JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M007237200 on January 23, 2001

J. Biol. Chem., Vol. 276, Issue 15, 12440-12448, April 13, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/15/12440    most recent
M007237200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Subbaramaiah, K.
Right arrow Articles by Dannenberg, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Subbaramaiah, K.
Right arrow Articles by Dannenberg, A. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Peroxisome Proliferator-activated Receptor gamma  Ligands Suppress the Transcriptional Activation of Cyclooxygenase-2

EVIDENCE FOR INVOLVEMENT OF ACTIVATOR PROTEIN-1 AND CREB-BINDING PROTEIN/p300*

Kotha SubbaramaiahDagger §, Derrick T. Lin||, Janice C. HartDagger , and Andrew J. DannenbergDagger §

From the Dagger  Department of Medicine (Division of Gastroenterology and Hepatology), New York Presbyterian Hospital and Weill Medical College of Cornell University, the § Strang Cancer Prevention Center, and the || Department of Surgery (Head and Neck Service), Memorial Sloan-Kettering Cancer Center, New York, New York 10021

Received for publication, August 9, 2000, and in revised form, January 22, 2001



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We investigated whether peroxisome proliferator-activated receptor gamma  (PPARgamma ) ligands (ciglitazone, troglitazone, and 15-deoxy-Delta 12,14 prostaglandin J2) inhibited cyclooxygenase-2 (COX-2) induction in human epithelial cells. Ligands of PPARgamma inhibited phorbol ester (phorbol 12-myristate 13-acetate, PMA)-mediated induction of COX-2 and prostaglandin E2 synthesis. Nuclear run-offs revealed increased rates of COX-2 transcription after treatment with PMA, an effect that was inhibited by PPARgamma ligands. PMA-mediated induction of COX-2 promoter activity was inhibited by PPARgamma ligands; this suppressive effect was prevented by overexpressing a dominant negative form of PPARgamma or a PPAR response element decoy oligonucleotide. The stimulatory effects of PMA were mediated by a cyclic AMP response element in the COX-2 promoter. Treatment with PMA increased activator protein-1 (AP-1) activity and the binding of c-Jun, c-Fos, and ATF-2 to the cyclic AMP response element, effects that were blocked by PPARgamma ligands. These findings raised questions about the mechanism underlying the anti-AP-1 effect of PPARgamma ligands. The induction of c-Jun by PMA was blocked by PPARgamma ligands. Overexpression of either c-Jun or CREB-binding protein/p300 partially relieved the suppressive effect of PPARgamma ligands. When CREB-binding protein and c-Jun were overexpressed together, the ability of PPARgamma ligands to suppress PMA-mediated induction of COX-2 promoter activity was essentially abrogated. Bisphenol A diglycidyl ether, a compound that binds to PPARgamma but lacks the ability to activate transcription, also inhibited PMA-mediated induction of AP-1 activity and COX-2. Taken together, these findings are likely to be important for understanding the anti-inflammatory and anti-cancer properties of PPARgamma ligands.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

COX1 catalyzes the synthesis of prostaglandins from arachidonic acid. There are two isoforms of COX. COX-1 is constitutively expressed in most tissues and appears to be responsible for various physiologic functions (1, 2). COX-2 is an immediate, early response gene that is rapidly induced by phorbol esters, growth factors, cytokines, and oncogenes (3-9).

COX-2 is an important therapeutic target for preventing or treating arthritis and cancer (10-12). Selective COX-2 inhibitors decrease inflammation and are widely used to treat arthritis (13). COX-2 is overexpressed in transformed cells (8, 14, 15) and in malignant tumors (16-20). COX-2 knockout mice are protected against both intestinal (21) and skin tumors (22). Moreover, selective COX-2 inhibitors suppress the formation and growth of tumors in experimental animals (23-27) and decrease the number of colorectal polyps in patients with familial adenomatous polyposis (28). Because targeted inhibition of COX-2 is a promising approach to treating inflammation and preventing cancer, it is important to elucidate the signaling mechanisms that regulate COX-2 expression.

Peroxisome proliferator-activated receptor gamma  (PPARgamma ) is a member of a nuclear hormone receptor superfamily that can modulate gene expression upon ligand binding. When PPARgamma is activated by ligand binding, it is able to heterodimerize with the retinoid X receptor and activate gene expression by binding to PPAR response elements (29, 30). PPARgamma ligands can also block both AP-1 and NFkappa B-mediated gene expression (31-34). Ligand-mediated activation of PPARgamma has been linked to glucose homeostasis (35), cellular differentiation (36, 37), apoptosis (38-40), and anti-inflammatory responses (31, 32, 41). Currently, thiazolidinediones, a class of PPARgamma ligands, are used to treat type II diabetes mellitus. Additionally, there is experimental evidence that PPARgamma ligands possess both anti-inflammatory (31, 32, 41) and anti-neoplastic properties (36-39, 42-46). The precise mechanisms underlying these effects of PPARgamma ligands are unknown.

In the current study, we show that PPARgamma ligands inhibited AP-1-mediated transcriptional activation of COX-2 in human epithelial cells. The anti-AP-1 activity of PPARgamma ligands was a consequence of inhibition of c-Jun expression and competition for limiting amounts of the general coactivator CREB-binding protein (CBP). These results may help to explain the ability of PPARgamma ligands to suppress carcinogenesis and arthritis.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- Minimal essential medium, Opti-MEM, and LipofectAMINE were from Life Technologies, Inc. Keratinocyte basal and growth media were from Clonetics Corp. (San Diego, CA). Phorbol 12-myristate 13-acetate, taxol, sphingomyelinase, sodium arachidonate, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (thiazolyl blue), lactate dehydrogenase diagnostic kits, epinephrine, epidermal growth factor, hydrocortisone, poly(dI·dC), and o-nitrophenyl-beta -D-galactopyranoside were from Sigma. Ciglitazone and 15-deoxy-Delta 12,14 prostaglandin J2 (15d-PGJ2) were from Biomol Research Labs Inc. (Plymouth Meeting, PA). Troglitazone and its M metabolite were generously provided by Dr. A. Saltiel (Parke-Davis). Bisphenol A diglycidyl ether (BADGE) was obtained from Fluka (Milwaukee, WI). Enzyme immunoassay reagents for PGE2 assays were from Cayman Co. (Ann Arbor, MI). Western blotting detection reagents, [32P]ATP, [32P]CTP, and [32P]UTP were from PerkinElmer Life Sciences. Random priming kits were from Roche Molecular Biochemicals. Nitrocellulose membranes were from Schleicher & Schuell. Reagents for the luciferase assay were from PharMingen (San Diego, CA). The 18 S rRNA cDNA was from Ambion, Inc. (Austin, TX). T4 polynucleotide kinase was from New England Biolabs (Beverly, MA). Antisera to PPARgamma , COX-2, c-Jun, c-Fos, and ATF-2 were purchased from Santa Cruz Biotechnology, Inc. (San Diego). Plasmid DNA was prepared using a kit from Promega Corp. (Madison, WI). Oligonucleotides were synthesized by Genosys (The Woodlands, TX).

Tissue Culture-- The 184B5/HER and 184B5 cell lines have been described previously (47). Cells were maintained in minimum essential medium/keratinocyte basal medium mixed in a ratio of 1:1 (basal medium) containing epidermal growth factor (10 ng/ml), hydrocortisone (0.5 µg/ml), transferrin (10 µg/ml), gentamicin (5 µg/ml), and insulin (10 µg/ml) (growth medium). Cells were grown to 60% confluence, trypsinized with 0.05% trypsin, 2 mM EDTA, and plated for experimental use. MSK Leuk1 cells have been described previously (48). Cells were routinely maintained in keratinocyte growth medium and passaged using 0.125% trypsin, 2 mM EDTA. In all experiments, 184B5/HER and MSK Leuk1 cells were grown in basal medium for 24 h prior to treatment. Treatment with vehicle (0.2% Me2SO), PPARgamma ligands, or PMA was always carried out in basal medium. Cellular cytotoxicity was assessed by measurements of cell number, release of lactate dehydrogenase, and the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide assay, which was performed according to the method of Denizot and Lang (49). Lactate dehydrogenase assays were performed according to the manufacturer's instructions. There was no evidence of toxicity in any of our experiments.

PGE2 Production by Cells-- 5 × 104 cells/well were plated in 6-well dishes and grown to 60% confluence in growth medium. Levels of PGE2 released by the cells were measured by enzyme immunoassay. Production of PGE2 was normalized to protein concentrations.

Western Blotting-- Cell lysates were prepared by treating cells with lysis buffer (150 mM NaCl, 100 mM Tris (pH 8.0), 1% Tween 20, 50 mM diethyldithiocarbamate, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, 10 µg/ml trypsin inhibitor, and 10 µg/ml leupeptin). Lysates were sonicated for 20 s on ice and centrifuged at 10,000 × g for 10 min to sediment the particulate material. The protein concentration of the supernatant was measured by the method of Lowry et al. (50). SDS-polyacrylamide gel electrophoresis was performed under reducing conditions on 10% polyacrylamide gels as described by Laemmli (51). The resolved proteins were transferred onto nitrocellulose sheets as detailed by Towbin et al. (52). The nitrocellulose membrane was then incubated with primary antisera. Secondary antibody to IgG conjugated to horseradish peroxidase was used. The blots were probed with Renaissance Western blot detection system according to the manufacturer's instructions.

Northern Blotting-- Total cellular RNA was isolated from cell monolayers using an RNA isolation kit from Qiagen Inc. 10 µg of total cellular RNA per lane were electrophoresed in a formaldehyde-containing 1.2% agarose gel and transferred to nylon-supported membranes. After baking, membranes were prehybridized overnight in a solution containing 50% formamide, 5× sodium chloride/sodium phosphate/EDTA buffer (SSPE), 5× Denhardt's solution, 0.1% SDS, and 100 µg/ml single-stranded salmon sperm DNA and then hybridized for 12 h at 42 °C with radiolabeled cDNA probes for human COX-2 and 18 S rRNA. COX-2 and 18 S rRNA probes were labeled with [32P]CTP by random priming. After hybridization, membranes were washed twice for 20 min at room temperature in 2× SSPE, 0.1% SDS, twice for 20 min in the same solution at 55 °C, and twice for 20 min in 0.1 × SSPE, 0.1% SDS at 55 °C. Washed membranes were then subjected to autoradiography.

Nuclear Run-off Assay-- 2.5 × 105 cells were plated in four T150 dishes for each condition. Cells were grown in growth medium until ~60% confluent. Nuclei were isolated and stored in liquid nitrogen. For the transcription assay, nuclei (1.0 × 107) were thawed and incubated in reaction buffer (10 mM Tris (pH 8), 5 mM MgCl2, and 0.3 M KCl) containing 100 µCi of uridine 5'-[32P]triphosphate and 1 mM unlabeled nucleotides. After 30 min, labeled nascent RNA transcripts were isolated. The human COX-2 and 18 S rRNA cDNAs were immobilized onto nitrocellulose and prehybridized overnight in hybridization buffer. Hybridization was carried out at 42 °C for 24 h using equal cpm/ml of labeled nascent RNA transcripts for each treatment group. The membranes were washed twice with 2× SSC buffer for 1 h at 55 °C and then treated with 10 mg/ml RNase A in 2× SSC at 37 °C for 30 min, dried, and autoradiographed.

Plasmids-- The PPRE3-tk-luciferase construct was provided by Dr. Mitchell Lazar (University of Pennsylvania, Philadelphia). The dominant negative PPARgamma expression vector was kindly provided by Dr. V. K. K. Chatterjee (University of Cambridge, Cambridge, UK) (53). The COX-2 promoter constructs (-1432/+59, -327/+59, -220/+59, -124/+59, -52/+59, KBM, ILM, CRM, and CRM-ILM) were a gift of Dr. Tadashi Tanabe (National Cardiovascular Center Research Institute, Osaka, Japan) (6). The human COX-2 cDNA was generously provided by Dr. Stephen M. Prescott (University of Utah, Salt Lake City, UT). RSV-c-Jun was a gift from Dr. Tom Curran (Roche Molecular Biochemicals). The AP-1 reporter plasmid (2xTRE-luciferase), composed of two copies of the consensus TRE ligated to luciferase, was kindly provided by Dr. Joan Heller Brown (University of California, La Jolla). P300/CBP expression vector was obtained from Dr. Robert Weinberg (Massachusetts Institute of Technology, Cambridge). The expression vector for CREB was kindly provided by Dr. James Leonard (Strang Cancer Prevention Center, New York). The expression vector for CEBPalpha was a gift from Dr. Steven McKnight (University of Texas Southwestern Medical Center, Dallas). pSV-beta -Galactosidase was obtained from Promega.

Oligonucleotides-- The PPRE decoy, scrambled and missense oligonucleotide sequences were as follows: PPRE decoy (ACTTGATCCCGTTTCAACTC), scrambled (TTAGGGAATCAGCAAGAGGT), and missense (ACTTGCGCCCGTTTCAACTC) (38). In addition, the following oligonucleotides containing the CRE of the COX-2 promoter were synthesized: 5'-AAACAGTCATTTCGTCACATGGGCTTG-3' (sense) and 5'-CAAGCCCATGTGACGAAATGACTGTTT-3' (antisense).

Transient Transfection Assays-- 184B5/HER cells were seeded at a density of 5 × 104 cells/well in 6-well dishes and grown to 50-60% confluence. For each well, 2 µg of plasmid DNA were introduced into cells using 8 µg of LipofectAMINE as per the manufacturer's instructions. After 7 h of incubation, the medium was replaced with basal medium. The activities of luciferase and beta -galactosidase were measured in cellular extract as described previously (55).

Electrophoretic Mobility Shift Assay-- Cells were harvested, and nuclear extracts were prepared. For binding studies, an oligonucleotide containing the CRE of the COX-2 promoter was used. The complementary oligonucleotides were annealed in 20 mM Tris (pH 7.6), 50 mM NaCl, 10 mM MgCl2, and 1 mM dithiothreitol. The annealed oligonucleotide was phosphorylated at the 5'-end with [gamma -32P]ATP and T4 polynucleotide kinase. The binding reaction was performed by incubating 5 µg of nuclear protein in 20 mM HEPES (pH 7.9), 10% glycerol, 300 µg of bovine serum albumin, and 1 µg of poly(dI·dC) in a final volume of 10 µl for 10 min at 25 °C. The labeled oligonucleotide was added to the reaction mixture and allowed to incubate for an additional 20 min at 25 °C. The samples were electrophoresed on a 4% nondenaturing polyacrylamide gel. The gel was then dried and subjected to autoradiography at -80 °C.

Statistics-- Comparisons between groups were made with the Student's t test. A difference between groups of p < 0.05 was considered significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

PPARgamma Ligands Inhibit the Induction of COX-2 in Human Epithelial Cells-- We determined the expression of PPARgamma in human breast and oral epithelial cells. Western blotting analysis revealed that PPARgamma was expressed in 184B5, 184B5/HER (Fig. 1A), and premalignant oral epithelial cells (data not shown). The receptor was also detected in human breast cancer (Fig. 1B). To investigate if the PPARgamma receptor expressed in cell lines was transcriptionally active, 184B5/HER and MSK Leuk1 cells were transfected with a PPAR response element cloned upstream of luciferase (PPRE3-tk-luciferase). Treatment of 184B5/HER (Fig. 1C) or MSK Leuk1 cells (data not shown) with PPARgamma ligands (ciglitazone, 15d-PGJ2) caused a dose-dependent increase in promoter activity. Similar effects were observed with troglitazone.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1.   PPARgamma is expressed in human mammary epithelial cells and breast cancers. Immunoblot analysis was performed on lysates from human mammary epithelial cells (A) and breast cancers (B). Equal amounts of protein (100 µg/lane) were loaded onto a 10% SDS-polyacrylamide gel, electrophoresed, and subsequently transferred onto nitrocellulose. Immunoblots were probed with an antibody specific for PPARgamma . A, lysate protein was from 184B5 (lane 2) and 184B5/HER (lane 3) cells; lane 1 represents a PPARgamma standard. B, lysate protein from human breast cancers (lanes 2-5); lane 1 represents a PPARgamma standard. C, 184B5/HER cells were transfected with 1.8 µg of a PPRE3-tk-luciferase construct and 0.2 µg of pSV-beta -galactosidase. After transfection, cells were treated with 0-40 µM ciglitazone (open columns) or 0-40 µM 15d-PGJ2 (black columns). Reporter activities were measured in cellular extract 24 h later. Luciferase activity represents data that have been normalized with beta -galactosidase activity. Columns, means; bars, S.D.; n = 6.

The possibility that PPARgamma ligands inhibited PMA-mediated induction of PGE2 synthesis was investigated. Treatment of 184B5/HER cells with PMA led to a severalfold increase in PGE2 production. This effect was suppressed by PPARgamma ligands in a dose-dependent manner (Fig. 2). PPARgamma ligands also inhibited PMA-mediated induction of PGE2 synthesis in MSK Leuk1 cells (data not shown). To determine whether the above effects on production of PGE2 could be related to differences in amounts of COX-2, Western blotting of cell lysate protein was carried out. PMA induced COX-2 protein (Fig. 3, A-D and G). Treatment with PPARgamma ligands (ciglitazone, Fig. 3A; 15d-PGJ2, Fig. 3B; troglitazone, Fig. 3, C and G) caused a dose-dependent decrease in PMA-mediated induction of COX-2. In contrast, the M metabolite of troglitazone, a compound that cannot transactivate PPARgamma , did not block the induction of COX-2 by PMA (Fig. 3D). In addition to PMA, sphingomyelinase and taxol are known to induce COX-2 (56, 57). Hence, we also determined whether PPARgamma ligands could suppress sphingomyelinase- and taxol-mediated induction of COX-2. Ciglitazone caused dose-dependent suppression of the induction of COX-2 by sphingomyelinase (Fig. 3E) and taxol (Fig. 3F).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2.   PPARgamma ligands suppress PMA-mediated induction of PGE2 synthesis. 184B5/HER cells were treated with vehicle, PMA (50 ng/ml), or PMA (50 ng/ml) plus ciglitazone (0-40 µM, A) or 15d-PGJ2 (0-40 µM, B) for 4.5 h. The medium was then replaced with basal medium and 10 µM sodium arachidonate. 30 min later, the medium was collected to determine the synthesis of PGE2. Production of PGE2 was determined by enzyme immunoassay. Columns, means; bars, S.D.; n = 6. *; p < 0.001 compared with PMA.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 3.   COX-2 induction is blocked by PPARgamma ligands. 184B5/HER cells (A-F) and MSK Leuk1 cells (G) were treated for 4.5 h. Cellular lysate protein (25 µg/lane) was loaded onto a 10% SDS-polyacrylamide gel, electrophoresed, and subsequently transferred onto nitrocellulose. Immunoblots were probed with antibody specific for COX-2. A, lysate protein was from cells treated with vehicle (lane 2), PMA (50 ng/ml, lane 3), or PMA and ciglitazone (10, 15, 20, 25, 30 µM; lanes 4-8, respectively). B, lysate protein was from cells treated with vehicle (lane 2), PMA (50 ng/ml, lane 3), or PMA and 15d-PGJ2 (10, 15, 20, 25, and 30 µM; lanes 4-8, respectively). C, lysate protein was from cells treated with vehicle (lane 2), PMA (50 ng/ml, lane 3), or PMA and troglitazone (25, 50 µM; lanes 4 and 5, respectively). D, lysate protein was from cells treated with vehicle (lane 2), PMA (50 ng/ml, lane 3), or PMA and the M metabolite of troglitazone (25, 50 µM; lanes 4 and 5, respectively). E, lysate protein was from cells treated with vehicle (lane 2), sphingomyelinase (10 milliunits/ml, lane 3), or sphingomyelinase and ciglitazone (10, 20, 30 µM; lanes 4-6, respectively). F, lysate protein was from cells treated with vehicle (lane 2), taxol (10 µM, lane 3), or taxol and ciglitazone (15, 20, 25, 30 µM; lanes 4-7, respectively). G, MSK Leuk1 cells were treated with vehicle (lane 2), PMA (50 ng/ml, lane 3), or PMA and troglitazone (12.5, 15, 17.5, 20 µM; lanes 4-7, respectively). In A-G, lane 1, represents a COX-2 standard.

Transcriptional Activation of COX-2 Is Inhibited by PPARgamma Ligands-- To elucidate further the mechanism responsible for the changes in amounts of COX-2 protein, we determined steady state levels of COX-2 mRNA by Northern blotting. As shown in Fig. 4, A and B, treatment with PMA enhanced levels of COX-2 mRNA, an effect that was suppressed by ciglitazone or troglitazone in a concentration-dependent manner. Comparable effects were observed with 15d-PGJ2 (data not shown). Nuclear run-off assays were performed to determine whether differences in amounts of COX-2 mRNA reflected altered rates of transcription. We detected a marked increase in rates of synthesis of nascent COX-2 mRNA after treatment with PMA consistent with the differences observed by Northern blotting (Fig. 4C). This effect was suppressed by ciglitazone (Fig. 4C) and 15d-PGJ2 (data not shown).



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 4.   PPARgamma ligands inhibit PMA-mediated induction of COX-2 transcription. A, 184B5/HER cells were treated with vehicle (lane 1), PMA (50 ng/ml, lane 2), or PMA (50 ng/ml) and ciglitazone (10, 15, 20, 25 and 35 µM; lanes 3-7, respectively) for 3 h. B, MSK Leuk1 cells were treated with vehicle (lane 1), PMA (50 ng/ml, lane 2), or PMA (50 ng/ml) and troglitazone (1, 10 and 25 µM; lanes 3-5, respectively) for 3 h. Total cellular RNA was isolated; 10 µg of RNA was added to each lane. The Northern blot was probed for COX-2 mRNA and 18 S rRNA. C, 184B5/HER cells were treated with vehicle (lane 1), PMA (50 ng/ml, lane 2), or PMA (50 ng/ml) and ciglitazone (10, 25, and 30 µM, lane 3-5) for 30 min. Nuclear run-offs were performed as described under "Experimental Procedures." The COX-2 and 18 S rRNA cDNAs were immobilized onto nitrocellulose membranes and hybridized with labeled nascent RNA transcripts.

Transient transfections were performed to elucidate further the effects of PMA and PPARgamma ligands on COX-2 transcription. PMA stimulated COX-2 promoter activity, an effect that was blocked by both ciglitazone (Fig. 5A) and 15d-PGJ2 (Fig. 5B). The suppressive effects of ciglitazone and 15d-PGJ2 were blocked by overexpressing a dominant negative form of PPARgamma . In addition to blocking transcriptional activation by endogenous PPARgamma , the dominant negative form of PPARgamma lacks the ability to recruit CBP (53). Additional transient transfections were performed to confirm the role of PPARgamma in mediating the inhibitory effects of ciglitazone and 15d-PGJ2. We examined the ability of a PPRE decoy oligonucleotide to prevent the inhibitory effects of ciglitazone and 15d-PGJ2 on PMA-mediated stimulation of COX-2 promoter activity. As shown in Fig. 6, the PPRE decoy oligonucleotide relieved the suppressive effects of both ciglitazone (Fig. 6A) and 15d-PGJ2 (Fig. 6B). In contrast, neither scrambled nor missense PPRE decoy oligonucleotides had any effect.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 5.   A dominant negative form of PPARgamma inhibits the suppressive effects of PPARgamma ligands. 184B5/HER cells were transfected with 0.9 µg of a human COX-2 promoter construct ligated to luciferase (-327/+59) and 0.2 µg pSVbeta gal. PPARgamma WT bars represent cells that received 0.9 µg of expression vector for wild-type PPARgamma ; PPARgamma DN bars represent cells that received 0.9 µg of expression vector for a dominant negative form of PPARgamma . The total amount of DNA in each reaction was kept constant at 2 µg by using corresponding empty expression vectors. Following transfection, cells were treated with vehicle (control), PMA (50 ng/ml), PMA plus 25 µM ciglitazone (A), or PMA plus 25 µM 15d-PGJ2 (B). Luciferase activity represents data that have been normalized to beta -galactosidase activity. Columns, means; bars, S.D.; n = 6.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 6.   Decoy PPRE relieves the suppressive effects of PPARgamma ligands on COX-2. 184B5/HER cells were transfected with 0.9 µg of a human COX-2 promoter construct ligated to luciferase (-327/+59) or COX-2 promoter plus decoy PPRE (0.4 µg) or COX-2 promoter plus scrambled PPRE (0.4 µg) or COX-2 promoter plus missense PPRE (0.4 µg). All cells received 0.2 µg of pSVbeta gal. The total amount of DNA in each reaction was kept constant at 2.0 µg by using empty vector. Cells were treated with vehicle (control), PMA (50 ng/ml), or PMA (50 ng/ml) plus either 20 µM ciglitazone (A) or 20 µM 15d-PGJ2 (B). Luciferase activity represents data that have been normalized to beta -galactosidase activity. Columns, means; bars, S.D.; n = 6.

To define the region of the COX-2 promoter (Fig. 7A) that responded to PMA and PPARgamma ligands, transient transfections were performed with a series of human COX-2 promoter deletion constructs. As shown in Fig. 7B, PMA treatment caused nearly a 4-fold increase in COX-2 promoter (-1432/+59) activity, an effect that was suppressed by ciglitazone. Both the inductive effect of PMA and the suppressive effect of ciglitazone were detected with all COX-2 promoter deletion constructs except the -52/+59 construct. A CRE is present between nucleotides -59 and -53, suggesting that this element may be responsible for mediating the effects of PMA. To test this notion, transient transfections were performed using COX-2 promoter constructs in which specific enhancer elements including the CRE were mutagenized. As shown in Fig. 7C, mutagenizing the CRE site caused a decrease in basal promoter activity and a loss of responsiveness to PMA. By contrast, mutagenizing the NF-IL6 or NFkappa B sites had little effect on COX-2 promoter function.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 7.   Localization of region of COX-2 promoter that mediates the effects of PMA and PPARgamma ligands. A, shown is a schematic of the human COX-2 promoter. B, 184B5/HER cells were transfected with 1.8 µg of a series of human COX-2 promoter deletion constructs ligated to luciferase (-1432/+59, -327/+59, -220/+59, -124/+59, and -52/+59) and 0.2 µg of pSVbeta gal. C, 184B5/HER cells were transfected with 1.8 µg of a series of human COX-2 promoter-luciferase constructs (-327/+59; KBM, ILM, CRM, and CRM-ILM) and 0.2 µg of pSVbeta gal. KBM represents the -327/+59 COX-2 promoter construct in which the NFkappa B site was mutagenized; ILM represents the -327/+59 COX-2 promoter construct in which the NF-IL6 site was mutagenized; CRM refers to the -327/+59 COX-2 promoter construct in which the CRE was mutagenized; CRM-ILM represents the -327/+59 COX-2 promoter construct in which both the NF-IL6 element and CRE were mutagenized. After transfection, cells were treated with vehicle (open columns), PMA (50 ng/ml, black columns), or PMA (50 ng/ml) plus ciglitazone (25 µM, stippled columns). Reporter activities were measured in cellular extract 6 h later. Luciferase activity represents data that have been normalized with beta -galactosidase activity. Columns, means; bars, S.D.; n = 6.

PPARgamma Ligands Inhibit COX-2 Expression via an Anti-AP-1 Mechanism-- Electrophoretic mobility shift assays were performed to identify the transcription factor that mediated the induction of COX-2 by PMA. PMA caused increased binding to the CRE site of the COX-2 promoter, an effect that was suppressed by ciglitazone (Fig. 8A) or 15d-PGJ2 (Fig. 8B). By contrast, PMA did not increase binding when the CRE site was mutagenized (data not shown). Supershift analyses identified c-Jun, c-Fos, and ATF-2 in the binding complex (Fig. 8C). Taken together, these results indicate that PMA stimulates the binding of the AP-1 transcription factor complex to the CRE of the COX-2 promoter; this effect was blocked by treatment with PPARgamma ligands.



View larger version (58K):
[in this window]
[in a new window]
 
Fig. 8.   PPARgamma ligands inhibit PMA-induced binding of AP-1 to the CRE of the COX-2 promoter. 5 µg of nuclear protein from 184B5/HER cells was incubated with a 32P-labeled oligonucleotide containing the CRE of COX-2. A, 184B5/HER cells were treated with vehicle (lane 1), PMA (50 ng/ml, lane 2), or PMA plus ciglitazone (10, 20, and 30 µM, lanes 3-5) for 4.5 h. B, 184B5/HER cells were treated with vehicle (lane 1), PMA (50 ng/ml, lane 2), or PMA plus 15d-PGJ2 (10, 15, 20, 25, and 30 µM, lanes 3-7) for 4.5 h. C, 184B5/HER cells were treated with vehicle (lane 1) or PMA (50 ng/ml, lane 2) for 4.5 h. Lanes 3-5 represent nuclear extract from PMA-treated cells incubated with antibodies to c-Jun (lane 3), c-Fos (lane 4), and ATF-2 (lane 5). In A-C, the protein DNA complex that formed was separated on a 4% polyacrylamide gel.

Additional experiments were done to define further the mechanism(s) by which PPARgamma ligands inhibit PMA-mediated induction of AP-1 activity. As shown in Fig. 9A, ciglitazone caused dose-dependent suppression of PMA-mediated activation of an AP-1 reporter plasmid (2xTRE-luciferase). Similar results were obtained with 15d-PGJ2 (data not shown). Moreover, PMA induced c-Jun, a component of the AP-1 transcription factor complex; this effect was also inhibited by ciglitazone (Fig. 9B) or 15d-PGJ2 (data not shown). To determine whether PPARgamma ligands blocked PMA-mediated induction of COX-2 solely via effects on c-Jun, transient transfections were performed. As shown in Fig. 10A, ciglitazone blocked PMA-mediated stimulation of COX-2 promoter activity, an effect that was partially reversed by overexpressing c-Jun. In addition to suppressing the expression of c-Jun, ligands of nuclear receptors can potentially inhibit AP-1 activity by other mechanisms. There is growing evidence, for example, that CREB-binding protein (CBP/p300) is important for optimal AP-1-dependent transcription (58). Addition of a PPARgamma ligand stimulates the interaction between PPARgamma and CBP/p300 (59, 60). Hence, PPARgamma ligand-mediated inhibition of AP-1 activity could also be a consequence of competition for limiting amounts of CBP/p300. To evaluate this possibility, transfection experiments were performed with a CBP/p300 expression vector. As shown in Fig. 10A, overexpression of CBP also partially relieved the suppressive effect of ciglitazone. Interestingly, when CBP and c-Jun were overexpressed together, the inhibitory effect of ciglitazone was essentially abrogated. By contrast, overexpressing NFkappa B, CEBP-alpha , or CREB did not relieve the inhibitory effects of ciglitazone (Fig. 10B).



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 9.   Ciglitazone inhibits PMA-mediated induction of AP-1 activity. A, 184B5/HER cells were cotransfected with 1.8 µg of 2xTRE-luciferase and 0.2 µg of pSVbeta gal. The AP-1 reporter plasmid (2xTRE-luciferase) is composed of two copies of the consensus TRE (TPA/PMA-responsive element) ligated to luciferase. After transfection, cells were treated with vehicle (control), PMA (50 ng/ml), or PMA (50 ng/ml) plus ciglitazone (0-40 µM) for 6 h. Luciferase activity represents data that have been normalized with beta -galactosidase activity. Columns, means; bars, S.D.; n = 6. B, 184B5/HER cells were treated with vehicle (lane 1), PMA (50 ng/ml, lane 2), or PMA plus ciglitazone (15, 20, 25, 30 µM, lanes 3-6) for 4.5 h. Cellular lysate protein (100 µg/lane) was loaded onto a 10% SDS-polyacrylamide gel, electrophoresed, and subsequently transferred onto nitrocellulose. The immunoblot was probed with an antibody specific for c-Jun.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 10.   Ligands of PPARgamma suppress PMA-mediated induction of COX-2 via effects on c-Jun and CBP. 184B5/HER cells were transfected with 0.9 µg of a human COX-2 promoter construct ligated to luciferase (-327/+59) and 0.2 µg of pSVbeta gal. A, c-Jun bar represents cells that received 0.45 µg of expression vector for c-Jun; the CBP bar received 0.45 µg of expression vector for CBP; the c-Jun + CBP bar received 0.45 µg each of expression vectors for c-Jun and CBP. B, the NF-kappa B, CREB, and CEBP-alpha bars received 0.9 µg each of expression vectors for NFkappa B, CREB, and CEBP-alpha , respectively. The total amount of DNA in each reaction was kept constant at 2 µg by using the corresponding empty expression vectors. Following transfection, cells were treated with vehicle (control), PMA (50 ng/ml), or PMA plus 25 µM ciglitazone for 7 h. Luciferase activity represents data that have been normalized with beta -galactosidase activity. Columns, means; bars, S.D.; n = 6.

BADGE, a synthetic ligand for PPARgamma , was recently identified (61). Although this compound binds to PPARgamma , it has no apparent transactivation function (61). In fact, unlike ciglitazone or 15d-PGJ2, BADGE did not stimulate PPRE3-tk-luciferase activity in 184B5/HER cells (data not shown). We wondered whether this compound would still possess anti-AP-1 activity and thereby block PMA-mediated induction of COX-2. Interestingly, BADGE caused dose-dependent suppression of PMA-mediated induction of COX-2 (Fig. 11A). To confirm that BADGE did possess anti-AP-1 activity, transient transfections were performed. As shown in Fig. 11B, BADGE caused concentration-dependent suppression of PMA-mediated activation of an AP-1 reporter plasmid.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 11.   BADGE, a synthetic antagonist for PPARgamma , inhibits PMA-mediated induction of COX-2. A, 184B5/HER cells were treated with vehicle (lane 2), PMA (50 ng/ml, lane 3), or PMA plus BADGE (100, 200, 300, 400, and 500 µM BADGE, lanes 4-8) for 4.5 h. Lane 1 represents a COX-2 standard. Cellular lysate protein (25 µg/lane) was loaded onto a 10% SDS-polyacrylamide gel, electrophoresed, and subsequently transferred onto nitrocellulose. The immunoblot was probed with antibody for COX-2. B, 184B5/HER cells were cotransfected with 1.8 µg of 2xTRE-luciferase and 0.2 µg of pSVbeta gal. Following transfection, cells were treated with vehicle (control), PMA (50 ng/ml), or PMA plus BADGE (0-500 µM) for 7 h. Luciferase activity represents data that have been normalized with beta -galactosidase activity. Columns, means; bars, S.D.; n = 6.



    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

PPARgamma ligands, like ligands of other nuclear receptors, modulate gene expression by multiple mechanisms. In the current study, we showed that PPARgamma ligands suppressed the induction of COX-2 by an anti-AP-1 mechanism. The AP-1 transcription factor complex consists of a collection of dimers of members of the Jun, Fos, and ATF cAMP-response element-binding protein bZip families. Little is known about the potential of PPARgamma ligands to interfere with AP-1-mediated gene expression. Transient transfection analyses indicated that the CRE site of the COX-2 promoter was important for the inductive effects of PMA. Electrophoretic mobility gel shift analyses showed that treatment with PMA augmented binding to the CRE of the COX-2 promoter; c-Jun, c-Fos, and ATF-2 were identified in the DNA binding complex. These findings are consistent with previous reports in which both AP-1 and the CRE were found to be important for the induction of COX-2 in human epithelial cells (57, 62, 63). The results are also consistent with the observations of Xie and Herschman (64, 65) who were the first to demonstrate the importance of c-Jun and the CRE site for mediating the induction of COX-2. Importantly, several different results support the idea that ligands of PPARgamma block the induction of COX-2 by antagonizing AP-1. First, PPARgamma ligands blocked PMA-, taxol-, and sphingomyelinase-mediated induction of COX-2 (Fig. 2); each of these inducers has been reported to stimulate AP-1-mediated induction of COX-2 transcription (56, 57, 62, 63). Second, PPARgamma ligands inhibited PMA-mediated increases in AP-1 binding to the CRE of the COX-2 promoter. Finally, ligands of PPARgamma suppressed PMA-mediated activation of an AP-1 reporter plasmid.

Ligands of nuclear receptors, e.g. retinoids, have been reported to antagonize AP-1-mediated transcription by a variety of mechanisms (66, 67). Hence, additional experiments were performed to elucidate the mechanism(s) by which PPARgamma ligands inhibited AP-1-mediated induction of COX-2. We found that ligands of PPARgamma blocked PMA-mediated induction of c-Jun, a component of the AP-1 transcription factor complex. The functional significance of this effect was confirmed by the finding that overexpressing c-Jun partially relieved the suppressive effects of ciglitazone on PMA-mediated induction of COX-2 promoter activity. Recent studies also suggest that transcriptional activation by AP-1 requires the coactivators CBP/p300 (68). Ligands of PPARgamma stimulate the interaction between PPARgamma and CBP (59, 60). Hence, competition for limiting amounts of these proteins represents a mechanism for transrepression by nuclear receptors including PPARgamma . In fact, CBP was recently implicated in PPARgamma -dependent repression of the inducible nitric-oxide synthase gene (33). Transient transfections were performed to investigate the potential of CBP to regulate COX-2 transcription. Overexpressing CBP partially reversed the suppressive effects of PPARgamma ligands; this suggests that PPARgamma ligands inhibited the stimulation of COX-2 promoter activity, in part, via a squelching mechanism. In support of this idea, overexpressing a dominant negative form of PPARgamma that cannot bind CBP prevented the suppressive effect of PPARgamma ligands (Fig. 5). When c-Jun and CBP were overexpressed simultaneously, the inhibitory effects of PPARgamma ligands were essentially abrogated. To our knowledge, these findings represent the first evidence that PPARgamma ligands can antagonize AP-1-mediated gene expression by multiple mechanisms (Fig. 12). Moreover, we are unaware of any prior work demonstrating that CBP is important for regulating COX-2 gene expression. Retinoids and dexamethasone, known ligands of nuclear receptors, can block the activation of COX-2 gene expression (55, 69). A potential role for CBP/p300 in mediating these suppressive effects is suggested by the findings of the current study.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 12.   Schematic of proposed mechanism by which PPARgamma ligands inhibit AP-1-mediated activation of COX-2 transcription. CBP/p300 links AP-1 with components of the basal transcription machinery. TBP, TATA-box-binding protein; TFIIB, transcription factor IIB; RNA Pol II, RNA polymerase II. Treatment with PMA increases the binding of AP-1 to the CRE site of the COX-2 promoter thereby enhancing transcription. This stimulatory effect of PMA is blocked by cotreatment with a PPARgamma ligand. PPARgamma ligands inhibit PMA-mediated induction of COX-2 by two mechanisms as follows: 1) induction of c-Jun, a component of the AP-1 transcription factor complex, is blocked; 2) binding of a PPARgamma ligand to its receptor enhances the interaction between CBP/p300 and PPARgamma . This results in less CBP/p300 being available for AP-1-mediated activation of COX-2, a process known as squelching.

Overexpressing a dominant negative form of PPARgamma or a PPRE decoy oligonucleotide relieved the suppressive effect of PPARgamma ligands on COX-2 expression. Both treatments suppress PPARgamma -mediated transactivation of gene expression (38, 53) suggesting that PPARgamma ligands could mediate their inhibitory effects on COX-2 induction by modulating the transcription of an unknown PPARgamma -responsive gene. This might contribute, in turn, to the observed anti-AP-1 effect of PPARgamma ligands. Recently, PPARgamma ligands were found to suppress the induction of COX-2 in PPARgamma (-/-) macrophages (70); this suggested that this class of compounds could act via a PPARgamma -independent mechanism. By contrast, in our epithelial cell model, overexpressing a dominant negative form of PPARgamma blocked the inhibitory effects of PPARgamma ligands on COX-2 expression. Thus, PPARgamma is required for mediating the suppressive effects of PPARgamma ligands on COX-2 expression in this cell system.

Clearly, PPARgamma can induce transcriptional activation through specific DNA sites or inhibit the transcription factor AP-1. A pharmacological approach was used to determine whether these two types of receptor actions were mechanistically distinct. As noted above, BADGE is a synthetic ligand that binds to the receptor but is unable to transactivate genes via PPARgamma (61). We investigated whether this functionally restricted PPARgamma ligand blocked the induction of COX-2 or AP-1 activity like other PPARgamma ligands. Importantly, although BADGE did not activate PPARgamma , it suppressed PMA-mediated induction of AP-1 activity and COX-2 expression. This finding suggests that it may be feasible to develop a class of PPARgamma ligands that selectively inhibit AP-1 activity without stimulating transcription. There is precedent for this idea. AP-1-selective retinoids have been developed (71); these retinoids inhibit AP-1 activity but are unable to stimulate transcription (71). AP-1-selective PPARgamma ligands would be anticipated to have different therapeutic properties and toxicity than traditional PPARgamma ligands.

Selective COX-2 inhibitors possess both chemopreventive and anti-inflammatory properties. Compounds that interfere with the signaling mechanisms that stimulate COX-2 transcription should also inhibit carcinogenesis and decrease inflammation. In support of this idea, PPARgamma ligands can inhibit carcinogenesis (44-46) and reduce inflammation (32, 41). Several of the known anti-neoplastic properties of PPARgamma ligands may be explained, in part, by their ability to inhibit COX-2 expression and PG biosynthesis. For example, overexpression of COX-2 promotes angiogenesis (72) and inhibits apoptosis (73), whereas PPARgamma ligands inhibit both of these effects (38-40, 42). Both selective COX-2 inhibitors and PPARgamma ligands protect against breast cancer in experimental animals (27, 46). Local production of estrogen in breast adipose tissue, a reaction catalyzed by aromatase, has been implicated in the development of breast cancer. Interestingly, the synthesis of aromatase is stimulated by PGE2 (74) and inhibited by PPARgamma ligands (75). Our finding that PPARgamma ligands block the induction of COX-2 and PGE2 synthesis may be important, therefore, for understanding how PPARgamma ligands inhibit mammary carcinogenesis (46).

Finally, the results of this study may provide additional insights into the mechanisms underlying the anti-diabetic effects of PPARgamma ligands. COX-2 is constitutively expressed in pancreatic islet cells (76). Prostaglandin E2 negatively modulates glucose-induced insulin secretion, an effect that can be blocked by inhibitors of COX (54). The discovery that PPARgamma ligands inhibit the production of COX-2-derived PGE2 may help to explain the hypoglycemic effects of this class of agents.


    FOOTNOTES

* This work was supported in part by National Institutes of Health Grants P01 CA29502, 1 R01 CA89578, and T32 CA09685, the Cancer Research Foundation of America, and the James E. Olson Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: New York Presbyterian Hospital-Cornell Campus, Division of Gastroenterology and Hepatology, 1300 York Ave., Rm. F-203A, New York, NY 10021. Tel.: 212-746-4402; Fax: 212-746-4885; E-mail: ksubba@med.cornell.edu.

Published, JBC Papers in Press, January 23, 2001, DOI 10.1074/jbc.M007237200


    ABBREVIATIONS

The abbreviations used are: COX, cyclooxygenase; AP-1, activator protein-1; CRE, cyclic AMP response element; PG, prostaglandin; 15d-PGJ2, 15-deoxy-Delta 12,14 prostaglandin J2; PMA, phorbol 12-myristate 13-acetate; PPAR, peroxisome proliferator-activated receptor; CBP, CREB-binding protein; PPRE, PPAR response element.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES


1. Smith, W. L., Garavito, R. M., and DeWitt, D. L. (1996) J. Biol. Chem. 271, 33157-33160
2. Smith, W. L., and DeWitt, D. L. (1995) Semin. Nephrol. 15, 179-194
3. Kujubu, D. A., Fletcher, B. S., Varnum, B. C., Lim, R. W., and Herschman, H. R. (1991) J. Biol. Chem. 266, 12866-12872
4. Jones, D. A., Carlton, D. P., McIntyre, T. M., Zimmerman, G. A., and Prescott, S. M. (1993) J. Biol. Chem. 268, 9049-9054
5. DuBois, R. N., Awad, J., Morrow, J., Roberts, L. J., and Bishop, P. R. (1994) J. Clin. Invest. 93, 493-498
6. Inoue, H., Yokoyama, C., Hara, S., Tone, Y., and Tanabe, T. (1995) J. Biol. Chem. 270, 24965-24971
7. Simmons, D. L., Levy, D. B., Yannoni, Y., and Erikson, R. L. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 1178-1182
8. Subbaramaiah, K., Telang, N., Ramonetti, J. T., Araki, R., DeVito, B., Weksler, B. B., and Dannenberg, A. J. (1996) Cancer Res. 56, 4424-4429
9. Mestre, J. R., Subbaramaiah, K., Sacks, P. G., Schantz, S. P., Tanabe, T., Inoue, H., and Dannenberg, A. J. (1997) Cancer Res. 57, 2890-2895
10. Anderson, G. D., Hauser, S. D., McGarity, K. L., Bremer, M. E., Isakson, P. C., and Gregory, S. A. (1996) J. Clin. Invest. 97, 2672-2679
11. Lipsky, P. E., and Isakson, P. C. (1997) J. Rheumatol. 24 Suppl. 49, 9-14
12. Dannenberg, A. J., and Zakim, D. (1999) Semin. Oncol. 26, 499-504
13. Simon, L. S., Weaver, A. L., Graham, D. Y., Kivitz, A. J., Lipsky, P. E., Hubbard, R. C., Isakson, P. C., Verburg, K. M., Yu, S. S., Zhao, W. W., and Geis, G. S. (1999) J. Am. Med. Assoc. 282, 1921-1928
14. Kutchera, W., Jones, D. A., Matsunami, N., Groden, J., McIntyre, T. M., Zimmerman, G. A., White, R. L., and Prescott, S. M. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 4816-4820
15. Sheng, G. G., Shao, J., Sheng, H., Hooton, E. B., Isakson, P. C., Morrow, J. D., Coffey, R. J., DuBois, R. N., and Beauchamp, R. D. (1997) Gastroenterology 113, 1883-1891
16. Kargman, S. L., O'Neil, G. P., Vickers, P. J., Evans, J. F., Mancini, J. A., and Jothy, S. (1995) Cancer Res. 55, 2556-2559
17. Ristimaki, A., Honkanen, N., Jankala, H., Sipponen, P., and Harkonen, M. (1997) Cancer Res. 57, 1276-1280
18. Parett, M. L., Harris, R. E., Joarder, F. S., Ross, M. S., Clausen, K. P., and Robertson, F. M. (1997) Int. J. Oncol. 10, 503-507
19. Chan, G., Boyle, J. O., Yang, E. K., Zhang, F., Sacks, P. G., Shah, J. P., Edelstein, D., Soslow, R. A., Koki, A. T., Woerner, B. M., Masferrer, J. L., and Dannenberg, A. J. (1999) Cancer Res. 59, 991-994
20. Tucker, O. N., Dannenberg, A. J., Yang, E. K., Zhang, F., Teng, L., Daly, J. M., Soslow, R. A., Masferrer, J. L., Woerner, B. M., Koki, A. T., and Fahey, T. J. (1999) Cancer Res. 59, 987-990
21. Oshima, M., Dinchuk, J. E., Kargman, S. L., Oshima, H., Hancock, B., Kwong, E., Trzaskos, J. M., Evans, J. F., and Taketo, M. M. (1996) Cell 87, 803-809
22. Tiano, H., Chulada, P., Spalding, J., Lee, C., Loftin, C., Mahler, J., Morham, S., and Langenbach, R. (1997) Proc. Am. Assoc. Cancer Res. 38, 1727
23. Kawamori, T., Rao, C. V., Seibert, K., and Reddy, B. S. (1998) Cancer Res. 58, 409-412
24. Fischer, S. M., Lo, H.-H., Gordon, G. B., Seibert, K., Kelloff, G., Lubet, R. A., and Conti, C. C. (1999) Mol. Carcinog. 25, 231-240
25. Sheng, H., Shao, J., Kirkland, S. C., Isakson, P., Coffey, R. J., Morrow, J., Beauchamp, R. D., and DuBois, R. N. (1997) J. Clin. Invest. 99, 2254-2259
26. Sawaoka, H., Kawano, S., Tsuji, S., Tsujii, M., Gunawan, E. S., Takei, Y., Nagano, K., and Hori, M. (1998) Am. J. Physiol. 274, G1061-G1067
27. Harris, R. E., Alshafie, G. A., Abou-Issa, H., and Seibert, K. (2000) Cancer Res. 60, 2101-2103
28. Steinbach, G., Lynch, P. M., Phillips, R. K. S., Wallace, M. H., Hawk, E., Gordon, G. B., Wakabayashi, N., Saunders, B., Shen, Y., Fujimura, T., Su, L. K., and Levin, B. (2000) N. Engl. J. Med. 342, 1946-1952
29. Kerstein, S., Desvergne, B., and Wahli, W. (2000) Nature 405, 421-424
30. Meade, E. A., McIntyre, T. M., Zimmerman, G. A., and Prescott, S. M. (1999) J. Biol. Chem. 274, 8328-8334
31. Ricote, M., Li, A. C., Willson, T. M., Kelly, C. J., and Glass, C. K. (1998) Nature 391, 79-82
32. Su, C. G., Wen, X., Bailey, S. T., Jiang, W., Rangwala, S. M., Keilbaugh, S. A., Flanigan, A., Murthy, S., Lazar, M. A., and Wu, G. (1999) J. Clin. Invest. 104, 383-389
33. Li, M., Pascual, G., and Glass, C. K. (2000) Mol. Cell. Biol. 20, 4699-4707
34. Inoue, H., Tanabe, T., and Umesono, K. (2000) J. Biol. Chem. 275, 28028-28032
35. Nolan, J. J., Ludvik, B., Beerdsen, P., Joyce, M., and Olefsky, J. (1994) N. Engl. J. Med. 331, 1188-1193
36. Tontonoz, P., Singer, S., Forman, B. M., Sarraf, P., Fletcher, J. A., Fletcher, C. D. M., Brun, R. P., Mueller, E., Altiok, A., Oppenheim, H., Evans, R. M., and Spiegelman, B. M. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 237-241
37. Mueller, E., Sarraf, P., Tontonoz, P., Evans, R. M., Martin, K. J., Zhang, M., Fletcher, C., Singer, S., and Spiegelman, B. M. (1998) Mol. Cell 1, 465-470
38. Bishop-Bailey, D., and Hla, T. (1999) J. Biol. Chem. 274, 17042-17048
39. Chang, T.-H., and Szabo, E. (2000) Cancer Res. 60, 1129-1138
40. Tsubouchi, Y., Sano, H., Kawahito, Y., Mukai, S., Yamada, R., Kohno, M., Inoue, K., Hla, T., and Kondo, M. (2000) Biochem. Biophys. Res. Commun. 270, 400-405
41. Kawahito, Y., Kondo, M., Tsubouchi, Y., Hashiramoto, A., Bishop-Bailey, D., Inoue, K.-I., Kohno, M., Yamada, R., Hla, T., and Sano, H. (2000) J. Clin. Invest. 106, 189-197
42. Xin, X., Yang, S., Kowalski, J., and Gerritsen, M. E. (1999) J. Biol. Chem. 274, 9116-9121
43. Brockman, J. A., Gupta, R. A., and Gupta, R. N. (1998) Gastroenterology 115, 1049-1055
44. Kubota, T., Koshizuka, K., Williamson, E. A., Asou, H., Said, J. W., Holden, S., Miyoshi, I., and Koeffler, H. P. (1998) Cancer Res. 58, 3344-3352
45. Demetri, G. D., Fletcher, C. D. M., Mueller, E., Sarraf, P., Naujoks, R., Campbell, N., Spiegelman, B. M., and Singer, S. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 3951-3956
46. Suh, N., Wang, Y., Williams, C. R., Risingsong, R., Gilmer, T., Willson, T. M., and Sporn, M. B. (1999) Cancer Res. 59, 5671-5673
47. Zhai, Y.-F., Beittenmiller, H., Wang, B., Gould, M. N., Oakley, C., Esselman, W. J., and Welsch, C. W. (1993) Cancer Res. 53, 2272-2278
48. Sacks, P. G. (1996) Cancer Metastasis Rev. 15, 27-51
49. Denizot, F., and Lang, R. (1986) J. Immunol. Methods 89, 271-277
50. Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randell, R. J. (1951) J. Biol. Chem. 193, 265-275
51. Laemmli, U. K. (1970) Nature 227, 680-685
52. Towbin, H., Staehelin, T., and Gordon, J. (1979) Proc. Natl. Acad. Sci. U. S. A. 76, 4350-4354
53. Gurnell, M., Wentworth, J. M., Agostini, M., Adams, M., Collingwood, T. N., Provenzano, C., Browne, P. O., Rajanayagam, O., Burris, T. P., Schwabe, J. W., Lazar, M. A., and Chatterjee, V. K. K. (2000) J. Biol. Chem. 275, 5754-5759
54. Robertson, R. P. (1998) Diabetes 47, 1379-1383
55. Mestre, J. R., Subbaramaiah, K., Sacks, P. G., Schantz, S. P., Tanabe, T., Inoue, H., and Dannenberg, A. J. (1997) Cancer Res. 57, 1081-1085
56. Subbaramaiah, K., Chung, W. J., and Dannenberg, A. J. (1998) J. Biol. Chem. 273, 32943