![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 16, 12827-12831, April 20, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,
,
From the
Department of Radiation Oncology, Emory
University, Atlanta, Georgia 30335, the § Lawrence Berkeley
National Laboratory, Berkeley, California 94720 and the ¶ Sealy
Center for Molecular Science, University of Texas Medical Branch,
Galveston, Texas 77555
Received for publication, December 4, 2000, and in revised form, January 17, 2001
| |
ABSTRACT |
|---|
|
|
|---|
One of the hallmarks of ionizing radiation
exposure is the formation of clustered damage that includes closely
opposed lesions. We show that the Ku70/80 complex (Ku) has a role in
the repair of closely opposed lesions in DNA. DNA containing a
dihydrouracil (DHU) close to an opposing single strand break was used
as a model substrate. It was found that Ku has no effect on the
enzymatic activity of human endonuclease III when the substrate DNA
contains only DHU. However, with DNA containing a DHU that is closely
opposed to a single strand break, Ku inhibited the nicking activity of human endonuclease III as well as the amount of free double strand breaks induced by the enzyme. The inhibition on the formation of a free
double strand break by Ku was found to be much greater than the
inhibition of human endonuclease III-nicking activity by Ku.
Furthermore, there was a concomitant increase in the formation of
Ku-DNA complexes when endonuclease III was present. Similar results
were also observed with Escherichia coli endonuclease III.
These results suggest that Ku reduces the formation of endonuclease III-induced free double strand breaks by sequestering the double strand
breaks formed as a Ku-DNA complex. In doing so, Ku helps to avoid the
formation of the intermediary free double strand breaks, possibly
helping to reduce the mutagenic event that might result from the
misjoining of frank double strand breaks.
Ionizing radiation generates a wide spectrum of DNA damages
including single-stranded breaks, base lesions, abasic sites, double-stranded breaks, multiple damage sites, and DNA-protein and
DNA-DNA cross-links (1-2). The energy from low linear energy transfer-ionizing radiation is not dispersed uniformly in the absorbing medium but is dispersed along the tracks of the charge particles (3). These nonrandom ionized tracks, consisting of "spurs" and "blobs" when traversing a DNA molecule, will
generate lesions that are clustered within a small region (3). These clustered lesions commonly referred to as multiple damage sites are the
hallmarks of exposure to ionizing radiation (4-7). The composition of
lesions within these clusters is not clear; however, they are expected
to consist predominantly of a random mixture of abasic sites, base
lesions, and strand breaks (6-7).
Recently, it was demonstrated that base lesions that are in close
proximity to each other are repaired at a reduced rate as compared with
isolated base lesions. Bacterial base excision repair enzymes, such as
endonuclease III and
formamidopyrimidine-N-glycosylase, were shown to be
inhibited by nicks formed either directly opposite or closely opposed
to a base lesion (8-12). The biological relevance of this inhibition
is not clear; however, it was thought that this would help to
reduce the formation of double strand breaks. In mammalian cells,
double strand breaks are repaired primarily through the nonhomologous
end-joining reaction involving the DNA end-binding protein
Ku1 and the catalytic subunit
of a DNA-dependent protein kinase, p450 (13-17).
In this study, we show that Ku binds to a nick opposite of DHU, leading
to an inhibition of endonuclease III activity. Furthermore, we show
that the presence of Ku at the nick helps to prevent the formation of
free double strand breaks by tethering the new ends generated by
endonuclease III-induced cleavage. Based on these observations, we
suggest that the formation of the DNA-Ku complex immediately after the
enzymatic processing of the closely opposed lesion is important for
channeling the double strand break directly to the end-joining reaction
to avoid the possibility of aberrant recombination through the
misjoining of different molecules containing double strand breaks.
DNA Substrates--
All oligonucleotides were obtained from
Operon and purified by polyacrylamide gel (15%) electrophoresis as
described previously (18). Oligonucleotides containing DHU were
5'-end-labeled with [
Duplex N:
5'-CACCCGTCTACTCCAQCC-CAACCAACCGTGTATTCTATAGTGCACCTGGTTC
GTGGGCAGATGAGGTGGG
GTTGGTTGGCACATAAGATATCACGTGGATTAAG
Duplex L:
5'-CACCCGTCTACTCCAQCCCAACCAACCGTGTATTCTATAGTGCACCTGGTTC
GTGGGCAGATGAGGTGGGGTTGGTTGGCACATAAGATATCACGTGGATTAAG
Duplex N contained a DHU that was placed three
nucleotides 5' to a nick on the opposite strand. It is expected that
incubating duplex N with endonuclease III at room temperature will
generate a double strand break. Duplex L differed from duplex N only in that it lacked a nick. Incubating duplex L with endonuclease III should
generate a single strand break in the DNA.
Enzymes and Proteins--
Escherichia coli
endonuclease III was purified from an overproducing strain employing
MonoS, MonoQ and phenyl-Sepharose column chromatography as described
previously (19). Human endonuclease III was purified by Dr. Robindra
Roy (20). Ku was purified by Dr. David Chen according to an earlier
published procedure (21).
Endonuclease III Assay--
Endonuclease III was assayed in a
standard reaction buffer (10 µl) containing 0.1 M KCl, 10 mM Tris-HCl, pH 7.5, 20 fmol of DNA substrate, and 20 fmol
of endonuclease III. The reaction was performed at 37 °C for 10 min
(22). The reaction was stopped with 10 µl of polyacrylamide
gel-loading buffer (90% formamide, 1 mM EDTA, 0.1%
xylene, and 0.1% bromphenol blue) and heated to 90 °C for 10 min.
3-5 µl of the reaction were loaded onto a 12.5% denaturing
polyacrylamide gel and electrophoresed at 2000 V for 1.5 h. The
polyacrylamide gel was then dried, and the amount of endonuclease
III-induced nicks was estimated by using the STORM PhosphorImager
(Molecular Dynamics).
To determine the amount of double strand breaks induced by endonuclease
III, at the end of 10 min of incubation, reactions were stopped with
the gel-loading buffer and then assayed with 10% nondenaturing
polyacrylamide gel. The double strand break assay is identical to the
electrophoretic mobility shift assay described below.
Electrophoretic Mobility Shift Assay--
The binding reaction
(10 µl) was performed in a standard endonuclease III reaction mixture
containing 0.1 M KCl, 10 mM Tris-HCl, pH 7.5, 20 fmol of DNA substrate, and increasing amounts of Ku (10-300 fmol).
In some reactions, 20 fmol of endonuclease III were added. After 10 min
at 37 °C, 5 µl of the reaction mixtures were added to 5 µl of
polyacrymide gel-loading buffer and heated to 90 °C for 10 min. The
amount of endonuclease III-induced nicks was assayed as described in
the previous section. The remainder (5 µl) of the binding reaction
was subjected immediately to electrophoretic mobility shift
assay as described below.
Electrophoretic mobility shift assay was performed with a 10%
polyacrylamide gel containing acrylamide/N,
N'-methylenebisacrylamide at 19.76/0.24 ratio as described
previously (18). The gels were pre-electrophoresed in TBE buffer (89 mM Tris, 89 mM boric acid, pH 8.3 and 2.5 mM EDTA) at 300 V (4 °C) for 30 min. Samples were loaded
onto the gel, and electrophoresis was continued at 300 V (4 °C) for
an additional 150 min. After electrophoresis, the gels were dried under
vacuum and exposed to x-ray film. The radioactive bands in the dried
gels were quantified with the STORM PhosphorImager.
Effect of Ku on Human and E. coli Endonuclease III
Activities--
Dihydrouracil, a product of the anoxic radiolysis of
deoxycytidine is readily recognized by human and E. coli
endonuclease III (20). To examine the role of Ku in the repair of
closely opposed lesions, duplex N that contained a DHU in close
proximity opposite to a nick was used as a substrate for endonuclease
III. Endonuclease III-induced cleavage of the DNA strand containing DHU
of duplex N will generate an additional nick opposite to the pre-existing nick that is separated from each other by only three nucleotides. At room temperature, this will result in a double strand
break that can be detected by electrophoresis in a nondenaturing polyacrylamide gel. Ku is known to bind to DNA ends and nicks (23-24),
and thus it might interfere with endonuclease III activity on duplex N. In contrast, Ku would be expected to have little or no effect on the
cleavage activity of endonuclease III on duplex L.
Fig. 1 shows the effect of Ku on the
human endonuclease III activity on DNA duplex L in which the
DHU-containing strands were labeled at their 5' ends with
32P. Ku is known to bind to only DNA ends and nicks and has
not been shown to have any endonuclease activity. Fig. 1A
shows that incubating with increasing amounts of Ku did not lead to an
appreciable nicking of duplex L (Fig. 1A, lanes
1-7). A small amount of background cleavage (approximately
5-10%) was frequently observed with the DNA preparations. Because Ku
does not cleave DNA-containing dihydrouracil, no detectable double
strand breaks were observed in the presence of increasing amounts of Ku
(Fig. 1C, lanes 1-7). Double strand break was
assayed by the formation of a species migrating faster than the free
DNA substrate. Double strand break formation was assayed with
nondenaturing polyacrylamide gel electrophoresis, an assay that is
identical to the electrophoretic mobility shift assay used for
detecting the various Ku-DNA complexes. Under these electrophoresis
conditions, the various Ku-DNA complexes that migrated slower than the
free DNA substrate were readily observed. Incubating duplex L with
human endonuclease III led to a substantial cleavage occurring at the
dihydrouracil lesion (Fig. 1B, lane 1); however,
incubating endonuclease III with increasing concentrations of Ku had
little or no effect on the human endonuclease activity on duplex L
(Fig. 1B, lanes 2-7). Because cleavage of duplex
L by human endonuclease III will only lead to a nick in a duplex DNA,
no appreciable amount of double strand breaks was observed when duplex
L was incubated with endonuclease III (Fig. 1D, lanes 1-7). However, when duplex N was used as a substrate, low
concentrations of Ku (below 50 fmol) had little effect on the human
endonuclease III activity (Fig.
2B, compare lane 1 with
lanes 2-4); however, at higher concentrations of Ku (above 50 fmol), the inhibition of human endonuclease III activity was observed
(Fig. 2B, compare lane 1 with lanes 5-7). At low
concentrations of Ku, the observed endonucleolytic activity of human
endonuclease III was also accompanied by a concomitant generation of
free double strand breaks (Fig. 2D, compare lane 1 with lanes 2-4). Since higher concentrations of Ku (above 100 fmol) were found to inhibit the nicking of duplex N, the formation of
free double strand breaks was also inhibited at higher Ku
concentrations.
Similar results were also obtained with E. coli endonuclease
III with the exception that increasing concentrations of Ku appeared to
have a nonspecific inhibitory effect on duplex L (Fig.
3B, lanes 1-7) and
duplex N (Fig. 4B, lanes
1-7). Like the results obtained for human endonuclease III,
increasing concentrations of Ku did not lead to an appreciable
production of double strand breaks with duplex L (Fig. 3D).
As expected, increasing Ku concentrations led to an increased
inhibition of double strand breaks formation induced by E. coli endonuclease III (Fig. 4D).
The gel data presented in Figs. 1-4 are qualitative. To obtain
quantitative analysis of these observations, these experiments were
repeated three times, and the amount of endonuclease III-induced nicks
and double strand breaks was quantified using a PhosphorImager. The
average amount of nicks or double strand breaks generated by
endonuclease III was plotted against the amount of Ku present during
the reactions. Fig. 5A shows
that increasing concentrations of Ku had no effect on the human
endonuclease III activity on duplex L, even at 15-fold molar excess
(300 fmol) over human endonuclease III. Similarly, low concentrations
of Ku (below 50 fmol) did not affect the human endonuclease III
activity appreciably on duplex N (Fig. 5B); however, at
higher concentrations of Ku (above 50 fmol), the inhibition of human
endonuclease III activity was observed (Fig. 5B). It is
important to point out that at low concentrations of Ku, the observed
human endonuclease III activity on duplex N was paralleled by the
formation of free double strand breaks induced by endonuclease III;
however, at higher concentrations of Ku, the formation of free double
strand breaks was inhibited to a greater extent than the production of
nicks by human endonuclease III (Fig. 5B). At 100 fmol of Ku
(5-fold molar excess of Ku70/80 over endonuclease III), human
endonuclease III-nicking activity was inhibited by ~20%; however, at
the same concentration, the formation of free double strand breaks was
inhibited by >75%. The discrepancy observed between the amount of
human endonuclease III-induced nicks and free double strand breaks
suggests that in the presence of Ku, a substantial amount of the double
strand breaks induced by human endonuclease III did not result in free double strand breaks but was sequestered and held together by Ku as a
DNA-Ku complex.
Similar results were also obtained with E. coli endonuclease
III with the exception that Ku appeared to have a weak nonspecific inhibitory effect (Fig. 5C). At higher concentrations of Ku,
E. coli endonuclease III activity was inhibited ~30% for
both substrates duplexes L and N (Fig. 5C). Similar to the
results obtained for human endonuclease III, the increasing
concentrations of Ku led to a much greater inhibition of the amount of
free double strand breaks formed as compared with the amount of nicks
generated by E. coli endonuclease III (Fig.
5D).
Fig. 5 show that the amount of free double strand breaks did not
correspond to the actual amount of nicks induced by human and E. coli endonucleases III in duplex N, suggesting that most of the
double strand breaks were sequestered and bridged by Ku as DNA-protein
complexes. Under nondenaturing conditions, it is clear that Ku forms
various complexes with both duplexes N and L (Figs. 1-4, C
and D). These DNA-Ku complexes were observed as slower
migrating species than the substrate DNA. It is known that Ku will bind
to the termini of a double-stranded DNA as a DNA-protein complex. In
addition, Ku can translocate along the DNA (25), allowing additional Ku
molecules to bind to the free DNA ends. As a result, Ku binds to a
double-stranded DNA like beads on a string and generates multimeric
Ku-DNA protein complexes. With Ku covering a 20-25-nucleotide
footprint, it is likely that a 56-mer duplex DNA can interact with Ku,
generating complexes containing 1, 2, or 3 Ku proteins (25,
26-28). Because endonuclease III reactions were performed at
37 °C, the binding assays were also performed at 37 °C. In the
absence of endonuclease III incubating duplex oligonucleotides with Ku,
three major slow migrating bands (complexes I, II, and III) were
observed (Figs. 1-4, C and D, arrows marked I,
II, and III). It is interesting to note that at
37 °C and at Ku protein concentrations below 50 fmol, little or no
stable binding of the Ku complex to duplex oligonucleotides was
observed (Figs. 1-4, C, lanes). However, when binding
reactions were performed at 20 °C, the formation of complexes I and
II can be readily observed even at 10 fmol of Ku (1:1 Ku/DNA ratio,
data not shown). Similarly, the incubating duplex oligonucleotides with
endonuclease III and increasing concentrations of Ku also generated
three DNA-Ku complexes (Figs. 1-4, D).
Effect of Human and E. coli Endonucleases III on Ku Binding to DNA
Containing DHU--
To have a quantitative estimate on the
interactions of Ku with duplexes N and L, each of the radioactive bands
corresponding to the various forms of Ku-DNA complexes was quantified
using a PhosphorImager and plotted as a function of Ku concentrations. Fig. 6 shows that when duplex L was used
as a DNA substrate, little or no stable binding of Ku to DNA was
observed at Ku concentrations below 50 fmol. At 300 fmol of Ku, ~30%
of the DNA was bound with two molecules of Ku (complex II), presumably
one at each end of the DNA. A smaller amount of complex I was observed.
It is interesting to note that under the reaction conditions used, the
amount of complex II formed was higher than the amount of complex I. Because duplex N is 56 nucleotides long, it is possible that the
binding of more Ku molecules to the DNA might promote interactions
among the Ku molecules, leading to increased stability for the DNA-Ku complex II as compared with DNA-Ku complex I. Only a small amount of
complex III was formed even at concentrations above 200 fmol. In the
presence of human endonuclease III (Fig. 6B), the
interaction of Ku with the DNA substrate led to an appreciable increase
in complex II, and as much as 50% of labeled DNA was bound as complex II. A similar increase in the level of complex II was also observed with E. coli endonuclease III (Fig. 6C). It is
possible that the binding of endonuclease III at the nick (generated by
the action of endonuclease III) or DHU lesion helps to stabilize
complex II, thus leading to an apparent increase in the amount of
complex II when endonuclease III is present. However, the levels of
complexes II and I were less affected by the presence of either human
or E. coli endonuclease III (Fig. 6, B and
C).
In the absence of endonuclease III, the binding of Ku to duplex N was
similar to that observed for duplex L. No appreciable stable binding of
Ku to duplex N was observed at concentrations below 50 fmol. Three
species of Ku-DNA complex were observed at higher concentrations of Ku
(data not shown). The formation of form I and II complexes was readily
observed, whereas the form III complex was only observed at relatively
high concentrations of Ku. Similarly, incubating duplex N with human
endonuclease III and increasing the amounts of Ku led to a significant
increase in the formation of complex II and a slight increase in that
of complex I (data not shown) while substantially inhibiting the formation of free double strand breaks. The parallel between the formation of complex II and the reduction in the number of free double
strand suggests that the double strand breaks formed were sequestered
by Ku and migrated as DNA-protein complexes. Similar results were also
observed with E. coli endonuclease III (data not shown).
It was shown earlier that base excision repair enzymes, such as
endonucleases III and VIII and
formamidopyrimidine-N-glycosylase, can efficiently remove 1 of 2 closely opposed base lesions (8-9) and produce a nick close to
the remaining lesion on the opposite strand. The removal of the
remaining base lesion is thereby inhibited. This inhibition was thought
to be important to reduce the possibility of generating free double
strand breaks by these repair enzymes. However, prolonged incubation or
the use of excess amounts of these N-glycosylases can
eventually convert all closely opposed lesions in DNA to frank double
strand breaks.
In humans, double strand breaks are primarily repaired by the
nonhomologous end-joining pathway involving Ku (13-17). Although free
double strand breaks are repaired readily in mammalian cells, it is
nevertheless desirable to avoid this formation to reduce the frequency
of misjoining, which might result in translocation mutagenesis. In the
processing of closely opposed base lesions, a nick is generated in
close proximity opposite to the remaining base lesion. We showed that
Ku binds to duplex N and inhibits endonuclease III activity on DHU
lesion opposite to a nick, suggesting that Ku might have a role in
modulating the repair of closely opposed base lesions. It has been
estimated that a human cell has as many as 500,000 molecules of Ku
(24). Thus, it is believed that the abundant Ku is always in excess
over endonuclease III and other repair N-glycosylases. Our
results suggest that in vivo Ku will inhibit the action of
endonuclease III on a lesion opposite to a nick. It is also interesting
to point out that Ku was demonstrated to inhibit the binding of
nucleotide excision repair proteins to a linear DNA (27). We suggest
that the binding of Ku to the nicked DNA will either help to recruit
DNA polymerase and ligase to the nick or provide extended time for
these enzymes to repair the intermediary nick. A model for the role of
Ku in the mediation of repair of the closely opposing lesion is
depicted in Fig. 7. It has been shown
that the binding of Ku to a nick does not inhibit the ligation reaction
catalyzed by either DNA ligase II or III. In fact, the binding of Ku
enhances these reactions (14). Recently, Ku-DNA complex was shown to
recruit DNA ligase IV and also interact directly with the human DNA
ligase IV (29, 30). However, it is not known whether the binding of Ku
to a nick will affect the rate of repair synthesis by DNA polymerase.
Once the nick is repaired, Ku should dissociate from the DNA, allowing
further excision of the remaining base lesion by human endonuclease
III. However, if the removal of the remaining lesion occurs before all
the nicks are repaired, any double strand DNA breaks generated will be
sequestered by Ku and channeled directly into the end-joining repair
pathway. In that case, no intermediary free double strand breaks are
formed, reducing the possibility of the misjoining of DNA ends.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-32P]ATP (Amersham Pharmacia
Biotech) using T4 polynucleotide kinase or 3'-end-labeled with
[
-32P]cordycepin 5'-triphosphate (PerkinElmer Life
Sciences) using terminal deoxynucleotidyltransferase following
the instructions from the enzyme supplier (U.S. Biochemical Corp.).
Labeled oligonucleotides containing DHU were annealed to the
appropriate complementary strands at 1:1.5 ratio in 10 mM
Tris-HCl, pH 7.5, 0.1 M NaCl, and 2 mM
2-mercaptoethanol by heating the mixture to 90 °C and cooling down
gradually to room temperature. The following oligonucleotide duplexes were used in this study (Q represents dihydrouracil):
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (38K):
[in a new window]
Fig. 1.
Effect of Ku on human endonuclease III
activity on duplex L. Human endonuclease III was assayed as
described under "Materials and Methods." At the end of 10 min, half
of the reaction mixtures were immediately assayed with nondenaturing
10% polyacrylamide gel for double strand break formation (C
and D). The remainder of the reaction mixtures were assayed
with denaturing 12.5% polyacrylamide gel for enzyme-induced nicks
(A and B). A, 20 fmol of duplex L were
incubated with an increasing amount of Ku in a standard endonuclease
III buffer at 37 °C for 10 min. Lane 1, duplex L only;
lanes 2-7, duplex L incubated with 10 (lane 2),
20 (lane 3), 50 (lane 4), 100 (lane
5), 200 (lane 6), and 300 fmol of Ku (lane
7). B, 20 fmol of duplex L were incubated with 20 fmol
of human endonuclease III and an increasing amount of Ku70/80 in a
standard endonuclease III buffer at 37 °C for 10 min. Lane
1, duplex L incubated with only human endonuclease III;
lanes 2-7, duplex L incubated with human endonuclease III
and 10 (lane 2), 20 (lane 3), 50 (lane
4), 100 (lane 5), 200 (lane 6), and 300 fmol
of Ku (lane 7). Arrow in B indicates
the position of the cleavage product (single-stranded 15-mer) generated
by human endonuclease III. C, the reaction is identical to
those described in A, with the exception that the reaction
mixtures were assayed using a 10% nondenaturing polyacrylamide gel.
D, the reaction is identical to those described in
B, with the exception that the reaction mixtures were
assayed using a 10% nondenaturing polyacrylamide gel. Three major slow
migrating species (I, II, and III)
were observed corresponding to the three different DNA-Ku complexes. A
faster migrating species corresponded to the position of a
double-stranded 15-mer, thus marking the position for the product of
double strand breaks.

View larger version (46K):
[in a new window]
Fig. 2.
Effect of Ku on human endonuclease III
activity on duplex N. Legend is identical to that of Fig. 1,
except that duplex N was used as the DNA substrate.

View larger version (39K):
[in a new window]
Fig. 3.
Effect of Ku on E. coli
endonuclease III activity on duplex L. Legend is identical
to that of Fig. 1, except that human endonuclease III was replaced with
E. coli endonuclease III on duplex L.

View larger version (58K):
[in a new window]
Fig. 4.
Effect of Ku on E. coli
endonuclease III activity on duplex N. Legend is identical
to that of Fig. 1, except that human endonuclease III was
replaced with E. coli endonuclease III on duplex N.

View larger version (12K):
[in a new window]
Fig. 5.
Effect of Ku on human and E. coli
endonuclease III activity. A, 20 fmol of duplex L
were incubated with 20 fmol of human endonuclease III and an increasing
amount of Ku in a standard endonuclease III buffer at 37 °C for 10 min. The amount of single strand breaks (
) and double strand
breaks (
) induced by human endonuclease III was measured by
electrophoresis on a 15% denaturing and 10% nondenaturing
polyacrylamide gel, respectively. Each data point is the average of
three independent experiments. B, 20 fmol of duplex N were
incubated with 20 fmol of human endonuclease III and an increasing
amount of Ku in a standard endonuclease III buffer at 37 °C for 10 min. The symbols used are the same as in A. C, 20 fmol of duplex L were incubated with 20 fmol of
E. coli endonuclease III and an increasing amount of Ku in a
standard endonuclease III buffer at 37 °C for 10 min. The
symbols used are same as in A. D, 20 fmol of duplex N were incubated with 20 fmol of E. coli
endonuclease III and an increasing amount of Ku70/80 in a standard
endonuclease III buffer at 37 °C for 10 min. The symbols
used are same as in A.

View larger version (15K):
[in a new window]
Fig. 6.
Effect of endonuclease III on the formation
of Ku-duplex L complexes. Complexes of Ku formed with duplex L
were resolved by electrophoresis in a 10% nondenaturing polyacrylamide
gel. A, 20 fmol of duplex L were incubated with an
increasing amount of Ku in a standard endonuclease III buffer at
37 °C for 10 min. B, 20 fmol of duplex L were incubated
with 20 fmol of human endonuclease III and an increasing amount of Ku
in a standard endonuclease III buffer at 37 °C for 10 min.
C, 20 fmol of duplex L were incubated with 20 fmol of
E. coli endonuclease III and an increasing amount of Ku in a
standard endonuclease III buffer at 37 °C for 10 min.
A-C, the amount of free DNA remaining (
) and the various
forms of Ku70/80-duplex L complexes (complex I (
), complex II (
),
and complex III (
)).
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (16K):
[in a new window]
Fig. 7.
Proposed role of Ku70/80 in the repair of
closely opposed base lesions.
| |
ACKNOWLEDGEMENT |
|---|
We thank Dr. Bernard Weiss for critical reading of the manuscript.
| |
FOOTNOTES |
|---|
* This work is supported by National Institutes of Health Grants GM 37216 and GM 54163 (to Y. W. K.), CA80917 (to R. R.), and CA50519 (to D. J. C.) and the Dept. of Energy Office of Health and Environmental Research (to D. J. C.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Division of Cancer
Biology, Dept. of Radiation Biology, Emory University School of
Medicine, 145 Edgewood Ave., Atlanta, GA 30335. Tel.: 404-616-6951; Fax: 404-616-5689; E-mail: ykow@emory.edu.
Published, JBC Papers in Press, January 25, 2001, DOI 10.1074/jbc.M010906200
| |
ABBREVIATIONS |
|---|
The abbreviations used are: Ku, Ku70/80 complex; DHU, dihydrouracil.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Huttermann, J., Kuhnlein, W., and Teoule, R. (1978) Effects of Ionizing Radiation on DNA: Physical, Chemical, and Biological aspects. , Springer-Verlag New York Inc., New York |
| 2. | Von Sonntag, C. (1987) The Chemical Basis of Radiation Biology. , Taylor & Francis Ltd., London |
| 3. | Hall, E. J. (1994) Radiobiology for the Radiobiologist , pp. 17-27, Lippincott Williams & Wilkins, Philadelphia |
| 4. | Ward, J. F. (1981) Radiat. Res. 86, 185-195 |
| 5. | Ward, J. F. (1988) Prog. Nucleic Acid Res. Mol. Biol. 35, 95-125 |
| 6. | Sutherland, B. M., Bennett, P. V., Sidorkina, O., and Laval, J. (2000) Biochemistry 39, 8026-8031 |
| 7. | Sutherland, B. M., Bennett, P. V., Sidorkina, O., and Laval, J. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 103-108 |
| 8. | Chaudhry, M. A., and Weinfeld, M. (1995) J. Mol. Biol. 249, 914-922 |
| 9. | Harrison, L., Hatahet, Z., Purmal, A. A., and Wallace, S. S. (1998) Nucleic Acids Res. 26, 932-941 |
| 10. | David-Cordonnier, M.-H., Laval, J., and O'Neill, P. (2000) J. Biol. Chem. 275, 11865-11873 |
| 11. | Takeshita, M., Chang, C. N., Johnson, F., Will, S., and Grollman, A. P. (1987) J. Biol. Chem. 262, 10171-10179 |
| 12. | Bourdat, A.-G., Gasparutto, D., and Cadet, J. (1999) Nucleic Acids Res. 27, 1016-1024 |
| 13. | Freidberg, E. C., Walker, G. C., and Siede, W. (1995) DNA Repair and Mutagenesis. , American Society of Microbiology Press, Washington, D. C. |
| 14. | Ramsden, D. A., and Gellert, M. (1998) EMBO J. 17, 609-614 |
| 15. | Chen, F., Peterson, S. R., Story, M. D., and Chen, D. J. (1996) Mutat. Res. 362, 9-19 |
| 16. | Rathmell, W. K., and Chu, G. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 7623-7627 |
| 17. | Blunt, T., Gell, D., Fox, M., Taccioli, G. E., Lehmann, A. R., Jackson, S. P., and Jeggo, P. A. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 10285-10290 |
| 18. | Yao, M., and Kow, Y. W. (1995) J. Biol. Chem. 270, 28609-28616 |
| 19. | Asahara, H., Wistort, P. M., Bank, J. F., Bakerian, R. H., and Cunningham, R. P. (1989) Biochemistry 10, 4444-4449 |
| 20. | Ikeda, S., Biswas, T., Roy, R., Izumi, T., Boldogh, I., Kurosky, A., Sarker, A. H., Seki, S., and Mitra, S. (1998) J. Biol. Chem. 273, 21585-21593 |
| 21. | Cary, R. B., Peterson, S. R., Wang, J., Bear, D. G., Bradbury, E. M., and Chen, D. J. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 4267-4272 |
| 22. | Kow, Y. W., and Wallace, S. S. (1987) Biochemistry 26, 8200-8206 |
| 23. | Rathmell, W. K., and Chu, G. (1998) in DNA Damage and Repair: DNA Repair in Higher Eukaryotes (Nickoloff, J. A. , and Hoekstra, M. F., eds), Vol. II , pp. 299-316, Humana Press Inc., Totowa, NJ |
| 24. | Bliss, T. M., and Lane, D. P. (1997) J. Biol. Chem. 272, 5765-5773 |
| 25. | de Vries, E., van Driel, W., Bergsma, W. G., Arnberg, A. C., and van der Vliet, P. C. (1989) J. Mol. Biol. 208, 65-78 |
| 26. | Frit, P., Calsou, P., Chen, D. J., and Salles, B. (1998) J. Mol. Biol. 284, 963-973 |
| 27. | Blier, P. R., Griffith, A. J., Craft, J., and Hardin, J. A. (1993) J. Biol. Chem. 268, 7594-7601 |
| 28. | Paillard, S., and Strauss, F. (1991) Nucleic Acids Res. 19, 5619-5624 |
| 29. | Chen, L., Trujillo, K., Sung, P., and Tomkinson, A. E. (2000) J. Biol. Chem. 275, 26196-26205 |
| 30. | McElhinny, S. A., Snowden, C. M., McCarville, J., and Ramsden, D. A. (2000) Mol. Cell. Biol. 20, 2996-3003 |
This article has been cited by other articles:
![]() |
I. Gaudreault, D. Guay, and M. Lebel YB-1 promotes strand separation in vitro of duplex DNA containing either mispaired bases or cisplatin modifications, exhibits endonucleolytic activities and binds several DNA repair proteins Nucleic Acids Res., January 12, 2004; 32(1): 316 - 327. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hashimoto, B. Imhoff, M. M. Ali, and Y. W. Kow HU Protein of Escherichia coli Has a Role in the Repair of Closely Opposed Lesions in DNA J. Biol. Chem., August 1, 2003; 278(31): 28501 - 28507. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |