|
Originally published In Press as doi:10.1074/jbc.M011511200 on January 18, 2001
J. Biol. Chem., Vol. 276, Issue 17, 13975-13981, April 27, 2001
RGD-containing Peptides Inhibit Fibrinogen Binding to
Platelet IIb 3 by Inducing an Allosteric
Change in the Amino-terminal Portion of IIb*
Ramesh B.
Basani §,
Giovanna
D'Andrea ¶,
Neal
Mitra ,
Gaston
Vilaire ,
Mark
Richberg§,
M. Anna
Kowalska ,
Joel S.
Bennett , and
Mortimer
Poncz §**
From the Children's Hospital of Philadelphia and the
Departments of § Pediatrics and Medicine, University
of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104 and the ¶ Istituto di Ricovero e Cura a Carattere
Scientifico Casa Sollievo della Sofferenza, Unitá di
Aterosclerosi e Trombosi, Foggia 71013, Italy
Received for publication, December 20, 2000, and in revised form, January 11, 2001
 |
ABSTRACT |
To determine the molecular basis for the
insensitivity of rat IIb 3 to
inhibition by RGD-containing peptides, hybrids of human and rat
IIb 3 and chimeras of
IIb 3 in which IIb was composed of portions of human and rat IIb were expressed
in Chinese hamster ovary cells and B lymphocytes, and the ability of
the tetrapeptide RGDS to inhibit fibrinogen binding to the various forms of IIb 3 was measured. These
measurements indicated that sequences regulating the sensitivity of
IIb 3 to RGDS are located in the seven
amino-terminal repeats of IIb. Moreover, replacing the
first three or four (but not the first two) repeats of rat IIb with the corresponding human sequences enhanced
sensitivity to RGDS, whereas replacing the first two or three repeats
of human IIb with the corresponding rat sequences had
little or no effect. Nevertheless, RGDS bound to Chinese hamster ovary
cells expressing IIb 3 regardless whether
the IIb in the heterodimers was human, rat, or a
rat-human chimera. These results indicate that the sequences determining the sensitivity of IIb 3 to
RGD-containing peptides are located in the third and fourth
amino-terminal repeats of IIb. Because RGDS binds to
both human and rat IIb 3, the results suggest that differences in RGDS sensitivity result from differences in
the allosteric changes induced in these repeats following RGDS binding.
 |
INTRODUCTION |
Ligand binding to integrins initiates intracellular signals that
are crucial for cellular growth and differentiation (1). Conversely,
many cells regulate the ability of their integrins to recognize
ligands. The prototypic example of integrin regulation is the platelet
integrin IIb 3 (2). In unstimulated
platelets, IIb 3 is inactive; but
following platelet stimulation by agonists such as ADP and thrombin,
IIb 3 assumes a conformation in which it
is able to bind macromolecular ligands such as fibrinogen and von
Willebrand factor. Because ligand binding to
IIb 3 is a prerequisite for platelet
aggregation, regulating the affinity of
IIb 3 for ligands assures that only
stimulated platelets aggregate.
The major ligand for IIb 3 in plasma is
fibrinogen. Three portions of the fibrinogen molecule (the carboxyl
terminus of the fibrinogen -chain (3) and two Arg-Gly-Asp (RGD)
motifs located in the fibrinogen -chain (4)) have been proposed to
be sites that mediate fibrinogen binding to
IIb 3. However, ultrastructural examination of fibrinogen bound to IIb 3
(5) and measurements of fibrinogen binding to
IIb 3 using fibrinogens containing mutated RGD or -chain sequences (6) indicate that it is the -chain sequences that mediate fibrinogen binding. Nonetheless, RGD-containing disintegrins and synthetic compounds based on the RGD motif are effective IIb 3 antagonists (7), implying
that they either directly or indirectly affect the -chain-binding
site when they bind to IIb 3.
Ligands appear to bind to IIb 3 by
interacting with the amino-terminal portion of 3 (8),
although the specific residues involved are not known. A region of
3 encoded by the fourth and fifth exons of the
3 gene that encompasses amino acids 95-223 has been
implicated in ligand binding (9). Moreover, chemical cross-linking
experiments have suggested that RGD-containing peptides bind to
3 in the vicinity of amino acids 109-171 (10). It is noteworthy that this region of 3 contains an array of
oxygenated residues whose three-dimensional structure may resemble that
of the ligand-binding I domains that are present in several integrin -subunits (11). In addition, overlapping peptides corresponding to
3 amino acids 211-222 inhibit fibrinogen binding to
purified IIb 3, suggesting that this
stretch of residues represents a portion of the fibrinogen-binding site
(12, 13). There is also evidence that more distal portions of
3 may be involved in fibrinogen binding because a
naturally occurring Leu262 Pro mutation prevents
IIb 3 binding to immobilized fibrinogen (14).
Ligand binding to IIb 3 also appears to
involve the amino-terminal third of IIb (15). Chemical
cross-linking experiments suggest that the carboxyl terminus of the
fibrinogen -chain binds to IIb in the vicinity of
amino acids 294-314 (16), a suggestion supported by the ability of a
peptide corresponding to IIb residues 300-312 to
inhibit platelet adhesion to fibrinogen (17). In addition, there are a
number of reports of naturally occurring and laboratory-induced
mutations involving amino acids located between IIb
residues 183 and 224 that impair IIb 3
function, suggesting that this portion of IIb binds to
ligands as well (18-21).
Although fibrinogen binding to IIb 3 on
the platelets of all mammalian species is required for platelet
aggregation, there are substantial differences in the ability of
RGD-containing peptides to inhibit the process. For example, fibrinogen
binding to rabbit and rat platelets is relatively insensitive to
inhibition by RGD-containing peptides (22, 23). To gain an
understanding of the molecular basis for the insensitivity of rat
IIb 3 to RGD-containing peptides, we
measured the effect of the tetrapeptide Arg-Gly-Asp-Ser (RGDS) on
fibrinogen binding to chimeric IIb 3
molecules composed of portions of the rat and human proteins. We found
that the sequences determining the sensitivity or resistance of
IIb 3 to inhibition by RGDS are located in
the third and fourth repeats of the amino-terminal portion of
IIb. Moreover, because we also found that RGDS bound to
IIb 3 regardless of whether the
heterodimer contained human or rat subunits, our results imply that
RGDS impairs fibrinogen binding to IIb 3
by inducing an allosteric change in the third and fourth repeats of
IIb. They also suggest that a conformational change in
these repeats may be required for the fibrinogen binding to
IIb 3 that occurs on agonist-stimulated platelets.
 |
EXPERIMENTAL PROCEDURES |
Measurement of Platelet Aggregation--
Platelet-rich plasma
was prepared from blood anticoagulated with 0.1 volume of 0.13 M sodium citrate, obtained from normal human volunteers by
venipuncture and from anesthetized rats by puncture of the exposed
abdominal aorta. Platelets were isolated from the platelet-rich plasma
by gel filtration on Sepharose 2B (Amersham Pharmacia Biotech) using
elution buffer containing 137 mM NaCl, 2.7 mM
KCl, 1 mM MgCl2, 5.6 mM glucose,
0.35 mg/ml bovine serum albumin, 3.3 mM
NaH2PO4, and 4 mM Hepes (pH 7.4) as
previously described (24). Turbidometric measurements of ADP-stimulated platelet aggregation were made in a Chrono-Log Lumi dual aggregometer. Platelet suspensions were supplemented with either human or rat fibrinogen (Sigma) at a final concentration of 200 µg/ml, with 1 mM CaCl2, and with various concentrations of
RGDS (Sigma) or the less active control tetrapeptide Arg-Gly-Glu-Ser
(RGES; Sigma) prior to adding ADP.
Measurement of Fibrinogen Binding to Human and Rat
Platelets--
Fibrinogen binding to gel-filtered human and rat
platelets was measured using 125I-labeled fibrinogen as
previously described (24). Briefly, 0.5-ml aliquots of 5 × 107 gel-filtered platelets were mixed with 200 µg/ml
125I-fibrinogen (Enzyme Research Laboratories), 0.5 mM CaCl2, and 10 µM ADP.
Following a 5-min incubation at 37 °C without stirring, the
platelets were sedimented through silicone oil in an Eppendorf centrifuge (Brinkmann Instruments). The tips of the centrifuge tubes
containing the pelleted platelets were amputated and counted for
125I. Nonspecific fibrinogen binding was determined by
including a 15-fold excess of unlabeled fibrinogen in the assay. The
dissociation constants (Kd) for human and rat
IIb 3 for fibrinogen were obtained by
Scatchard analysis of the fibrinogen binding data.
Construction of Chimeric Human-Rat IIb
Subunits--
Full-length cDNAs for human and rat
IIb and a full-length cDNA for human
3 were used in selected experiments (25-28). A nearly full-length rat 3 cDNA was completed by inserting
the sequences corresponding to the signal peptide and the first 31 amino acids of human 3 (21, 29). The amino-terminal
region of mature 3 is highly conserved; for example,
human and Xenopus 3 cDNAs differ by only
nine amino acids in this region (30).
cDNAs encoding chimeras of IIb in which the
amino-terminal halves of human and rat IIb were
exchanged were constructed by swapping homologous
ClaI/NheI 5'-fragments of human and rat
IIb cDNAs (28). cDNAs encoding
IIb chimeras containing smaller segments of rat and
human IIb were constructed using a polymerase chain
reaction-based site-directed mutagenesis protocol described previously
(21). Briefly, using either a human or rat IIb cDNA template, the 3'-portion of the targeted sequence was amplified using
one of the sense primers shown below and the appropriate antisense
primer 3' to the ClaI site. Similarly, the 5'-portion was
amplified using the appropriate IIb cDNA template, a
primer complementary to one of the sense primers shown below, and a T7 primer. The 5'- and 3'-polymerase chain reaction products were then
purified on agarose gels after separation from the templates. A third
polymerase chain reaction was performed using the two first-round
amplified products, the T7 primer, and the appropriate primer 3' to the
ClaI site in the template. The product was double-digested with ClaI and NheI and subcloned into either a
human or rat IIb cDNA that had previously been
inserted into the expression plasmid pcDNA3.1 (Invitrogen).
Selected clones were sequenced to ensure the fidelity of the desired
nucleotide sequence. The nomenclature used to identify the various
chimeras is based on the presence of seven tandem repeats in the
amino-terminal half of IIb (31). The sense primers used
for the polymerase chain reactions were as follows:
R2-H, GGAGTACTCGGCGCGGCGCCCGCTTTGGAGCTCAGC;
R3-H, GGACACGTGCCACAAAAGGGTACCGGGGCGGTACGT;
R4-H, CTGGTAGTAGGAATCCAAAATTTCCACCGCTCCCAA; H2-R, GCTGAGCTCCAAAGCGGGCGCCGCGCCGCGTACTCC;
H3-R, ACGTACCGCCCCGGTACCCTTTTGTGGCACGTGTCC; and
H4-R, TTGGGAGCGGTGGAAATTTTGGATTCCTACTACCAG. The sequences of the primers 3' to the ClaI site in human and rat
IIb were GCTGCAGCTCGGCATTTAGG and CTTCAGTGTGGGATTCAG, respectively.
Stable Expression of IIb 3 in
Chinese Hamster Ovary (CHO)1
Cells--
CHO cells were cultured in Ham's F-12 medium (Life
Technologies, Inc.) supplemented with 10% fetal bovine serum (Hyclone
Laboratories). cDNAs encoding human 3 and either
human or rat IIb were subcloned into pcDNA3.1(+)-Zeo
and pcDNA3.1(+)-Neo, respectively, and were introduced into the CHO
cells using FUGENE 6 (Roche Molecular Biochemicals) according to
the manufacturer's instructions. Two days after transfection, the
cells were transferred to selection medium containing 500 µg/ml G418
(Life Technologies, Inc.) and 300 µg/ml Zeocin (Invitrogen). After 3 weeks of selection, IIb 3 expression was
assessed by flow cytometry using P34, a mAb that recognizes both rat
and human IIb 3 (a gift from Dr. H. Miyazaki, Kirin Brewery, Gunma, Japan). The cells were then sorted by
fluorescence-activated cell sorting to obtain cell lines expressing
high levels of IIb 3 as previously
described (21).
Fibrinogen Binding to CHO Cells Expressing
IIb 3--
To measure fibrinogen binding
to IIb 3 on the transfected CHO cells,
purified human fibrinogen was labeled with fluorescein isothiocyanate
(FITC) using a Calbiochem FITC labeling kit as described by the
manufacturer. Fibrinogen labeled in this manner was monomeric as
assessed by gel-filtration chromatography, supported platelet
aggregation as well as unlabeled fibrinogen, and was 95% clottable
with thrombin (32). 1.5 × 105 CHO cells, suspended in
100 µl of 10 mM sodium phosphate buffer (pH 7.4)
containing 137 mM NaCl, 1 mM CaCl2,
and 1% bovine serum albumin, were then incubated with 200 µg/ml
FITC-fibrinogen and 5 mM dithiothreitol (DTT) for 30 min at
37 °C (33, 34). The cells were washed once with the suspension
buffer and fixed with 0.37% formalin. The amount of FITC-fibrinogen
bound was determined by flow cytometry as described previously (21).
Specific fibrinogen binding represented the difference in fluorescence
of transfected and untransfected cells incubated with FITC-fibrinogen
in the presence of DTT minus the fluorescence of transfected cells
incubated with FITC-fibrinogen in the absence of DTT. The ability of
RGDS to inhibit fibrinogen binding was determined by adding increasing concentrations of the tetrapeptide to the 30-min incubation.
Adhesion of B Lymphocytes Expressing
IIb 3 to Immobilized
Fibrinogen--
IIb and 3 were expressed
in human B lymphocytes as previously described (35). Briefly, pREP
vectors containing rat or human IIb and 3
cDNAs were introduced into 7.5 × 106 GM1500 B
lymphocytes by electroporation (250 V and 960 microfarads). Stable
transfectants were selected using G418 and hygromycin, and the amount
of IIb 3 on the lymphocyte surface was
quantified by flow cytometry using mAb P34. To measure
IIb 3-mediated lymphocyte adherence to
fibrinogen, the wells of Immulon-2 flat-bottom microtiter plates
(Dynatech Laboratories Inc.) were coated with 50 µg/ml purified human
fibrinogen in 50 mM NaHCO3 buffer (pH 8.0)
containing 150 mM NaCl. Unoccupied protein-binding sites on
the wells were blocked with 5 mg/ml bovine serum albumin dissolved in
the same buffer. 1.5 × 105 B lymphocytes,
metabolically labeled overnight with [35S]methionine,
were suspended in 100 µl of 50 mM Tris-HCl buffer (pH
7.4) containing 150 mM NaCl, 0.5 mM
CaCl2, 0.1% glucose, and 1% bovine serum albumin and
added to the protein-coated wells, in either the presence or absence of
200 ng/ml phorbol myristate acetate. Following incubation at 37 °C
for 30 min without agitation, the plates were washed four times with
the lymphocyte suspension buffer, and adherent cells were dissolved
using 2% SDS. The SDS solutions were then counted for 35S
in a liquid scintillation counter. The ability of RGDS to inhibit lymphocyte adhesion to immobilized fibrinogen was determined by adding
increasing concentrations of the tetrapeptide to the 30-min incubation.
Induction of mAb Binding to 3by
RGDS--
To measure the RGDS-induced binding of the conformation-specific
mAb 10-758 to human 3 (36), 1.5 × 105
CHO cells expressing human IIb 3 and
hybrids of rat IIb and human 3 were
incubated with 0.3 mM RGDS and a 1:100 dilution of mAb
10-758 for 30 min at 37 °C. The cells were then washed once and
incubated with a 1:10 dilution of FITC-labeled goat anti-mouse IgG for
an additional 30 min. Antibody binding was detected using flow cytometry.
 |
RESULTS |
Effect of RGDS on the ADP-stimulated Aggregation of Human and Rat
Platelets--
To confirm the reported insensitivity of rat platelets
to the inhibitory effects of RGD-containing peptides (22), we compared the ability of the tetrapeptide RGDS to inhibit the ADP-stimulated aggregation of gel-filtered human and rat platelets. Although neither
human nor rat platelets aggregated in the absence of added fibrinogen
(data not shown), ADP-stimulated platelets of both species aggregated
readily in the presence of either human or rat fibrinogen (Fig.
1). Furthermore, whereas the tetrapeptide RGES had no effect on the aggregation of platelets of either species, the aggregation of human platelets was partially inhibited by 10 µM RGDS and completely inhibited by 100 µM
RGDS. In contrast, concentrations of RGDS as great as 1 mM
had no effect on the aggregation of rat platelets. Thus, these
experiments confirm the difference in sensitivity of human and rat
platelets to RGD-containing peptides and indicate that this difference
is due to a difference between human and rat platelets and not to a
difference between human and rat fibrinogen.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 1.
Effect of the tetrapeptides RGDS and RGES on
the ADP-stimulated aggregation of human and rat platelets.
Gel-filtered human and rat platelets were suspended in buffer
containing 1 mM CaCl2 and either 200 µg/ml
human or rat fibrinogen. Turbidometric platelet aggregation was
stimulated by 20 µM ADP and measured in the presence of
0.1 and 1 mM concentrations of either RGDS or RGES.
|
|
One explanation for the insensitivity of rat platelets to RGDS is
simply that the affinity of IIb 3 on rat
platelets for fibrinogen is greater than that of
IIb 3 on human platelets. To address this
possibility, we measured the affinity of
IIb 3 on human and rat platelets using
125I-labeled fibrinogen (24). We found that the
Kd for fibrinogen binding to
IIb 3 on human platelets was (1.32 ± 0.12) × 10 7 (n = 21),
compared with a Kd of (2.31 ± 0.45) × 10 7 (n = 3) for fibrinogen
binding to IIb 3 on rat platelets. Thus, these measurements indicate that a difference in the affinity of human
and rat IIb 3 for fibrinogen cannot
account for the difference in sensitivity of human and rat platelets to RGDS.
Effect of RGDS on Fibrinogen Binding to Human-Rat
IIb 3 Hybrids Expressed in CHO
Cells--
We next sought a molecular basis for the difference in
sensitivity of human and rat platelets to RGDS by expressing
IIb 3 heterodimers composed of human and
rat subunits in CHO cells. As shown by the flow cytometry histograms in
Fig. 2, comparable amounts of each of the
four possible combinations of human and rat IIb and
3 were expressed on the CHO cell surface.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 2.
Expression of human, rat, and human-rat
hybrid
IIb 3
on the surface of transfected CHO cells. CHO cells were
cotransfected with plasmids containing cDNAs for either human or
rat IIb and human or rat 3 as described
under "Experimental Procedures." The level of
IIb 3 expression by the resulting cells
lines was assessed by flow cytometry using P34, a mAb that recognizes
both rat and human IIb 3, as well as a
class-matched control antibody. H/H, human
IIb/human 3; H/R, human
IIb/rat 3; R/H, rat
IIb/human 3; R/R, rat
IIb/rat 3.
|
|
Because IIb 3 expressed in CHO cells
cannot be activated by cellular agonists, ligand binding is usually
induced using "activating" mAbs (37). These antibodies generally do
not bind to rat IIb 3. Consequently, we
induced fibrinogen binding to IIb 3 in our
CHO cell lines by incubating the cells with DTT, based on previous reports that DTT induces fibrinogen binding to
IIb 3 on platelets (33, 34). To confirm
that the fibrinogen binding induced by DTT is indeed comparable to that
induced by activating mAbs, we incubated CHO cells expressing human
IIb 3 with 5 mM DTT and with
the activating mAb PT25-2 and measured FITC-fibrinogen binding to the
incubated cells using flow cytometry. As shown by the histograms in
Fig. 3, fibrinogen binding induced by DTT
and mAb PT25-2 was indistinguishable. Moreover, the fibrinogen binding
induced by either agent was inhibited by the
IIb 3-specific mAb A2A9, confirming that
the fibrinogen was bound to IIb 3.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 3.
Comparison of mAb PT25-2-induced and
DTT-induced FITC-fibrinogen binding to CHO cells expressing human
IIb 3.
CHO cells stably expressing human IIb 3
were incubated either with the
IIb 3-activating mAb PT25-2 at 10 µg/ml
(A) or with 5 mM DTT (B) for 30 min
at 37 °C in the presence of 200 µg/ml FITC-fibrinogen and 1 mM CaCl2. The extent of FITC-fibrinogen binding
was then measured by flow cytometry. The specificity of fibrinogen
binding induced by mAb PT25-2 and DTT was assessed by adding the
IIb 3-inhibiting mAb A2A9 to the
incubations.
|
|
The effect of RGDS on fibrinogen binding to the cell lines shown in
Fig. 2 was studied by adding increasing concentrations of the
tetrapeptide to the fibrinogen binding assays. The results of these
experiments are shown in Fig. 4. As
expected, fibrinogen binding to cells expressing human
IIb 3 was relatively sensitive to
inhibition by RGDS, whereas fibrinogen binding to cells expressing rat
IIb 3 was relatively resistant. However,
to our surprise, based on the observation that RGD-containing peptides
cross-link to the amino terminus of 3 (10), we found
that fibrinogen binding to cells expressing
IIb 3 containing a rat -subunit and a
human -subunit was resistant to RGDS, whereas fibrinogen binding to cells expressing IIb 3 containing a human
-subunit and a rat -subunit was sensitive. The IC50
values (concentrations of RGDS that inhibited fibrinogen binding by
50%) for RGDS, calculated from semilog plots of the binding data, were
1.65 and 2.07 mM for cells expressing rat
IIb 3 and rat IIb/human
3, compared with 0.04 and 0.01 mM for cells
expressing human IIb 3 and human IIb/rat 3 (Table
I), respectively.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 4.
Effect of RGDS on DTT-stimulated
FITC-fibrinogen binding to CHO cells expressing human and rat
IIb 3.
CHO cell lines stably expressing the four possible combinations of
human and rat IIb and 3 were incubated
with 5 mM DTT in the presence of 200 µg/ml
FITC-fibrinogen, 1 mM CaCl2, and increasing
concentrations of the tetrapeptide RGDS for 30 min at 37 °C. The
extent of FITC-fibrinogen binding was measured by flow cytometry.
Solid circles, human IIb/human
3 (H/H); shaded circles, human
IIb/rat 3 (H/R); solid
squares, rat IIb/rat 3
(R/R); shaded squares, rat
IIb/human 3 (R/H). The data
shown are the means ± S.E. of nine (human
IIb/human 3 and rat
IIb/rat 3) and three (human
IIb/rat 3 and rat
IIb/human 3) experiments.
|
|
Effect of RGDS on the Adhesion of B Lymphocytes Expressing
IIb 3 to Immobilized Fibrinogen--
To
rule out the possibility that the observed differences in sensitivity
to RGDS were due to differences in the response of human and rat
IIb to DTT, we expressed the four combinations of human
and rat IIb and 3 in the B lymphocyte
cell line GM1500 (35). Flow cytometry of the transfected cells using
mAb P34 indicated that each of the combinations of human and rat
IIb and 3 was expressed to a comparable
extent on the lymphocyte surface (data not shown). We then measured the
effect of RGDS on phorbol 12-myristate 13-acetate-stimulated lymphocyte
adhesion to immobilized fibrinogen. As shown in Fig.
5, we found that lymphocytes expressing
IIb 3 heterodimers containing an
-subunit of human origin were 20-fold more sensitive to the
inhibitory effect of RGDS than lymphocytes expressing heterodimers
containing an -subunit of rat origin. Thus, these experiments
confirm that the difference in sensitivity of human and rat
IIb 3 to RGD-containing peptides can be
attributed to structural differences between human and rat
IIb.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of RGDS on the phorbol 12-myristate
13-acetate-stimulated adhesion of B lymphocytes expressing human and
rat
IIb 3
to immobilized fibrinogen. 1.5 × 105 GM1500 B
lymphocytes stably expressing the four possible combinations of human
and rat IIb and 3 and metabolically
labeled with [35S]methionine were added to the wells of
microtiter plates coated with purified human fibrinogen. Following the
addition of increasing concentrations of the tetrapeptide RGDS,
lymphocyte adhesion to the immobilized fibrinogen was induced by
stimulating the cells with 200 ng/ml phorbol 12-myristate 13-acetate,
and the extent of cell adhesion was measured as described under
"Experimental Procedures." Solid circles, human
IIb/human 3 (H/H);
shaded circles, human IIb/rat
3 (H/R); solid squares, rat
IIb/rat 3 (R/R); shaded
squares, rat IIb/human 3
(R/H). The data shown are the means of measurements made in
triplicate and are representative of three experiments.
|
|
Localization of the IIb Regions Regulating
Sensitivity to RGDS Using Human-Rat IIb
Chimeras--
The amino-terminal portion of IIb
consists of seven tandem repeats, each of which contains ~60 amino
acids (31). To localize the sites in IIb that regulate
sensitivity to RGDS, we exchanged the amino-terminal repeats of rat
IIb for the human repeats and vice versa, making use of
a conserved ClaI restriction site. The IIb
chimeras were then coexpressed with human 3 in CHO
cells, and the ability of RGDS to inhibit the binding of
FITC-fibrinogen to the chimeras was tested. As shown in Fig.
6, chimeras in which the seven
amino-terminal repeats of IIb were of human origin were
sensitive to RGDS, whereas chimeras in which the seven amino-terminal repeats were of rat origin were resistant. Thus, these experiments indicate that the sequences regulating the sensitivity of
IIb 3 to RGDS are located in the seven
amino-terminal repeats of IIb.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 6.
Effect of exchanging the amino-terminal
halves of human and rat IIb on the
ability of RGDS to inhibit FITC-fibrinogen binding to
IIb 3.
CHO cells stably coexpressing human 3 and chimeras of
human and rat IIb in which the seven amino-terminal
repeats had been exchanged were incubated with 5 mM DTT in
the presence of 200 µg/ml FITC-fibrinogen, 1 mM
CaCl2, and increasing concentrations of the tetrapeptide
RGDS for 30 min at 37 °C. The extent of fibrinogen binding was then
measured using flow cytometry. Solid circles, an
IIb chimera containing the seven amino-terminal repeats
of human IIb (H1-7-R);
shaded circles, an IIb chimera containing the
seven amino-terminal repeats of rat IIb
(R1-7-H). The data shown are the
means ± S.E. of four (R1-7-H) and
six (H1-7-R) experiments.
|
|
Identification of Specific Regions of the Amino Terminus of
IIb That Regulate Sensitivity to RGDS--
To
further localize the sequences that regulate the sensitivity of
IIb 3 to RGDS, we replaced the first two,
three, and four amino-terminal repeats of rat IIb with
the corresponding human sequences. The resulting chimeric -subunits
were coexpressed with human 3 in CHO cells, and the
ability of RGDS to inhibit FITC-fibrinogen binding to each cell line
was measured. As shown in Fig.
7A, when the first four
repeats of rat IIb were replaced by the human sequences,
the resulting IIb 3 heterodimer was
sensitive to RGDS. In contrast, when only the first two repeats were of human origin, the IIb 3 chimera was
resistant. A chimera in which the first three repeats were of human
origin was of intermediate sensitivity. Thus, these data indicate that
sequences regulating the response of IIb 3
to RGDS are located in the third and fourth amino-terminal repeats of
IIb.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 7.
Effect of RGDS on DTT-stimulated
FITC-fibrinogen binding to
IIb 3
composed of human 3 and chimeras
of human and rat IIb.
Chimeric human and rat IIb subunits in which the first
and second, first through third, and first through fourth
amino-terminal repeats had been replaced with those of the other
species were stably coexpressed with human 3 in CHO
cells as described under "Experimental Procedures." The effect of
RGDS on FITC-fibrinogen binding to the resulting cells lines was
measured as described in the legends to Figs. 4 and 6. A,
the amino-terminal repeats of rat IIb were replaced by
the corresponding human repeats. Solid circles, first
through fourth repeats (H1-4-R/H);
shaded circles, first through third repeats
(H1-3-R/H); open circles,
first and second repeats (H1-2-R/H).
B, the amino-terminal repeats of human IIb
were replaced by the corresponding rat repeats. Solid
circles, first and second repeats
(R1-2-H/H); shaded circles,
first through third repeats (R1-3-H/H).
The data shown are the means ± S.E. of three experiments.
|
|
To confirm this conclusion, we made the reciprocal exchanges. However,
although human IIb in which the first and second repeats and the first through third repeats were replaced by the corresponding rat sequences readily coexpressed with human 3 on the
CHO cell surface, IIb in which the first through fourth
repeats were of rat origin was never expressed to a level sufficient to
measure fibrinogen binding. Nonetheless, as shown in Fig.
7B, replacing the first and second human repeats with the
corresponding rat sequence had no effect on the sensitivity of
IIb 3 to RGDS, and a chimera in which the
first through third repeats were exchanged was only slightly less
sensitive. Thus, these results are consistent with those shown in Fig.
7A.
The IC50 values for RGDS inhibition of fibrinogen binding
to the various cell lines, as well as a relative RGDS resistance index
derived by normalizing the IC50 values to that for human IIb 3, are shown in Table I. This analysis
verifies that the locus for sensitivity to RGDS is located in
IIb and that the relevant sequences are present in its
third and fourth amino-terminal repeats.
Induction of mAb Binding to 3by RGDS--
Based on
these data, there are two possible ways in RGDS could inhibit
fibrinogen binding to IIb 3. First, it is
possible that RGDS binds to the third and fourth amino-terminal repeats of IIb and directly competes with fibrinogen for binding
to this site. Second, it is possible that RGDS binds elsewhere in
IIb 3 and exerts an allosteric effect on
the third and fourth amino-terminal repeats of IIb, thereby
inhibiting fibrinogen binding. Binding of RGD-based peptides and
peptidomimetics to IIb 3 has been shown to
induce the expression of epitopes for a number of
anti- IIb and anti- 3 mAbs (36). Therefore,
to differentiate between the two possibilities discussed above, we
measured the ability of RGDS to induce the binding of the human
3-specific mAb 10-758 to RGDS-sensitive human
IIb 3, to RGDS-resistant rat
IIb/human 3, and to RGDS-resistant
IIb 3 in which the amino-terminal half of
IIb was of rat origin. As shown in Fig.
8, 0.3 mM RGDS induced mAb
10-758 binding to each form of IIb 3. We
conclude from these data that RGDS bound to each form of
IIb 3, a result consistent with the
possibility that RGDS inhibits fibrinogen binding to IIb 3 by inducing an allosteric change in
the third and fourth amino-terminal IIb repeats.

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 8.
RGDS induction of mAb 10-758 binding to
IIb 3
containing either a human or rat
-subunit. 1.5 × 105 CHO
cells coexpressing human IIb with human 3
(H/H), rat IIb with human 3
(R/H), and an IIb chimera composed of the
amino-terminal half of rat IIb and the carboxyl-terminal
half of human IIb with human 3
(R1-7-H/H) were incubated with 0.3 mM RGDS and a 1:100 dilution of mAb 10-758 or a
class-matched control antibody for 30 min at 37 °C. The cells were
then incubated with a 1:10 dilution of FITC-labeled goat anti-mouse IgG
for an additional 30 min. Antibody binding was assessed by flow
cytometry.
|
|
 |
DISCUSSION |
Although fibrinogen appears to bind to
IIb 3 exclusively via sequences located at
the carboxyl-terminal end of the fibrinogen -chain (5, 6), peptides
containing an RGD motif are competitive inhibitors of fibrinogen
binding to IIb 3 (4). Moreover, despite chemical cross-linking experiments suggesting that the -chain and
RGD-containing peptides bind to different subunits of the IIb 3 heterodimer (16, 38), competitive
binding measurements indicate that the peptides bind to
IIb 3 in a mutually exclusive manner (39),
implying either that the peptides bind to same site or that the binding
sites interact allosterically. Hu et al. (40), using
plasmon resonance spectroscopy to study the effect of RGD ligands on
fibrinogen binding to IIb 3, concluded that fibrinogen and RGD ligands bind to separate sites on
IIb 3, but suggested that there is an
allosteric relationship between the two. Using chimeras of
RGD-insensitive rat IIb 3 and
RGD-sensitive human IIb 3, we found that
sensitivity to the inhibitory effects of the tetrapeptide RGDS was
determined by the origin of the third and fourth amino-terminal repeats
of IIb. We also found little difference in the affinity
of IIb 3 on human and rat platelets for
fibrinogen. Thus, our data suggest that rather than directly affecting
fibrinogen binding, species differences in the third and fourth
IIb repeats affect an allosteric change that regulates fibrinogen binding to IIb 3.
Ligand binding to IIb 3 is thought to
involve regions located in the amino-terminal portions of both
IIb and 3 (8), although much of this
evidence is indirect. The 3 region encompasses amino
acids 95-223 (9) and includes the RGD-cross-linking site located in
the vicinity of amino acids 109-171 (38) as well as an array of
oxygenated residues whose fold may resemble that of the ligand-binding
metal ion-dependent
adhesion sites (MIDAS) present in integrin I
domains (11). It is noteworthy that the deleterious effect of an
Arg214 Trp mutation, located in the midst of this
sequence, can be reversed by exposing
IIb 3 to DTT, suggesting that the presence of Trp at residue 214 does not prevent fibrinogen binding to
IIb 3 directly, but rather obscures the
fibrinogen-binding site (41).
It is also noteworthy that the location of the binding site for
RGD-containing peptides in integrins is uncertain, and there is
evidence for binding sites in both - and -subunits. For example, proteins corresponding to the fourth through seventh amino-terminal repeats of 5 and IIb bind to fibronectin
III fragment-(8-10) and to fibrinogen, respectively, in an
RGD- dependent manner (42, 43). Conversely, experiments using
chemical and photoaffinity cross-linking, site-directed mutagenesis,
synthetic integrin and RGD-containing peptides, and mAbs have
identified regions in the amino-terminal portion of 1-
and 3-subunits that recognize the RGD motif (11, 38,
44-46). Based on these observations, one possible explanation for our
results is simply that RGDS does not bind to either rat
IIb or rat 3. However, we found that first, the sensitivity of IIb 3 composed
of human subunits or of a human -subunit and rat -subunit to RGDS
was equivalent, and second, binding of mAb 10-758 to human
3 was induced by RGDS to an equal extent regardless of
whether IIb was human, rat, or a human-rat chimera.
Thus, our data imply that RGDS binds to both human and rat
IIb 3 and that differences in its
inhibitory potency are due to differences in allosteric events that
follow RGDS binding.
The portion of IIb implicated in ligand binding has also
been localized to the amino-terminal third of the molecule (15) and
includes the fibrinogen -chain peptide-cross-linking site at amino
acids 294-314 (16). In addition, a number of naturally occurring and
laboratory-induced mutations involving amino acids 145, 183, 184, 189, 190, 191, 193, and 224 have been described that impair
IIb 3 function, suggesting that these
residues interact with IIb 3 ligands
(18-20). Of note, residues 183-224 are located in the third
IIb repeat (25). Because our data suggest that the third
repeat is involved in the allosteric regulation of fibrinogen binding
to IIb 3, it is possible that mutation of
the residues listed above interferes with this allosteric change,
rather than directly perturbing the fibrinogen-binding site.
The tertiary structure of integrins has yet to be determined. Based on
computer modeling, Springer (31) proposed that the amino-terminal
portion of integrin -subunits folds into a seven-bladed -propeller configuration, with each of the blades corresponding to a
-sheet formed from four anti-parallel -strands located within
each of the amino-terminal repeats. Loops connecting the -strands
would be located on either the upper or low surface of the proposed
propeller such that residues in three loops in human IIb
between Arg147 and Tyr166, Val182
and Leu195, and His215 and Gly233,
connecting portions of the third and fourth propeller blades, would be
juxtaposed in one quadrant of the upper surface of the propeller (21).
Comparison of the amino acid sequence of the loops in human
IIb with that of the analogous portions of rat IIb (47) indicates that the putative second loop is
fully conserved, whereas the first and third loops would be only 50%
homologous. Thus, it is possible that amino acid sequence differences
between human and rat IIb in the putative first and
third loops could be responsible for the differences in sensitivity of
human and rat IIb 3 to RGD-containing peptides.
Alterations in the tertiary and/or quaternary structure of integrins
regulate their affinity, and possibly their avidity, for ligands.
Recent nuclear magnetic resonance spectroscopic and x-ray
crystallographic studies of the I domain of L emphasize the importance of changes in the conformation of the -subunit amino
terminus in integrin function (48, 49). I domains are present in nine
integrin -subunits, where they are inserted between the second and
third amino-terminal repeats (49). In L and M, ligands such as ICAM-1-3
(intercellular adhesion
molecule) bind to a divalent cation-containing MIDAS motif
on the upper I domain surface (50-53). In the I domain of
L, residues distal to the MIDAS motif, lining a cleft
formed by the seventh -helix and the central -sheet, regulate
ligand binding to L 2 allosterically (49)
and constitute the binding site for the
L 2 inhibitor lovastatin (48). In
addition, mutations in the amino- and carboxyl-terminal linker
sequences that connect the I domain to the rest of L
either activate or inactivate I domain function (49), implying that the
changes in I domain conformation that regulate its function are
transmitted from the amino-terminal portion of L to the
I domain via these sequences. In the case of
IIb 3, agonist-induced changes in tertiary
structure are essential for its function (2). Our results indicate that
an allosteric change in the third and fourth amino-terminal repeats of
IIb, a portion of IIb located immediately
downstream from the I domain insertion site in I domain-containing integrins, regulates ligand binding to
IIb 3. Thus, by extrapolation, our data
suggest that allosteric changes involving the third and fourth
-subunit repeats may be a general mechanism by which ligand binding
to integrins is regulated.
 |
ACKNOWLEDGEMENTS |
We thank Dr. H. Miyazaki for providing mAb
P34 and Dr. Bohumil Bednar (Merck Research Laboratories) for providing
mAb 10-758.
 |
FOOTNOTES |
*
This work was supported in part by Grant HL40387 from the
National Institutes of Health (to J. S. B. and M. P.) and by a
generous contribution from the Plummer Family (to M. P.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
**
To whom correspondence should be addressed: Children's
Hospital of Philadelphia, 34th St. and Civic Center Blvd.,
Philadelphia, PA 19104. Tel.: 215-590-3574; Fax: 215-590-3889; E-mail:
poncz@email.chop.edu.
Published, JBC Papers in Press, January 18, 2001, DOI 10.1074/jbc.M011511200
 |
ABBREVIATIONS |
The abbreviations used are:
CHO, Chinese hamster
ovary;
mAb, monoclonal antibody;
FITC, fluorescein isothiocyanate;
DTT, dithiothreitol.
 |
REFERENCES |
| 1.
|
Hynes, R. O.
(1987)
Cell
48,
549-554
|
| 2.
|
Bennett, J. S.
(1996)
Trends Cardiovasc. Med.
16,
31-36
|
| 3.
|
Kloczewiak, M.,
Timmons, S.,
and Hawiger, J.
(1982)
Biochem. Biophys. Res. Commun.
107,
181-187
|
| 4.
|
Gartner, T. K.,
and Bennett, J. S.
(1985)
J. Biol. Chem.
260,
11891-11894
|
| 5.
|
Weisel, J. W.,
Nagaswami, C.,
Vilaire, G.,
and Bennett, J. S.
(1992)
J. Biol. Chem.
267,
16637-16643
|
| 6.
|
Farrell, D. H.,
and Thiagarajan, P.
(1994)
J. Biol. Chem.
269,
226-231
|
| 7.
|
Lefkovits, J.,
Plow, E.,
and Topol, E.
(1995)
N. Engl. J. Med.
332,
1553-1559
|
| 8.
|
Puzon-McLaughlin, W.,
Kamata, T.,
and Takada, Y.
(2000)
J. Biol. Chem.
275,
7795-7802
|
| 9.
|
Lin, E. C. K.,
Ratnikov, B. I.,
Tsai, P. M.,
Carron, C. P.,
Myers, D. M.,
Barbas, C. F., III,
and Smith, J. W.
(1997)
J. Biol. Chem.
272,
23912-23920
|
| 10.
|
D'Souza, S. E.,
Ginsberg, M. H.,
Burke, T. A.,
Lam, S. C.-T.,
and Plow, E. F.
(1988)
Science
242,
91-93
|
| 11.
|
Tozer, E. C.,
Liddington, R. C.,
Sutcliffe, M. J.,
Smeeton, A. H.,
and Loftus, J. C.
(1996)
J. Biol. Chem.
271,
21978-21984
|
| 12.
|
Charo, I. F.,
Nannizzi, L.,
Phillips, D. R.,
Hsu, M. A.,
and Scarborough, R. M.
(1991)
J. Biol. Chem.
266,
1415-1421
|
| 13.
|
Steiner, B.,
Trzeciak, A.,
Pfenninger, G.,
and Kouns, W.
(1993)
J. Biol. Chem.
268,
6870-6873
|
| 14.
|
Ward, C. M.,
Kestin, A. S.,
and Newman, P. J.
(2000)
Blood
96,
161-169
|
| 15.
|
Loftus, J. C.,
Halloran, C. E.,
Ginsberg, M. H.,
Feigen, L. P.,
Zablocki, J. A.,
and Smith, J. W.
(1996)
J. Biol. Chem.
271,
2033-2039
|
| 16.
|
D'Souza, S. E.,
Ginsberg, M. H.,
Burke, T. A.,
and Plow, E. F.
(1990)
J. Biol. Chem.
265,
3440-3446
|
| 17.
|
Taylor, D. B.,
and Gartner, T. K.
(1992)
J. Biol. Chem.
267,
11729-11733
|
| 18.
|
Kamata, T.,
Irie, A.,
Tokuhira, M.,
and Takada, Y.
(1996)
J. Biol. Chem.
271,
18610-18615
|
| 19.
|
Grimaldi, C. M.,
Chen, F.,
Wu, C.,
Weiss, H. J.,
Coller, B. S.,
and French, D. L.
(1998)
Blood
91,
1562-1571
|
| 20.
|
Tozer, E. C.,
Baker, E. K.,
Ginsberg, M. H.,
and Loftus, J. C.
(1999)
Blood
93,
918-924
|
| 21.
|
Basani, R. B.,
French, D. L.,
Vilaire, G.,
Brown, D. L.,
Chen, F.,
Coller, B. S.,
Derrick, J. M.,
Gartner, T. K.,
Bennett, J. S.,
and Poncz, M.
(2000)
Blood
95,
180-188
|
| 22.
|
Harfenist, E. J.,
Packham, M. A.,
and Mustard, J. F.
(1988)
Blood
71,
132-136
|
| 23.
|
Jennings, L. K.,
White, M. M.,
and Mandrell, T. D.
(1995)
Thromb. Haemostasis
74,
1551-1556
|
| 24.
|
Bennett, J. S.,
and Vilaire, G.
(1979)
J. Clin. Invest.
64,
1393-1401
|
| 25.
|
Poncz, M.,
Eisman, R.,
Heidenreich, R.,
Silver, S. M.,
Vilaire, G.,
Surrey, S.,
Schwartz, E.,
and Bennett, J. S.
(1987)
J. Biol. Chem.
262,
8476-8482
|
| 26.
|
Poncz, M.,
and Newman, P. J.
(1990)
Blood
75,
1282-1289
|
| 27.
|
Zimrin, A. B.,
Eisman, R.,
Vilaire, G.,
Schwartz, E.,
Bennett, J. S.,
and Poncz, M.
(1988)
J. Clin. Invest.
81,
1470-1475
|
| 28.
|
Cieutat, A. M.,
Rosa, J. P.,
Letourneur, F.,
Poncz, M.,
and Rifat, S.
(1993)
Biochem. Biophys. Res. Commun.
193,
771-778
|
| 29.
|
Wilhide, C. C.,
Jin, Y.,
Guo, Q.,
Li, L.,
Li, S. X.,
Rubin, E.,
and Bray, P. F.
(1997)
Blood
90,
3951-3961
|
| 30.
|
Ransom, D. G.,
Hens, M. D.,
and DeSimone, D. W.
(1993)
Dev. Biol.
160,
265-275
|
| 31.
|
Springer, T. A.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
65-72
|
| 32.
|
Qi, W.,
Loh, E.,
Vilaire, G.,
and Bennett, J. S.
(1998)
J. Biol. Chem.
273,
15271-15278
|
| 33.
|
Macintyre, D. E.,
and Gordon, J. L.
(1974)
Biochem. Soc. Trans.
2,
873-875
|
| 34.
|
Zucker, M. B.,
and Masiello, N. C.
(1984)
Thromb. Haemostasis
51,
19-124
|
| 35.
|
Loh, E.,
Beaverson, K.,
Vilaire, G.,
Qi, W.,
Poncz, M.,
and Bennett, J. S.
(1995)
J. Biol. Chem.
270,
18631-18636
|
| 36.
|
Bennett, J. S.,
Zigmond, S.,
Vilaire, G.,
Cunningham, M. E.,
and Bednar, B.
(1999)
J. Biol. Chem.
274,
25301-25307
|
| 37.
|
O'Toole, T. E.,
Katagiri, Y.,
Faull, R. J.,
Peter, K.,
Tamura, R.,
Quaranta, V.,
Loftus, J. C.,
Shattil, S. J.,
and Ginsberg, M. H.
(1994)
J. Cell Biol.
124,
1047-1059
|
| 38.
|
D'Souza, S. E.,
Ginsberg, M. H.,
Lam, S. C.,
and Plow, E. F.
(1988)
J. Biol. Chem.
263,
3943-3951
|
| 39.
|
Bennett, J. S.,
Shattil, S. J.,
Power, J. W.,
and Gartner, T. K.
(1988)
J. Biol. Chem.
263,
12948-12953
|
| 40.
|
Hu, D. D.,
White, C. A.,
Panzer-Knodle, S.,
Page, J. D.,
Nicholson, N.,
and Smith, J. W.
(1999)
J. Biol. Chem.
274,
4633-4639
|
| 41.
|
Kouns, W.,
Steiner, B.,
Kunicki, T.,
Moog, S.,
Jutzi, J.,
Jennings, L.,
Cazenave, J.,
and Lanza, F.
(1994)
Blood
84,
1108-1015
|
| 42.
|
Baneres, J. L.,
Roquet, F.,
Green, M.,
LeCalvez, H.,
and Parello, J.
(1998)
J. Biol. Chem.
273,
24744-24753
|
| 43.
|
Gulino, D.,
Boudignon, C.,
Zhang, L.,
Concord, E.,
Rabiet, M.-J.,
and Marguerie, G.
(1992)
J. Biol. Chem.
267,
1001-1007
|
| 44.
|
Bitan, G.,
Scheibler, L.,
Greenberg, Z.,
Rosenblatt, M.,
and Chorev, M.
(1999)
Biochemistry
38,
3414-3420
|
| 45.
|
Mould, A. P.,
Askari, J. A.,
Aota, S.,
Yamada, K. M.,
Irie, A.,
Takada, Y.,
Mardon, H. J.,
and Humphries, M. J.
(1997)
J. Biol. Chem.
272,
17283-17292
|
| 46.
|
Humphries, J. D.,
Askari, J. A.,
Zhang, X. P.,
Takada, Y.,
Humphries, M. J.,
and Mould, A. P.
(2000)
J. Biol. Chem.
275,
20337-20345
|
| 47.
|
Thornton, M. A.,
and Poncz, M.
(1999)
Blood
94,
3947-3950
|
| 48.
|
Kallen, J.,
Welzenbach, K.,
Ramage, P.,
Geyl, D.,
Kriwacki, R.,
Legge, G.,
Cottens, S.,
Weitz-Schmidt, G.,
and Hommel, U.
(1999)
J. Mol. Biol.
292,
1-9
|
| 49.
|
Huth, J. R.,
Olejniczak, E. T.,
Mendoza, R.,
Liang, H.,
Harris, E. A.,
Lupher, M. L., Jr.,
Wilson, A. E.,
Fesik, S. W.,
and Staunton, D. E.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
5231-5236
|
| 50.
|
Lee, J. O.,
Bankston, L. A.,
Arnaout, M. A.,
and Liddington, R. C.
(1995)
Structure
3,
1333-1340
|
| 51.
|
Qu, A.,
and Leahy, D. J.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
10277-10281
|
| 52.
|
Liddington, R.,
and Bankston, L.
(1998)
Structure
6,
937-938
|
| 53.
|
Oxvig, C.,
Lu, C.,
and Springer, T. A.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
2215-2220
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. Blue, M. A. Kowalska, J. Hirsch, M. Murcia, C. A. Janczak, A. Harrington, M. Jirouskova, J. Li, R. Fuentes, M. A. Thornton, et al.
Structural and therapeutic insights from the species specificity and in vivo antithrombotic activity of a novel {alpha}IIb-specific {alpha}IIb{beta}3 antagonist
Blood,
July 2, 2009;
114(1):
195 - 201.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Honda, H. Shirotani-Ikejima, S. Tadokoro, Y. Maeda, T. Kinoshita, Y. Tomiyama, and T. Miyata
Integrin-linked kinase associated with integrin activation
Blood,
May 21, 2009;
113(21):
5304 - 5313.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. W. Bougie, J. Birenbaum, M. Rasmussen, M. Poncz, and R. H. Aster
Quinine-dependent, platelet-reactive monoclonals mimic antibodies found in patients with quinine-induced immune thrombocytopenia
Blood,
January 29, 2009;
113(5):
1105 - 1111.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. B. Basani, H. Zhu, M. A. Thornton, C. S. Soto, W. F. DeGrado, M. A. Kowalska, J. S. Bennett, and M. Poncz
Species differences in small molecule binding to {alpha}IIb{beta}3 are the result of sequence differences in 2 loops of the {alpha}IIb {beta} propeller
Blood,
January 22, 2009;
113(4):
902 - 910.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. W. Miller, S. Basra, D. W. Kulp, P. C. Billings, S. Choi, M. P. Beavers, O. J. T. McCarty, Z. Zou, M. L. Kahn, J. S. Bennett, et al.
Small-molecule inhibitors of integrin {alpha}2{beta}1 that prevent pathological thrombus formation via an allosteric mechanism
PNAS,
January 20, 2009;
106(3):
719 - 724.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. Marwali, C.-P. Hu, B. Mohandas, A. Dandapat, P. Deonikar, J. Chen, I. Cawich, T. Sawamura, M. Kavdia, and J. L. Mehta
Modulation of ADP-Induced Platelet Activation by Aspirin and Pravastatin: Role of Lectin-Like Oxidized Low-Density Lipoprotein Receptor-1, Nitric Oxide, Oxidative Stress, and Inside-Out Integrin Signaling
J. Pharmacol. Exp. Ther.,
September 1, 2007;
322(3):
1324 - 1332.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Yin, R. I. Litvinov, G. Vilaire, H. Zhu, W. Li, G. A. Caputo, D. T. Moore, J. D. Lear, J. W. Weisel, W. F. DeGrado, et al.
Activation of Platelet {alpha}IIbbeta3 by an Exogenous Peptide Corresponding to the Transmembrane Domain of {alpha}IIb
J. Biol. Chem.,
December 1, 2006;
281(48):
36732 - 36741.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Li, D. G. Metcalf, R. Gorelik, R. Li, N. Mitra, V. Nanda, P. B. Law, J. D. Lear, W. F. DeGrado, and J. S. Bennett
A push-pull mechanism for regulating integrin function
PNAS,
February 1, 2005;
102(5):
1424 - 1429.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. I. Litvinov, C. Nagaswami, G. Vilaire, H. Shuman, J. S. Bennett, and J. W. Weisel
Functional and structural correlations of individual {alpha}IIb{beta}3 molecules
Blood,
December 15, 2004;
104(13):
3979 - 3985.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. I. Litvinov, G. Vilaire, H. Shuman, J. S. Bennett, and J. W. Weisel
Quantitative Analysis of Platelet {alpha}v{beta}3 Binding to Osteopontin Using Laser Tweezers
J. Biol. Chem.,
December 19, 2003;
278(51):
51285 - 51290.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Tabuchi, A. Yoshioka, T. Higashi, R. Shirakawa, H. Nishioka, T. Kita, and H. Horiuchi
Direct Demonstration of Involvement of Protein Kinase C{alpha} in the Ca2+-induced Platelet Aggregation
J. Biol. Chem.,
July 11, 2003;
278(29):
26374 - 26379.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Quinn, T. V. Byzova, J. Qin, E. J. Topol, and E. F. Plow
Integrin {alpha}IIb{beta}3 and Its Antagonism
Arterioscler. Thromb. Vasc. Biol.,
June 1, 2003;
23(6):
945 - 952.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Li, N. Mitra, H. Gratkowski, G. Vilaire, R. Litvinov, C. Nagasami, J. W. Weisel, J. D. Lear, W. F. DeGrado, and J. S. Bennett
Activation of Integrin {alpha}IIb{beta}3 by Modulation of Transmembrane Helix Associations
Science,
May 2, 2003;
300(5620):
795 - 798.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Thornton, C. Zhang, M. A. Kowalska, and M. Poncz
Identification of distal regulatory regions in the human alpha IIb gene locus necessary for consistent, high-level megakaryocyte expression
Blood,
November 15, 2002;
100(10):
3588 - 3596.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Calzada, M. V. Alvarez, and J. Gonzalez-Rodriguez
Agonist-specific Structural Rearrangements of Integrin alpha IIbbeta 3. CONFIRMATION OF THE BENT CONFORMATION IN PLATELETS AT REST AND AFTER ACTIVATION
J. Biol. Chem.,
October 11, 2002;
277(42):
39899 - 39908.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. W. Bougie, P. R. Wilker, E. D. Wuitschick, B. R. Curtis, M. Malik, S. Levine, R. N. Lind, J. Pereira, and R. H. Aster
Acute thrombocytopenia after treatment with tirofiban or eptifibatide is associated with antibodies specific for ligand-occupied GPIIb/IIIa
Blood,
August 28, 2002;
100(6):
2071 - 2076.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. D. Watson, R. Prado, A. Veloso, J-P. Brunschwig, and W. D. Dietrich
Cerebral Blood Flow Restoration and Reperfusion Injury After Ultraviolet Laser-Facilitated Middle Cerebral Artery Recanalization in Rat Thrombotic Stroke
Stroke,
February 1, 2002;
33(2):
428 - 434.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|