Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M011562200 on January 22, 2001

J. Biol. Chem., Vol. 276, Issue 17, 13718-13726, April 27, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/17/13718    most recent
M011562200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Peters, C. S.
Right arrow Articles by Diamond, R. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Peters, C. S.
Right arrow Articles by Diamond, R. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

ATF-7, a Novel bZIP Protein, Interacts with the PRL-1 Protein-tyrosine Phosphatase*

Charles S. PetersDagger , Xianping LiangDagger , Shuixing Li§, Subburaj Kannan§, Yong PengDagger , Rebecca TaubDagger , and Robert H. Diamond§

From the § Department of Medicine, Division of Gastroenterology, and the Dagger  Department of Genetics, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104-6145

Received for publication, December 21, 2000, and in revised form, January 12, 2001




    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We have identified a novel basic leucine zipper (bZIP) protein, designated ATF-7, that physically interacts with the PRL-1 protein-tyrosine phosphatase (PTPase). PRL-1 is a predominantly nuclear, farnesylated PTPase that has been linked to the control of cellular growth and differentiation. This interaction was initially found using the yeast two-hybrid system. ATF-7 is most closely related to members of the ATF/CREB family of bZIP proteins, with highest homology to ATF-4. ATF-7 homodimers can bind specifically to CRE elements. ATF-7 is expressed in a number of different tissues and is expressed in association with differentiation in the Caco-2 cell model of intestinal differentiation. We have confirmed the PRL-1·ATF-7 interaction and mapped the regions of ATF-7 and PRL-1 important for interaction to ATF-7's bZIP region and PRL-1's phosphatase domain. Finally, we have determined that PRL-1 is able to dephosphorylate ATF-7 in vitro. Further insight into ATF-7's precise cellular roles, transcriptional function, and downstream targets are likely be of importance in understanding the mechanisms underlying the complex processes of maintenance, differentiation, and turnover of epithelial tissues.




    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

It is clear that many cellular processes are regulated through protein phosphorylation. This post-translational modification is responsible for the control of a wide variety of important processes, including the regulation of metabolism, cell proliferation, the cell cycle, gene expression, protein synthesis, and cellular transport (1, 2). Because phosphorylation is a dynamic and reversible process, it follows that phosphatases are as important as kinases in its regulation (3, 4). Phosphorylation of transcription factors and their associated proteins is one of the principal methods used to regulate gene expression (1, 2, 5, 6). Alterations in protein phosphorylation states bring about these changes in a number of different ways, including the regulation of subcellular localization (7-9), changes in DNA binding (10, 11), or alterations in transactivating ability. Classic examples of this latter phenomenon include the basic leucine zipper (bZIP)1 proteins CREB and c-Jun, where phosphorylation of specific residues in the transactivating domain has been demonstrated to up-regulate transactivation, probably by allowing interaction of these proteins with transcriptional coactivators such as CREB-binding protein (12, 13). Kinases or phosphatases may also, in some situations, bind transcription factors but influence transcription by acting on proteins other than the transcription factors themselves (7, 14). An example of this phenomenon is the nuclear tyrosine kinase c-Abl, which binds to p53 and increases its transactivating ability without phosphorylating it. It is thought that Abl may be able to execute this function by phosphorylating the C-terminal domain of RNA polymerase II, which is known to be extensively phosphorylated on tyrosine (14, 15).

The PRL-1 protein-tyrosine phosphatase (PTPase) was initially identified as an immediate-early response gene in regenerating liver and mitogen-stimulated fibroblasts (16). PRL-1 is a 20-kDa protein that contains the "signature" amino acid sequence for the active site of PTPases but otherwise does not contain regions of homology to any previously described protein (16). PRL-1 is primarily localized to the cell nucleus with a discrete, reproducible "speckled" pattern on immunofluorescence. Under certain circumstances, PRL-1 also is localized to extranuclear sites in the cell (17, 18). PRL-1 is found in the insoluble cellular fraction, despite the fact that it is readily soluble when expressed in bacteria (16). This is likely a result of protein prenylation, because PRL-1 is a farnesylated protein (19). When PRL-1 was stably overexpressed in 3T3 fibroblasts, altered growth characteristics became apparent, including a faster doubling time, growth to a greater saturation density, altered morphology, and evidence of anchorage-independent growth manifested by the ability of these cells to grow in soft agar (16). Overexpression of PRL-1 in epithelial cells resulted in tumor formation in nude mice (19).

PRL-1 is also significantly expressed in intestinal epithelia, and in contrast to PRL-1's expression pattern in liver, its expression is associated with cellular differentiation in the intestine. Specifically, PRL-1 is expressed in villus but not crypt enterocytes, and in differentiated, but not proliferating, Caco-2 cells (20). Recently, PRL-1 protein was found to be expressed during development in a number of differentiating epithelial tissues (17). These results suggest that PRL-1 may have divergent roles in different tissues. It is an established feature of some growth response genes that they may play a role in terminal differentiation in some tissues (21-25). The apparently paradoxical dual roles may be explained by the availability of different substrates or cofactors in different cells, different kinetics of protein expression, or by the presence of scaffolding or anchoring proteins that may direct an enzyme to a different cellular location and different substrates (26, 27).

Significant insight into PRL-1's specific cellular functions and the reasons for its apparently varied expression pattern in different tissues may be derived from identification of PRL-1's substrates and other cellular partners. To that end, we performed a yeast two-hybrid screen using PRL-1 as bait. We have identified a novel protein that interacts with PRL-1. This protein, which we have designated ATF-7, is a novel bZIP protein most closely related to members of the ATF/CREB family. We have functionally confirmed that ATF-7 is a bZIP protein by showing that its homodimers specifically bind to cyclic AMP response (CRE) elements. We have confirmed the interaction of PRL-1 and ATF-7 using GST binding and coimmunoprecipitation assays, and we have mapped the sites of interaction to include PRL-1's phosphatase domain and ATF-7's bZIP domain. ATF-7 is expressed in a number of different tissues, and it is expressed in association with differentiation in the Caco-2 cell model of intestinal differentiation. Finally, we have determined that PRL-1 is able to dephosphorylate ATF-7 in vitro. It is likely that further insight into ATF-7's precise cellular roles, transcriptional function, and downstream targets will be of importance in understanding the mechanisms underlying the complex processes of maintenance, differentiation, and turnover of epithelial tissues.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Yeast Two-hybrid System and beta -Galactosidase Assays-- The N-terminal 132 amino acids of PRL-1 fused to the C terminus of the GAL4 DNA binding domain in the yeast expression vector pGBT9 (CLONTECH) was constructed from the full-length PRL-1 cDNA. This construct contains most of the full-length PRL-1 cDNA except for the C-terminal basic region and CCIQ farnesylation domain. The active site cysteine (Cys-104) was mutated to serine as previously described (C104S) (16). Use of active site cysteine-serine mutant PTPases to demonstrate binding of PTPases to other proteins is a well-established and validated method (28-30). A 3T3-L1 adipocyte library was synthesized from fully differentiated adipocytes with a cDNA synthesis kit (Stratagene) and constructed in the pGAD-10 GAL4 vector (CLONTECH) (gift of Dr. Alan Saltiel) (31). The yeast strain HF7c was cotransformed with the GAL4-PRL-1 construct and with the 3T3-L1 adipocyte library. The resulting transformants were plated on selection medium lacking tryptophan, leucine, and histidine and were incubated at 30 °C for 4-5 days. 5 × 106 clones were analyzed. Colonies positive for growth on selective media lacking histidine were blotted on filter paper (Whatman number 5), permeabilized in liquid nitrogen, and placed on another filter soaked in Z buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, 37.5 mM beta -mercaptoethanol) containing 1 mM 5-bromo-4-chloro-3-indolyl-beta -D-galactoside. Yeast colonies were scored as positive when a bright color developed within 3 h. Library-derived plasmids were rescued from positive clones and then transformed into HB101 Escherichia coli by electroporation. False positives were eliminated by transforming the rescued plasmids back into yeast along with either the PRL-1 bait construct, empty vector, or a control p53 bait construct. True positives were identified by their requirement for the PRL-1 bait construct to activate the reporter genes, and these were then sequenced. Sequence analysis was performed using GenAlign software, and FASTA and BLAST searches were performed against the SwissProt and GenBankTM data libraries.

Northern Blots-- RNA preparation, Northern blot analyses, and labeling of recombinant plasmids have been described elsewhere (16, 32). Caco-2 cells were grown and harvested with respect to proliferating and differentiated phenotypes as previously described (20). Total RNA was extracted from cells and from mouse tissues using the techniques previously described (32, 33). Hybridization buffer consisted of 10% dextran sulfate, 40% formamide, 0.6 M NaCl, 0.06 M sodium citrate, 7 mM Tris (pH 7.6), 0.8× Denhardt's solution, and 0.002% heat-denatured, sonicated salmon sperm DNA. Northern blots were hybridized at 42 °C for 16 h and washed for 30 min twice at 60 °C in 0.015 M NaCl-0.0015 M sodium citrate-0.1% SDS prior to exposure to film (33).

Plasmids and Antibodies-- The cDNA insert of a full-length ATF-7 clone isolated in the yeast two-hybrid screen and the cDNA insert of full-length C104S-PRL-1 were cloned into the pSPUTK (Stratagene) both with and without an Myc epitope fused to the N-terminal end. This vector provides a strong Kozak (34) consensus sequence and methionine for translation. C104S-PRL-1 and wild type PRL-1 were cloned into the pGEX GST fusion vector (Amersham Pharmacia Biotech). The appropriate restriction sites and the indicated epitope tags were added by performing the polymerase chain reaction with primers containing these sequences. Plasmid constructs were confirmed by sequencing and by protein expression. For interaction site mapping studies, the following constructs were made in pSPUTK: pSPUTK-ATF-7-amino (amino acids (aa) 1-139) and pSPUTK-ATF-7-bZIP (aa 140-217). The following constructs were made in pGEX: PGEX-PRL-1-aa-1-96, PGEX-PRL-1-aa-1-132, PGEX-PRL-1-aa-60-118, PGEX-PRL-1-aa-97-173, PGEX-PRL-1-aa-97-132, and PGEX-PRL-1-aa-118-173. All deletion and truncation constructs were made using polymerase chain reaction with appropriate primers and restriction sites and were sequenced completely prior to use in experiments. The in vitro translated proteins (pSPUTK) or bacterially expressed proteins (pGEX) were all of the predicted size. Rabbit polyclonal anti-ATF-7 antibodies were prepared by Cocalico Biologicals (Reamstown, PA) against bacterially expressed purified denatured ATF-7 protein expressed as a fusion protein linked to six histidines (35). The anti-Myc epitope tag monoclonal antibody (9E10) was obtained commercially (Babco, Richmond, CA).

In Vitro Transcription/Translation-- In vitro transcription/translation was performed using the TnT-coupled lysate system (Promega) according to the manufacturer's instructions. The reaction was incubated for 2 h at 30 °C in the presence of [35S]methionine, and the products were analyzed directly by SDS-PAGE or subjected to immunoprecipitation or binding assays prior to SDS-PAGE as described in the text.

GST Binding Assays-- Radiolabeled in vitro translated proteins (5 µl) were incubated with GST or GST-PRL-1 C104S fusion proteins (1 µg), or with the indicated PRL-1 protein fragments attached to glutathione-Sepharose beads in 500 µl of binding buffer (20 mM HEPES, pH 7.5, 150 mM NaCl) for 1 h at 4 °C with gentle rotation. The beads were washed five times with binding buffer and resuspended in Laemmli sample buffer, and the sample was analyzed by SDS-PAGE followed by autoradiography.

Coimmunoprecipitations-- The two proteins or protein fragments being tested were in vitro translated simultaneously as described above. One protein used was fused to the Myc-tag epitope. 7.5 µl of the in vitro translated protein was incubated with to 5 µl of the anti-Myc-tag antibody or control sera in 500 µl of IP buffer (50 mM Tris, pH 7.4, 1 mM EDTA, 150 mM NaCl, 1% Triton) for 1 h at 4 °C. Immunocomplexes were bound to protein A-agarose beads and, after washing four times in IP buffer, were resolved by SDS-PAGE and visualized by autoradiography.

Electromobility Shift Assays-- Preannealed, gel-purified, double-stranded oligonucleotides were radiolabeled and incubated with 5 µl of in vitro translated proteins or 10 µg of mouse liver nuclear extract for 15 min at room temperature in binding buffer (10 mM Tris, pH 7.5/50 mM NaCl/1 mM EDTA/1 mM dithiothreitol/5 mM MgCl2/10% (v/v) glycerol). 1-2 µg of poly(dI-dC) was used as a nonspecific competitor in each reaction. Nuclear extracts from liver were prepared according to the method of Hattori (36), with modifications (37). The mixtures were electrophoresed on a nondenaturing polyacrylamide gel in 1× TBE buffer (88 mM Tris, 88 mM boric acid, 2 mM EDTA). Gels were dried and exposed to x-ray film. Supershifts were performed by incubating 1-1.5 µl of primary antibody with in vitro translated proteins in binding buffer for 45 min at 4 °C, prior to addition of labeled oligonucleotide. Cold competitions were performed by incubating unlabeled oligonucleotide in 100-fold excess with in vitro translated proteins in binding buffer for 45 min at 4 °C prior to the addition of labeled oligonucleotide. The double-stranded oligonucleotides used were: CRE: TCATGGTAAAAATGACGTCATGGTAATTA, C/EBP: GATCCGGTTGCCAAACATTGCGCAATCT, and AP1: TATCGATAAGCTATGACTCATCCGGGGGA. Oligonucleotides were end-labeled with [gamma -32P]ATP using polynucleotide kinase.

In Vitro Dephosphorylation of Tyrosine-phosphorylated ATF-7 by PRL-1-- GST-ATF-7 was expressed in bacteria and purified using the methods outlined above. The protein, attached to glutathione beads, was tyrosine-phosphorylated with 32P using c-Src kinase (Upstate Biotechnology) according to the manufacturer's directions. After the kinase reaction was stopped, the beads were washed four times in 1 ml of phosphatase buffer (50 mM HEPES, pH 7.5, 0.1% beta -mercaptoethanol), resuspended, and split into three equal aliquots. PRL-1 active phosphatase and C104S-PRL-1 inactive mutant phosphatase were prepared as described previously (16). Equal amounts of active or mutant PRL-1, or buffer (negative control), were added to each tube, which were then incubated for 60 min at 37 °C. The phosphatase reaction was terminated by the addition of equal volumes of 2× Laemmli buffer, the products were then boiled, and run on an SDS-PAGE gel, which was then dried and exposed to x-ray film (Kodak). The results were quantified by densitometry.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Isolation of ATF-7 as a PRL-1 Binding Protein with the Yeast Two-hybrid System-- To identify PRL-1-interacting proteins, a truncated PRL-1 (amino acids 1-132) fused to the DNA binding domain of GAL4 was used as bait to screen a 3T3-L1 adipocyte cDNA expression library fused to the GAL4 transcriptional activation domain in the yeast two-hybrid interaction system. The bait construct used contains most of the full-length PRL-1 protein except for the C-terminal basic and farnesylation domains. Full-length PRL-1 bait did not yield any positives (true or false), although we later determined that full-length PRL-1 can in fact interact with ATF-7. We were able to document that the full-length fusion protein was able to be expressed in the yeast (data not shown). Because PRL-1 is a farnesylated protein residing in the insoluble cellular fraction (despite being readily soluble itself when expressed in bacteria) (16), we surmise that the C-terminal basic and farnesylation domains caused misdirection of the protein to a cellular site in the yeast where it was unable to interact with potential prey proteins. Of 5 × 106 total transformants, 38 colonies positive for beta -galactosidase activity were isolated from histidine-minus plates. When the library-derived plasmids were recovered from these 38 colonies, we determined that 31 were true positives. 16 of these clones encoded either full-length or near full-length ATF-7. The remaining 15 clones all encoded another novel protein that has no homology to ATF-7 and is not a transcription factor.2 This protein will be the subject of a separate report. As summarized in Fig. 1, each of the GAL4-AD/ATF-7 clones induced histidine-minus growth and beta -galactosidase activity only when they were coexpressed with PRL-1-derived/GAL4-BD fusion protein and not with an unrelated GAL4-BD fusion protein containing p53 or the GAL4 DNA binding domain alone (empty vector).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1.   ATF-7 interaction with PRL-1 in the yeast two-hybrid system. A two-hybrid screen was performed as described under "Experimental Procedures." Of the 31 true positive clones identified, 16 encoded ATF-7. Results of the two-hybrid screen show that the interaction between the PRL-1-C104S-(1-132)-Gal4 DNA-binding domain and ATF-7-Gal4 activation domain fusions is dependent on the presence of both constructs and does not occur if empty vector controls or an irrelevant bait construct (p53) is used.

cDNA Sequence of ATF-7-- Sequence analysis of the clone with the longest insert (1.6 kb) revealed a single open reading frame of 651 bp fused in-frame to the GAL4 activation domain. The sequence is shown in Fig. 2A. An ATG initiation codon was present near the 5'-end, which was a good match for the canonical Kozak eukaryotic translation initiation consensus (34). The sequence encodes a protein of 217 amino acid residues, with a predicted molecular mass of 24 kDa and a pI of 5.46. In vitro translation of the ATF cDNA yielded an ~30-kDa protein (Fig. 4), probably due to post-translational modification of the protein.



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 2.   ATF-7 encodes a novel bZIP protein, most closely related to ATF-4, whose homodimers specifically bind to CRE elements. A, nucleotide and deduced amino acid sequence of the open reading frame of ATF-7. The bZIP domain is indicated by the solid line, the leucine-valine zipper residues are indicated in boldface, and the initiation (ATG) and stop (TAG) codons are boxed. B, comparison of the amino acid sequences of the bZIP domains of ATF-7 and several other bZIP proteins showing greatest degree of homology with ATF-4. Shaded areas indicate identical amino acids; boxed areas indicate homologous amino acids. In a number of cases, especially near the C terminus, ATF-7 and ATF-4 contain identical amino acids that diverge from the consensus deduced from the other bZIP proteins (see text for details). C, table summarizing the homology among the bZIP proteins shown in B. In D: left panel), CRE oligonucleotide was radiolabeled and incubated with in vitro translated ATF-7 (first lane) as described under "Experimental Procedures." The mixtures were electrophoresed on a nondenaturing polyacrylamide gel, which was then dried and exposed to film. Supershift (second lane) and competition assays (third and fourth lanes) were performed as described in the text. Specific ATF-7 and nonspecific bands are indicated by arrows. Right panel, C/EBP oligonucleotide was radiolabeled and incubated with reticulocyte lysate alone (first lane), in vitro translated ATF-7 (second, third, and fourth lanes), or mouse liver nuclear extract (fifth and sixth lanes) as described under "Experimental Procedures." The mixtures were processed as indicated for supershift and competition experiments in the same manner as was done for the CRE experiments. The supershift and cold competition data confirm that the band seen is a nonspecific band that is not due to ATF-7 binding.

Comparison with data bases revealed that the sequence is novel but that it has several characteristics of a bZIP transcription factor. The extreme C-terminal end of the predicted ATF-7 protein contains three leucines and three valines, each separated by six other amino acids, suggesting a leucine zipper structure (38). This hybrid leucine-valine zipper is unique to ATF-7 among the previously described bZIP proteins. Immediately upstream of this leucine-valine zipper sequence is an arginine-lysine-rich basic domain, thought to be necessary for sequence-specific DNA binding by bZIP proteins (39, 40). The N-terminal end of the predicted protein is negatively charged and proline-rich, reminiscent of the acidic activation domains of bZIP transcription factors. The bZIP family can be divided into three groups on the basis of binding site preference (41): (i) the C/EBPs, (ii) the AP1 group of transcription factors, and (iii) the CREB/ATF family, which contains the ATFs, the original CREBs, and the CRE modulators. Distinctions within the bZIP family are also based upon differences in transactivating ability, patterns of tissue expression, and phosphorylation by specific kinases (41). As shown in Fig. 2B and summarized in Fig. 2C, ATF-7 is most closely related to ATF-4 (also known as CREB-2, C/ATF, and TAXREB67 (42-45)). In a number of cases, especially near the C terminus, ATF-7 and ATF-4 contain identical amino acids that diverge from the consensus deduced from the other bZIP proteins (Tyr-227, Asp-230, Glu-234, Val-235, Lys-237, Arg-239, and Gln-241).

DNA Binding and Tissue Expression Pattern of ATF-7-- Because bZIP proteins bind specific DNA elements, we next sought to confirm that ATF-7 is indeed a DNA-binding protein and identify which DNA sites ATF-7 it can bind. We used electromobility shift assays to test the ability of in vitro translated ATF-7 to bind different DNA sequences known to bound by bZIP proteins. As shown in Fig. 2D, in vitro translated ATF-7 can bind as a homodimer to a CRE oligo probe (first lane). The specificity of this binding is underscored by the supershift of the DNA·protein complex by the addition of anti-ATF-7 antibody (second lane) and its elimination upon addition of an excess of cold competitor oligo (third lane). Conversely, the band is not eliminated by the addition of excess mutant oligonucleotide composed of the same nucleotides in a scrambled sequence (fourth lane). We have verified that the supershift shown in the second lane is due to ATF-7 and not a cross-reacting protein by obtaining the same results using Myc- tagged ATF-7 and ant-Myc tag (9E10) antibody (data not shown). Because ATF-4 has been reported to bind to C/EBP sites (45-47), we also tested ATF-7's ability to bind to a C/EBP site oligo. These data are also shown in Fig. 2D. We found that ATF-7 could not bind this element as a homodimer. The single band that appears in the ATF-7 (second) lane, is also present when reticulocyte lysate alone is used (first lane). This band is not supershifted by the addition of anti-ATF-7 antibody (third lane) and is not eliminated by the addition of excess cold competitor oligo (fourth lane). The fifth lane shows results with liver nuclear extract. As expected, there is prominent binding evident, indicating that the failure of ATF-7 to bind is not due to a problem with the oligo or binding conditions. We have also not found evidence that ATF-7 homodimers can bind to AP1 sites (data not shown).

Northern blot analysis was performed to determine the tissue distribution of ATF-7, and, as shown in Fig. 3A, it was found to be expressed ubiquitously. The highest levels of expression appear to be in the liver, lung, adipose tissue, heart, and skeletal muscle. We also examined the expression pattern of ATF-7 in situations where PRL-1 has a distinctive pattern of expression. We did not find variation in the level of ATF-7 expression during liver regeneration (data not shown). We then examined the expression of ATF-7 in Caco-2 cells, a human colonic adenocarcinoma cell line, which exhibits spontaneous functional differentiation when the cells have grown to confluence. This differentiation is characterized by the development of an apical brush border, expression of high levels of intestine-specific enzymes such as lactase and sucrase, and the formation of a polarized cell layer with domes (48, 49). As shown in Fig. 3B, ATF-7 is expressed to a significantly greater degree in the post-confluent, differentiated cells than it is in the preconfluent undifferentiated cells. Interestingly, ATF-7's pattern of expression in these cells is reminiscent of that of PRL-1 (20).



View larger version (62K):
[in this window]
[in a new window]
 
Fig. 3.   ATF-7 is expressed in a number of different mouse tissues and is expressed in association with differentiation in Caco-2 cells. A, total RNA was extracted from mouse tissues using the techniques previously described (32, 33), Northern blots were prepared and probed for ATF-7 as described under "Experimental Procedures." The bottom panel shows the ethidium stain of the gel used to prepare the Northern blot. B, Caco-2 cells were grown in Dulbecco's modified Eagle's medium, 10% fetal calf serum, and proliferating cells (Pre) were harvested before they reached confluence. For the differentiated phenotype (Post), cells were allowed to reach confluence, and media was changed every 2 days until 7 days post-confluence when the cell were harvested (73).

Confirmation and Mapping of the PRL-1·ATF-7 Interaction-- Coimmunoprecipitation assays were performed to verify the interaction of ATF-7 with PRL-1 in vitro. As shown in Fig. 4A, anti-Myc-tag antibody (9E10) was able to coimmunoprecipitate in vitro translated ATF-7 along with Myc-tagged C104S-PRL-1 (lane 5), whereas control antisera did not (lane 4). The anti-Myc-tag antibody could not coimmunoprecipitate luciferase, a control in vitro translated protein along with Myc-tagged C104S-PRL-1 (lane 6), indicating that the coimmunoprecipitation of ATF-7 is specific.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 4.   PRL-1 and ATF-7 interact in vitro. A, in vitro transcription/translation of ATF-7, Myc-tagged C104S-PRL-1 (full-length), and luciferase control protein was performed in the presence of [35S]methionine as described under "Experimental Procedures." Immunoprecipitation with an anti-Myc-tag antibody was then carried out as described under "Experimental Procedures," and the products were resolved by SDS-PAGE and visualized by autoradiography. Lanes 1-3 show the results of the in vitro translation; lanes 4-6 show the results of the immunoprecipitation, which demonstrates that ATF-7 coimmunoprecipitates with the Myc-tagged C104S PRL-1. B, in vitro transcription/translation of C104S-PRL-1 (full-length), Myc-tagged ATF-7, and luciferase control protein was performed in the presence of [35S]methionine as described under "Experimental Procedures." Immunoprecipitation with an anti-Myc-tag antibody was then carried out as described under "Experimental Procedures," and the products were resolved by SDS-PAGE and visualized by autoradiography. Lanes 1-3 show the results of the in vitro translation; lanes 4-6 show the results of the immunoprecipitation, which demonstrates that C104S PRL-1 co-immunoprecipitates with the Myc-tagged ATF-7. C, in vitro translated ATF-7 was incubated with GST or GST-PRL-1 C104S full-length fusion proteins attached to glutathione-Sepharose beads, and after washing, the sample was analyzed by SDS-PAGE followed by autoradiography. The bottom panel shows a Coomassie Blue-stained SDS-PAGE gel demonstrating that the fusion proteins were expressed and were of the expected size.

In a similar manner, as shown in Fig. 4B, the anti-Myc-tag antibody was able to coimmunoprecipitate in vitro translated C104S PRL-1 along with Myc-tagged ATF-7 (lane 5), whereas control antisera did not (lane 4). The specificity of this experiment was confirmed by demonstrating that the luciferase control protein could not be coimmunoprecipitated along with Myc-ATF-7 (lane 6). Taken together, these results confirm the interaction of PRL-1 and ATF-7 in vitro. To further confirm this interaction, a glutathione S-transferase (GST)-C104S-PRL-1 fusion protein was used in an in vitro binding assay with full-length in vitro translated ATF-7. As shown in Fig. 4C, the GST-C104S-PRL-1 protein bound to glutathione Sepharose beads interacts with full-length ATF-7 (lane 2), but ATF-7 did not interact with the control GST protein (lane 1). We also performed the same experiment using wild type GST-PRL-1 protein and obtained similar results (data not shown).

To determine the regions of PRL-1 that are important for the interaction with ATF-7, six truncated GST-PRL-1 constructs were synthesized and tested for their ability to bind in vitro translated ATF-7. The constructs made spanned different regions of the 189-amino acid full-length PRL-1. As shown in Fig. 5A, GST fused to PRL-1 amino acids 1-96, 60-118, or 118-173 are not able to bind to in vitro translated ATF-7, whereas GST constructs fused to PRL-1 amino acids 1-132 and 97-173 could bind to ATF-7. The results with the construct containing amino acids 1-132 are not surprising, because this construct corresponds to the "bait" construct used in the two-hybrid screen. Analysis of these data (see diagram in Fig. 5B) generated the hypothesis that the region comprising amino acids 97-132, which corresponds to PRL-1's PTPase domain, was critical in mediating PRL-1's ability to interact with ATF-7. Accordingly, we synthesized a GST fusion protein containing only amino acids 97-132, and determined, as shown in lane 1 of Fig. 5A, that it was able to bind in vitro translated ATF-7, albeit less efficiently than the aa 97-173 construct (lane 3 of Fig. 5A) or full-length PRL-1 (Fig. 4C). The region contained in the 97-132 construct spans the PRL-1's phosphatase domain and the 15 amino acids that follow it. Neither the phosphatase domain alone nor the 15-amino acid region alone is sufficient for ATF-7 binding, because neither the 60-118 nor 118-173 constructs, which contain the complete phosphatase domain or the 15-amino acid region, respectively, was able to bind ATF-7. In summary, these results indicate that the PRL-1 PTPase domain, combined with an adjacent small amino acid region, is necessary and sufficient for ATF-7 binding,. In addition, there may be regions in the C-terminal of PRL-1 that contribute to ATF-7 binding, although they are not absolutely required.



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 5.   PRL-1 and ATF-7 interact in vitro largely through the ATF-7 bZIP domain and the PRL-1 PTPase domain. A, in vitro translated ATF-7 was incubated with the indicated GST-PRL-1 fragment fusion proteins attached to glutathione-Sepharose beads, and after washing, the sample was analyzed by SDS-PAGE followed by autoradiography. The bottom panel shows a Coomassie Blue-stained SDS-PAGE gel demonstrating that the GST-PRL-1 fusion proteins were expressed and were of the expected size. B, diagram summarizing the results depicted in A, indicating that the PRL-1 PTPase domain and a short stretch of amino acids following it are necessary for interaction with ATF-7. See text for details. C, in vitro translated ATF-7 (1) (amino) or ATF-7 (141) (bZIP) was incubated with GST or GST-PRL-1 full-length fusion proteins, and after washing, the sample was analyzed by SDS-PAGE followed by autoradiography. Lanes 1 and 2 show the in vitro translation products alone. Lanes 3 and 4 show the result of binding assays with GST alone, and lanes 5 and 6 show the results of binding with GST-PRL-1. The results show that the ATF-7 bZIP domain (lane 6) alone binds GST-PRL-1, but the non-bZIP (amino) region of ATF-7 (lane 5) does not, indicating that the bZIP domain of ATF-7 alone is sufficient for interaction with PRL-1.

To determine the regions of ATF-7 that are important for mediating the interaction with PRL-1, we employed GST binding assays. Full-length (C104S) PRL-1 fused to GST was used in these assays along with two in vitro translated ATF-7 fragments, ATF-7 amino acids 1-138 and ATF-7 amino acids 139-218. The latter construct consists of only the bZIP region of ATF-7. As shown in Fig. 5C, the ATF-7-139-218 (bZIP domain-only) protein was able to bind to GST-C104S-PRL-1 (lane 6), whereas the large region upstream of the bZIP region by itself was not able to bind GST-C104S-PRL-1 (lane 5). As expected, neither fragment was able to bind to GST alone (lanes 3 and 4). These data indicate that the bZIP region is necessary and sufficient for PRL-1 binding. Taken together, it can be concluded that the PRL-1·ATF-7 interaction is mediated by interaction of PRL-1's PTPase domain and ATF-7's bZIP domain.

Ability of PRL-1 to Selectively Dephosphorylate ATF-7 in Vitro-- Because our data indicated that the PRL-1 phosphatase domain was necessary for interaction with ATF-7, we sought to determine whether PRL-1 is capable of dephosphorylating ATF-7 in vitro. We used c-Src kinase to phospholabel GST-ATF-7 on tyrosine. This kinase was not able to phosphorylate GST alone (data not shown). We split the products of the kinase reaction into equal aliquots and then used each in a phosphatase assay using either PRL-1, C104S inactive PRL-1 (MUT), or buffer. Because all three phosphatase reactions derive from the same common kinase reaction, the ratio of labeled ATF-7 to labeled c-Abl must be constant among the three tubes before the addition of the phosphatase or control. This ratio would not be affected by uneven division of the kinase reaction or uneven loading of the gel, because there would be more or less of both proteins in the same proportion. No change in this ratio would be seen if PRL-1 nonspecifically dephosphorylated both c-Src and ATF-7, because the phosphorylation of both would decrease. The degree to which this ratio decreases thus reflects selective dephosphorylation of ATF-7 by PRL-1. A representative result is shown in Fig. 6A. We found that significantly less ATF-7 remained phosphorylated relative to c-Abl after treatment with PRL-1 than after treatment with the C104S-PRL-1 or buffer controls. This indicates that PRL-1 was able to selectively partially dephosphorylate the tyrosine-phosphorylated ATF-7. The results of four separate experiments were quantified by densitometry and are shown in Fig. 6B. PRL-1 was significantly (p < 0.01) more able to dephosphorylate the labeled ATF-7 than either C104S-PRL-1 or buffer alone control.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 6.   Tyrosine-phosphorylated ATF-7 can be specifically dephosphorylated in vitro by PRL-1. A, GST-ATF-7 was expressed in bacteria, purified, and tyrosine-phosphorylated with 32P using c-Src as outlined under "Experimental Procedures." After the kinase reaction was stopped, the beads were washed four times and split into three equal aliquots. Equal amounts of active or mutant PRL-1, or buffer (negative control), were added to each tube, which were then incubated for 60 min at 37 °C. The phosphatase reaction was terminated by the addition of equal volumes of 2× Laemmli buffer. The products were then boiled and run on an SDS-PAGE gel, which was then dried and exposed to x-ray film (Kodak). Because all three phosphatase reactions derive from the same common kinase reaction, the ratio of labeled ATF-7 to labeled c-Src must be constant among the three tubes before the addition of phosphatase or control. (This ratio would not be affected by uneven division of the kinase reaction or uneven loading of the gel, because there would be more or less of both proteins in the same proportion.) No change in this ratio would be seen if PRL-1 nonspecifically dephosphorylated both c-Src and ATF-7, because the phosphorylation of both would decrease. The degree to which this ratio decreases thus reflects selective dephosphorylation of ATF-7 by PRL-1. A representative result is shown in A. We found that significantly less ATF-7 remained phosphorylated relative to c-Src after treatment with PRL-1 than after treatment with the C104S-PRL-1 or buffer controls. This indicates that PRL-1 was able to selectively partially dephosphorylate the tyrosine-phosphorylated ATF-7. The results of four separate experiments were quantified by densitometry and are shown in B. PRL-1 was significantly (p < 0.01) more able to dephosphorylate the labeled ATF-7 than either C104S-PRL-1 or buffer alone control.



    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Using the yeast two-hybrid system, we have identified ATF-7 as a novel bZIP protein that interacts with the PRL-1 nuclear PTPase. The interaction of PRL-1 and ATF-7 has been confirmed using GST binding and coimmunoprecipitation assays, and the sites of interaction have been mapped to include PRL-1's phosphatase domain and ATF-7's bZIP domain.

An important issue is the role of ATF-7 and its partner PRL-1 in cellular differentiation. There are a number of items that support the existence of such a role. We have previously shown that PRL-1 expression is associated with differentiation (20). Recently, we have also found that PRL-1 is expressed both in the adult and during development in a number of differentiating epithelial tissues, including intestine, stomach, kidney, and lung (17). We have also found that PRL-1 is expressed in 3T3-L1 adipocytes in association with differentiation,2 and we identified the ATF-7·PRL-1 interaction by two-hybrid screening of a 3T3-L1 adipocyte library. We have further shown here that ATF-7 is expressed to a much greater degree in post-confluent, differentiated Caco-2 cells than in preconfluent undifferentiated cells, a pattern reminiscent of that of PRL-1. All of these findings suggest that ATF-7 may play an important role in the development and maintenance of differentiating epithelial tissues.

Ultimately, experiments involving ectopic overexpression or ablation of ATF-7 in specific cells and tissues will be necessary to determine whether it has a direct role in modulating cellular differentiation. A potential mechanism might involve the ZIPK/DLK kinase (50). It is interesting to note that the highly homologous ATF-4 protein has been shown to interact with this protein, which in turn has been linked to both differentiation and apoptosis (51, 52). Concomitant roles in differentiation and apoptosis are plausible in the intestine, where enterocytes sequentially pass through proliferation, differentiation, and apoptosis phases during their life cycle (53). Agents that induce differentiation in several tissue models have also been shown capable of promoting apoptosis. One example is the ability of butyrate to sequentially induce these two processes in intestinal cells (54-56).

We show here that tyrosine-phosphorylated ATF-7 can be selectively dephosphorylated by PRL-1 in vitro. The control of transcription through the regulation of transcription factor phosphorylation is a well-established concept (1, 2, 5, 6). However, our results must be interpreted with caution. Although they are consistent with the possibility that PRL-1's cellular role may involve dephosphorylating ATF-7, much more work will need to be done before this can be established. We have observed only partial dephosphorylation of the labeled ATF-7 in these experiments, a result that could indicate that proper reaction conditions are not present, or that ATF-7 is phosphorylated at multiple sites, only some of which are dephosphorylated by PRL-1. However, it is also possible that the basis for the PRL-1·ATF-7 interaction is not that of a phosphatase·substrate interaction. Future studies will be geared toward analyzing whether this phenomenon occurs in vivo, mapping the specific residue(s) that are affected, and determining the transcriptional consequences of such a reaction. If ATF-7 itself is not a target of PRL-1, it may serve to bring PRL-1 into proximity with its true substrates. In this manner, PRL-1 could influence transcription by acting on transcriptional cofactors or elements of the basal transcription machinery. In some situations, kinases or phosphatases may bind transcription factors but influence transcription by acting on proteins other than the transcription factors themselves. A classic example of this phenomenon is the regulation of the NFkappa B transcription factor by phosphorylation of its sequestering inhibitor Ikappa B, which leads to Ikappa B's degradation (7, 57). Another example is the nuclear tyrosine kinase c-Abl, which binds to p53 and increases its transactivating ability without phosphorylating it. It is thought that Abl may be able to execute this function by phosphorylating the C-terminal domain of RNA polymerase II, which is known to be extensively phosphorylated on tyrosine (14, 15). Alternatively, ATF-7 may have extra-transcriptional roles involving sequestration of specific proteins (e.g. ZIPK) with roles in the regulation of apoptosis or differentiation, as has been proposed for the highly homologous ATF-4 protein, (51, 52, 58). PRL-1 might impact upon these processes by dephosphorylating ATF-7 itself, or by acting on the target proteins bound by ATF-7.

We have determined that ATF-7 homodimers bind to CRE sites, and we have not found evidence that ATF-7 homodimers can bind to AP1 or C/EBP sites. Interestingly however, the only other published data about ATF-7 is the description of a partial clone, comprising only ATF-7's bZIP region, that was identified in a Far Western screen as interacting with the C/EBPgamma transcription factor (59). This suggests that ATF-7 can interact with C/EBP family members, which are known to play important roles in the differentiation and development of a number of tissues, including liver and intestine (60-63). One manner in which this could occur is through the formation of ATF-7-C/EBP heterodimers. It is a hallmark of bZIP proteins that they extensively heterodimerize with each other, both within and outside of individual families. These interactions are not completely promiscuous but are instead restricted by a specific and complex "dimerization code" (64, 65). In some cases, cross-family heterodimers bind to the preferred site of one of the dimer members (66, 67), whereas in other cases, the heterodimers bind to novel composite sites (45-47, 68-70). In some cases, dimerization occurs only with members of other bZIP families. In this regard, it is interesting to note that ATF-4, the bZIP protein most similar to ATF-7, can form heterodimers with members of the C/EBP family, including C/EBPbeta and C/EBPgamma (45, 46, 68, 71), but has not been reported to heterodimerize with any other member of the ATF/CREB family. In these situations, the heterodimeric complexes bind to either C/EBP sites or to ATF-C/EBP composite sites (45-47, 70), although ATF-4 homodimers do not bind to either of these sites. In addition, ATF-4 has also been reported to form heterodimers with the AP1 proteins Fos and Jun (72). It is possible that ATF-7 may play an important role in transcriptional regulation in a similar manner as ATF-4 through interaction with C/EBP and/or AP1 family members. Future experiments will be designed to address this issue.

In summary, the identification of the ATF-7·PRL-1 interaction not only provides information about how PRL-1 may bring about the phenotypic states with which it is associated but also may have important implications for our understanding of the transcriptional regulation of target genes that modulate differentiation.


    ACKNOWLEDGEMENT

We thank Dr. Anil K. Rustgi for helpful discussions.

Note Added in Proof---While this manuscript was under review, sequences for mouse and human ATF-5 were deposited in GenBankTM. It appears that ATF-7 and ATF-5 are likely to be the same protein. In addition, an unrelated sequence named ATF7 has also been deposited in GenBankTM. In order to avoid confusion, future work on the protein described in this publication will likely refer to it as either ATF-5 or ATF-5/7.


    FOOTNOTES

* This work is supported by National Institutes of Health Grants R01 DK52216 and R01 DK44237, by University of Pennsylvania NIDDK/National Institutes of Health Center for Molecular Studies in Digestive and Liver Diseases Grant P30 DK50306, and by the American Digestive Health Foundation Miles and Shirley Fiterman Award for Basic Science Research.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Dept. of Medicine/GI Division, 664 Clinical Research Bldg., University of Pennsylvania School of Medicine, 415 Curie Blvd., Philadelphia, PA 19104-6145. Tel.: 215-898-0155; Fax: 215-573-2024; E-mail: diamondr@mail.med.upenn.edu.

Published, JBC Papers in Press, January 22, 2001, DOI 10.1074/jbc.M011562200

2 R. Diamond, unpublished data.


    ABBREVIATIONS

The abbreviations used are: bZIP, basic leucine zipper protein; PTPase, protein-tyrosine phosphatase; CRE, cyclic-AMP response element; CREB, CRE-binding protein; ATF, activating transcription factor; bp, base pair(s); C/EBP, CCAAT enhancer-binding protein; GST, glutathione S-transferase; TK, thymidine kinase; aa, amino acid(s); PAGE, polyacrylamide gel electrophoresis; kb, kilobase(s).


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES


1. Hunter, T. (1995) Cell 80, 225-236
2. Karin, M. (1995) Curr. Opin. Cell Biol. 6, 415-424
3. Tonks, N. K., and Neel, B. G. (1996) Cell 87, 365-368
4. Fauman, E. B., and Saper, M. A. (1996) Trends Biochem. Sci. 21, 413-417
5. Boulikas, T. (1995) Crit. Rev. Eukaryot. Gene Expr. 5, 1-77
6. Hunter, T., and Karin, M. (1992) Cell 70, 375-387
7. Ghosh, S., and Baltimore, D. (1990) Nature 344, 678-682
8. Darnell, J. E. (1997) Science 277, 1630-1635
9. Beals, C. R., Clipstone, N. A., Hu, S. N., and Crabtree, G. R. (1997) Genes Dev. 11, 824-834
10. Boyle, W. J., Smeal, T., Defize, L. H., Angel, P., Woodgett, J. R., Karin, M., and Hunter, T. (1991) Cell 64, 573-584
11. Bourbon, H. M., Martin-Blanco, E., Rosen, D., and Kornberg, T. B. (1995) Cell 270, 11130-11139
12. Chrivia, J. C., Kwok, R. P. S., Lamb, N., Hagiwara, M., Montminy, M. R., and Goodman, R. H. (1993) Nature 365, 855-859
13. Kwok, R. P. S., Lundblad, J. R., Chrivia, J. C., Richards, J. P., Bachinger, H. P., Brennan, R. G., Roberts, S. G. E., Green, M. R., and Goodman, R. H. (1994) Nature 370, 223-226
14. Baskaran, R., Dahmus, M. E., and Wang, J. Y. J. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 11167-11171
15. Kharbanda, S., Yuan, Z. M., Weichselbaum, R., and Kufe, D. (1998) Oncogene 17, 3309-3318
16. Diamond, R. H., Cressman, D. E., Laz, T. M., Abrams, C. S., and Taub, R. (1994) Mol. Cell. Biol. 14, 3752-3762
17. Kong, W., Swain, G. P., Li, S., and Diamond, R. H. (2000) Am. J. Physiol. 279, G613-G621
18. Zeng, Q., Si, X., Horstmann, H., Xu, Y., Hong, W., and Pallen, C. J. (2000) J. Biol. Chem. 275, 21444-21452
19. Cates, C. A., Michael, R. L., Stayrook, K. R., Harvey, K. A., Burke, Y. D., Randall, S. K., Crowell, P. L., and Crowell, D. N. (1996) Cancer Lett. 110, 49-55
20. Diamond, R. H., Peters, C., Jung, S. P., Greenbaum, L. E., Haber, B. A., Silberg, D. G., Traber, P. G., and Taub, R. (1996) Am. J. Physiol. 271, G121-G129
21. Bar-Sagi, D., and Feramisco, J. R. (1985) Cell 42, 841-848
22. Benito, M., Porras, A., Nebreda, A. R., and Santos, E. (1991) Science 253, 565-568
23. Cass, L. A., and Meinkoth, J. L. (2000) Oncogene 19, 924-932
24. Celano, P. C. M., Berchtold, M., Mabry, M., Carroll, M., Sidransky, D., Casero, R. A., and Lupu, R. (1993) Cell Growth Differ. 4, 341-347
25. Yamaguchi-Iwai, Y., Satake, M., Murakami, Y., Sakai, M., Muramatsu, M., and Ito, Y. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 8670-8674
26. Pawson, T., and Scott, J. D. (1997) Science 275, 2075-2080
27. Marshall, C. J. (1995) Cell 80, 179-185
28. Sun, H., Charles, C. H., Lau, L. F., and Tonks, N. K. (1993) Cell 75, 487-493
29. Garton, A. J., Flint, A. J., and Tonks, N. K. (1996) Mol. Cell. Biol. 16, 6408-6418
30. Zhang, S. H., Liu, J., Koyabashi, R., and Tonks, N. K. (1999) J. Biol. Chem. 274, 17806-17812
31. Ribon, V., Printen, J. A., Hoffman, N. G., Kay, B. K., and Saltiel, A. R. (1998) Mol. Cell. Biol. 18, 872-879
32. Mohn, K. L., Laz, T. M., Hsu, J. C., Melby, A. E., Bravo, R., and Taub, R. (1991) Mol. Cell. Biol. 11, 381-390
33. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
34. Kozak, M. (1991) J. Biol. Chem. 266, 19867-19870
35. Rosenberg, A. H., Lade, B. N., Chui, D. S., Lin, S. W., Dunn, J. J., and Studier, F. W. (1987) Gene 56, 125-135
36. Hattori, M., Tugores, A., Veloz, L., Karin, M., and Brenner, D. A. (1990) DNA Cell Biol. 9, 777-781
37. Greenbaum, L. E., Cressman, D. E., Haber, B. A., and Taub, R. (1995) J. Clin. Invest. 96, 1351-1365
38. Landschulz, W. H., Johnson, P. F., and McKnight, S. L. (1988) Science 240, 1759-1764
39. Dang, C. V., McGuire, M., Buckmire, M., and Lee, W. M. F. (1989) Nature 337, 664-666
40. Neuberg, M. M., Schuermann, M., Hunter, J. B., and Muller, R. (1989) Nature 338, 589-590
41. Lamb, P., and McKnight, S. L. (1991) Trends Biochem. Sci. 16, 417-422
42. Tsujimoto, A., Nyunoya, H., Morita, T., Sato, T., and Shimotohno, K. (1991) J. Virol. 65, 1420-1426
43. Mielnicki, L. M., Hughes, R. G., Chevray, P. M., and Pruitt, S. C. (1996) Bichem. Biophys Res. Commun. 228, 586-595
44. Karpinski, B. A., Marle, G. D., Huggenvik, J., Uhler, M. D., and Leiden, J. M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 4820-4824
45. Vallejo, M., Ron, D., Miller, C. P., and Habener, J. F. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 4679-4683
46. Kapatos, G., Stegenga, S. L., and Hirayama, K. (2000) J. Biol. Chem. 275, 5947-5957
47. Estes, S. D., Stoler, D. L., and Anderson, G. R. (1995) Exp. Cell Res. 220, 47-54
48. Pinto, M., Robine-Leon, S., Appay, M. D., Kedinger, M., Triandou, N., Dussaulx, W., Lacroix, B., Simon-Assmann, P., Haffen, K., Fogh, J., and Zweibaum, A. (1983) Biol. Cell 47, 323-330
49. Jumarie, C., and Malo, C. (1991) J. Cell. Physiol. 149, 24-33
50. Kawai, T., Matsumoto, M., Takeda, K., Sanjo, H., and Akira, S. (1998) Mol. Cell. Biol. 18, 1642-1651
51. Kogel, D., Bierbaum, H., Preuss, U., and Scheidtmann, K. H. (1999) Oncogene 18, 7212-7218
52. Page, G., Kogel, D., Rangnekar, V., and Scheidtmann, K. H. (1999) Oncogene 18, 7265-7273
53. Potten, C. S. (1997) Am. J. Physiol. 273, G253-G257
54. Heerdt, B. G., Houston, M. A., and Augenlicht, L. H. (1994) Cancer Res. 54, 3288-3294
55. Litvak, D. A., Evers, B. M., Hwang, K. O., Hellmich, M. R., Ko, T. C., and Townsend, C. W. (1998) Surgery 124, 161-170
56. Maruoka, Y., Harada, H., Mitsuyasu, T., Seta, Y., Kurokawa, H., Kajiyama, M., and Toyoshima, K. (1997) Biochem. Biophys Res. Commun. 238, 886-890
57. Regnier, C. H., Song, H. Y., Gao, X., Goeddel, D. V., Cao, Z., and Rothe, M. (1997) Cell 90, 373-383
58. Kogel, D., Plottner, O., Landsberg, G., Christian, S., and Scheidtmann, K. H. (1998) Oncogene 17, 2645-2654
59. Nishizawa, M., and Nagata, S. (1992) FEBS Lett. 299, 36-38
60. Darlington, G. J., Wang, N., and Hanson, R. W. (1995) Curr. Opin. Genet. Dev. 5, 565-570
61. Umek, R. M., Friedman, A. D., and McKnight, S. L. (1991) Science 251, 288-292
62. Yeh, W. C., Cao, Z., Classon, M., and McKnight, S. L. (1995) Genes Dev. 9, 168-181
63. Montgomery, R. K., Rings, E. H., Thompson, J. F., Schuijt, C. C., Aras, K. M., Wielenga, V. J., Kothe, M. J., Buller, H. A., and Grand, R. J. (1997) Am. J. Physiol. 272, G534-G544
64. Hoeffler, J. P., Lustbader, J. W., and Chen, C. Y. (1991) Mol. Endocrinol. 5, 256-266
65. Kerppola, T. K., and Curran, T. (1993) Mol. Cell. Biol. 13, 5479-5486
66. Benbrook, D. M., and Jones, N. C. (1990) Oncogene 5, 295-302
67. Shuman, J., Cheung, J. H., and Coligan, J. E. (1997) J. Biol. Chem. 272, 12793-12800
68. Avitahl, N., and Calame, K. (1994) J. Biol. Chem. 269, 23553-23562
69. Ubeda, M., Wang, X. Z., Zinszner, H., Wu, I., Habener, J. F., and Ron, D. (1996) Mol. Cell. Biol. 16, 1479-1489
70. Fawcett, T. W., Martindale, J. L., Guyton, K. Z., Hai, T., and Holbrook, N. J. (1999) Biochem. J. 339, 135-141
71. Vinson, C. R., Hai, T., and Boyd, S. M. (1993) Genes Dev. 7, 1047-1058
72. Hai, T., and Curran, T. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 3720-3724
73. Field, F. J., Albright, E., and Mathur, S. N. (1987) J. Lipid Res. 28, 1057-1066


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol Cancer ResHome page
G. Li, W. Li, J. M. Angelastro, L. A. Greene, and D. X. Liu
Identification of a Novel DNA Binding Site and a Transcriptional Target for Activating Transcription Factor 5 in C6 Glioma and MCF-7 Breast Cancer Cells
Mol. Cancer Res., June 1, 2009; 7(6): 933 - 943.
[Abstract] [Full Text] [PDF]


Home page
Anticancer ResHome page
S. KNIPPEN, T. LONING, V. MULLER, C. SCHRODER, F. JANICKE, and K. MILDE-LANGOSCH
Expression and Prognostic Value of Activating Transcription Factor 2 (ATF2) and its Phosphorylated Form in Mammary Carcinomas
Anticancer Res, January 1, 2009; 29(1): 183 - 189.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
M. Pascual, M. J. Gomez-Lechon, J. V. Castell, and R. Jover
ATF5 Is a Highly Abundant Liver-Enriched Transcription Factor that Cooperates with Constitutive Androstane Receptor in the Transactivation of CYP2B6: Implications in Hepatic Stress Responses
Drug Metab. Dispos., June 1, 2008; 36(6): 1063 - 1072.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
N. Tommasino, M. Villani, A. Qureshi, J. Henry, C. Luberto, and M. Del Poeta
Atf2 Transcription Factor Binds to the APP1 Promoter in Cryptococcus neoformans: Stimulatory Effect of Diacylglycerol
Eukaryot. Cell, February 1, 2008; 7(2): 294 - 301.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Tateyama, K. Horisawa, H. Takashima, E. Miyamoto-Sato, N. Doi, and H. Yanagawa
Affinity selection of DNA-binding protein complexes using mRNA display
Nucleic Acids Res., February 14, 2006; 34(3): e27 - e27.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
B. J. Stephens, H. Han, V. Gokhale, and D. D. Von Hoff
PRL phosphatases as potential molecular targets in cancer
Mol. Cancer Ther., November 1, 2005; 4(11): 1653 - 1661.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. Forgacs, S. K. Gupta, J. A. Kerry, and O. J. Semmes
The bZIP Transcription Factor ATFx Binds Human T-Cell Leukemia Virus Type 1 (HTLV-1) Tax and Represses HTLV-1 Long Terminal Repeat-Mediated Transcription
J. Virol., June 1, 2005; 79(11): 6932 - 6939.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. S. Moorefield, S. J. Fry, and J. M. Horowitz
Sp2 DNA Binding Activity and trans-Activation Are Negatively Regulated in Mammalian Cells
J. Biol. Chem., April 2, 2004; 279(14): 13911 - 13924.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. M. Angelastro, T. N. Ignatova, V. G. Kukekov, D. A. Steindler, G. B. Stengren, C. Mendelsohn, and L. A. Greene
Regulated Expression of ATF5 Is Required for the Progression of Neural Progenitor Cells to Neurons
J. Neurosci., June 1, 2003; 23(11): 4590 - 4600.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
S. P. Persengiev, L. R. Devireddy, and M. R. Green
Inhibition of apoptosis by ATFx: a novel role for a member of the ATF/CREB family of mammalian bZIP transcription factors
Genes & Dev., July 15, 2002; 16(14): 1806 - 1814.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Si, Q. Zeng, C. H. Ng, W. Hong, and C. J. Pallen
Interaction of Farnesylated PRL-2, a Protein-tyrosine Phosphatase, with the beta -Subunit of Geranylgeranyltransferase II
J. Biol. Chem., August 24, 2001; 276(35): 32875 - 32882.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/17/13718    most recent
M011562200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Peters, C. S.
Right arrow Articles by Diamond, R. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Peters, C. S.
Right arrow Articles by Diamond, R. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement