|
Originally published In Press as doi:10.1074/jbc.M010629200 on January 22, 2001
J. Biol. Chem., Vol. 276, Issue 16, 13469-13475, April 20, 2001
Glycosylation Signals That Separate the Trimerization from the
MHC Class II-binding Domain Control Intracellular Degradation of
Invariant Chain*
Jürgen
Neumann,
Nicole
Schach, and
Norbert
Koch
From the Section of Immunobiology, University of Bonn, 53117 Bonn,
Römerstrasse 164, Germany
Received for publication, November 26, 2000, and in revised form, December 28, 2000
 |
ABSTRACT |
Invariant chain (Ii) serves as a chaperone
for folding and intracellular transport of major histocompatibility
complex class II (MHCII) molecules. Early in biosynthesis, Ii
associates with MHCII molecules and directs their intracellular
transport to endocytic compartments where vesicular proteinases
sequentially release Ii from the MHCII heterodimer. The detachment of
Ii makes the MHCII groove susceptible for binding of antigenic
peptides. We investigated the role of N-linked
glycosylation in the controlled intracellular degradation of Ii. Motifs
for asparagine-linked glycosylation were altered, and mutated Ii
(IiNmut) was transiently expressed in COS cells. The half-life of
IiNmut was strongly reduced compared with wild-type Ii although the
sensitivity of the N glycan-free polypeptide to in
vitro proteinase digestion was not substantially increased.
Inhibition of vesicular proteinases revealed endosomal degradation of
IiNmut. Intracellular proteolysis of IiNmut is substantially impaired
by serine proteinase inhibitors. Thus, a considerable amount of IiNmut
is degraded in nonacidic intracellular compartments. The data
suggest that N-linked glycosylation of Ii hinders premature
proteolysis in nonacidic vesicles resulting in Ii degradation in acidic
MHC class II-processing compartments.
 |
INTRODUCTION |
MHC class II (MHCII)1
antigen presentation to CD4 T cells is a prerequisite for an antibody
response against T cell-dependent antigens. In addition to
Th2 cells, which help B cells to produce Ab, MHCII
molecules activate Th1 cells that play a role in the cellular immune response. To achieve their function as peptide receptors, MHCII molecules undergo several stages of maturation (1).
Early in biosynthesis, MHCII heterodimers assemble in the ER with an
invariant chain (Ii) trimer to form a nonameric complex (2). Ii binds
to the peptide binding groove of MHCII dimers and prevents premature
binding of unfolded polypeptides that are available from biosynthesis
of soluble and membrane proteins in the ER (3, 4). Ii promotes folding
of MHCII dimers and rescues them from aggregation (5, 6). The trimer of
Ii contains a cytoplasmic sorting signal that directs transport of the
MHCII/Ii complex from the secretory pathway to the endocytic route (7, 8). In endocytic vesicles, Ii is degraded, and the MHCII groove becomes
able to bind antigenic peptides that are generated from internalized
antigen on route to lysosomal degradation (9-11). The regulated
cleavage of Ii is accomplished when a set of peptides from Ii (CLIP;
class II-associated Ii peptides) is produced, which remain bound to
MHCII molecules. This peptide is displaced from mouse Ia haplotypes
(murine MHCII) with a low off-rate for CLIP with the catalytic
assistance of H2-M (12).
Ii plays multiple roles in the MHCII-processing pathway. A dissection
of certain segments revealed that functional domains of Ii could be
grouped to sequences encoded by relatively short exons of the
Ii gene (13). Exon 1 encodes the sorting sequence of Ii that
is based on a Leu-Ile motif responsible for interaction with
cytoplasmic components (14). The stretch of Ii that spans the cell
membrane is encoded by exon 2. This sequence contains a noncleavable
leader sequence, which is important for insertion of Ii, as a type II
transmembrane protein into the ER membrane (15). A luminal part of Ii
encoded by exon 3 interacts with MHCII dimers (16). Within this
segment, the residues amino acids 91-99 of human Ii associate with the
polymorphic peptide binding groove of MHCII molecules (17). This
interaction is stabilized by residues 81-87 (18) and mediates
promiscuous binding of Ii to the various MHCII allo- and isotypes (19).
Beyond the MHCII binding site of Ii follows the trimerization sequence
(20-22). A sequence between the MHCII binding site and the
trimerization domain of Ii contains two N-linked
glycosylation motifs. These two N-glycan binding sequences
are conserved in the sequence of homologous forms of Ii, found in
human, mouse, rat, and cattle. A sequence C-terminal to the
N-linked glycosylation sites of Ii interacts with the
ribosome-associated membrane protein 4, which plays a role in the ER
translocation machinery. It was speculated that this interaction
controls glycosylation of Ii and may contribute to the efficiency of
antigen processing (23). The role of N-linked glycosylation
of Ii is not completely understood. The proximity of the carbohydrates
to other functional domains suggests that the glycans may control
degradation of Ii and be important for the function of MHCII molecules.
It is possible that glycosylation of Ii regulates the stepwise
degradation of Ii, which is critical for binding of antigenic peptide
to the MHCII groove.
Inhibition of initial glycosylation by tunicamycin treatment alters the
cellular degradation pathway by up-regulating ER-associated proteolysis. To avoid aberrant proteolysis by inhibition of
glycosylation, we mutated the two N-linked glycosylation
sites of Ii that are at the junction of the MHCII groove binding
segment and the trimerization domain. Inhibition of various vesicular
proteinases was conducted and intracellular degradation of the mutated
invariant chain was assessed. The results suggest that the
carbohydrates of Ii prevent proteolysis of Ii by proteinases that are
active at neutral conditions. Protection by carbohydrates against
premature digestion may facilitate degradation of Ii in
acidic-processing compartments only and thus after release of CLIP
antigenic peptides bind to the MHCII cleft.
 |
EXPERIMENTAL PROCEDURES |
Biochemicals and Antibodies--
In 1 is a rat mAb
directed against the N terminus of murine Ii (24). MAR18.5 is directed
against mouse kappa and was used as a sandwich mAb to bind In1 to
protein A-Sepharose. The mAb Bu45 is directed against a C-terminal
domain of human Ii (25). Chloroquine, leupeptin, pepstatin A, brefeldin
A, lactacystin, cathepsin B, cathepsin D, and TLCK was supplied by
CalBiochem (Bad Soden, Germany). E64d was purchased from Bachem
(Heidelberg, Germany) and Pefabloc
(4-(2-aminoethyl)-benzenesulfonyl-fluoride-hydrochloride) from Roche
Molecular Biochemicals (Germany). Horseradish-peroxidase coupled Abs
and ECL Western blotting detection reagent were obtained from Amersham
Pharmacia Biotech. Concanamycin B was a kind gift from Dr. J. Villadangos, Walter and Eliza Hall Institute, Melbourne.
Chemical Cross-linking--
Cross-linking of oligomerized Ii was
performed by using the chemical cross-linker
dithiobis-succinimidyl-propionate (DSP). Cells were lysed in 1%
Nonidet P-40 in Tris-buffered saline (TBS), pH 7.4 containing
proteinase inhibitors and 2 mM iodoacetamide to quench
intracellular reducing agents. Lysates were cleared by
ultracentrifugation (100,000 × g for 40 min). DSP was
dissolved in dimethyl sulfoxide and added to the lysates in
concentrations of 0.5, 1, and 2 mM. After an incubation
period of 1 h on ice, 50 mM glycine, pH 7, was added,
and incubation was continued on ice for 1 h. Subsequently the
samples were analyzed by Western blotting.
Mutagenesis and Transfection--
The Ii cDNA was mutated as
described earlier (26). A phosphorylated oligonucleotide
(AAGAACGTTAACAAGTACGGCAGCATGACCCAG) containing the mutation of the two
N-linked glycosylation sites of Ii was hybridized to the Ii
plasmid (Ii cDNA cloned into the polylinker region of pUC18). This
oligonucleotide contains an unique HpaI site. A second
oligonucleotide (AGGATCGCCGGGTAC) that hybridizes to the plasmid
sequence deletes a BamHI site. After transformation, mutant
clones were selected by restriction digest of the nonmutated plasmid by
BamHI. Mutated clones were identified by HpaI
restriction digest. The mutation was confirmed by DNA sequencing. The
mutated murine Ii cDNA was cloned into the EcoRI site of
the expression vector pcEX-V3 (27), and the Ii protein product of the
plasmid in which asparagine-linked glycosylation sites were mutated was
designated IiNmut.
Metabolic Radiolabeling, Cell Surface Biotinylation,
Immunoprecipitation, SDS-PAGE, and Western Blotting (19)--
For
metabolic labeling, 5 × 106 transfected cells were
cultured for 45 min in methionine-free RPMI 1640, followed by a 20-min pulse with 50 µCi [35S]methionine. In some experiments,
the cells were recultured in medium containing 150 µg/ml cold
methionine for the indicated times. YOK-1 human B lymphoma cells were
incubated for 12 h in 10 µg/ml of tunicamycin. Subsequently,
cells were biotinylated by a standard protocol. In brief, cells were
suspended in 1 ml of biotinylation buffer (50 mM boric
acid, 150 mM NaCl), 10 µl (10 mg/ml in H2O)
of sulfosuccinimidyl-6'-biotinamido-6-hexanamidohexanoate were added
and incubated for 15 min. Reaction was stopped by addition of 20 µl
of 100 mM NH4Cl.
For immunoprecipitation, cells were lysed in 1% Nonidet P-40, and
lysates were precleared by ultracentrifugation (100,000 × g for 40 min) and by precipitation with CL4B-Sepharose
(Amersham Pharmacia Biotech). The supernatants were immunoprecipitated
with protein A-Sepharose and 50 µl of 20-fold-concentrated hybridoma supernatant. The protein A-bound material was washed several times with
0.25% Nonidet P-40/TBS containing proteinase inhibitors and was
subsequently analyzed by SDS-PAGE. For Western blotting, cell lysates
were prepared as described above, electrophoresed, and transferred to
nitrocellulose membranes. Nitrocellulose membranes were blocked with
10% nonfat dry milk and subsequently probed with the indicated primary
antibody. Detection of nitrocellulose-bound primary Ab was performed
with horseradish-peroxidase-coupled secondary Ab followed by enhanced chemiluminescence.
Proteolytic Digestion--
Ii and IiNmut were proteolytically
digested in vitro by cathepsins B and D. For this purpose,
Ii and IiNmut were isolated from metabolically-labeled cells by
immunoprecipitation but were not yet dissociated from the beads.
Cathepsins were diluted in citric acid buffer (40 mM, pH
5). 15 µl of each proteinase dilution was added to the
Sepharose-bound proteins. For activation of the cysteine proteinase, 5 mM L-cysteine and 1 mM
dithiothreitol were added. After 1-h incubation at 37 °C with gentle
agitation, 2 µl of Tris/HCl (2 M, pH7.5) and 17 µl of
reducing sample buffer were added, and immediately the samples were
boiled to stop the digestion. Samples were analyzed by 15%
SDS-PAGE.
Protease Inhibition--
Brefeldin A, dissolved in ethanol, was
added to cells to a final concentration of 5 µg/ml. A solution of
lactacystin in Me2SO was added to transfected cells to a
final concentration of 5, 7.5, and 10 µM. Cells were
preincubated with 250 µM chloroquine. Concanamycin B
(stock in ethanol), Pefabloc (stock in phosphate-buffered saline), and
TLCK (stock in 0.05 M 3-morpholino-ethansulfonic acid, pH
5.5) were present 12 h before labeling at concentrations of 20 nM, 0.5 mM, and 100 µM. TLCK (100 µM) was additionally added before biosynthetic labeling.
The inhibitors E64d and pepstatin A were dissolved in Me2SO
(final concentration 200 µM and 1 µg/ml) and added
12 h before labeling to COS7 cells. All inhibitors were present
during labeling and pulse-chase periods.
 |
RESULTS |
Mutation of N-linked Glycosylation Motifs in the Invariant
Chain--
The sequence of the Ii31 isoform contains two
N-linked glycosylation sites in positions 113 and 119 (Fig.
1A). Functional domains of Ii
flank the two carbohydrates. C-terminal to the second carbohydrate
adjoins a trimerization domain of Ii that is essential for assembly of
the functional nonameric MHCII/Ii complex. The binding sequence of
Ii to the MHCII groove is adjacent to the first N-bound
carbohydrate toward the N terminus. A release of Ii from associated
MHCII molecules, which is important for activation of the MHCII
heterodimer is initiated by proteolytic cleavage at Met103
or nearby residues of Ii. The vicinity of the cleavage site to the
position of the N-bound oligosaccharides (amino acids 113 and 119) could be important for control of proteolytic cleavage of Ii.
We introduced point mutations into the glycosylation motifs and changed
Thr115 to Asn and Asn119 to Ser (Fig.
1A). In the targeted sequence the Asn113 residue
is retained, which could be of importance for cleavage of the mutated
Ii by asparagine-specific endopeptidases (28).

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 1.
Scheme of invariant chain structure.
A, functional domains of Ii are indicated. Ii31 and Ii41:
31-kDa and 41-kDa isoforms of Ii. Targeting, sorting signal
for endocytic transport; TM, transmembrane domain;
GBS, class II groove binding site of Ii;
trimerization, trimerization domain of Ii; TgR,
thyroglobulin-like segment encoded by alternative splicing of mRNA
leading to Ii41 isoform. After degradation of Ii41, this fragment is an
inhibitor of cathepsin L. Post-translational modifications:
palmitylation of cysteine 27; glycosylation of asparagine 113 and
asparagine 119. Glucosoaminoglycan attached to a small proportion of Ii
at serine 201. The DNA and protein sequence of the glycosylation motif
and mutations of threonine 115 and of asparagine 119 (arrows) are shown below. N-linked glycosylation
motifs are underlined. B, IiNmut forms trimers.
COS7 cells were transfected with Ii31 or with IiNmut cDNAs.
Cross-linker (DSP) was added to cell lysates and protein extracts were
separated by SDS-PAGE. Ii bands were identified by Western blotting
with mAb In1. The positions of Ii and of IiNmut and their cross-linked
oligomers are indicated on the left and right,
respectively.
|
|
The structural integrity of IiNmut was confirmed. Chemical
cross-linking of IiNmut from cell lysates revealed that the mutated polypeptide forms trimers demonstrated for N-glycosylated Ii
(29). Lysates of Ii or IiNmut transfected COS7 cells were cross-linked with dithiobis-succinimidyl-propionate and the covalently linked protein complexes were separated by SDS-PAGE. Subsequently Ii oligomers
were detected by Western blotting with mAb In1. With increasing
cross-linker concentrations, dimeric and trimeric forms of Ii and of
IiNmut are detected whereas the monomeric Ii declines (Fig.
1B). The difference in size of IiNmut and of Ii is caused by
Asn-linked glycans, which can be demonstrated by inhibition with
tunicamycin (data not shown).
Immunoprecipitation of cotransfected MHCII molecules showed association
of IiNmut with MHCII heterodimers (data not shown). This result is
consistent with experiments with Ii deletions and with Ii from
tunicamycin treated cells that both lack the two N-linked
carbohydrates. In these studies it was shown that deglycosylated Ii
associates with MHCII molecules (20, 30). Our results indicate that
structures of Ii important for trimerization and for association to
MHCII heterodimers are maintained in IiNmut and suggest that the
glycans are not required for the formation of functional Ii. The
glycosylation mutant IiNmut was used to explore Ii degradation pathways
and to characterize proteinases against whose action the carbohydrates
may protect the Ii polypeptide.
Mutant Invariant Chain Is Rapidly Degraded--
It was possible
that the lack of the two N-linked oligosaccharides in IiNmut
affects its intracellular degradation. We investigated whether cellular
degradation of IiNmut deviates from that of wild-type Ii. Ii- and
IiNmut-expressing cells were pulse-labeled for 20 min with
[35S]methionine and subsequently chased for up to 5 h. We analyzed for Ii decay by SDS-PAGE separation of
immunoprecipitates (Fig. 2).
Densitometric scans of these bands are displayed in Fig. 2 (below). Wild-type Ii has a cellular half-life that exceeds
that of IiNmut by at least five times. Mean half-lives were calculated from four experiments yielding t1/2 IiNmut = 35 min
(S = 12 min) and t1/2 Ii = 162 min (S = 16 min).
Enhanced rates of degradation of non-N-glycosylated Ii had
also been demonstrated by Romagnoli and Germain (30). They found that
in tunicamycin-treated cells after a 5-min pulse labeling and 15 min of
chase, 60% of the initially labeled pool of nonglycosylated Ii
remained detectable. This is shorter then the cellular half-life that
we determined for IiNmut, which could indicate up-regulated
ER-associated proteolysis in tunicamycin-treated cells. The rapid
cellular degradation of IiNmut suggests that glycosylation of Ii
prevents premature degradation. It is possible that the lack of
carbohydrate site chains makes the mutant more susceptible for
proteolytic degradation.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 2.
Intracellular degradation of invariant
chains. COS7 cells were transfected with Ii31 or with IiNmut
cDNA and pulse-labeled for 20 min with
[35S]methionine followed by the chase time indicated on
top. Ii was immunoprecipitated and separated by SDS-PAGE.
Densitometric scans are shown below. Ii31 was followed over
300 min, and the mutant Ii chain was chased for up to 90 min.
|
|
Digestion of Ii Immunoprecipitates with Proteinases--
We
employed a cysteine and an aspartate proteinase, cathepsins B and D
that play a role in antigen presentation. The sensitivity of IiNmut
compared with wild-type Ii was assayed by in vitro digestion with cathepsin B or D (Fig. 3). With
increasing units of cathepsins B and D a complete digest of Ii and of
IiNmut was achieved. Comparison of dose-dependent
degradation of Ii and of nonglycosylated Ii however did not indicate an
abundantly increased sensitivity of IiNmut to cathepsin B or D digest
that would explain the observed difference of half-life in living
cells. Thus, we conclude that the lower half-life of IiNmut is not
because of an increased sensitivity against proteinase digestion.

View larger version (68K):
[in this window]
[in a new window]
|
Fig. 3.
In vitro digestion of Ii
immunoprecipitates. COS7 cells were transfected with Ii or IiNmut
cDNAs. Cells were labeled for 20 min with
[35S]methionine, and Ii chains were immunoprecipitated
with mAb In1. Isolated Ii chains were digested with increasing units of
cathepsin B (A) or cathepsin D (B). The positions
of undigested Ii or IiNmut are indicated on the right.
|
|
Inhibition of ER-associated Degradation--
We studied a
potential ER-associated degradation of IiNmut. This possibility was
first addressed by blocking export of newly synthesized proteins out of
the ER. Cells were treated with brefeldin A for 5 h and
subsequently labeled in the presence of the inhibitor with
[35S]methionine. Fig.
4A illustrates a SDS-PAGE
separation of Ii immunoprecipitates. Over a chase time of 4 h
neither wild-type Ii with high mannose Asp-linked glycans nor mutant Ii
were significantly degraded in brefeldin A-treated cells. This result
suggests that in untreated cells, IiNmut is degraded after
leaving the ER. In addition, we tested cytoplasmic degradation by
proteasomes upon a potential translocation of Ii to the cytosol (Fig.
4B). Cells were incubated with increasing amounts of the
proteasome inhibitor lactacystin. Subsequently cells were pulse-labeled
for 20 min with [35S]methionine and chased for 2 h.
Without inhibition, at 2-h chase, Ii is partially degraded whereas
IiNmut disappeared almost completely. Inhibition of proteasome activity
by lactacystin did not abolish the decline of Ii independent of its
glycosylation. From these data we conclude that IiNmut degradation is
not ER-associated.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 4.
Inhibition of Ii degradation by brefeldin A
and by lactacystin. SDS-PAGE-separated Ii immunoprecipitates are
shown for brefeldin A (A) and lactacystin- (B)
treated cells. COS7 cells were transfected with Ii31 or with IiNmut
cDNA. Cells were incubated with 5 µg/ml brefeldin A,
pulse-labeled for 20 min with [35S]methionine, and chased
in the presence of the inhibitor for the times indicated. At a chase
time of 0.5 h, the mobility of IiNmut decreases. This is caused by
a post-translational modification, possibly O-glycosylation.
For inhibition of proteasome activity, cells were incubated with
increasing amounts of lactacystin. Cells were pulse-labeled for 20 min
with [35S]methionine and chased for 2 h or lysed
directly for immunoprecipitation of Ii. The positions of Ii31 and of
IiNmut are indicated. C, for detection of surface expression
of non-N-glycosylated Ii, human B lymphoma cells (JOK-1)
were incubated for 12 h with 10 µg/ml tunicamycin
(TM). Cells were subsequently surface labeled with biotin,
and surface Ii was detected by Western blotting.
|
|
Endocytic Degradation of Mutated Ii--
Ii was previously
detected on the cell surface (CD74) of human B lymphoma cells (31). If
non-N-glycosylated Ii is found on the cell surface this
would indicate export from the ER to the cell membrane. We
treated the human B lymphoma cell line JOK-1 for 12 h with
tunicamycin and subsequently labeled the cell surface with biotin.
Cells were lysed, and Ii was immunoprecipitated with mAb Bu45. Surface
biotinylated Ii was detected by Western blotting (Fig. 4C).
Both non-N-glycosylated and fully glycosylated surface Ii
were stained by a streptavidin-peroxidase-mediated reaction. This
result was confirmed by fluorescent-activated cell sorting staining of
tunicamycin and untreated JOK-1 cells with mAb Bu45 (not shown).
Surface expression of non-N-glycosylated Ii may suggest that
after internalization N-glycan-free, Ii is degraded in
endosomal/lysosomal vesicles. Various reagents with impact on endosomal
transport, acidic pH, or proteolytic activity had been used to block
degradation of Ii (32). We used chloroquine that elevates the pH in
endosomes and inhibits proteinase activity. As shown in Fig.
5A (right) treatment of cells with 250 µM of chloroquine almost
completely arrests degradation of Ii, indicating that the enzymes
involved in Ii proteolysis are pH sensitive. Inhibition of IiNmut
degradation by chloroquine (Fig. 5A, left)
indicates endosomal degradation, and this was further investigated with
additional proteinase inhibitors. The different proportion of
inhibition of Ii and IiNmut degradation that was observed after
chloroquine treatment may suggest that proteinases are involved in the
decay of the mutated Ii that are hindered by the carbohydrates in
degradation of wild-type Ii.

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 5.
Inhibition of endosomal degradation.
SDS-PAGE separation of Ii31 and IiNmut immunoprecipitated from
transfected COS7 cells is shown. Cells were labeled with
[35S]methionine for 20 min and subsequently cultured in
the presence of inhibitor in complete medium for the times indicated.
A, chloroquine; B, pepstatin A (aspartate
proteinase inhibitor); C, E64d (cysteine proteinase
inhibitor); D, concanamycin B; E, Pefabloc; and
F, TLCK (serine proteinase inhibitors). SDS-PAGE and
densitometric scans are shown.
|
|
It has been reported that cleavage of Ii is initiated by aspartate
proteinases whereas subsequent release of Ii from MHCII depends on
cysteine proteinases (33). We utilized pepstatin A and E64d as
asparagine and cysteine proteinase inhibitors, respectively. The impact
of these inhibitors on Ii and on IiNmut degradation after various times
of labeling with [35S]methionine is shown in Fig. 5,
B and C. Pepstatin A (Fig. 5B) and
E64d (Fig. 5C), both strongly impede degradation of Ii,
demonstrating a role of aspartate and of cysteine proteinases in Ii
degradation. Both inhibitors impair the decay of IiNmut, although to a
lower degree than of wild-type Ii. In the presence of inhibitors the half-life of IiNmut is substantially shorter than that of wild-type Ii.
It is interesting to note, that the aspartate proteinase inhibitor pepstatin A only doubles the half-life of IiNmut. This result may
suggest unlike the initial cleavage of Ii, which involves aspartate
proteinases, other proteinases account for degradation of IiNmut.
We explored the impact of concanamycin B, an antibiotic that
highly selectively inhibits vacuolar H+-ATPase, on
degradation of IiNmut. Concanamycin B raises the pH in
endosomal/lysosomal compartments, thus interrupting the early endosomal/late endosomal/lysosomal transition (34). Fig. 5D illustrates inhibition of Ii degradation by concanamycin B. Cellular degradation of Ii is almost completely blocked by concanamycin B,
greatly exceeding the efficacy of chloroquine. In the presence of
concanamycin B, IiNmut is stabilized to a half-life of about 200 min.
Inhibition of the decline of IiNmut by several inhibitors of acidic
endosomal proteinases indicates a vesicular degradation in
endosomal/lysosomal compartments. The incomplete block of acidic proteolysis (Fig. 5, A-D) of IiNmut may suggest that
nonacidic proteinases play a role. Thus, it is possible that enzymes
such as serine proteinases, which are active at a neutral pH, are
involved. We tested Pefabloc and TLCK, inhibitors of serine proteinases (Fig. 5, E and F). Remarkably, the
degradation of IiNmut was extensively inhibited by Pefabloc and by
TLCK, and both exceeded the impact of pepstatin A (Fig. 5B)
and E64d (Fig. 5C). Both Pefabloc and TLCK also affect decay
of Ii, indicating that in addition to neutral proteinases, acidic
proteinases responsible for Ii degradation are impaired. The degree of
inhibition of IiNmut degradation by concanamycin B and by Pefabloc
suggests a complementary function of the affected proteinases. In fact,
inhibition of IiNmut degradation by a combination of concanamycin B and
of Pefabloc almost completely blocked proteolysis (data not shown).
 |
DISCUSSION |
Consideration of the known functions of N-linked
glycosylation (35, 36) leads us to postulate several possible roles for the N-linked carbohydrates of Ii. The presence of Ii glycans
influences transient association to calnexin in the ER and the
stability of the MHCII/Ii complex. IiNmut forms trimers and associates
to MHCII complexes despite the lack of calnexin interaction
(30).2 The role of calnexin
may be to retain glycosylated Ii in the ER in order to provide excess
Ii for association to newly synthesized MHCII molecules (30).
Ii is degraded intracellularly to generate functional MHCII
heterodimers and is a very proteolytically sensitive protein. Thus, the
N-linked glycans may be essential to protect from immediate degradation while committing the Ii substrate to a controlled proteolysis. As shown in this paper, the N-linked
carbohydrates affect degradation at neutral pH, conditions that are
present in early endosomes. The intact MHCII/Ii complex is transported from early endosomes to more acidic compartments. There proteolytic release of Ii occurs and subsequent binding of antigenic peptides to
empty MHCII heterodimers is facilitated by an acidic pH. The N-linked carbohydrates thus may play a key role in directing
the route of Ii degradation to MHCII-processing compartments.
Activation of protein complexes by proteolysis is a common mechanism in
cell biology and is also found in the innate immune system. Several
components of the complement system acquire activity upon partial
proteolytic digestion. Such regulated degradation also plays a role in
the antigen-specific immune system and accounts for activation of the
immature MHCII complex. Recent findings indicate that MHCII dimers
appear in two conformations (37). One of these isomeric forms is active
for binding of peptides. The release of the Ii fragment CLIP from MHCII
dimers generates the peptide-receptive isomer. Thus the regulated
degradation of Ii and the generation of CLIP are important for
subsequent binding of peptides by MHCII molecules.
An increasing number of endosomal proteinases involved in MHCII antigen
processing have been identified (38). These proteinases shape the
repertoire of antigenic peptides that are captured by MHCII
heterodimers. Some of these proteinases are in addition to
fragmentation of protein antigens involved in processing of the
MHCII/Ii nonameric complex. A first cleavage of Ii occurs at the C
terminus of the MHCII groove-binding segment (39). Enzymes that under
physiological conditions initiate cleavage of the homotrimeric Ii and
generate the C-terminal truncated Ii fragment LIP (leupeptin-induced
peptide), have not yet been identified. There is some evidence that
degradation of Ii is started by an aspartate proteinase (33). Two
proteinases, cathepsin S and L were specific for subsequent cleavage of
LIP. The cysteine proteinase cathepsin S cleaves Ii after amino acids
78 or 80 of the Ii sequence and presumably generates the N terminus of
CLIP (40). In mice deficient for cathepsin S or L, LIP accumulates that
still associates with MHCII molecules (41, 42). Macrophages express
cathepsin F that also appears to be involved in Ii degradation (43).
Because the Asn-linked glycans separate the trimerization site from the MHCII binding site of Ii, it is possible that the carbohydrate moiety
directs the proteolytic cleavage towards the boundaries of the MHCII
groove. It is conceivable that this cleavage site is only available
under acidic conditions.
The carbohydrates may influence intracellular transport and
sorting of Ii. Possibly IiNmut is aberrantly sorted to neutral endocytic compartments where it is degraded. Villandangos et
al. (44) described recently a novel MHCII processing pathway.
Characteristic of this pathway is that it is independent of H2-M and
that degradation of MHCII-associated Ii cannot be blocked by
concanamycin B. Inhibition by concanamycin B demonstrated two
components of the endocytic pathway. In one of these pathways the
release of Ii from MHCII does not depend on cysteine proteinases.
Because, as has been shown here, degradation of IiNmut is not
completely blocked by concanamycin B, it is possible that this novel
MHCII-processing pathway accounts for the partial decay of IiNmut in
the presence of concanamycin B.
We demonstrated in this report, that N-linked
glycosylation plays a key role in the controlled endosomal degradation
of Ii. In the sequential degradation of Ii, N-glycans
provide a signal for acidic degradation in MHCII processing compartments.
 |
ACKNOWLEDGEMENT |
We thank Dr. Ian van Driel for critical
reading of the mansucript.
 |
FOOTNOTES |
*
This work was supported by the Sonderforschungsbereich 284, Teilprojekt B6.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 0049 228 734343;
Fax: 0049 228 734555; E-mail: norbert.koch@uni-bonn.de.
Published, JBC Papers in Press, January 22, 2001, DOI 10.1074/jbc.M010629200
2
N. Schach and N. Koch, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
MHCII, major histocompatibility complex class II;
Ii, MHCII-associated
invariant chain;
CLIP, class II-associated Ii peptides;
LIP, leupeptin-induced peptides. IiNmut, the Ii protein in which
asparagine-linked glycosylation sites were mutated;
ER, endoplasmic
reticulum;
PAGE, polyacrylamide gel electrophoresis;
Ab, antibody;
DSP, dithiobis-succinimidyl-propionate;
TLCK, 1-chloro-3-tosylamido-7-amino-2-heptanone.
 |
REFERENCES |
| 1.
|
Busch, R.,
Doebele, R. C.,
Patil, N. S.,
Pashine, A.,
and Mellins, E. D.
(2000)
Curr. Opin. Immunol.
12,
99-106
|
| 2.
|
Roche, P. A.,
Marks, M. S.,
and Cresswell, P.
(1991)
Nature
354,
392-394
|
| 3.
|
Busch, R.,
Cloutier, I.,
Sekaly, R. P.,
and Hammerling, G. J.
(1996)
EMBO J.
15,
418-428
|
| 4.
|
Hitzel, C.,
van Endert, P.,
and Koch, N.
(1995)
J. Immunol.
154,
1048-1056
|
| 5.
|
Anderson, M. S.,
and Miller, J.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
2282-2286
|
| 6.
|
Germain, R. N.,
and Rinker, A. G. J.
(1993)
Nature
363,
725-728
|
| 7.
|
Bakke, O.,
and Dobberstein, B.
(1990)
Cell
63,
707-716
|
| 8.
|
Arneson, L. S.,
and Miller, J.
(1995)
J. Cell Biol.
129,
1217-1228
|
| 9.
|
Tulp, A.,
Verwoerd, D.,
Dobberstein, B.,
Ploegh, H. L.,
and Pieters, J.
(1994)
Nature
369,
120-126
|
| 10.
|
Amigorena, S.,
Drake, J. R.,
Webster, P.,
and Mellman, I.
(1994)
Nature
369,
113-120
|
| 11.
|
Amigorena, S.,
Webster, P.,
Drake, J.,
Newcomb, J.,
Cresswell, P.,
and Mellman, I.
(1995)
J. Exp. Med.
181,
1729-1741
|
| 12.
|
Wolf, P. R.,
Tourne, S.,
Miyazaki, T.,
Benoist, C.,
Mathis, D.,
and Ploegh, H. L.
(1998)
Eur. J. Immunol.
28,
2605-2618
|
| 13.
|
Koch, N.,
Lauer, W.,
Habicht, J.,
and Dobberstein, B.
(1987)
EMBO J.
6,
1677-1683
|
| 14.
|
Bremnes, T.,
Lauvrak, V.,
Lindqvist, B.,
and Bakke, O.
(1998)
J. Biol. Chem.
273,
8638-8645
|
| 15.
|
Singer, P. A.,
Lauer, W.,
Dembic, Z.,
Mayer, W. E.,
Lipp, J.,
Koch, N.,
Hammerling, G.,
Klein, J.,
and Dobberstein, B.
(1984)
EMBO J.
3,
873-877
|
| 16.
|
Freisewinkel, I. M.,
Schenck, K.,
and Koch, N.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
9703-9706
|
| 17.
|
Ghosh, P.,
Amaya, M.,
Mellins, E.,
and Wiley, D. C.
(1995)
Nature
378,
457-462
|
| 18.
|
Stumptner, P.,
and Benaroch, P.
(1997)
EMBO J.
16,
5807-5818
|
| 19.
|
Siebenkotten, I. M.,
Carstens, C.,
and Koch, N.
(1998)
J. Immunol.
160,
3355-3362
|
| 20.
|
Bertolino, P.,
Staschewski, M.,
Trescol Biemont, M. C.,
Freisewinkel, I. M.,
Schenck, K.,
Chretien, I.,
Forquet, F.,
Gerlier, D.,
Rabourdin Combe, C.,
and Koch, N.
(1995)
J. Immunol.
154,
5620-5629
|
| 21.
|
Jasanoff, A.,
Wagner, G.,
and Wiley, D. C.
(1998)
EMBO J.
17,
6812-6818
|
| 22.
|
Bijlmakers, M. J.,
Benaroch, P.,
and Ploegh, H. L.
(1994)
J. Exp. Med.
180,
623-629
|
| 23.
|
Schroder, K.,
Martoglio, B.,
Hofmann, M.,
Holscher, C.,
Hartmann, E.,
Prehn, S.,
Rapoport, T. A.,
and Dobberstein, B.
(1999)
EMBO J.
18,
4804-4815
|
| 24.
|
Koch, N.,
Koch, S.,
and Hammerling, G. J.
(1982)
Nature
299,
644-645
|
| 25.
|
Wraight, C. J.,
van Endert, P.,
Moller, P.,
Lipp, J.,
Ling, N. R.,
MacLennan, I. C.,
Koch, N.,
and Moldenhauer, G.
(1990)
J. Biol. Chem.
265,
5787-5792
|
| 26.
|
Brosterhus, H.
(1994)
Post-translational Modifications of the MHC Class II-associated Invariant Chain, Thesis
, Universität Bonn, Germany
|
| 27.
|
Okayama, H.,
and Berg, P.
(1983)
Mol. Cell. Biol.
3,
280-289
|
| 28.
|
Manoury, B.,
Hewitt, E. W.,
Morrice, N.,
Dando, P. M.,
Barrett, A. J.,
and Watts, C.
(1998)
Nature
396,
695-699
|
| 29.
|
Gedde Dahl, M.,
Freisewinkel, I.,
Staschewski, M.,
Schenck, K.,
Koch, N.,
and Bakke, O.
(1997)
J. Biol. Chem.
272,
8281-8287
|
| 30.
|
Romagnoli, P.,
and Germain, R. N.
(1995)
J. Exp. Med.
182,
2027-2036
|
| 31.
|
Koch, N.,
Moldenhauer, G.,
Hofmann, W. J.,
and Moller, P.
(1991)
J. Immunol.
147,
2643-2651
|
| 32.
|
Villadangos, J. A.,
Bryant, R. A.,
Deussing, J.,
Driessen, C.,
Lennon,
D.umenil, A. M.,
Riese, R. J.,
Roth, W.,
Saftig, P.,
Shi, G. P.,
Chapman, H. A.,
Peters, C.,
and Ploegh, H. L.
(1999)
Immunol. Rev.
172,
109-120
|
| 33.
|
Maric, M. A.,
Taylor, M. D.,
and Blum, J. S.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
2171-2175
|
| 34.
|
Benaroch, P.,
Yilla, M.,
Raposo, G.,
Ito, K.,
Miwa, K.,
Geuze, H. J.,
and Ploegh, H. L.
(1995)
EMBO J.
14,
37-49
|
| 35.
|
Kundra-R,
and Kornfeld-S.
(1999)
J. Biol. Chem.
274,
31039-31046
|
| 36.
|
Hammond, C.,
Braakman, I.,
and Helenius, A.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
913-917
|
| 37.
|
Rabinowitz, J. D.,
Vrljic, M.,
Kasson, P. M.,
Liang, M. N.,
Busch, R.,
Boniface, J. J.,
Davis, M. M.,
and McConnell, H. M.
(1998)
Immunity
9,
699-709
|
| 38.
|
Villadangos, J. A.,
and Ploegh, H. L.
(2000)
Immunity
12,
233-239
|
| 39.
|
Riese, R. J.,
and Chapman, H. A.
(2000)
Curr. Opin. Immunol.
12,
107-113
|
| 40.
|
Villadangos, J. A.,
Riese, R. J.,
Peters, C.,
Chapman, H. A.,
and Ploegh, H. L.
(1997)
J. Exp. Med.
186,
549-560
|
| 41.
|
Nakagawa, T.,
Roth, W.,
Wong, P.,
Nelson, A.,
Farr, A.,
Deussing, J.,
Villadangos, J. A.,
Ploegh, H.,
Peters, C.,
and Rudensky, A. Y.
(1998)
Science
280,
450-453
|
| 42.
|
Nakagawa, T. Y.,
Brissette, W. H.,
Lira, P. D.,
Griffiths, R. J.,
Petrushova, N.,
Stock, J.,
McNeish, J. D.,
Eastman, S. E.,
Howard, E. D.,
Clarke, S. R.,
Rosloniec, E. F.,
Elliott, E. A.,
and Rudensky, A. Y.
(1999)
Immunity
10,
207-217
|
| 43.
|
Shi, G. P.,
Bryant, R. A.,
Riese, R.,
Verhelst, S.,
Driessen, C.,
Li, Z.,
Bromme, D.,
Ploegh, H. L.,
and Chapman, H. A.
(2000)
J. Exp. Med.
191,
1177-1186
|
| 44.
|
Villadangos, J. A.,
Driessen, C.,
Shi, G. P.,
Chapman, H. A.,
and Ploegh, H. L.
(2000)
EMBO J.
19,
882-891
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
I. Sloma, M.-T. Zilber, T. Vasselon, N. Setterblad, M. Cavallari, L. Mori, G. De Libero, D. Charron, N. Mooney, and C. Gelin
Regulation of CD1a Surface Expression and Antigen Presentation by Invariant Chain and Lipid Rafts
J. Immunol.,
January 15, 2008;
180(2):
980 - 987.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Neumann and N. Koch
A novel domain on HLA-DR{beta} chain regulates the chaperone role of the invariant chain
J. Cell Sci.,
October 15, 2006;
119(20):
4207 - 4214.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Klein, S. Koch, B. Borm, J. Neumann, V. Herzog, N. Koch, and T. Bieber
CD83 localization in a recycling compartment of immature human monocyte-derived dendritic cells
Int. Immunol.,
April 1, 2005;
17(4):
477 - 487.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Neumann, A. M. Eis-Hubinger, and N. Koch
Herpes Simplex Virus Type 1 Targets the MHC Class II Processing Pathway for Immune Evasion
J. Immunol.,
September 15, 2003;
171(6):
3075 - 3083.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|