Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M010629200 on January 22, 2001

J. Biol. Chem., Vol. 276, Issue 16, 13469-13475, April 20, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/16/13469    most recent
M010629200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Neumann, J.
Right arrow Articles by Koch, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Neumann, J.
Right arrow Articles by Koch, N.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Glycosylation Signals That Separate the Trimerization from the MHC Class II-binding Domain Control Intracellular Degradation of Invariant Chain*

Jürgen Neumann, Nicole Schach, and Norbert KochDagger

From the Section of Immunobiology, University of Bonn, 53117 Bonn, Römerstrasse 164, Germany

Received for publication, November 26, 2000, and in revised form, December 28, 2000



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Invariant chain (Ii) serves as a chaperone for folding and intracellular transport of major histocompatibility complex class II (MHCII) molecules. Early in biosynthesis, Ii associates with MHCII molecules and directs their intracellular transport to endocytic compartments where vesicular proteinases sequentially release Ii from the MHCII heterodimer. The detachment of Ii makes the MHCII groove susceptible for binding of antigenic peptides. We investigated the role of N-linked glycosylation in the controlled intracellular degradation of Ii. Motifs for asparagine-linked glycosylation were altered, and mutated Ii (IiNmut) was transiently expressed in COS cells. The half-life of IiNmut was strongly reduced compared with wild-type Ii although the sensitivity of the N glycan-free polypeptide to in vitro proteinase digestion was not substantially increased. Inhibition of vesicular proteinases revealed endosomal degradation of IiNmut. Intracellular proteolysis of IiNmut is substantially impaired by serine proteinase inhibitors. Thus, a considerable amount of IiNmut is degraded in nonacidic intracellular compartments. The data suggest that N-linked glycosylation of Ii hinders premature proteolysis in nonacidic vesicles resulting in Ii degradation in acidic MHC class II-processing compartments.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

MHC class II (MHCII)1 antigen presentation to CD4 T cells is a prerequisite for an antibody response against T cell-dependent antigens. In addition to Th2 cells, which help B cells to produce Ab, MHCII molecules activate Th1 cells that play a role in the cellular immune response. To achieve their function as peptide receptors, MHCII molecules undergo several stages of maturation (1). Early in biosynthesis, MHCII heterodimers assemble in the ER with an invariant chain (Ii) trimer to form a nonameric complex (2). Ii binds to the peptide binding groove of MHCII dimers and prevents premature binding of unfolded polypeptides that are available from biosynthesis of soluble and membrane proteins in the ER (3, 4). Ii promotes folding of MHCII dimers and rescues them from aggregation (5, 6). The trimer of Ii contains a cytoplasmic sorting signal that directs transport of the MHCII/Ii complex from the secretory pathway to the endocytic route (7, 8). In endocytic vesicles, Ii is degraded, and the MHCII groove becomes able to bind antigenic peptides that are generated from internalized antigen on route to lysosomal degradation (9-11). The regulated cleavage of Ii is accomplished when a set of peptides from Ii (CLIP; class II-associated Ii peptides) is produced, which remain bound to MHCII molecules. This peptide is displaced from mouse Ia haplotypes (murine MHCII) with a low off-rate for CLIP with the catalytic assistance of H2-M (12).

Ii plays multiple roles in the MHCII-processing pathway. A dissection of certain segments revealed that functional domains of Ii could be grouped to sequences encoded by relatively short exons of the Ii gene (13). Exon 1 encodes the sorting sequence of Ii that is based on a Leu-Ile motif responsible for interaction with cytoplasmic components (14). The stretch of Ii that spans the cell membrane is encoded by exon 2. This sequence contains a noncleavable leader sequence, which is important for insertion of Ii, as a type II transmembrane protein into the ER membrane (15). A luminal part of Ii encoded by exon 3 interacts with MHCII dimers (16). Within this segment, the residues amino acids 91-99 of human Ii associate with the polymorphic peptide binding groove of MHCII molecules (17). This interaction is stabilized by residues 81-87 (18) and mediates promiscuous binding of Ii to the various MHCII allo- and isotypes (19). Beyond the MHCII binding site of Ii follows the trimerization sequence (20-22). A sequence between the MHCII binding site and the trimerization domain of Ii contains two N-linked glycosylation motifs. These two N-glycan binding sequences are conserved in the sequence of homologous forms of Ii, found in human, mouse, rat, and cattle. A sequence C-terminal to the N-linked glycosylation sites of Ii interacts with the ribosome-associated membrane protein 4, which plays a role in the ER translocation machinery. It was speculated that this interaction controls glycosylation of Ii and may contribute to the efficiency of antigen processing (23). The role of N-linked glycosylation of Ii is not completely understood. The proximity of the carbohydrates to other functional domains suggests that the glycans may control degradation of Ii and be important for the function of MHCII molecules. It is possible that glycosylation of Ii regulates the stepwise degradation of Ii, which is critical for binding of antigenic peptide to the MHCII groove.

Inhibition of initial glycosylation by tunicamycin treatment alters the cellular degradation pathway by up-regulating ER-associated proteolysis. To avoid aberrant proteolysis by inhibition of glycosylation, we mutated the two N-linked glycosylation sites of Ii that are at the junction of the MHCII groove binding segment and the trimerization domain. Inhibition of various vesicular proteinases was conducted and intracellular degradation of the mutated invariant chain was assessed. The results suggest that the carbohydrates of Ii prevent proteolysis of Ii by proteinases that are active at neutral conditions. Protection by carbohydrates against premature digestion may facilitate degradation of Ii in acidic-processing compartments only and thus after release of CLIP antigenic peptides bind to the MHCII cleft.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Biochemicals and Antibodies-- In 1 is a rat mAb directed against the N terminus of murine Ii (24). MAR18.5 is directed against mouse kappa and was used as a sandwich mAb to bind In1 to protein A-Sepharose. The mAb Bu45 is directed against a C-terminal domain of human Ii (25). Chloroquine, leupeptin, pepstatin A, brefeldin A, lactacystin, cathepsin B, cathepsin D, and TLCK was supplied by CalBiochem (Bad Soden, Germany). E64d was purchased from Bachem (Heidelberg, Germany) and Pefabloc (4-(2-aminoethyl)-benzenesulfonyl-fluoride-hydrochloride) from Roche Molecular Biochemicals (Germany). Horseradish-peroxidase coupled Abs and ECL Western blotting detection reagent were obtained from Amersham Pharmacia Biotech. Concanamycin B was a kind gift from Dr. J. Villadangos, Walter and Eliza Hall Institute, Melbourne.

Chemical Cross-linking-- Cross-linking of oligomerized Ii was performed by using the chemical cross-linker dithiobis-succinimidyl-propionate (DSP). Cells were lysed in 1% Nonidet P-40 in Tris-buffered saline (TBS), pH 7.4 containing proteinase inhibitors and 2 mM iodoacetamide to quench intracellular reducing agents. Lysates were cleared by ultracentrifugation (100,000 × g for 40 min). DSP was dissolved in dimethyl sulfoxide and added to the lysates in concentrations of 0.5, 1, and 2 mM. After an incubation period of 1 h on ice, 50 mM glycine, pH 7, was added, and incubation was continued on ice for 1 h. Subsequently the samples were analyzed by Western blotting.

Mutagenesis and Transfection-- The Ii cDNA was mutated as described earlier (26). A phosphorylated oligonucleotide (AAGAACGTTAACAAGTACGGCAGCATGACCCAG) containing the mutation of the two N-linked glycosylation sites of Ii was hybridized to the Ii plasmid (Ii cDNA cloned into the polylinker region of pUC18). This oligonucleotide contains an unique HpaI site. A second oligonucleotide (AGGATCGCCGGGTAC) that hybridizes to the plasmid sequence deletes a BamHI site. After transformation, mutant clones were selected by restriction digest of the nonmutated plasmid by BamHI. Mutated clones were identified by HpaI restriction digest. The mutation was confirmed by DNA sequencing. The mutated murine Ii cDNA was cloned into the EcoRI site of the expression vector pcEX-V3 (27), and the Ii protein product of the plasmid in which asparagine-linked glycosylation sites were mutated was designated IiNmut.

Metabolic Radiolabeling, Cell Surface Biotinylation, Immunoprecipitation, SDS-PAGE, and Western Blotting (19)-- For metabolic labeling, 5 × 106 transfected cells were cultured for 45 min in methionine-free RPMI 1640, followed by a 20-min pulse with 50 µCi [35S]methionine. In some experiments, the cells were recultured in medium containing 150 µg/ml cold methionine for the indicated times. YOK-1 human B lymphoma cells were incubated for 12 h in 10 µg/ml of tunicamycin. Subsequently, cells were biotinylated by a standard protocol. In brief, cells were suspended in 1 ml of biotinylation buffer (50 mM boric acid, 150 mM NaCl), 10 µl (10 mg/ml in H2O) of sulfosuccinimidyl-6'-biotinamido-6-hexanamidohexanoate were added and incubated for 15 min. Reaction was stopped by addition of 20 µl of 100 mM NH4Cl.

For immunoprecipitation, cells were lysed in 1% Nonidet P-40, and lysates were precleared by ultracentrifugation (100,000 × g for 40 min) and by precipitation with CL4B-Sepharose (Amersham Pharmacia Biotech). The supernatants were immunoprecipitated with protein A-Sepharose and 50 µl of 20-fold-concentrated hybridoma supernatant. The protein A-bound material was washed several times with 0.25% Nonidet P-40/TBS containing proteinase inhibitors and was subsequently analyzed by SDS-PAGE. For Western blotting, cell lysates were prepared as described above, electrophoresed, and transferred to nitrocellulose membranes. Nitrocellulose membranes were blocked with 10% nonfat dry milk and subsequently probed with the indicated primary antibody. Detection of nitrocellulose-bound primary Ab was performed with horseradish-peroxidase-coupled secondary Ab followed by enhanced chemiluminescence.

Proteolytic Digestion-- Ii and IiNmut were proteolytically digested in vitro by cathepsins B and D. For this purpose, Ii and IiNmut were isolated from metabolically-labeled cells by immunoprecipitation but were not yet dissociated from the beads. Cathepsins were diluted in citric acid buffer (40 mM, pH 5). 15 µl of each proteinase dilution was added to the Sepharose-bound proteins. For activation of the cysteine proteinase, 5 mM L-cysteine and 1 mM dithiothreitol were added. After 1-h incubation at 37 °C with gentle agitation, 2 µl of Tris/HCl (2 M, pH7.5) and 17 µl of reducing sample buffer were added, and immediately the samples were boiled to stop the digestion. Samples were analyzed by 15% SDS-PAGE.

Protease Inhibition-- Brefeldin A, dissolved in ethanol, was added to cells to a final concentration of 5 µg/ml. A solution of lactacystin in Me2SO was added to transfected cells to a final concentration of 5, 7.5, and 10 µM. Cells were preincubated with 250 µM chloroquine. Concanamycin B (stock in ethanol), Pefabloc (stock in phosphate-buffered saline), and TLCK (stock in 0.05 M 3-morpholino-ethansulfonic acid, pH 5.5) were present 12 h before labeling at concentrations of 20 nM, 0.5 mM, and 100 µM. TLCK (100 µM) was additionally added before biosynthetic labeling. The inhibitors E64d and pepstatin A were dissolved in Me2SO (final concentration 200 µM and 1 µg/ml) and added 12 h before labeling to COS7 cells. All inhibitors were present during labeling and pulse-chase periods.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Mutation of N-linked Glycosylation Motifs in the Invariant Chain-- The sequence of the Ii31 isoform contains two N-linked glycosylation sites in positions 113 and 119 (Fig. 1A). Functional domains of Ii flank the two carbohydrates. C-terminal to the second carbohydrate adjoins a trimerization domain of Ii that is essential for assembly of the functional nonameric MHCII/Ii complex. The binding sequence of Ii to the MHCII groove is adjacent to the first N-bound carbohydrate toward the N terminus. A release of Ii from associated MHCII molecules, which is important for activation of the MHCII heterodimer is initiated by proteolytic cleavage at Met103 or nearby residues of Ii. The vicinity of the cleavage site to the position of the N-bound oligosaccharides (amino acids 113 and 119) could be important for control of proteolytic cleavage of Ii. We introduced point mutations into the glycosylation motifs and changed Thr115 to Asn and Asn119 to Ser (Fig. 1A). In the targeted sequence the Asn113 residue is retained, which could be of importance for cleavage of the mutated Ii by asparagine-specific endopeptidases (28).


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 1.   Scheme of invariant chain structure. A, functional domains of Ii are indicated. Ii31 and Ii41: 31-kDa and 41-kDa isoforms of Ii. Targeting, sorting signal for endocytic transport; TM, transmembrane domain; GBS, class II groove binding site of Ii; trimerization, trimerization domain of Ii; TgR, thyroglobulin-like segment encoded by alternative splicing of mRNA leading to Ii41 isoform. After degradation of Ii41, this fragment is an inhibitor of cathepsin L. Post-translational modifications: palmitylation of cysteine 27; glycosylation of asparagine 113 and asparagine 119. Glucosoaminoglycan attached to a small proportion of Ii at serine 201. The DNA and protein sequence of the glycosylation motif and mutations of threonine 115 and of asparagine 119 (arrows) are shown below. N-linked glycosylation motifs are underlined. B, IiNmut forms trimers. COS7 cells were transfected with Ii31 or with IiNmut cDNAs. Cross-linker (DSP) was added to cell lysates and protein extracts were separated by SDS-PAGE. Ii bands were identified by Western blotting with mAb In1. The positions of Ii and of IiNmut and their cross-linked oligomers are indicated on the left and right, respectively.

The structural integrity of IiNmut was confirmed. Chemical cross-linking of IiNmut from cell lysates revealed that the mutated polypeptide forms trimers demonstrated for N-glycosylated Ii (29). Lysates of Ii or IiNmut transfected COS7 cells were cross-linked with dithiobis-succinimidyl-propionate and the covalently linked protein complexes were separated by SDS-PAGE. Subsequently Ii oligomers were detected by Western blotting with mAb In1. With increasing cross-linker concentrations, dimeric and trimeric forms of Ii and of IiNmut are detected whereas the monomeric Ii declines (Fig. 1B). The difference in size of IiNmut and of Ii is caused by Asn-linked glycans, which can be demonstrated by inhibition with tunicamycin (data not shown).

Immunoprecipitation of cotransfected MHCII molecules showed association of IiNmut with MHCII heterodimers (data not shown). This result is consistent with experiments with Ii deletions and with Ii from tunicamycin treated cells that both lack the two N-linked carbohydrates. In these studies it was shown that deglycosylated Ii associates with MHCII molecules (20, 30). Our results indicate that structures of Ii important for trimerization and for association to MHCII heterodimers are maintained in IiNmut and suggest that the glycans are not required for the formation of functional Ii. The glycosylation mutant IiNmut was used to explore Ii degradation pathways and to characterize proteinases against whose action the carbohydrates may protect the Ii polypeptide.

Mutant Invariant Chain Is Rapidly Degraded-- It was possible that the lack of the two N-linked oligosaccharides in IiNmut affects its intracellular degradation. We investigated whether cellular degradation of IiNmut deviates from that of wild-type Ii. Ii- and IiNmut-expressing cells were pulse-labeled for 20 min with [35S]methionine and subsequently chased for up to 5 h. We analyzed for Ii decay by SDS-PAGE separation of immunoprecipitates (Fig. 2). Densitometric scans of these bands are displayed in Fig. 2 (below). Wild-type Ii has a cellular half-life that exceeds that of IiNmut by at least five times. Mean half-lives were calculated from four experiments yielding t1/2 IiNmut = 35 min (S = 12 min) and t1/2 Ii = 162 min (S = 16 min). Enhanced rates of degradation of non-N-glycosylated Ii had also been demonstrated by Romagnoli and Germain (30). They found that in tunicamycin-treated cells after a 5-min pulse labeling and 15 min of chase, 60% of the initially labeled pool of nonglycosylated Ii remained detectable. This is shorter then the cellular half-life that we determined for IiNmut, which could indicate up-regulated ER-associated proteolysis in tunicamycin-treated cells. The rapid cellular degradation of IiNmut suggests that glycosylation of Ii prevents premature degradation. It is possible that the lack of carbohydrate site chains makes the mutant more susceptible for proteolytic degradation.


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 2.   Intracellular degradation of invariant chains. COS7 cells were transfected with Ii31 or with IiNmut cDNA and pulse-labeled for 20 min with [35S]methionine followed by the chase time indicated on top. Ii was immunoprecipitated and separated by SDS-PAGE. Densitometric scans are shown below. Ii31 was followed over 300 min, and the mutant Ii chain was chased for up to 90 min.

Digestion of Ii Immunoprecipitates with Proteinases-- We employed a cysteine and an aspartate proteinase, cathepsins B and D that play a role in antigen presentation. The sensitivity of IiNmut compared with wild-type Ii was assayed by in vitro digestion with cathepsin B or D (Fig. 3). With increasing units of cathepsins B and D a complete digest of Ii and of IiNmut was achieved. Comparison of dose-dependent degradation of Ii and of nonglycosylated Ii however did not indicate an abundantly increased sensitivity of IiNmut to cathepsin B or D digest that would explain the observed difference of half-life in living cells. Thus, we conclude that the lower half-life of IiNmut is not because of an increased sensitivity against proteinase digestion.


View larger version (68K):
[in this window]
[in a new window]
 
Fig. 3.   In vitro digestion of Ii immunoprecipitates. COS7 cells were transfected with Ii or IiNmut cDNAs. Cells were labeled for 20 min with [35S]methionine, and Ii chains were immunoprecipitated with mAb In1. Isolated Ii chains were digested with increasing units of cathepsin B (A) or cathepsin D (B). The positions of undigested Ii or IiNmut are indicated on the right.

Inhibition of ER-associated Degradation-- We studied a potential ER-associated degradation of IiNmut. This possibility was first addressed by blocking export of newly synthesized proteins out of the ER. Cells were treated with brefeldin A for 5 h and subsequently labeled in the presence of the inhibitor with [35S]methionine. Fig. 4A illustrates a SDS-PAGE separation of Ii immunoprecipitates. Over a chase time of 4 h neither wild-type Ii with high mannose Asp-linked glycans nor mutant Ii were significantly degraded in brefeldin A-treated cells. This result suggests that in untreated cells, IiNmut is degraded after leaving the ER. In addition, we tested cytoplasmic degradation by proteasomes upon a potential translocation of Ii to the cytosol (Fig. 4B). Cells were incubated with increasing amounts of the proteasome inhibitor lactacystin. Subsequently cells were pulse-labeled for 20 min with [35S]methionine and chased for 2 h. Without inhibition, at 2-h chase, Ii is partially degraded whereas IiNmut disappeared almost completely. Inhibition of proteasome activity by lactacystin did not abolish the decline of Ii independent of its glycosylation. From these data we conclude that IiNmut degradation is not ER-associated.


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 4.   Inhibition of Ii degradation by brefeldin A and by lactacystin. SDS-PAGE-separated Ii immunoprecipitates are shown for brefeldin A (A) and lactacystin- (B) treated cells. COS7 cells were transfected with Ii31 or with IiNmut cDNA. Cells were incubated with 5 µg/ml brefeldin A, pulse-labeled for 20 min with [35S]methionine, and chased in the presence of the inhibitor for the times indicated. At a chase time of 0.5 h, the mobility of IiNmut decreases. This is caused by a post-translational modification, possibly O-glycosylation. For inhibition of proteasome activity, cells were incubated with increasing amounts of lactacystin. Cells were pulse-labeled for 20 min with [35S]methionine and chased for 2 h or lysed directly for immunoprecipitation of Ii. The positions of Ii31 and of IiNmut are indicated. C, for detection of surface expression of non-N-glycosylated Ii, human B lymphoma cells (JOK-1) were incubated for 12 h with 10 µg/ml tunicamycin (TM). Cells were subsequently surface labeled with biotin, and surface Ii was detected by Western blotting.

Endocytic Degradation of Mutated Ii-- Ii was previously detected on the cell surface (CD74) of human B lymphoma cells (31). If non-N-glycosylated Ii is found on the cell surface this would indicate export from the ER to the cell membrane. We treated the human B lymphoma cell line JOK-1 for 12 h with tunicamycin and subsequently labeled the cell surface with biotin. Cells were lysed, and Ii was immunoprecipitated with mAb Bu45. Surface biotinylated Ii was detected by Western blotting (Fig. 4C). Both non-N-glycosylated and fully glycosylated surface Ii were stained by a streptavidin-peroxidase-mediated reaction. This result was confirmed by fluorescent-activated cell sorting staining of tunicamycin and untreated JOK-1 cells with mAb Bu45 (not shown). Surface expression of non-N-glycosylated Ii may suggest that after internalization N-glycan-free, Ii is degraded in endosomal/lysosomal vesicles. Various reagents with impact on endosomal transport, acidic pH, or proteolytic activity had been used to block degradation of Ii (32). We used chloroquine that elevates the pH in endosomes and inhibits proteinase activity. As shown in Fig. 5A (right) treatment of cells with 250 µM of chloroquine almost completely arrests degradation of Ii, indicating that the enzymes involved in Ii proteolysis are pH sensitive. Inhibition of IiNmut degradation by chloroquine (Fig. 5A, left) indicates endosomal degradation, and this was further investigated with additional proteinase inhibitors. The different proportion of inhibition of Ii and IiNmut degradation that was observed after chloroquine treatment may suggest that proteinases are involved in the decay of the mutated Ii that are hindered by the carbohydrates in degradation of wild-type Ii.


View larger version (51K):
[in this window]
[in a new window]
 
Fig. 5.   Inhibition of endosomal degradation. SDS-PAGE separation of Ii31 and IiNmut immunoprecipitated from transfected COS7 cells is shown. Cells were labeled with [35S]methionine for 20 min and subsequently cultured in the presence of inhibitor in complete medium for the times indicated. A, chloroquine; B, pepstatin A (aspartate proteinase inhibitor); C, E64d (cysteine proteinase inhibitor); D, concanamycin B; E, Pefabloc; and F, TLCK (serine proteinase inhibitors). SDS-PAGE and densitometric scans are shown.

It has been reported that cleavage of Ii is initiated by aspartate proteinases whereas subsequent release of Ii from MHCII depends on cysteine proteinases (33). We utilized pepstatin A and E64d as asparagine and cysteine proteinase inhibitors, respectively. The impact of these inhibitors on Ii and on IiNmut degradation after various times of labeling with [35S]methionine is shown in Fig. 5, B and C. Pepstatin A (Fig. 5B) and E64d (Fig. 5C), both strongly impede degradation of Ii, demonstrating a role of aspartate and of cysteine proteinases in Ii degradation. Both inhibitors impair the decay of IiNmut, although to a lower degree than of wild-type Ii. In the presence of inhibitors the half-life of IiNmut is substantially shorter than that of wild-type Ii. It is interesting to note, that the aspartate proteinase inhibitor pepstatin A only doubles the half-life of IiNmut. This result may suggest unlike the initial cleavage of Ii, which involves aspartate proteinases, other proteinases account for degradation of IiNmut.

We explored the impact of concanamycin B, an antibiotic that highly selectively inhibits vacuolar H+-ATPase, on degradation of IiNmut. Concanamycin B raises the pH in endosomal/lysosomal compartments, thus interrupting the early endosomal/late endosomal/lysosomal transition (34). Fig. 5D illustrates inhibition of Ii degradation by concanamycin B. Cellular degradation of Ii is almost completely blocked by concanamycin B, greatly exceeding the efficacy of chloroquine. In the presence of concanamycin B, IiNmut is stabilized to a half-life of about 200 min. Inhibition of the decline of IiNmut by several inhibitors of acidic endosomal proteinases indicates a vesicular degradation in endosomal/lysosomal compartments. The incomplete block of acidic proteolysis (Fig. 5, A-D) of IiNmut may suggest that nonacidic proteinases play a role. Thus, it is possible that enzymes such as serine proteinases, which are active at a neutral pH, are involved. We tested Pefabloc and TLCK, inhibitors of serine proteinases (Fig. 5, E and F). Remarkably, the degradation of IiNmut was extensively inhibited by Pefabloc and by TLCK, and both exceeded the impact of pepstatin A (Fig. 5B) and E64d (Fig. 5C). Both Pefabloc and TLCK also affect decay of Ii, indicating that in addition to neutral proteinases, acidic proteinases responsible for Ii degradation are impaired. The degree of inhibition of IiNmut degradation by concanamycin B and by Pefabloc suggests a complementary function of the affected proteinases. In fact, inhibition of IiNmut degradation by a combination of concanamycin B and of Pefabloc almost completely blocked proteolysis (data not shown).

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Consideration of the known functions of N-linked glycosylation (35, 36) leads us to postulate several possible roles for the N-linked carbohydrates of Ii. The presence of Ii glycans influences transient association to calnexin in the ER and the stability of the MHCII/Ii complex. IiNmut forms trimers and associates to MHCII complexes despite the lack of calnexin interaction (30).2 The role of calnexin may be to retain glycosylated Ii in the ER in order to provide excess Ii for association to newly synthesized MHCII molecules (30).

Ii is degraded intracellularly to generate functional MHCII heterodimers and is a very proteolytically sensitive protein. Thus, the N-linked glycans may be essential to protect from immediate degradation while committing the Ii substrate to a controlled proteolysis. As shown in this paper, the N-linked carbohydrates affect degradation at neutral pH, conditions that are present in early endosomes. The intact MHCII/Ii complex is transported from early endosomes to more acidic compartments. There proteolytic release of Ii occurs and subsequent binding of antigenic peptides to empty MHCII heterodimers is facilitated by an acidic pH. The N-linked carbohydrates thus may play a key role in directing the route of Ii degradation to MHCII-processing compartments.

Activation of protein complexes by proteolysis is a common mechanism in cell biology and is also found in the innate immune system. Several components of the complement system acquire activity upon partial proteolytic digestion. Such regulated degradation also plays a role in the antigen-specific immune system and accounts for activation of the immature MHCII complex. Recent findings indicate that MHCII dimers appear in two conformations (37). One of these isomeric forms is active for binding of peptides. The release of the Ii fragment CLIP from MHCII dimers generates the peptide-receptive isomer. Thus the regulated degradation of Ii and the generation of CLIP are important for subsequent binding of peptides by MHCII molecules.

An increasing number of endosomal proteinases involved in MHCII antigen processing have been identified (38). These proteinases shape the repertoire of antigenic peptides that are captured by MHCII heterodimers. Some of these proteinases are in addition to fragmentation of protein antigens involved in processing of the MHCII/Ii nonameric complex. A first cleavage of Ii occurs at the C terminus of the MHCII groove-binding segment (39). Enzymes that under physiological conditions initiate cleavage of the homotrimeric Ii and generate the C-terminal truncated Ii fragment LIP (leupeptin-induced peptide), have not yet been identified. There is some evidence that degradation of Ii is started by an aspartate proteinase (33). Two proteinases, cathepsin S and L were specific for subsequent cleavage of LIP. The cysteine proteinase cathepsin S cleaves Ii after amino acids 78 or 80 of the Ii sequence and presumably generates the N terminus of CLIP (40). In mice deficient for cathepsin S or L, LIP accumulates that still associates with MHCII molecules (41, 42). Macrophages express cathepsin F that also appears to be involved in Ii degradation (43). Because the Asn-linked glycans separate the trimerization site from the MHCII binding site of Ii, it is possible that the carbohydrate moiety directs the proteolytic cleavage towards the boundaries of the MHCII groove. It is conceivable that this cleavage site is only available under acidic conditions.

The carbohydrates may influence intracellular transport and sorting of Ii. Possibly IiNmut is aberrantly sorted to neutral endocytic compartments where it is degraded. Villandangos et al. (44) described recently a novel MHCII processing pathway. Characteristic of this pathway is that it is independent of H2-M and that degradation of MHCII-associated Ii cannot be blocked by concanamycin B. Inhibition by concanamycin B demonstrated two components of the endocytic pathway. In one of these pathways the release of Ii from MHCII does not depend on cysteine proteinases. Because, as has been shown here, degradation of IiNmut is not completely blocked by concanamycin B, it is possible that this novel MHCII-processing pathway accounts for the partial decay of IiNmut in the presence of concanamycin B.

We demonstrated in this report, that N-linked glycosylation plays a key role in the controlled endosomal degradation of Ii. In the sequential degradation of Ii, N-glycans provide a signal for acidic degradation in MHCII processing compartments.

    ACKNOWLEDGEMENT

We thank Dr. Ian van Driel for critical reading of the mansucript.

    FOOTNOTES

* This work was supported by the Sonderforschungsbereich 284, Teilprojekt B6.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed. Tel.: 0049 228 734343; Fax: 0049 228 734555; E-mail: norbert.koch@uni-bonn.de.

Published, JBC Papers in Press, January 22, 2001, DOI 10.1074/jbc.M010629200

2 N. Schach and N. Koch, unpublished results.

    ABBREVIATIONS

The abbreviations used are: MHCII, major histocompatibility complex class II; Ii, MHCII-associated invariant chain; CLIP, class II-associated Ii peptides; LIP, leupeptin-induced peptides. IiNmut, the Ii protein in which asparagine-linked glycosylation sites were mutated; ER, endoplasmic reticulum; PAGE, polyacrylamide gel electrophoresis; Ab, antibody; DSP, dithiobis-succinimidyl-propionate; TLCK, 1-chloro-3-tosylamido-7-amino-2-heptanone.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Busch, R., Doebele, R. C., Patil, N. S., Pashine, A., and Mellins, E. D. (2000) Curr. Opin. Immunol. 12, 99-106
2. Roche, P. A., Marks, M. S., and Cresswell, P. (1991) Nature 354, 392-394
3. Busch, R., Cloutier, I., Sekaly, R. P., and Hammerling, G. J. (1996) EMBO J. 15, 418-428
4. Hitzel, C., van Endert, P., and Koch, N. (1995) J. Immunol. 154, 1048-1056
5. Anderson, M. S., and Miller, J. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 2282-2286
6. Germain, R. N., and Rinker, A. G. J. (1993) Nature 363, 725-728
7. Bakke, O., and Dobberstein, B. (1990) Cell 63, 707-716
8. Arneson, L. S., and Miller, J. (1995) J. Cell Biol. 129, 1217-1228
9. Tulp, A., Verwoerd, D., Dobberstein, B., Ploegh, H. L., and Pieters, J. (1994) Nature 369, 120-126
10. Amigorena, S., Drake, J. R., Webster, P., and Mellman, I. (1994) Nature 369, 113-120
11. Amigorena, S., Webster, P., Drake, J., Newcomb, J., Cresswell, P., and Mellman, I. (1995) J. Exp. Med. 181, 1729-1741
12. Wolf, P. R., Tourne, S., Miyazaki, T., Benoist, C., Mathis, D., and Ploegh, H. L. (1998) Eur. J. Immunol. 28, 2605-2618
13. Koch, N., Lauer, W., Habicht, J., and Dobberstein, B. (1987) EMBO J. 6, 1677-1683
14. Bremnes, T., Lauvrak, V., Lindqvist, B., and Bakke, O. (1998) J. Biol. Chem. 273, 8638-8645
15. Singer, P. A., Lauer, W., Dembic, Z., Mayer, W. E., Lipp, J., Koch, N., Hammerling, G., Klein, J., and Dobberstein, B. (1984) EMBO J. 3, 873-877
16. Freisewinkel, I. M., Schenck, K., and Koch, N. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 9703-9706
17. Ghosh, P., Amaya, M., Mellins, E., and Wiley, D. C. (1995) Nature 378, 457-462
18. Stumptner, P., and Benaroch, P. (1997) EMBO J. 16, 5807-5818
19. Siebenkotten, I. M., Carstens, C., and Koch, N. (1998) J. Immunol. 160, 3355-3362
20. Bertolino, P., Staschewski, M., Trescol Biemont, M. C., Freisewinkel, I. M., Schenck, K., Chretien, I., Forquet, F., Gerlier, D., Rabourdin Combe, C., and Koch, N. (1995) J. Immunol. 154, 5620-5629
21. Jasanoff, A., Wagner, G., and Wiley, D. C. (1998) EMBO J. 17, 6812-6818
22. Bijlmakers, M. J., Benaroch, P., and Ploegh, H. L. (1994) J. Exp. Med. 180, 623-629
23. Schroder, K., Martoglio, B., Hofmann, M., Holscher, C., Hartmann, E., Prehn, S., Rapoport, T. A., and Dobberstein, B. (1999) EMBO J. 18, 4804-4815
24. Koch, N., Koch, S., and Hammerling, G. J. (1982) Nature 299, 644-645
25. Wraight, C. J., van Endert, P., Moller, P., Lipp, J., Ling, N. R., MacLennan, I. C., Koch, N., and Moldenhauer, G. (1990) J. Biol. Chem. 265, 5787-5792
26. Brosterhus, H. (1994) Post-translational Modifications of the MHC Class II-associated Invariant Chain, Thesis , Universität Bonn, Germany
27. Okayama, H., and Berg, P. (1983) Mol. Cell. Biol. 3, 280-289
28. Manoury, B., Hewitt, E. W., Morrice, N., Dando, P. M., Barrett, A. J., and Watts, C. (1998) Nature 396, 695-699
29. Gedde Dahl, M., Freisewinkel, I., Staschewski, M., Schenck, K., Koch, N., and Bakke, O. (1997) J. Biol. Chem. 272, 8281-8287
30. Romagnoli, P., and Germain, R. N. (1995) J. Exp. Med. 182, 2027-2036
31. Koch, N., Moldenhauer, G., Hofmann, W. J., and Moller, P. (1991) J. Immunol. 147, 2643-2651
32. Villadangos, J. A., Bryant, R. A., Deussing, J., Driessen, C., Lennon, D.umenil, A. M., Riese, R. J., Roth, W., Saftig, P., Shi, G. P., Chapman, H. A., Peters, C., and Ploegh, H. L. (1999) Immunol. Rev. 172, 109-120
33. Maric, M. A., Taylor, M. D., and Blum, J. S. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2171-2175
34. Benaroch, P., Yilla, M., Raposo, G., Ito, K., Miwa, K., Geuze, H. J., and Ploegh, H. L. (1995) EMBO J. 14, 37-49
35. Kundra-R, and Kornfeld-S. (1999) J. Biol. Chem. 274, 31039-31046
36. Hammond, C., Braakman, I., and Helenius, A. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 913-917
37. Rabinowitz, J. D., Vrljic, M., Kasson, P. M., Liang, M. N., Busch, R., Boniface, J. J., Davis, M. M., and McConnell, H. M. (1998) Immunity 9, 699-709
38. Villadangos, J. A., and Ploegh, H. L. (2000) Immunity 12, 233-239
39. Riese, R. J., and Chapman, H. A. (2000) Curr. Opin. Immunol. 12, 107-113
40. Villadangos, J. A., Riese, R. J., Peters, C., Chapman, H. A., and Ploegh, H. L. (1997) J. Exp. Med. 186, 549-560
41. Nakagawa, T., Roth, W., Wong, P., Nelson, A., Farr, A., Deussing, J., Villadangos, J. A., Ploegh, H., Peters, C., and Rudensky, A. Y. (1998) Science 280, 450-453
42. Nakagawa, T. Y., Brissette, W. H., Lira, P. D., Griffiths, R. J., Petrushova, N., Stock, J., McNeish, J. D., Eastman, S. E., Howard, E. D., Clarke, S. R., Rosloniec, E. F., Elliott, E. A., and Rudensky, A. Y. (1999) Immunity 10, 207-217
43. Shi, G. P., Bryant, R. A., Riese, R., Verhelst, S., Driessen, C., Li, Z., Bromme, D., Ploegh, H. L., and Chapman, H. A. (2000) J. Exp. Med. 191, 1177-1186
44. Villadangos, J. A., Driessen, C., Shi, G. P., Chapman, H. A., and Ploegh, H. L. (2000) EMBO J. 19, 882-891


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
I. Sloma, M.-T. Zilber, T. Vasselon, N. Setterblad, M. Cavallari, L. Mori, G. De Libero, D. Charron, N. Mooney, and C. Gelin
Regulation of CD1a Surface Expression and Antigen Presentation by Invariant Chain and Lipid Rafts
J. Immunol., January 15, 2008; 180(2): 980 - 987.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
J. Neumann and N. Koch
A novel domain on HLA-DR{beta} chain regulates the chaperone role of the invariant chain
J. Cell Sci., October 15, 2006; 119(20): 4207 - 4214.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
E. Klein, S. Koch, B. Borm, J. Neumann, V. Herzog, N. Koch, and T. Bieber
CD83 localization in a recycling compartment of immature human monocyte-derived dendritic cells
Int. Immunol., April 1, 2005; 17(4): 477 - 487.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Neumann, A. M. Eis-Hubinger, and N. Koch
Herpes Simplex Virus Type 1 Targets the MHC Class II Processing Pathway for Immune Evasion
J. Immunol., September 15, 2003; 171(6): 3075 - 3083.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/16/13469    most recent
M010629200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Neumann, J.
Right arrow Articles by Koch, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Neumann, J.
Right arrow Articles by Koch, N.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement