
| 42.
|
Xin, X.,
Yang, S.,
Kowalski, J.,
and Gerritsen, M. E.
(1999)
J. Biol. Chem.
274,
9116-9121
|
| 43.
|
Brockman, J. A.,
Gupta, R. A.,
and Gupta, R. N.
(1998)
Gastroenterology
115,
1049-1055
|
| 44.
|
Kubota, T.,
Koshizuka, K.,
Williamson, E. A.,
Asou, H.,
Said, J. W.,
Holden, S.,
Miyoshi, I.,
and Koeffler, H. P.
(1998)
Cancer Res.
58,
3344-3352
|
| 45.
|
Demetri, G. D.,
Fletcher, C. D. M.,
Mueller, E.,
Sarraf, P.,
Naujoks, R.,
Campbell, N.,
Spiegelman, B. M.,
and Singer, S.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
3951-3956
|
| 46.
|
Suh, N.,
Wang, Y.,
Williams, C. R.,
Risingsong, R.,
Gilmer, T.,
Willson, T. M.,
and Sporn, M. B.
(1999)
Cancer Res.
59,
5671-5673
|
| 47.
|
Zhai, Y.-F.,
Beittenmiller, H.,
Wang, B.,
Gould, M. N.,
Oakley, C.,
Esselman, W. J.,
and Welsch, C. W.
(1993)
Cancer Res.
53,
2272-2278
|
| 48.
|
Sacks, P. G.
(1996)
Cancer Metastasis Rev.
15,
27-51
|
| 49.
|
Denizot, F.,
and Lang, R.
(1986)
J. Immunol. Methods
89,
271-277
|
| 50.
|
Lowry, O. H.,
Rosebrough, N. J.,
Farr, A. L.,
and Randell, R. J.
(1951)
J. Biol. Chem.
193,
265-275
|
| 51.
|
Laemmli, U. K.
(1970)
Nature
227,
680-685
|
| 52.
|
Towbin, H.,
Staehelin, T.,
and Gordon, J.
(1979)
Proc. Natl. Acad. Sci. U. S. A.
76,
4350-4354
|
| 53.
|
Gurnell, M.,
Wentworth, J. M.,
Agostini, M.,
Adams, M.,
Collingwood, T. N.,
Provenzano, C.,
Browne, P. O.,
Rajanayagam, O.,
Burris, T. P.,
Schwabe, J. W.,
Lazar, M. A.,
and Chatterjee, V. K. K.
(2000)
J. Biol. Chem.
275,
5754-5759
|
| 54.
|
Robertson, R. P.
(1998)
Diabetes
47,
1379-1383
|
| 55.
|
Mestre, J. R.,
Subbaramaiah, K.,
Sacks, P. G.,
Schantz, S. P.,
Tanabe, T.,
Inoue, H.,
and Dannenberg, A. J.
(1997)
Cancer Res.
57,
1081-1085
|
| 56.
|
Subbaramaiah, K.,
Chung, W. J.,
and Dannenberg, A. J.
(1998)
J. Biol. Chem.
273,
32943 |