|
Originally published In Press as doi:10.1074/jbc.M011562200 on January 22, 2001
J. Biol. Chem., Vol. 276, Issue 17, 13718-13726, April 27, 2001
ATF-7, a Novel bZIP Protein, Interacts with the PRL-1
Protein-tyrosine Phosphatase*
Charles S.
Peters ,
Xianping
Liang ,
Shuixing
Li§,
Subburaj
Kannan§,
Yong
Peng ,
Rebecca
Taub , and
Robert H.
Diamond§¶
From the § Department of Medicine, Division of
Gastroenterology, and the Department of Genetics,
University of Pennsylvania School of Medicine, Philadelphia,
Pennsylvania 19104-6145
Received for publication, December 21, 2000, and in revised form, January 12, 2001
 |
ABSTRACT |
We have identified a novel basic leucine zipper
(bZIP) protein, designated ATF-7, that physically interacts with the
PRL-1 protein-tyrosine phosphatase (PTPase). PRL-1 is a predominantly nuclear, farnesylated PTPase that has been linked to the control of
cellular growth and differentiation. This interaction was initially found using the yeast two-hybrid system. ATF-7 is most closely related
to members of the ATF/CREB family of bZIP proteins, with highest
homology to ATF-4. ATF-7 homodimers can bind specifically to CRE
elements. ATF-7 is expressed in a number of different tissues and is
expressed in association with differentiation in the Caco-2 cell model
of intestinal differentiation. We have confirmed the PRL-1·ATF-7
interaction and mapped the regions of ATF-7 and PRL-1 important
for interaction to ATF-7's bZIP region and PRL-1's phosphatase domain. Finally, we have determined that PRL-1 is able to
dephosphorylate ATF-7 in vitro. Further insight into
ATF-7's precise cellular roles, transcriptional function, and
downstream targets are likely be of importance in understanding the
mechanisms underlying the complex processes of maintenance,
differentiation, and turnover of epithelial tissues.
 |
INTRODUCTION |
It is clear that many cellular processes are regulated through
protein phosphorylation. This post-translational modification is
responsible for the control of a wide variety of important processes,
including the regulation of metabolism, cell proliferation, the cell
cycle, gene expression, protein synthesis, and cellular transport (1,
2). Because phosphorylation is a dynamic and reversible process, it
follows that phosphatases are as important as kinases in its regulation
(3, 4). Phosphorylation of transcription factors and their associated
proteins is one of the principal methods used to regulate gene
expression (1, 2, 5, 6). Alterations in protein phosphorylation states bring about these changes in a number of different ways, including the
regulation of subcellular localization (7-9), changes in DNA binding
(10, 11), or alterations in transactivating ability. Classic examples
of this latter phenomenon include the basic leucine zipper
(bZIP)1 proteins CREB and
c-Jun, where phosphorylation of specific residues in the
transactivating domain has been demonstrated to up-regulate transactivation, probably by allowing interaction of these proteins with transcriptional coactivators such as CREB-binding protein (12,
13). Kinases or phosphatases may also, in some situations, bind
transcription factors but influence transcription by acting on proteins
other than the transcription factors themselves (7, 14). An example of
this phenomenon is the nuclear tyrosine kinase c-Abl, which binds to
p53 and increases its transactivating ability without phosphorylating
it. It is thought that Abl may be able to execute this function by
phosphorylating the C-terminal domain of RNA polymerase II, which is
known to be extensively phosphorylated on tyrosine (14, 15).
The PRL-1 protein-tyrosine phosphatase (PTPase) was initially
identified as an immediate-early response gene in regenerating liver
and mitogen-stimulated fibroblasts (16). PRL-1 is a 20-kDa protein that
contains the "signature" amino acid sequence for the active site of
PTPases but otherwise does not contain regions of homology to any
previously described protein (16). PRL-1 is primarily localized to the
cell nucleus with a discrete, reproducible "speckled" pattern on
immunofluorescence. Under certain circumstances, PRL-1 also is
localized to extranuclear sites in the cell (17, 18). PRL-1 is found in
the insoluble cellular fraction, despite the fact that it is readily
soluble when expressed in bacteria (16). This is likely a result of
protein prenylation, because PRL-1 is a farnesylated protein (19). When
PRL-1 was stably overexpressed in 3T3 fibroblasts, altered growth
characteristics became apparent, including a faster doubling time,
growth to a greater saturation density, altered morphology, and
evidence of anchorage-independent growth manifested by the ability of
these cells to grow in soft agar (16). Overexpression of PRL-1 in epithelial cells resulted in tumor formation in nude mice (19).
PRL-1 is also significantly expressed in intestinal epithelia, and in
contrast to PRL-1's expression pattern in liver, its expression is
associated with cellular differentiation in the intestine.
Specifically, PRL-1 is expressed in villus but not crypt enterocytes,
and in differentiated, but not proliferating, Caco-2 cells (20).
Recently, PRL-1 protein was found to be expressed during development in
a number of differentiating epithelial tissues (17). These results
suggest that PRL-1 may have divergent roles in different tissues. It is
an established feature of some growth response genes that they may play
a role in terminal differentiation in some tissues (21-25). The
apparently paradoxical dual roles may be explained by the availability
of different substrates or cofactors in different cells, different
kinetics of protein expression, or by the presence of scaffolding or
anchoring proteins that may direct an enzyme to a different cellular
location and different substrates (26, 27).
Significant insight into PRL-1's specific cellular functions and the
reasons for its apparently varied expression pattern in different
tissues may be derived from identification of PRL-1's substrates and
other cellular partners. To that end, we performed a yeast two-hybrid
screen using PRL-1 as bait. We have identified a novel protein that
interacts with PRL-1. This protein, which we have designated ATF-7, is
a novel bZIP protein most closely related to members of the ATF/CREB
family. We have functionally confirmed that ATF-7 is a bZIP protein by
showing that its homodimers specifically bind to cyclic AMP response
(CRE) elements. We have confirmed the interaction of PRL-1 and ATF-7
using GST binding and coimmunoprecipitation assays, and we have mapped
the sites of interaction to include PRL-1's phosphatase domain and
ATF-7's bZIP domain. ATF-7 is expressed in a number of different
tissues, and it is expressed in association with differentiation in the Caco-2 cell model of intestinal differentiation. Finally, we have determined that PRL-1 is able to dephosphorylate ATF-7 in
vitro. It is likely that further insight into ATF-7's precise
cellular roles, transcriptional function, and downstream targets will
be of importance in understanding the mechanisms underlying the complex processes of maintenance, differentiation, and turnover of epithelial tissues.
 |
EXPERIMENTAL PROCEDURES |
Yeast Two-hybrid System and -Galactosidase Assays--
The
N-terminal 132 amino acids of PRL-1 fused to the C terminus of the GAL4
DNA binding domain in the yeast expression vector pGBT9
(CLONTECH) was constructed from the full-length
PRL-1 cDNA. This construct contains most of the full-length PRL-1
cDNA except for the C-terminal basic region and CCIQ farnesylation
domain. The active site cysteine (Cys-104) was mutated to serine
as previously described (C104S) (16). Use of active site
cysteine-serine mutant PTPases to demonstrate binding of PTPases to
other proteins is a well-established and validated method (28-30). A
3T3-L1 adipocyte library was synthesized from fully differentiated
adipocytes with a cDNA synthesis kit (Stratagene) and constructed
in the pGAD-10 GAL4 vector (CLONTECH) (gift of Dr.
Alan Saltiel) (31). The yeast strain HF7c was cotransformed with the
GAL4-PRL-1 construct and with the 3T3-L1 adipocyte library. The
resulting transformants were plated on selection medium lacking
tryptophan, leucine, and histidine and were incubated at 30 °C for
4-5 days. 5 × 106 clones were analyzed. Colonies
positive for growth on selective media lacking histidine were blotted
on filter paper (Whatman number 5), permeabilized in liquid nitrogen,
and placed on another filter soaked in Z buffer (60 mM
Na2HPO4, 40 mM
NaH2PO4, 10 mM KCl, 1 mM MgSO4, 37.5 mM
-mercaptoethanol) containing 1 mM
5-bromo-4-chloro-3-indolyl- -D-galactoside. Yeast
colonies were scored as positive when a bright color developed within
3 h. Library-derived plasmids were rescued from positive clones
and then transformed into HB101 Escherichia coli by
electroporation. False positives were eliminated by transforming the
rescued plasmids back into yeast along with either the PRL-1 bait
construct, empty vector, or a control p53 bait construct. True
positives were identified by their requirement for the PRL-1 bait
construct to activate the reporter genes, and these were then
sequenced. Sequence analysis was performed using GenAlign software, and
FASTA and BLAST searches were performed against the SwissProt and
GenBankTM data libraries.
Northern Blots--
RNA preparation, Northern blot analyses, and
labeling of recombinant plasmids have been described elsewhere (16,
32). Caco-2 cells were grown and harvested with respect to
proliferating and differentiated phenotypes as previously described
(20). Total RNA was extracted from cells and from mouse tissues using the techniques previously described (32, 33). Hybridization buffer
consisted of 10% dextran sulfate, 40% formamide, 0.6 M NaCl, 0.06 M sodium citrate, 7 mM Tris (pH
7.6), 0.8× Denhardt's solution, and 0.002% heat-denatured, sonicated
salmon sperm DNA. Northern blots were hybridized at 42 °C for
16 h and washed for 30 min twice at 60 °C in 0.015 M NaCl-0.0015 M sodium citrate-0.1% SDS prior
to exposure to film (33).
Plasmids and Antibodies--
The cDNA insert of a
full-length ATF-7 clone isolated in the yeast two-hybrid screen and the
cDNA insert of full-length C104S-PRL-1 were cloned into the pSPUTK
(Stratagene) both with and without an Myc epitope fused to the
N-terminal end. This vector provides a strong Kozak (34) consensus
sequence and methionine for translation. C104S-PRL-1 and wild type
PRL-1 were cloned into the pGEX GST fusion vector (Amersham Pharmacia
Biotech). The appropriate restriction sites and the indicated epitope
tags were added by performing the polymerase chain reaction with
primers containing these sequences. Plasmid constructs were confirmed
by sequencing and by protein expression. For interaction site mapping
studies, the following constructs were made in pSPUTK:
pSPUTK-ATF-7-amino (amino acids (aa) 1-139) and pSPUTK-ATF-7-bZIP (aa
140-217). The following constructs were made in pGEX:
PGEX-PRL-1-aa-1-96, PGEX-PRL-1-aa-1-132, PGEX-PRL-1-aa-60-118,
PGEX-PRL-1-aa-97-173, PGEX-PRL-1-aa-97-132, and
PGEX-PRL-1-aa-118-173. All deletion and truncation constructs were
made using polymerase chain reaction with appropriate primers and
restriction sites and were sequenced completely prior to use in
experiments. The in vitro translated proteins (pSPUTK) or
bacterially expressed proteins (pGEX) were all of the predicted size.
Rabbit polyclonal anti-ATF-7 antibodies were prepared by Cocalico
Biologicals (Reamstown, PA) against bacterially expressed
purified denatured ATF-7 protein expressed as a fusion protein
linked to six histidines (35). The anti-Myc epitope tag
monoclonal antibody (9E10) was obtained commercially (Babco, Richmond, CA).
In Vitro Transcription/Translation--
In vitro
transcription/translation was performed using the TnT-coupled lysate
system (Promega) according to the manufacturer's instructions. The
reaction was incubated for 2 h at 30 °C in the presence of
[35S]methionine, and the products were analyzed directly
by SDS-PAGE or subjected to immunoprecipitation or binding assays prior
to SDS-PAGE as described in the text.
GST Binding Assays--
Radiolabeled in vitro
translated proteins (5 µl) were incubated with GST or GST-PRL-1
C104S fusion proteins (1 µg), or with the indicated PRL-1 protein
fragments attached to glutathione-Sepharose beads in 500 µl of
binding buffer (20 mM HEPES, pH 7.5, 150 mM NaCl) for 1 h at 4 °C with gentle rotation. The beads were
washed five times with binding buffer and resuspended in Laemmli sample buffer, and the sample was analyzed by SDS-PAGE followed by autoradiography.
Coimmunoprecipitations--
The two proteins or protein
fragments being tested were in vitro translated
simultaneously as described above. One protein used was fused to the
Myc-tag epitope. 7.5 µl of the in vitro translated protein
was incubated with to 5 µl of the anti-Myc-tag antibody or control
sera in 500 µl of IP buffer (50 mM Tris, pH 7.4, 1 mM EDTA, 150 mM NaCl, 1% Triton) for 1 h
at 4 °C. Immunocomplexes were bound to protein A-agarose beads and,
after washing four times in IP buffer, were resolved by SDS-PAGE and
visualized by autoradiography.
Electromobility Shift Assays--
Preannealed, gel-purified,
double-stranded oligonucleotides were radiolabeled and incubated with 5 µl of in vitro translated proteins or 10 µg of mouse
liver nuclear extract for 15 min at room temperature in binding buffer
(10 mM Tris, pH 7.5/50 mM NaCl/1 mM
EDTA/1 mM dithiothreitol/5 mM
MgCl2/10% (v/v) glycerol). 1-2 µg of poly(dI-dC) was
used as a nonspecific competitor in each reaction. Nuclear extracts
from liver were prepared according to the method of Hattori (36), with
modifications (37). The mixtures were electrophoresed on a
nondenaturing polyacrylamide gel in 1× TBE buffer (88 mM
Tris, 88 mM boric acid, 2 mM EDTA). Gels were
dried and exposed to x-ray film. Supershifts were performed by
incubating 1-1.5 µl of primary antibody with in vitro
translated proteins in binding buffer for 45 min at 4 °C, prior to
addition of labeled oligonucleotide. Cold competitions were performed
by incubating unlabeled oligonucleotide in 100-fold excess with
in vitro translated proteins in binding buffer for 45 min at
4 °C prior to the addition of labeled oligonucleotide. The
double-stranded oligonucleotides used were: CRE:
TCATGGTAAAAATGACGTCATGGTAATTA, C/EBP:
GATCCGGTTGCCAAACATTGCGCAATCT, and AP1:
TATCGATAAGCTATGACTCATCCGGGGGA. Oligonucleotides were
end-labeled with [ -32P]ATP using polynucleotide kinase.
In Vitro Dephosphorylation of Tyrosine-phosphorylated ATF-7 by
PRL-1--
GST-ATF-7 was expressed in bacteria and purified using the
methods outlined above. The protein, attached to glutathione beads, was
tyrosine-phosphorylated with 32P using c-Src kinase
(Upstate Biotechnology) according to the manufacturer's directions.
After the kinase reaction was stopped, the beads were washed four times
in 1 ml of phosphatase buffer (50 mM HEPES, pH 7.5, 0.1%
-mercaptoethanol), resuspended, and split into three
equal aliquots. PRL-1 active phosphatase and C104S-PRL-1 inactive
mutant phosphatase were prepared as described previously (16). Equal
amounts of active or mutant PRL-1, or buffer (negative control), were
added to each tube, which were then incubated for 60 min at 37 °C.
The phosphatase reaction was terminated by the addition of equal
volumes of 2× Laemmli buffer, the products were then boiled, and run
on an SDS-PAGE gel, which was then dried and exposed to x-ray film
(Kodak). The results were quantified by densitometry.
 |
RESULTS |
Isolation of ATF-7 as a PRL-1 Binding Protein with the Yeast
Two-hybrid System--
To identify PRL-1-interacting proteins, a
truncated PRL-1 (amino acids 1-132) fused to the DNA binding domain of
GAL4 was used as bait to screen a 3T3-L1 adipocyte cDNA expression
library fused to the GAL4 transcriptional activation domain in the
yeast two-hybrid interaction system. The bait construct used contains most of the full-length PRL-1 protein except for the C-terminal basic
and farnesylation domains. Full-length PRL-1 bait did not yield any
positives (true or false), although we later determined that
full-length PRL-1 can in fact interact with ATF-7. We were able to
document that the full-length fusion protein was able to be expressed
in the yeast (data not shown). Because PRL-1 is a farnesylated protein
residing in the insoluble cellular fraction (despite being readily
soluble itself when expressed in bacteria) (16), we surmise that the
C-terminal basic and farnesylation domains caused misdirection of the
protein to a cellular site in the yeast where it was unable to interact
with potential prey proteins. Of 5 × 106 total
transformants, 38 colonies positive for -galactosidase activity were
isolated from histidine-minus plates. When the library-derived plasmids
were recovered from these 38 colonies, we determined that 31 were true
positives. 16 of these clones encoded either full-length or near
full-length ATF-7. The remaining 15 clones all encoded another novel
protein that has no homology to ATF-7 and is not a transcription
factor.2 This protein will be
the subject of a separate report. As summarized in Fig.
1, each of the GAL4-AD/ATF-7 clones
induced histidine-minus growth and -galactosidase activity only when
they were coexpressed with PRL-1-derived/GAL4-BD fusion protein and not
with an unrelated GAL4-BD fusion protein containing p53 or the GAL4 DNA
binding domain alone (empty vector).

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 1.
ATF-7 interaction with PRL-1 in the yeast
two-hybrid system. A two-hybrid screen was performed as described
under "Experimental Procedures." Of the 31 true positive clones
identified, 16 encoded ATF-7. Results of the two-hybrid screen show
that the interaction between the PRL-1-C104S-(1-132)-Gal4 DNA-binding
domain and ATF-7-Gal4 activation domain fusions is dependent on the
presence of both constructs and does not occur if empty vector controls
or an irrelevant bait construct (p53) is used.
|
|
cDNA Sequence of ATF-7--
Sequence analysis of the clone
with the longest insert (1.6 kb) revealed a single open reading frame
of 651 bp fused in-frame to the GAL4 activation domain. The sequence is
shown in Fig. 2A. An ATG
initiation codon was present near the 5'-end, which was a good match
for the canonical Kozak eukaryotic translation initiation consensus
(34). The sequence encodes a protein of 217 amino acid residues, with a
predicted molecular mass of 24 kDa and a pI of 5.46. In
vitro translation of the ATF
cDNA yielded an ~30-kDa protein
(Fig. 4), probably due to post-translational modification of the
protein.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 2.
ATF-7 encodes a novel bZIP protein, most
closely related to ATF-4, whose homodimers specifically bind to CRE
elements. A, nucleotide and deduced amino acid sequence
of the open reading frame of ATF-7. The bZIP domain is indicated by the
solid line, the leucine-valine zipper residues are indicated
in boldface, and the initiation (ATG) and stop (TAG)
codons are boxed. B, comparison of the
amino acid sequences of the bZIP domains of ATF-7 and several other
bZIP proteins showing greatest degree of homology with ATF-4.
Shaded areas indicate identical amino acids; boxed
areas indicate homologous amino acids. In a number of cases,
especially near the C terminus, ATF-7 and ATF-4 contain identical amino
acids that diverge from the consensus deduced from the other bZIP
proteins (see text for details). C, table summarizing the
homology among the bZIP proteins shown in B. In
D: left panel), CRE oligonucleotide was
radiolabeled and incubated with in vitro translated ATF-7
(first lane) as described under "Experimental
Procedures." The mixtures were electrophoresed on a nondenaturing
polyacrylamide gel, which was then dried and exposed to film.
Supershift (second lane) and competition assays
(third and fourth lanes) were performed as
described in the text. Specific ATF-7 and nonspecific bands are
indicated by arrows. Right panel, C/EBP
oligonucleotide was radiolabeled and incubated with reticulocyte lysate
alone (first lane), in vitro translated ATF-7
(second, third, and fourth lanes), or
mouse liver nuclear extract (fifth and sixth
lanes) as described under "Experimental Procedures." The
mixtures were processed as indicated for supershift and competition
experiments in the same manner as was done for the CRE experiments. The
supershift and cold competition data confirm that the band seen is a
nonspecific band that is not due to ATF-7 binding.
|
|
Comparison with data bases revealed that the sequence is novel but that
it has several characteristics of a bZIP transcription factor. The
extreme C-terminal end of the predicted ATF-7 protein contains three
leucines and three valines, each separated by six other amino acids,
suggesting a leucine zipper structure (38). This hybrid leucine-valine
zipper is unique to ATF-7 among the previously described bZIP proteins.
Immediately upstream of this leucine-valine zipper sequence is an
arginine-lysine-rich basic domain, thought to be necessary for
sequence-specific DNA binding by bZIP proteins (39, 40). The N-terminal
end of the predicted protein is negatively charged and proline-rich,
reminiscent of the acidic activation domains of bZIP transcription
factors. The bZIP family can be divided into three groups on the basis
of binding site preference (41): (i) the C/EBPs, (ii) the AP1 group of transcription factors, and (iii) the CREB/ATF family, which contains the ATFs, the original CREBs, and the CRE modulators. Distinctions within the bZIP family are also based upon differences in
transactivating ability, patterns of tissue expression, and
phosphorylation by specific kinases (41). As shown in Fig.
2B and summarized in Fig. 2C, ATF-7 is most
closely related to ATF-4 (also known as CREB-2, C/ATF, and TAXREB67
(42-45)). In a number of cases, especially near the C terminus, ATF-7
and ATF-4 contain identical amino acids that diverge from the consensus
deduced from the other bZIP proteins (Tyr-227, Asp-230, Glu-234,
Val-235, Lys-237, Arg-239, and Gln-241).
DNA Binding and Tissue Expression Pattern of ATF-7--
Because
bZIP proteins bind specific DNA elements, we next sought to confirm
that ATF-7 is indeed a DNA-binding protein and identify which DNA sites
ATF-7 it can bind. We used electromobility shift assays to test the
ability of in vitro translated ATF-7 to bind different DNA
sequences known to bound by bZIP proteins. As shown in Fig.
2D, in vitro translated ATF-7 can bind as a
homodimer to a CRE oligo probe (first lane). The specificity
of this binding is underscored by the supershift of the DNA·protein
complex by the addition of anti-ATF-7 antibody (second lane)
and its elimination upon addition of an excess of cold competitor oligo
(third lane). Conversely, the band is not eliminated by the
addition of excess mutant oligonucleotide composed of the same
nucleotides in a scrambled sequence (fourth lane). We have
verified that the supershift shown in the second lane is due
to ATF-7 and not a cross-reacting protein by obtaining the same results
using Myc- tagged ATF-7 and ant-Myc tag (9E10) antibody (data not
shown). Because ATF-4 has been reported to bind to C/EBP sites
(45-47), we also tested ATF-7's ability to bind to a C/EBP site
oligo. These data are also shown in Fig. 2D. We found that
ATF-7 could not bind this element as a homodimer. The single band that
appears in the ATF-7 (second) lane, is also present when
reticulocyte lysate alone is used (first lane). This band is
not supershifted by the addition of anti-ATF-7 antibody (third
lane) and is not eliminated by the addition of excess cold competitor oligo (fourth lane). The fifth lane
shows results with liver nuclear extract. As expected, there is
prominent binding evident, indicating that the failure of ATF-7 to bind
is not due to a problem with the oligo or binding conditions. We have
also not found evidence that ATF-7 homodimers can bind to AP1 sites (data not shown).
Northern blot analysis was performed to determine the tissue
distribution of ATF-7, and, as shown in Fig.
3A, it was found to be
expressed ubiquitously. The highest levels of expression appear to be
in the liver, lung, adipose tissue, heart, and skeletal muscle. We also
examined the expression pattern of ATF-7 in situations where PRL-1 has
a distinctive pattern of expression. We did not find variation in the
level of ATF-7 expression during liver regeneration (data not shown).
We then examined the expression of ATF-7 in Caco-2 cells, a human
colonic adenocarcinoma cell line, which exhibits spontaneous functional
differentiation when the cells have grown to confluence. This
differentiation is characterized by the development of an apical brush
border, expression of high levels of intestine-specific enzymes such as
lactase and sucrase, and the formation of a polarized cell layer with
domes (48, 49). As shown in Fig. 3B, ATF-7 is expressed to a
significantly greater degree in the post-confluent, differentiated
cells than it is in the preconfluent undifferentiated cells.
Interestingly, ATF-7's pattern of expression in these cells is
reminiscent of that of PRL-1 (20).

View larger version (62K):
[in this window]
[in a new window]
|
Fig. 3.
ATF-7 is expressed in a number of different
mouse tissues and is expressed in association with differentiation in
Caco-2 cells. A, total RNA was extracted from mouse
tissues using the techniques previously described (32, 33), Northern
blots were prepared and probed for ATF-7 as described under
"Experimental Procedures." The bottom panel shows the
ethidium stain of the gel used to prepare the Northern blot.
B, Caco-2 cells were grown in Dulbecco's modified Eagle's
medium, 10% fetal calf serum, and proliferating cells (Pre)
were harvested before they reached confluence. For the differentiated
phenotype (Post), cells were allowed to reach confluence,
and media was changed every 2 days until 7 days post-confluence when
the cell were harvested (73).
|
|
Confirmation and Mapping of the PRL-1·ATF-7
Interaction--
Coimmunoprecipitation assays were performed to verify
the interaction of ATF-7 with PRL-1 in vitro. As shown in
Fig. 4A, anti-Myc-tag antibody
(9E10) was able to coimmunoprecipitate in vitro translated ATF-7 along with Myc-tagged C104S-PRL-1 (lane 5), whereas
control antisera did not (lane 4). The anti-Myc-tag antibody
could not coimmunoprecipitate luciferase, a control in vitro
translated protein along with Myc-tagged C104S-PRL-1 (lane
6), indicating that the coimmunoprecipitation of ATF-7 is
specific.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 4.
PRL-1 and ATF-7 interact in
vitro. A, in vitro
transcription/translation of ATF-7, Myc-tagged C104S-PRL-1
(full-length), and luciferase control protein was performed in the
presence of [35S]methionine as described under
"Experimental Procedures." Immunoprecipitation with an anti-Myc-tag
antibody was then carried out as described under "Experimental
Procedures," and the products were resolved by SDS-PAGE and
visualized by autoradiography. Lanes 1-3 show the results
of the in vitro translation; lanes 4-6 show the
results of the immunoprecipitation, which demonstrates that ATF-7
coimmunoprecipitates with the Myc-tagged C104S PRL-1. B,
in vitro transcription/translation of C104S-PRL-1
(full-length), Myc-tagged ATF-7, and luciferase control protein was
performed in the presence of [35S]methionine as described
under "Experimental Procedures." Immunoprecipitation with an
anti-Myc-tag antibody was then carried out as described under
"Experimental Procedures," and the products were resolved by
SDS-PAGE and visualized by autoradiography. Lanes 1-3 show
the results of the in vitro translation; lanes
4-6 show the results of the immunoprecipitation, which
demonstrates that C104S PRL-1 co-immunoprecipitates with the Myc-tagged
ATF-7. C, in vitro translated ATF-7 was incubated
with GST or GST-PRL-1 C104S full-length fusion proteins attached to
glutathione-Sepharose beads, and after washing, the sample was analyzed
by SDS-PAGE followed by autoradiography. The bottom panel
shows a Coomassie Blue-stained SDS-PAGE gel demonstrating that the
fusion proteins were expressed and were of the expected size.
|
|
In a similar manner, as shown in Fig. 4B, the anti-Myc-tag
antibody was able to coimmunoprecipitate in vitro translated
C104S PRL-1 along with Myc-tagged ATF-7 (lane 5), whereas
control antisera did not (lane 4). The specificity of this
experiment was confirmed by demonstrating that the luciferase control
protein could not be coimmunoprecipitated along with Myc-ATF-7
(lane 6). Taken together, these results confirm the
interaction of PRL-1 and ATF-7 in vitro. To further confirm
this interaction, a glutathione S-transferase (GST)-C104S-PRL-1 fusion protein was used in an in vitro
binding assay with full-length in vitro translated ATF-7. As
shown in Fig. 4C, the GST-C104S-PRL-1 protein bound to
glutathione Sepharose beads interacts with full-length ATF-7
(lane 2), but ATF-7 did not interact with the control GST
protein (lane 1). We also performed the same experiment
using wild type GST-PRL-1 protein and obtained similar results (data
not shown).
To determine the regions of PRL-1 that are important for the
interaction with ATF-7, six truncated GST-PRL-1 constructs were synthesized and tested for their ability to bind in vitro
translated ATF-7. The constructs made spanned different regions of the
189-amino acid full-length PRL-1. As shown in Fig.
5A, GST fused to PRL-1 amino
acids 1-96, 60-118, or 118-173 are not able to bind to in vitro translated ATF-7, whereas GST constructs fused to PRL-1 amino acids 1-132 and 97-173 could bind to ATF-7. The results with
the construct containing amino acids 1-132 are not surprising, because
this construct corresponds to the "bait" construct used in the
two-hybrid screen. Analysis of these data (see diagram in Fig.
5B) generated the hypothesis that the region comprising amino acids 97-132, which corresponds to PRL-1's PTPase domain, was
critical in mediating PRL-1's ability to interact with ATF-7. Accordingly, we synthesized a GST fusion protein containing only amino
acids 97-132, and determined, as shown in lane 1 of Fig. 5A, that it was able to bind in vitro translated
ATF-7, albeit less efficiently than the aa 97-173 construct
(lane 3 of Fig. 5A) or full-length PRL-1 (Fig.
4C). The region contained in the 97-132 construct spans the
PRL-1's phosphatase domain and the 15 amino acids that follow it.
Neither the phosphatase domain alone nor the 15-amino acid region alone
is sufficient for ATF-7 binding, because neither the 60-118 nor
118-173 constructs, which contain the complete phosphatase domain or
the 15-amino acid region, respectively, was able to bind ATF-7. In
summary, these results indicate that the PRL-1 PTPase domain, combined
with an adjacent small amino acid region, is necessary and sufficient
for ATF-7 binding,. In addition, there may be regions in the C-terminal of PRL-1 that contribute to ATF-7 binding, although they are not absolutely required.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 5.
PRL-1 and ATF-7 interact in vitro
largely through the ATF-7 bZIP domain and the PRL-1 PTPase
domain. A, in vitro translated ATF-7 was
incubated with the indicated GST-PRL-1 fragment fusion proteins
attached to glutathione-Sepharose beads, and after washing, the sample
was analyzed by SDS-PAGE followed by autoradiography. The bottom
panel shows a Coomassie Blue-stained SDS-PAGE gel demonstrating
that the GST-PRL-1 fusion proteins were expressed and were of the
expected size. B, diagram summarizing the results depicted
in A, indicating that the PRL-1 PTPase domain and a short
stretch of amino acids following it are necessary for interaction with
ATF-7. See text for details. C, in vitro
translated ATF-7 (1) (amino) or ATF-7 (141)
(bZIP) was incubated with GST or GST-PRL-1 full-length
fusion proteins, and after washing, the sample was analyzed by SDS-PAGE
followed by autoradiography. Lanes 1 and 2 show
the in vitro translation products alone. Lanes 3 and 4 show the result of binding assays with GST alone, and
lanes 5 and 6 show the results of binding with
GST-PRL-1. The results show that the ATF-7 bZIP domain (lane
6) alone binds GST-PRL-1, but the non-bZIP (amino)
region of ATF-7 (lane 5) does not, indicating that the bZIP
domain of ATF-7 alone is sufficient for interaction with PRL-1.
|
|
To determine the regions of ATF-7 that are important for mediating the
interaction with PRL-1, we employed GST binding assays. Full-length
(C104S) PRL-1 fused to GST was used in these assays along with two
in vitro translated ATF-7 fragments, ATF-7 amino acids
1-138 and ATF-7 amino acids 139-218. The latter construct consists of
only the bZIP region of ATF-7. As shown in Fig. 5C, the
ATF-7-139-218 (bZIP domain-only) protein was able to bind to
GST-C104S-PRL-1 (lane 6), whereas the large region upstream of the bZIP region by itself was not able to bind GST-C104S-PRL-1 (lane 5). As expected, neither fragment was able to bind to
GST alone (lanes 3 and 4). These data indicate
that the bZIP region is necessary and sufficient for PRL-1 binding.
Taken together, it can be concluded that the PRL-1·ATF-7 interaction
is mediated by interaction of PRL-1's PTPase domain and ATF-7's bZIP domain.
Ability of PRL-1 to Selectively Dephosphorylate ATF-7 in
Vitro--
Because our data indicated that the PRL-1 phosphatase
domain was necessary for interaction with ATF-7, we sought to determine whether PRL-1 is capable of dephosphorylating ATF-7 in
vitro. We used c-Src kinase to phospholabel GST-ATF-7 on tyrosine.
This kinase was not able to phosphorylate GST alone (data not shown). We split the products of the kinase reaction into equal aliquots and
then used each in a phosphatase assay using either PRL-1, C104S
inactive PRL-1 (MUT), or buffer. Because all three phosphatase reactions derive from the same common kinase reaction, the ratio of
labeled ATF-7 to labeled c-Abl must be constant among the three tubes
before the addition of the phosphatase or control. This ratio would not
be affected by uneven division of the kinase reaction or uneven loading
of the gel, because there would be more or less of both proteins in the
same proportion. No change in this ratio would be seen if PRL-1
nonspecifically dephosphorylated both c-Src and ATF-7, because the
phosphorylation of both would decrease. The degree to which this ratio
decreases thus reflects selective dephosphorylation of ATF-7 by PRL-1.
A representative result is shown in Fig.
6A. We found that
significantly less ATF-7 remained phosphorylated relative to c-Abl
after treatment with PRL-1 than after treatment with the C104S-PRL-1 or
buffer controls. This indicates that PRL-1 was able to selectively
partially dephosphorylate the tyrosine-phosphorylated ATF-7. The
results of four separate experiments were quantified by densitometry
and are shown in Fig. 6B. PRL-1 was significantly
(p < 0.01) more able to dephosphorylate the labeled
ATF-7 than either C104S-PRL-1 or buffer alone control.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 6.
Tyrosine-phosphorylated ATF-7 can be
specifically dephosphorylated in vitro by PRL-1.
A, GST-ATF-7 was expressed in bacteria, purified, and
tyrosine-phosphorylated with 32P using c-Src as outlined
under "Experimental Procedures." After the kinase reaction was
stopped, the beads were washed four times and split into three equal
aliquots. Equal amounts of active or mutant PRL-1, or buffer (negative
control), were added to each tube, which were then incubated for 60 min
at 37 °C. The phosphatase reaction was terminated by the addition of
equal volumes of 2× Laemmli buffer. The products were then boiled and
run on an SDS-PAGE gel, which was then dried and exposed to x-ray film
(Kodak). Because all three phosphatase reactions derive from the same
common kinase reaction, the ratio of labeled ATF-7 to labeled c-Src
must be constant among the three tubes before the addition of
phosphatase or control. (This ratio would not be affected by uneven
division of the kinase reaction or uneven loading of the gel, because
there would be more or less of both proteins in the same
proportion.) No change in this ratio would be seen if PRL-1
nonspecifically dephosphorylated both c-Src and ATF-7, because the
phosphorylation of both would decrease. The degree to which this ratio
decreases thus reflects selective dephosphorylation of ATF-7 by PRL-1.
A representative result is shown in A. We found that
significantly less ATF-7 remained phosphorylated relative to c-Src
after treatment with PRL-1 than after treatment with the C104S-PRL-1 or
buffer controls. This indicates that PRL-1 was able to selectively
partially dephosphorylate the tyrosine-phosphorylated ATF-7. The
results of four separate experiments were quantified by densitometry
and are shown in B. PRL-1 was significantly
(p < 0.01) more able to dephosphorylate the labeled
ATF-7 than either C104S-PRL-1 or buffer alone control.
|
|
 |
DISCUSSION |
Using the yeast two-hybrid system, we have identified ATF-7 as a
novel bZIP protein that interacts with the PRL-1 nuclear PTPase. The
interaction of PRL-1 and ATF-7 has been confirmed using GST binding and
coimmunoprecipitation assays, and the sites of interaction have been
mapped to include PRL-1's phosphatase domain and ATF-7's bZIP domain.
An important issue is the role of ATF-7 and its partner PRL-1 in
cellular differentiation. There are a number of items that support the
existence of such a role. We have previously shown that PRL-1
expression is associated with differentiation (20). Recently, we have
also found that PRL-1 is expressed both in the adult and during
development in a number of differentiating epithelial tissues,
including intestine, stomach, kidney, and lung (17). We have also found
that PRL-1 is expressed in 3T3-L1 adipocytes in association with
differentiation,2 and we identified the ATF-7·PRL-1
interaction by two-hybrid screening of a 3T3-L1 adipocyte library. We
have further shown here that ATF-7 is expressed to a much greater
degree in post-confluent, differentiated Caco-2 cells than in
preconfluent undifferentiated cells, a pattern reminiscent of that of
PRL-1. All of these findings suggest that ATF-7 may play an important
role in the development and maintenance of differentiating
epithelial tissues.
Ultimately, experiments involving ectopic overexpression or
ablation of ATF-7 in specific cells and tissues will be necessary to
determine whether it has a direct role in modulating cellular differentiation. A potential mechanism might involve the
ZIPK/DLK kinase (50). It is interesting to note that the highly
homologous ATF-4 protein has been shown to interact with this protein,
which in turn has been linked to both differentiation and apoptosis (51, 52). Concomitant roles in differentiation and apoptosis are
plausible in the intestine, where enterocytes sequentially pass
through proliferation, differentiation, and apoptosis phases during
their life cycle (53). Agents that induce differentiation in several
tissue models have also been shown capable of promoting apoptosis. One
example is the ability of butyrate to sequentially induce these two
processes in intestinal cells (54-56).
We show here that tyrosine-phosphorylated ATF-7 can be
selectively dephosphorylated by PRL-1 in vitro. The control
of transcription through the regulation of transcription factor
phosphorylation is a well-established concept (1, 2, 5, 6). However, our results must be interpreted with caution. Although they are consistent with the possibility that PRL-1's cellular role may involve
dephosphorylating ATF-7, much more work will need to be done before
this can be established. We have observed only partial dephosphorylation of the labeled ATF-7 in these experiments, a result
that could indicate that proper reaction conditions are not present, or
that ATF-7 is phosphorylated at multiple sites, only some of which are
dephosphorylated by PRL-1. However, it is also possible that the basis
for the PRL-1·ATF-7 interaction is not that of a
phosphatase·substrate interaction. Future studies will be geared
toward analyzing whether this phenomenon occurs in vivo,
mapping the specific residue(s) that are affected, and determining the
transcriptional consequences of such a reaction. If ATF-7 itself is not
a target of PRL-1, it may serve to bring PRL-1 into proximity with its
true substrates. In this manner, PRL-1 could influence transcription by
acting on transcriptional cofactors or elements of the basal
transcription machinery. In some situations, kinases or phosphatases
may bind transcription factors but influence transcription by acting on
proteins other than the transcription factors themselves. A classic
example of this phenomenon is the regulation of the NF B
transcription factor by phosphorylation of its sequestering inhibitor
I B, which leads to I B's degradation (7, 57). Another example is
the nuclear tyrosine kinase c-Abl, which binds to p53 and increases its
transactivating ability without phosphorylating it. It is thought that
Abl may be able to execute this function by phosphorylating the
C-terminal domain of RNA polymerase II, which is known to be
extensively phosphorylated on tyrosine (14, 15). Alternatively, ATF-7 may have extra-transcriptional roles involving sequestration of specific proteins (e.g. ZIPK) with roles in the
regulation of apoptosis or differentiation, as has been proposed for
the highly homologous ATF-4 protein, (51, 52, 58). PRL-1 might impact upon these processes by dephosphorylating ATF-7 itself, or by acting on
the target proteins bound by ATF-7.
We have determined that ATF-7 homodimers bind to CRE sites,
and we have not found evidence that ATF-7 homodimers can bind to AP1 or
C/EBP sites. Interestingly however, the only other published data about
ATF-7 is the description of a partial clone, comprising only ATF-7's
bZIP region, that was identified in a Far Western screen as interacting
with the C/EBP transcription factor (59). This suggests that ATF-7
can interact with C/EBP family members, which are known to play
important roles in the differentiation and development of a number of
tissues, including liver and intestine (60-63). One manner in which
this could occur is through the formation of ATF-7-C/EBP heterodimers.
It is a hallmark of bZIP proteins that they extensively heterodimerize
with each other, both within and outside of individual families. These
interactions are not completely promiscuous but are instead restricted
by a specific and complex "dimerization code" (64, 65). In some
cases, cross-family heterodimers bind to the preferred site of one of
the dimer members (66, 67), whereas in other cases, the heterodimers
bind to novel composite sites (45-47, 68-70). In some cases,
dimerization occurs only with members of other bZIP families. In this
regard, it is interesting to note that ATF-4, the bZIP protein most
similar to ATF-7, can form heterodimers with members of the C/EBP
family, including C/EBP and C/EBP (45, 46, 68, 71), but has not
been reported to heterodimerize with any other member of the ATF/CREB
family. In these situations, the heterodimeric complexes bind to either
C/EBP sites or to ATF-C/EBP composite sites (45-47, 70), although
ATF-4 homodimers do not bind to either of these sites. In addition,
ATF-4 has also been reported to form heterodimers with the AP1 proteins
Fos and Jun (72). It is possible that ATF-7 may play an
important role in transcriptional regulation in a similar manner as
ATF-4 through interaction with C/EBP and/or AP1 family members. Future
experiments will be designed to address this issue.
In summary, the identification of the ATF-7·PRL-1 interaction not
only provides information about how PRL-1 may bring about the
phenotypic states with which it is associated but also may have
important implications for our understanding of the transcriptional regulation of target genes that modulate differentiation.
 |
ACKNOWLEDGEMENT |
We thank Dr. Anil K. Rustgi for helpful discussions.
Note Added in Proof While this manuscript was under review,
sequences for mouse and human ATF-5 were deposited in GenBankTM. It
appears that ATF-7 and ATF-5 are likely to be the same protein. In
addition, an unrelated sequence named ATF7 has also been deposited in
GenBankTM. In order to avoid confusion, future work on the protein described in this publication will likely refer to it as either ATF-5
or ATF-5/7.
 |
FOOTNOTES |
*
This work is supported by National Institutes of Health
Grants R01 DK52216 and R01 DK44237, by University of Pennsylvania NIDDK/National Institutes of Health Center for Molecular Studies in
Digestive and Liver Diseases Grant P30 DK50306, and by the American
Digestive Health Foundation Miles and Shirley Fiterman Award for Basic
Science Research.The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: Dept. of
Medicine/GI Division, 664 Clinical Research Bldg., University of
Pennsylvania School of Medicine, 415 Curie Blvd., Philadelphia, PA
19104-6145. Tel.: 215-898-0155; Fax: 215-573-2024; E-mail:
diamondr@mail.med.upenn.edu.
Published, JBC Papers in Press, January 22, 2001, DOI 10.1074/jbc.M011562200
2
R. Diamond, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
bZIP, basic leucine
zipper protein;
PTPase, protein-tyrosine phosphatase;
CRE, cyclic-AMP
response element;
CREB, CRE-binding protein;
ATF, activating
transcription factor;
bp, base pair(s);
C/EBP, CCAAT enhancer-binding
protein;
GST, glutathione S-transferase;
TK, thymidine
kinase;
aa, amino acid(s);
PAGE, polyacrylamide gel electrophoresis;
kb, kilobase(s).
 |
REFERENCES |
| 1.
|
Hunter, T.
(1995)
Cell
80,
225-236
|
| 2.
|
Karin, M.
(1995)
Curr. Opin. Cell Biol.
6,
415-424
|
| 3.
|
Tonks, N. K.,
and Neel, B. G.
(1996)
Cell
87,
365-368
|
| 4.
|
Fauman, E. B.,
and Saper, M. A.
(1996)
Trends Biochem. Sci.
21,
413-417
|
| 5.
|
Boulikas, T.
(1995)
Crit. Rev. Eukaryot. Gene Expr.
5,
1-77
|
| 6.
|
Hunter, T.,
and Karin, M.
(1992)
Cell
70,
375-387
|
| 7.
|
Ghosh, S.,
and Baltimore, D.
(1990)
Nature
344,
678-682
|
| 8.
|
Darnell, J. E.
(1997)
Science
277,
1630-1635
|
| 9.
|
Beals, C. R.,
Clipstone, N. A.,
Hu, S. N.,
and Crabtree, G. R.
(1997)
Genes Dev.
11,
824-834
|
| 10.
|
Boyle, W. J.,
Smeal, T.,
Defize, L. H.,
Angel, P.,
Woodgett, J. R.,
Karin, M.,
and Hunter, T.
(1991)
Cell
64,
573-584
|
| 11.
|
Bourbon, H. M.,
Martin-Blanco, E.,
Rosen, D.,
and Kornberg, T. B.
(1995)
Cell
270,
11130-11139
|
| 12.
|
Chrivia, J. C.,
Kwok, R. P. S.,
Lamb, N.,
Hagiwara, M.,
Montminy, M. R.,
and Goodman, R. H.
(1993)
Nature
365,
855-859
|
| 13.
|
Kwok, R. P. S.,
Lundblad, J. R.,
Chrivia, J. C.,
Richards, J. P.,
Bachinger, H. P.,
Brennan, R. G.,
Roberts, S. G. E.,
Green, M. R.,
and Goodman, R. H.
(1994)
Nature
370,
223-226
|
| 14.
|
Baskaran, R.,
Dahmus, M. E.,
and Wang, J. Y. J.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
11167-11171
|
| 15.
|
Kharbanda, S.,
Yuan, Z. M.,
Weichselbaum, R.,
and Kufe, D.
(1998)
Oncogene
17,
3309-3318
|
| 16.
|
Diamond, R. H.,
Cressman, D. E.,
Laz, T. M.,
Abrams, C. S.,
and Taub, R.
(1994)
Mol. Cell. Biol.
14,
3752-3762
|
| 17.
|
Kong, W.,
Swain, G. P.,
Li, S.,
and Diamond, R. H.
(2000)
Am. J. Physiol.
279,
G613-G621
|
| 18.
|
Zeng, Q.,
Si, X.,
Horstmann, H.,
Xu, Y.,
Hong, W.,
and Pallen, C. J.
(2000)
J. Biol. Chem.
275,
21444-21452
|
| 19.
|
Cates, C. A.,
Michael, R. L.,
Stayrook, K. R.,
Harvey, K. A.,
Burke, Y. D.,
Randall, S. K.,
Crowell, P. L.,
and Crowell, D. N.
(1996)
Cancer Lett.
110,
49-55
|
| 20.
|
Diamond, R. H.,
Peters, C.,
Jung, S. P.,
Greenbaum, L. E.,
Haber, B. A.,
Silberg, D. G.,
Traber, P. G.,
and Taub, R.
(1996)
Am. J. Physiol.
271,
G121-G129
|
| 21.
|
Bar-Sagi, D.,
and Feramisco, J. R.
(1985)
Cell
42,
841-848
|
| 22.
|
Benito, M.,
Porras, A.,
Nebreda, A. R.,
and Santos, E.
(1991)
Science
253,
565-568
|
| 23.
|
Cass, L. A.,
and Meinkoth, J. L.
(2000)
Oncogene
19,
924-932
|
| 24.
|
Celano, P. C. M.,
Berchtold, M.,
Mabry, M.,
Carroll, M.,
Sidransky, D.,
Casero, R. A.,
and Lupu, R.
(1993)
Cell Growth Differ.
4,
341-347
|
| 25.
|
Yamaguchi-Iwai, Y.,
Satake, M.,
Murakami, Y.,
Sakai, M.,
Muramatsu, M.,
and Ito, Y.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
8670-8674
|
| 26.
|
Pawson, T.,
and Scott, J. D.
(1997)
Science
275,
2075-2080
|
| 27.
|
Marshall, C. J.
(1995)
Cell
80,
179-185
|
| 28.
|
Sun, H.,
Charles, C. H.,
Lau, L. F.,
and Tonks, N. K.
(1993)
Cell
75,
487-493
|
| 29.
|
Garton, A. J.,
Flint, A. J.,
and Tonks, N. K.
(1996)
Mol. Cell. Biol.
16,
6408-6418
|
| 30.
|
Zhang, S. H.,
Liu, J.,
Koyabashi, R.,
and Tonks, N. K.
(1999)
J. Biol. Chem.
274,
17806-17812
|
| 31.
|
Ribon, V.,
Printen, J. A.,
Hoffman, N. G.,
Kay, B. K.,
and Saltiel, A. R.
(1998)
Mol. Cell. Biol.
18,
872-879
|
| 32.
|
Mohn, K. L.,
Laz, T. M.,
Hsu, J. C.,
Melby, A. E.,
Bravo, R.,
and Taub, R.
(1991)
Mol. Cell. Biol.
11,
381-390
|
| 33.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 34.
|
Kozak, M.
(1991)
J. Biol. Chem.
266,
19867-19870
|
| 35.
|
Rosenberg, A. H.,
Lade, B. N.,
Chui, D. S.,
Lin, S. W.,
Dunn, J. J.,
and Studier, F. W.
(1987)
Gene
56,
125-135
|
| 36.
|
Hattori, M.,
Tugores, A.,
Veloz, L.,
Karin, M.,
and Brenner, D. A.
(1990)
DNA Cell Biol.
9,
777-781
|
| 37.
|
Greenbaum, L. E.,
Cressman, D. E.,
Haber, B. A.,
and Taub, R.
(1995)
J. Clin. Invest.
96,
1351-1365
|
| 38.
|
Landschulz, W. H.,
Johnson, P. F.,
and McKnight, S. L.
(1988)
Science
240,
1759-1764
|
| 39.
|
Dang, C. V.,
McGuire, M.,
Buckmire, M.,
and Lee, W. M. F.
(1989)
Nature
337,
664-666
|
| 40.
|
Neuberg, M. M.,
Schuermann, M.,
Hunter, J. B.,
and Muller, R.
(1989)
Nature
338,
589-590
|
| 41.
|
Lamb, P.,
and McKnight, S. L.
(1991)
Trends Biochem. Sci.
16,
417-422
|
| 42.
|
Tsujimoto, A.,
Nyunoya, H.,
Morita, T.,
Sato, T.,
and Shimotohno, K.
(1991)
J. Virol.
65,
1420-1426
|
| 43.
|
Mielnicki, L. M.,
Hughes, R. G.,
Chevray, P. M.,
and Pruitt, S. C.
(1996)
Bichem. Biophys Res. Commun.
228,
586-595
|
| 44.
|
Karpinski, B. A.,
Marle, G. D.,
Huggenvik, J.,
Uhler, M. D.,
and Leiden, J. M.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
4820-4824
|
| 45.
|
Vallejo, M.,
Ron, D.,
Miller, C. P.,
and Habener, J. F.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
4679-4683
|
| 46.
|
Kapatos, G.,
Stegenga, S. L.,
and Hirayama, K.
(2000)
J. Biol. Chem.
275,
5947-5957
|
| 47.
|
Estes, S. D.,
Stoler, D. L.,
and Anderson, G. R.
(1995)
Exp. Cell Res.
220,
47-54
|
| 48.
|
Pinto, M.,
Robine-Leon, S.,
Appay, M. D.,
Kedinger, M.,
Triandou, N.,
Dussaulx, W.,
Lacroix, B.,
Simon-Assmann, P.,
Haffen, K.,
Fogh, J.,
and Zweibaum, A.
(1983)
Biol. Cell
47,
323-330
|
| 49.
|
Jumarie, C.,
and Malo, C.
(1991)
J. Cell. Physiol.
149,
24-33
|
| 50.
|
Kawai, T.,
Matsumoto, M.,
Takeda, K.,
Sanjo, H.,
and Akira, S.
(1998)
Mol. Cell. Biol.
18,
1642-1651
|
| 51.
|
Kogel, D.,
Bierbaum, H.,
Preuss, U.,
and Scheidtmann, K. H.
(1999)
Oncogene
18,
7212-7218
|
| 52.
|
Page, G.,
Kogel, D.,
Rangnekar, V.,
and Scheidtmann, K. H.
(1999)
Oncogene
18,
7265-7273
|
| 53.
|
Potten, C. S.
(1997)
Am. J. Physiol.
273,
G253-G257
|
| 54.
|
Heerdt, B. G.,
Houston, M. A.,
and Augenlicht, L. H.
(1994)
Cancer Res.
54,
3288-3294
|
| 55.
|
Litvak, D. A.,
Evers, B. M.,
Hwang, K. O.,
Hellmich, M. R.,
Ko, T. C.,
and Townsend, C. W.
(1998)
Surgery
124,
161-170
|
| 56.
|
Maruoka, Y.,
Harada, H.,
Mitsuyasu, T.,
Seta, Y.,
Kurokawa, H.,
Kajiyama, M.,
and Toyoshima, K.
(1997)
Biochem. Biophys Res. Commun.
238,
886-890
|
| 57.
|
Regnier, C. H.,
Song, H. Y.,
Gao, X.,
Goeddel, D. V.,
Cao, Z.,
and Rothe, M.
(1997)
Cell
90,
373-383
|
| 58.
|
Kogel, D.,
Plottner, O.,
Landsberg, G.,
Christian, S.,
and Scheidtmann, K. H.
(1998)
Oncogene
17,
2645-2654
|
| 59.
|
Nishizawa, M.,
and Nagata, S.
(1992)
FEBS Lett.
299,
36-38
|
| 60.
|
Darlington, G. J.,
Wang, N.,
and Hanson, R. W.
(1995)
Curr. Opin. Genet. Dev.
5,
565-570
|
| 61.
|
Umek, R. M.,
Friedman, A. D.,
and McKnight, S. L.
(1991)
Science
251,
288-292
|
| 62.
|
Yeh, W. C.,
Cao, Z.,
Classon, M.,
and McKnight, S. L.
(1995)
Genes Dev.
9,
168-181
|
| 63.
|
Montgomery, R. K.,
Rings, E. H.,
Thompson, J. F.,
Schuijt, C. C.,
Aras, K. M.,
Wielenga, V. J.,
Kothe, M. J.,
Buller, H. A.,
and Grand, R. J.
(1997)
Am. J. Physiol.
272,
G534-G544
|
| 64.
|
Hoeffler, J. P.,
Lustbader, J. W.,
and Chen, C. Y.
(1991)
Mol. Endocrinol.
5,
256-266
|
| 65.
|
Kerppola, T. K.,
and Curran, T.
(1993)
Mol. Cell. Biol.
13,
5479-5486
|
| 66.
|
Benbrook, D. M.,
and Jones, N. C.
(1990)
Oncogene
5,
295-302
|
| 67.
|
Shuman, J.,
Cheung, J. H.,
and Coligan, J. E.
(1997)
J. Biol. Chem.
272,
12793-12800
|
| 68.
|
Avitahl, N.,
and Calame, K.
(1994)
J. Biol. Chem.
269,
23553-23562
|
| 69.
|
Ubeda, M.,
Wang, X. Z.,
Zinszner, H.,
Wu, I.,
Habener, J. F.,
and Ron, D.
(1996)
Mol. Cell. Biol.
16,
1479-1489
|
| 70.
|
Fawcett, T. W.,
Martindale, J. L.,
Guyton, K. Z.,
Hai, T.,
and Holbrook, N. J.
(1999)
Biochem. J.
339,
135-141
|
| 71.
|
Vinson, C. R.,
Hai, T.,
and Boyd, S. M.
(1993)
Genes Dev.
7,
1047-1058
|
| 72.
|
Hai, T.,
and Curran, T.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
3720-3724
|
| 73.
|
Field, F. J.,
Albright, E.,
and Mathur, S. N.
(1987)
J. Lipid Res.
28,
1057-1066
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
G. Li, W. Li, J. M. Angelastro, L. A. Greene, and D. X. Liu
Identification of a Novel DNA Binding Site and a Transcriptional Target for Activating Transcription Factor 5 in C6 Glioma and MCF-7 Breast Cancer Cells
Mol. Cancer Res.,
June 1, 2009;
7(6):
933 - 943.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. KNIPPEN, T. LONING, V. MULLER, C. SCHRODER, F. JANICKE, and K. MILDE-LANGOSCH
Expression and Prognostic Value of Activating Transcription Factor 2 (ATF2) and its Phosphorylated Form in Mammary Carcinomas
Anticancer Res,
January 1, 2009;
29(1):
183 - 189.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Pascual, M. J. Gomez-Lechon, J. V. Castell, and R. Jover
ATF5 Is a Highly Abundant Liver-Enriched Transcription Factor that Cooperates with Constitutive Androstane Receptor in the Transactivation of CYP2B6: Implications in Hepatic Stress Responses
Drug Metab. Dispos.,
June 1, 2008;
36(6):
1063 - 1072.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Tommasino, M. Villani, A. Qureshi, J. Henry, C. Luberto, and M. Del Poeta
Atf2 Transcription Factor Binds to the APP1 Promoter in Cryptococcus neoformans: Stimulatory Effect of Diacylglycerol
Eukaryot. Cell,
February 1, 2008;
7(2):
294 - 301.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Tateyama, K. Horisawa, H. Takashima, E. Miyamoto-Sato, N. Doi, and H. Yanagawa
Affinity selection of DNA-binding protein complexes using mRNA display
Nucleic Acids Res.,
February 14, 2006;
34(3):
e27 - e27.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. Stephens, H. Han, V. Gokhale, and D. D. Von Hoff
PRL phosphatases as potential molecular targets in cancer
Mol. Cancer Ther.,
November 1, 2005;
4(11):
1653 - 1661.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Forgacs, S. K. Gupta, J. A. Kerry, and O. J. Semmes
The bZIP Transcription Factor ATFx Binds Human T-Cell Leukemia Virus Type 1 (HTLV-1) Tax and Represses HTLV-1 Long Terminal Repeat-Mediated Transcription
J. Virol.,
June 1, 2005;
79(11):
6932 - 6939.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. S. Moorefield, S. J. Fry, and J. M. Horowitz
Sp2 DNA Binding Activity and trans-Activation Are Negatively Regulated in Mammalian Cells
J. Biol. Chem.,
April 2, 2004;
279(14):
13911 - 13924.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Angelastro, T. N. Ignatova, V. G. Kukekov, D. A. Steindler, G. B. Stengren, C. Mendelsohn, and L. A. Greene
Regulated Expression of ATF5 Is Required for the Progression of Neural Progenitor Cells to Neurons
J. Neurosci.,
June 1, 2003;
23(11):
4590 - 4600.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. P. Persengiev, L. R. Devireddy, and M. R. Green
Inhibition of apoptosis by ATFx: a novel role for a member of the ATF/CREB family of mammalian bZIP transcription factors
Genes & Dev.,
July 15, 2002;
16(14):
1806 - 1814.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Si, Q. Zeng, C. H. Ng, W. Hong, and C. J. Pallen
Interaction of Farnesylated PRL-2, a Protein-tyrosine Phosphatase, with the beta -Subunit of Geranylgeranyltransferase II
J. Biol. Chem.,
August 24, 2001;
276(35):
32875 - 32882.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|