JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M011511200 on January 18, 2001

J. Biol. Chem., Vol. 276, Issue 17, 13975-13981, April 27, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/17/13975    most recent
M011511200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Basani, R. B.
Right arrow Articles by Poncz, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Basani, R. B.
Right arrow Articles by Poncz, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

RGD-containing Peptides Inhibit Fibrinogen Binding to Platelet alpha IIbbeta 3 by Inducing an Allosteric Change in the Amino-terminal Portion of alpha IIb*

Ramesh B. BasaniDagger §, Giovanna D'AndreaDagger , Neal Mitra||, Gaston Vilaire||, Mark Richberg§, M. Anna KowalskaDagger , Joel S. Bennett||, and Mortimer PonczDagger §**

From the Dagger  Children's Hospital of Philadelphia and the Departments of § Pediatrics and || Medicine, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104 and the  Istituto di Ricovero e Cura a Carattere Scientifico Casa Sollievo della Sofferenza, Unitá di Aterosclerosi e Trombosi, Foggia 71013, Italy

Received for publication, December 20, 2000, and in revised form, January 11, 2001




    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

To determine the molecular basis for the insensitivity of rat alpha IIbbeta 3 to inhibition by RGD-containing peptides, hybrids of human and rat alpha IIbbeta 3 and chimeras of alpha IIbbeta 3 in which alpha IIb was composed of portions of human and rat alpha IIb were expressed in Chinese hamster ovary cells and B lymphocytes, and the ability of the tetrapeptide RGDS to inhibit fibrinogen binding to the various forms of alpha IIbbeta 3 was measured. These measurements indicated that sequences regulating the sensitivity of alpha IIbbeta 3 to RGDS are located in the seven amino-terminal repeats of alpha IIb. Moreover, replacing the first three or four (but not the first two) repeats of rat alpha IIb with the corresponding human sequences enhanced sensitivity to RGDS, whereas replacing the first two or three repeats of human alpha IIb with the corresponding rat sequences had little or no effect. Nevertheless, RGDS bound to Chinese hamster ovary cells expressing alpha IIbbeta 3 regardless whether the alpha IIb in the heterodimers was human, rat, or a rat-human chimera. These results indicate that the sequences determining the sensitivity of alpha IIbbeta 3 to RGD-containing peptides are located in the third and fourth amino-terminal repeats of alpha IIb. Because RGDS binds to both human and rat alpha IIbbeta 3, the results suggest that differences in RGDS sensitivity result from differences in the allosteric changes induced in these repeats following RGDS binding.




    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Ligand binding to integrins initiates intracellular signals that are crucial for cellular growth and differentiation (1). Conversely, many cells regulate the ability of their integrins to recognize ligands. The prototypic example of integrin regulation is the platelet integrin alpha IIbbeta 3 (2). In unstimulated platelets, alpha IIbbeta 3 is inactive; but following platelet stimulation by agonists such as ADP and thrombin, alpha IIbbeta 3 assumes a conformation in which it is able to bind macromolecular ligands such as fibrinogen and von Willebrand factor. Because ligand binding to alpha IIbbeta 3 is a prerequisite for platelet aggregation, regulating the affinity of alpha IIbbeta 3 for ligands assures that only stimulated platelets aggregate.

The major ligand for alpha IIbbeta 3 in plasma is fibrinogen. Three portions of the fibrinogen molecule (the carboxyl terminus of the fibrinogen gamma -chain (3) and two Arg-Gly-Asp (RGD) motifs located in the fibrinogen alpha -chain (4)) have been proposed to be sites that mediate fibrinogen binding to alpha IIbbeta 3. However, ultrastructural examination of fibrinogen bound to alpha IIbbeta 3 (5) and measurements of fibrinogen binding to alpha IIbbeta 3 using fibrinogens containing mutated RGD or gamma -chain sequences (6) indicate that it is the gamma -chain sequences that mediate fibrinogen binding. Nonetheless, RGD-containing disintegrins and synthetic compounds based on the RGD motif are effective alpha IIbbeta 3 antagonists (7), implying that they either directly or indirectly affect the gamma -chain-binding site when they bind to alpha IIbbeta 3.

Ligands appear to bind to alpha IIbbeta 3 by interacting with the amino-terminal portion of beta 3 (8), although the specific residues involved are not known. A region of beta 3 encoded by the fourth and fifth exons of the beta 3 gene that encompasses amino acids 95-223 has been implicated in ligand binding (9). Moreover, chemical cross-linking experiments have suggested that RGD-containing peptides bind to beta 3 in the vicinity of amino acids 109-171 (10). It is noteworthy that this region of beta 3 contains an array of oxygenated residues whose three-dimensional structure may resemble that of the ligand-binding I domains that are present in several integrin alpha -subunits (11). In addition, overlapping peptides corresponding to beta 3 amino acids 211-222 inhibit fibrinogen binding to purified alpha IIbbeta 3, suggesting that this stretch of residues represents a portion of the fibrinogen-binding site (12, 13). There is also evidence that more distal portions of beta 3 may be involved in fibrinogen binding because a naturally occurring Leu262 right-arrow Pro mutation prevents alpha IIbbeta 3 binding to immobilized fibrinogen (14).

Ligand binding to alpha IIbbeta 3 also appears to involve the amino-terminal third of alpha IIb (15). Chemical cross-linking experiments suggest that the carboxyl terminus of the fibrinogen gamma -chain binds to alpha IIb in the vicinity of amino acids 294-314 (16), a suggestion supported by the ability of a peptide corresponding to alpha IIb residues 300-312 to inhibit platelet adhesion to fibrinogen (17). In addition, there are a number of reports of naturally occurring and laboratory-induced mutations involving amino acids located between alpha IIb residues 183 and 224 that impair alpha IIbbeta 3 function, suggesting that this portion of alpha IIb binds to ligands as well (18-21).

Although fibrinogen binding to alpha IIbbeta 3 on the platelets of all mammalian species is required for platelet aggregation, there are substantial differences in the ability of RGD-containing peptides to inhibit the process. For example, fibrinogen binding to rabbit and rat platelets is relatively insensitive to inhibition by RGD-containing peptides (22, 23). To gain an understanding of the molecular basis for the insensitivity of rat alpha IIbbeta 3 to RGD-containing peptides, we measured the effect of the tetrapeptide Arg-Gly-Asp-Ser (RGDS) on fibrinogen binding to chimeric alpha IIbbeta 3 molecules composed of portions of the rat and human proteins. We found that the sequences determining the sensitivity or resistance of alpha IIbbeta 3 to inhibition by RGDS are located in the third and fourth repeats of the amino-terminal portion of alpha IIb. Moreover, because we also found that RGDS bound to alpha IIbbeta 3 regardless of whether the heterodimer contained human or rat subunits, our results imply that RGDS impairs fibrinogen binding to alpha IIbbeta 3 by inducing an allosteric change in the third and fourth repeats of alpha IIb. They also suggest that a conformational change in these repeats may be required for the fibrinogen binding to alpha IIbbeta 3 that occurs on agonist-stimulated platelets.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Measurement of Platelet Aggregation-- Platelet-rich plasma was prepared from blood anticoagulated with 0.1 volume of 0.13 M sodium citrate, obtained from normal human volunteers by venipuncture and from anesthetized rats by puncture of the exposed abdominal aorta. Platelets were isolated from the platelet-rich plasma by gel filtration on Sepharose 2B (Amersham Pharmacia Biotech) using elution buffer containing 137 mM NaCl, 2.7 mM KCl, 1 mM MgCl2, 5.6 mM glucose, 0.35 mg/ml bovine serum albumin, 3.3 mM NaH2PO4, and 4 mM Hepes (pH 7.4) as previously described (24). Turbidometric measurements of ADP-stimulated platelet aggregation were made in a Chrono-Log Lumi dual aggregometer. Platelet suspensions were supplemented with either human or rat fibrinogen (Sigma) at a final concentration of 200 µg/ml, with 1 mM CaCl2, and with various concentrations of RGDS (Sigma) or the less active control tetrapeptide Arg-Gly-Glu-Ser (RGES; Sigma) prior to adding ADP.

Measurement of Fibrinogen Binding to Human and Rat Platelets-- Fibrinogen binding to gel-filtered human and rat platelets was measured using 125I-labeled fibrinogen as previously described (24). Briefly, 0.5-ml aliquots of approx 5 × 107 gel-filtered platelets were mixed with 200 µg/ml 125I-fibrinogen (Enzyme Research Laboratories), 0.5 mM CaCl2, and 10 µM ADP. Following a 5-min incubation at 37 °C without stirring, the platelets were sedimented through silicone oil in an Eppendorf centrifuge (Brinkmann Instruments). The tips of the centrifuge tubes containing the pelleted platelets were amputated and counted for 125I. Nonspecific fibrinogen binding was determined by including a 15-fold excess of unlabeled fibrinogen in the assay. The dissociation constants (Kd) for human and rat alpha IIbbeta 3 for fibrinogen were obtained by Scatchard analysis of the fibrinogen binding data.

Construction of Chimeric Human-Rat alpha IIb Subunits-- Full-length cDNAs for human and rat alpha IIb and a full-length cDNA for human beta 3 were used in selected experiments (25-28). A nearly full-length rat beta 3 cDNA was completed by inserting the sequences corresponding to the signal peptide and the first 31 amino acids of human beta 3 (21, 29). The amino-terminal region of mature beta 3 is highly conserved; for example, human and Xenopus beta 3 cDNAs differ by only nine amino acids in this region (30).

cDNAs encoding chimeras of alpha IIb in which the amino-terminal halves of human and rat alpha IIb were exchanged were constructed by swapping homologous ClaI/NheI 5'-fragments of human and rat alpha IIb cDNAs (28). cDNAs encoding alpha IIb chimeras containing smaller segments of rat and human alpha IIb were constructed using a polymerase chain reaction-based site-directed mutagenesis protocol described previously (21). Briefly, using either a human or rat alpha IIb cDNA template, the 3'-portion of the targeted sequence was amplified using one of the sense primers shown below and the appropriate antisense primer 3' to the ClaI site. Similarly, the 5'-portion was amplified using the appropriate alpha IIb cDNA template, a primer complementary to one of the sense primers shown below, and a T7 primer. The 5'- and 3'-polymerase chain reaction products were then purified on agarose gels after separation from the templates. A third polymerase chain reaction was performed using the two first-round amplified products, the T7 primer, and the appropriate primer 3' to the ClaI site in the template. The product was double-digested with ClaI and NheI and subcloned into either a human or rat alpha IIb cDNA that had previously been inserted into the expression plasmid pcDNA3.1 (Invitrogen). Selected clones were sequenced to ensure the fidelity of the desired nucleotide sequence. The nomenclature used to identify the various chimeras is based on the presence of seven tandem repeats in the amino-terminal half of alpha IIb (31). The sense primers used for the polymerase chain reactions were as follows: R2-H, GGAGTACTCGGCGCGGCGCCCGCTTTGGAGCTCAGC; R3-H, GGACACGTGCCACAAAAGGGTACCGGGGCGGTACGT; R4-H, CTGGTAGTAGGAATCCAAAATTTCCACCGCTCCCAA; H2-R, GCTGAGCTCCAAAGCGGGCGCCGCGCCGCGTACTCC; H3-R, ACGTACCGCCCCGGTACCCTTTTGTGGCACGTGTCC; and H4-R, TTGGGAGCGGTGGAAATTTTGGATTCCTACTACCAG. The sequences of the primers 3' to the ClaI site in human and rat alpha IIb were GCTGCAGCTCGGCATTTAGG and CTTCAGTGTGGGATTCAG, respectively.

Stable Expression of alpha IIbbeta 3 in Chinese Hamster Ovary (CHO)1 Cells-- CHO cells were cultured in Ham's F-12 medium (Life Technologies, Inc.) supplemented with 10% fetal bovine serum (Hyclone Laboratories). cDNAs encoding human beta 3 and either human or rat alpha IIb were subcloned into pcDNA3.1(+)-Zeo and pcDNA3.1(+)-Neo, respectively, and were introduced into the CHO cells using FUGENE 6 (Roche Molecular Biochemicals) according to the manufacturer's instructions. Two days after transfection, the cells were transferred to selection medium containing 500 µg/ml G418 (Life Technologies, Inc.) and 300 µg/ml Zeocin (Invitrogen). After 3 weeks of selection, alpha IIbbeta 3 expression was assessed by flow cytometry using P34, a mAb that recognizes both rat and human alpha IIbbeta 3 (a gift from Dr. H. Miyazaki, Kirin Brewery, Gunma, Japan). The cells were then sorted by fluorescence-activated cell sorting to obtain cell lines expressing high levels of alpha IIbbeta 3 as previously described (21).

Fibrinogen Binding to CHO Cells Expressing alpha IIbbeta 3-- To measure fibrinogen binding to alpha IIbbeta 3 on the transfected CHO cells, purified human fibrinogen was labeled with fluorescein isothiocyanate (FITC) using a Calbiochem FITC labeling kit as described by the manufacturer. Fibrinogen labeled in this manner was monomeric as assessed by gel-filtration chromatography, supported platelet aggregation as well as unlabeled fibrinogen, and was 95% clottable with thrombin (32). 1.5 × 105 CHO cells, suspended in 100 µl of 10 mM sodium phosphate buffer (pH 7.4) containing 137 mM NaCl, 1 mM CaCl2, and 1% bovine serum albumin, were then incubated with 200 µg/ml FITC-fibrinogen and 5 mM dithiothreitol (DTT) for 30 min at 37 °C (33, 34). The cells were washed once with the suspension buffer and fixed with 0.37% formalin. The amount of FITC-fibrinogen bound was determined by flow cytometry as described previously (21). Specific fibrinogen binding represented the difference in fluorescence of transfected and untransfected cells incubated with FITC-fibrinogen in the presence of DTT minus the fluorescence of transfected cells incubated with FITC-fibrinogen in the absence of DTT. The ability of RGDS to inhibit fibrinogen binding was determined by adding increasing concentrations of the tetrapeptide to the 30-min incubation.

Adhesion of B Lymphocytes Expressing alpha IIbbeta 3 to Immobilized Fibrinogen-- alpha IIb and beta 3 were expressed in human B lymphocytes as previously described (35). Briefly, pREP vectors containing rat or human alpha IIb and beta 3 cDNAs were introduced into 7.5 × 106 GM1500 B lymphocytes by electroporation (250 V and 960 microfarads). Stable transfectants were selected using G418 and hygromycin, and the amount of alpha IIbbeta 3 on the lymphocyte surface was quantified by flow cytometry using mAb P34. To measure alpha IIbbeta 3-mediated lymphocyte adherence to fibrinogen, the wells of Immulon-2 flat-bottom microtiter plates (Dynatech Laboratories Inc.) were coated with 50 µg/ml purified human fibrinogen in 50 mM NaHCO3 buffer (pH 8.0) containing 150 mM NaCl. Unoccupied protein-binding sites on the wells were blocked with 5 mg/ml bovine serum albumin dissolved in the same buffer. 1.5 × 105 B lymphocytes, metabolically labeled overnight with [35S]methionine, were suspended in 100 µl of 50 mM Tris-HCl buffer (pH 7.4) containing 150 mM NaCl, 0.5 mM CaCl2, 0.1% glucose, and 1% bovine serum albumin and added to the protein-coated wells, in either the presence or absence of 200 ng/ml phorbol myristate acetate. Following incubation at 37 °C for 30 min without agitation, the plates were washed four times with the lymphocyte suspension buffer, and adherent cells were dissolved using 2% SDS. The SDS solutions were then counted for 35S in a liquid scintillation counter. The ability of RGDS to inhibit lymphocyte adhesion to immobilized fibrinogen was determined by adding increasing concentrations of the tetrapeptide to the 30-min incubation.

Induction of mAb Binding to beta 3by RGDS-- To measure the RGDS-induced binding of the conformation-specific mAb 10-758 to human beta 3 (36), 1.5 × 105 CHO cells expressing human alpha IIbbeta 3 and hybrids of rat alpha IIb and human beta 3 were incubated with 0.3 mM RGDS and a 1:100 dilution of mAb 10-758 for 30 min at 37 °C. The cells were then washed once and incubated with a 1:10 dilution of FITC-labeled goat anti-mouse IgG for an additional 30 min. Antibody binding was detected using flow cytometry.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Effect of RGDS on the ADP-stimulated Aggregation of Human and Rat Platelets-- To confirm the reported insensitivity of rat platelets to the inhibitory effects of RGD-containing peptides (22), we compared the ability of the tetrapeptide RGDS to inhibit the ADP-stimulated aggregation of gel-filtered human and rat platelets. Although neither human nor rat platelets aggregated in the absence of added fibrinogen (data not shown), ADP-stimulated platelets of both species aggregated readily in the presence of either human or rat fibrinogen (Fig. 1). Furthermore, whereas the tetrapeptide RGES had no effect on the aggregation of platelets of either species, the aggregation of human platelets was partially inhibited by 10 µM RGDS and completely inhibited by 100 µM RGDS. In contrast, concentrations of RGDS as great as 1 mM had no effect on the aggregation of rat platelets. Thus, these experiments confirm the difference in sensitivity of human and rat platelets to RGD-containing peptides and indicate that this difference is due to a difference between human and rat platelets and not to a difference between human and rat fibrinogen.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 1.   Effect of the tetrapeptides RGDS and RGES on the ADP-stimulated aggregation of human and rat platelets. Gel-filtered human and rat platelets were suspended in buffer containing 1 mM CaCl2 and either 200 µg/ml human or rat fibrinogen. Turbidometric platelet aggregation was stimulated by 20 µM ADP and measured in the presence of 0.1 and 1 mM concentrations of either RGDS or RGES.

One explanation for the insensitivity of rat platelets to RGDS is simply that the affinity of alpha IIbbeta 3 on rat platelets for fibrinogen is greater than that of alpha IIbbeta 3 on human platelets. To address this possibility, we measured the affinity of alpha IIbbeta 3 on human and rat platelets using 125I-labeled fibrinogen (24). We found that the Kd for fibrinogen binding to alpha IIbbeta 3 on human platelets was (1.32 ± 0.12) × 10-7 (n = 21), compared with a Kd of (2.31 ± 0.45) × 10-7 (n = 3) for fibrinogen binding to alpha IIbbeta 3 on rat platelets. Thus, these measurements indicate that a difference in the affinity of human and rat alpha IIbbeta 3 for fibrinogen cannot account for the difference in sensitivity of human and rat platelets to RGDS.

Effect of RGDS on Fibrinogen Binding to Human-Rat alpha IIbbeta 3 Hybrids Expressed in CHO Cells-- We next sought a molecular basis for the difference in sensitivity of human and rat platelets to RGDS by expressing alpha IIbbeta 3 heterodimers composed of human and rat subunits in CHO cells. As shown by the flow cytometry histograms in Fig. 2, comparable amounts of each of the four possible combinations of human and rat alpha IIb and beta 3 were expressed on the CHO cell surface.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2.   Expression of human, rat, and human-rat hybrid alpha IIbbeta 3 on the surface of transfected CHO cells. CHO cells were cotransfected with plasmids containing cDNAs for either human or rat alpha IIb and human or rat beta 3 as described under "Experimental Procedures." The level of alpha IIbbeta 3 expression by the resulting cells lines was assessed by flow cytometry using P34, a mAb that recognizes both rat and human alpha IIbbeta 3, as well as a class-matched control antibody. H/H, human alpha IIb/human beta 3; H/R, human alpha IIb/rat beta 3; R/H, rat alpha IIb/human beta 3; R/R, rat alpha IIb/rat beta 3.

Because alpha IIbbeta 3 expressed in CHO cells cannot be activated by cellular agonists, ligand binding is usually induced using "activating" mAbs (37). These antibodies generally do not bind to rat alpha IIbbeta 3. Consequently, we induced fibrinogen binding to alpha IIbbeta 3 in our CHO cell lines by incubating the cells with DTT, based on previous reports that DTT induces fibrinogen binding to alpha IIbbeta 3 on platelets (33, 34). To confirm that the fibrinogen binding induced by DTT is indeed comparable to that induced by activating mAbs, we incubated CHO cells expressing human alpha IIbbeta 3 with 5 mM DTT and with the activating mAb PT25-2 and measured FITC-fibrinogen binding to the incubated cells using flow cytometry. As shown by the histograms in Fig. 3, fibrinogen binding induced by DTT and mAb PT25-2 was indistinguishable. Moreover, the fibrinogen binding induced by either agent was inhibited by the alpha IIbbeta 3-specific mAb A2A9, confirming that the fibrinogen was bound to alpha IIbbeta 3.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 3.   Comparison of mAb PT25-2-induced and DTT-induced FITC-fibrinogen binding to CHO cells expressing human alpha IIbbeta 3. CHO cells stably expressing human alpha IIbbeta 3 were incubated either with the alpha IIbbeta 3-activating mAb PT25-2 at 10 µg/ml (A) or with 5 mM DTT (B) for 30 min at 37 °C in the presence of 200 µg/ml FITC-fibrinogen and 1 mM CaCl2. The extent of FITC-fibrinogen binding was then measured by flow cytometry. The specificity of fibrinogen binding induced by mAb PT25-2 and DTT was assessed by adding the alpha IIbbeta 3-inhibiting mAb A2A9 to the incubations.

The effect of RGDS on fibrinogen binding to the cell lines shown in Fig. 2 was studied by adding increasing concentrations of the tetrapeptide to the fibrinogen binding assays. The results of these experiments are shown in Fig. 4. As expected, fibrinogen binding to cells expressing human alpha IIbbeta 3 was relatively sensitive to inhibition by RGDS, whereas fibrinogen binding to cells expressing rat alpha IIbbeta 3 was relatively resistant. However, to our surprise, based on the observation that RGD-containing peptides cross-link to the amino terminus of beta 3 (10), we found that fibrinogen binding to cells expressing alpha IIbbeta 3 containing a rat alpha -subunit and a human beta -subunit was resistant to RGDS, whereas fibrinogen binding to cells expressing alpha IIbbeta 3 containing a human alpha -subunit and a rat beta -subunit was sensitive. The IC50 values (concentrations of RGDS that inhibited fibrinogen binding by 50%) for RGDS, calculated from semilog plots of the binding data, were 1.65 and 2.07 mM for cells expressing rat alpha IIbbeta 3 and rat alpha IIb/human beta 3, compared with 0.04 and 0.01 mM for cells expressing human alpha IIbbeta 3 and human alpha IIb/rat beta 3 (Table I), respectively.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 4.   Effect of RGDS on DTT-stimulated FITC-fibrinogen binding to CHO cells expressing human and rat alpha IIbbeta 3. CHO cell lines stably expressing the four possible combinations of human and rat alpha IIb and beta 3 were incubated with 5 mM DTT in the presence of 200 µg/ml FITC-fibrinogen, 1 mM CaCl2, and increasing concentrations of the tetrapeptide RGDS for 30 min at 37 °C. The extent of FITC-fibrinogen binding was measured by flow cytometry. Solid circles, human alpha IIb/human beta 3 (H/H); shaded circles, human alpha IIb/rat beta 3 (H/R); solid squares, rat alpha IIb/rat beta 3 (R/R); shaded squares, rat alpha IIb/human beta 3 (R/H). The data shown are the means ± S.E. of nine (human alpha IIb/human beta 3 and rat alpha IIb/rat beta 3) and three (human alpha IIb/rat beta 3 and rat alpha IIb/human beta 3) experiments.


                              
View this table:
[in this window]
[in a new window]
 
Table I
Inhibition of fibrinogen binding to human alpha IIbbeta 3 and to human-rat chimeras by the tetrapeptide RGDS

Effect of RGDS on the Adhesion of B Lymphocytes Expressing alpha IIbbeta 3 to Immobilized Fibrinogen-- To rule out the possibility that the observed differences in sensitivity to RGDS were due to differences in the response of human and rat alpha IIb to DTT, we expressed the four combinations of human and rat alpha IIb and beta 3 in the B lymphocyte cell line GM1500 (35). Flow cytometry of the transfected cells using mAb P34 indicated that each of the combinations of human and rat alpha IIb and beta 3 was expressed to a comparable extent on the lymphocyte surface (data not shown). We then measured the effect of RGDS on phorbol 12-myristate 13-acetate-stimulated lymphocyte adhesion to immobilized fibrinogen. As shown in Fig. 5, we found that lymphocytes expressing alpha IIbbeta 3 heterodimers containing an alpha -subunit of human origin were approx 20-fold more sensitive to the inhibitory effect of RGDS than lymphocytes expressing heterodimers containing an alpha -subunit of rat origin. Thus, these experiments confirm that the difference in sensitivity of human and rat alpha IIbbeta 3 to RGD-containing peptides can be attributed to structural differences between human and rat alpha IIb.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of RGDS on the phorbol 12-myristate 13-acetate-stimulated adhesion of B lymphocytes expressing human and rat alpha IIbbeta 3 to immobilized fibrinogen. 1.5 × 105 GM1500 B lymphocytes stably expressing the four possible combinations of human and rat alpha IIb and beta 3 and metabolically labeled with [35S]methionine were added to the wells of microtiter plates coated with purified human fibrinogen. Following the addition of increasing concentrations of the tetrapeptide RGDS, lymphocyte adhesion to the immobilized fibrinogen was induced by stimulating the cells with 200 ng/ml phorbol 12-myristate 13-acetate, and the extent of cell adhesion was measured as described under "Experimental Procedures." Solid circles, human alpha IIb/human beta 3 (H/H); shaded circles, human alpha IIb/rat beta 3 (H/R); solid squares, rat alpha IIb/rat beta 3 (R/R); shaded squares, rat alpha IIb/human beta 3 (R/H). The data shown are the means of measurements made in triplicate and are representative of three experiments.

Localization of the alpha IIb Regions Regulating Sensitivity to RGDS Using Human-Rat alpha IIb Chimeras-- The amino-terminal portion of alpha IIb consists of seven tandem repeats, each of which contains ~60 amino acids (31). To localize the sites in alpha IIb that regulate sensitivity to RGDS, we exchanged the amino-terminal repeats of rat alpha IIb for the human repeats and vice versa, making use of a conserved ClaI restriction site. The alpha IIb chimeras were then coexpressed with human beta 3 in CHO cells, and the ability of RGDS to inhibit the binding of FITC-fibrinogen to the chimeras was tested. As shown in Fig. 6, chimeras in which the seven amino-terminal repeats of alpha IIb were of human origin were sensitive to RGDS, whereas chimeras in which the seven amino-terminal repeats were of rat origin were resistant. Thus, these experiments indicate that the sequences regulating the sensitivity of alpha IIbbeta 3 to RGDS are located in the seven amino-terminal repeats of alpha IIb.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 6.   Effect of exchanging the amino-terminal halves of human and rat alpha IIb on the ability of RGDS to inhibit FITC-fibrinogen binding to alpha IIbbeta 3. CHO cells stably coexpressing human beta 3 and chimeras of human and rat alpha IIb in which the seven amino-terminal repeats had been exchanged were incubated with 5 mM DTT in the presence of 200 µg/ml FITC-fibrinogen, 1 mM CaCl2, and increasing concentrations of the tetrapeptide RGDS for 30 min at 37 °C. The extent of fibrinogen binding was then measured using flow cytometry. Solid circles, an alpha IIb chimera containing the seven amino-terminal repeats of human alpha IIb (H1-7-R); shaded circles, an alpha IIb chimera containing the seven amino-terminal repeats of rat alpha IIb (R1-7-H). The data shown are the means ± S.E. of four (R1-7-H) and six (H1-7-R) experiments.

Identification of Specific Regions of the Amino Terminus of alpha IIb That Regulate Sensitivity to RGDS-- To further localize the sequences that regulate the sensitivity of alpha IIbbeta 3 to RGDS, we replaced the first two, three, and four amino-terminal repeats of rat alpha IIb with the corresponding human sequences. The resulting chimeric alpha -subunits were coexpressed with human beta 3 in CHO cells, and the ability of RGDS to inhibit FITC-fibrinogen binding to each cell line was measured. As shown in Fig. 7A, when the first four repeats of rat alpha IIb were replaced by the human sequences, the resulting alpha IIbbeta 3 heterodimer was sensitive to RGDS. In contrast, when only the first two repeats were of human origin, the alpha IIbbeta 3 chimera was resistant. A chimera in which the first three repeats were of human origin was of intermediate sensitivity. Thus, these data indicate that sequences regulating the response of alpha IIbbeta 3 to RGDS are located in the third and fourth amino-terminal repeats of alpha IIb.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7.   Effect of RGDS on DTT-stimulated FITC-fibrinogen binding to alpha IIbbeta 3 composed of human beta 3 and chimeras of human and rat alpha IIb. Chimeric human and rat alpha IIb subunits in which the first and second, first through third, and first through fourth amino-terminal repeats had been replaced with those of the other species were stably coexpressed with human beta 3 in CHO cells as described under "Experimental Procedures." The effect of RGDS on FITC-fibrinogen binding to the resulting cells lines was measured as described in the legends to Figs. 4 and 6. A, the amino-terminal repeats of rat alpha IIb were replaced by the corresponding human repeats. Solid circles, first through fourth repeats (H1-4-R/H); shaded circles, first through third repeats (H1-3-R/H); open circles, first and second repeats (H1-2-R/H). B, the amino-terminal repeats of human alpha IIb were replaced by the corresponding rat repeats. Solid circles, first and second repeats (R1-2-H/H); shaded circles, first through third repeats (R1-3-H/H). The data shown are the means ± S.E. of three experiments.

To confirm this conclusion, we made the reciprocal exchanges. However, although human alpha IIb in which the first and second repeats and the first through third repeats were replaced by the corresponding rat sequences readily coexpressed with human beta 3 on the CHO cell surface, alpha IIb in which the first through fourth repeats were of rat origin was never expressed to a level sufficient to measure fibrinogen binding. Nonetheless, as shown in Fig. 7B, replacing the first and second human repeats with the corresponding rat sequence had no effect on the sensitivity of alpha IIbbeta 3 to RGDS, and a chimera in which the first through third repeats were exchanged was only slightly less sensitive. Thus, these results are consistent with those shown in Fig. 7A.

The IC50 values for RGDS inhibition of fibrinogen binding to the various cell lines, as well as a relative RGDS resistance index derived by normalizing the IC50 values to that for human alpha IIbbeta 3, are shown in Table I. This analysis verifies that the locus for sensitivity to RGDS is located in alpha IIb and that the relevant sequences are present in its third and fourth amino-terminal repeats.

Induction of mAb Binding to beta 3by RGDS-- Based on these data, there are two possible ways in RGDS could inhibit fibrinogen binding to alpha IIbbeta 3. First, it is possible that RGDS binds to the third and fourth amino-terminal repeats of alpha IIb and directly competes with fibrinogen for binding to this site. Second, it is possible that RGDS binds elsewhere in alpha IIbbeta 3 and exerts an allosteric effect on the third and fourth amino-terminal repeats of alpha IIb, thereby inhibiting fibrinogen binding. Binding of RGD-based peptides and peptidomimetics to alpha IIbbeta 3 has been shown to induce the expression of epitopes for a number of anti-alpha IIb and anti-beta 3 mAbs (36). Therefore, to differentiate between the two possibilities discussed above, we measured the ability of RGDS to induce the binding of the human beta 3-specific mAb 10-758 to RGDS-sensitive human alpha IIbbeta 3, to RGDS-resistant rat alpha IIb/human beta 3, and to RGDS-resistant alpha IIbbeta 3 in which the amino-terminal half of alpha IIb was of rat origin. As shown in Fig. 8, 0.3 mM RGDS induced mAb 10-758 binding to each form of alpha IIbbeta 3. We conclude from these data that RGDS bound to each form of alpha IIbbeta 3, a result consistent with the possibility that RGDS inhibits fibrinogen binding to alpha IIbbeta 3 by inducing an allosteric change in the third and fourth amino-terminal alpha IIb repeats.



View larger version (9K):
[in this window]
[in a new window]
 
Fig. 8.   RGDS induction of mAb 10-758 binding to alpha IIbbeta 3 containing either a human or rat alpha -subunit. 1.5 × 105 CHO cells coexpressing human alpha IIb with human beta 3 (H/H), rat alpha IIb with human beta 3 (R/H), and an alpha IIb chimera composed of the amino-terminal half of rat alpha IIb and the carboxyl-terminal half of human alpha IIb with human beta 3 (R1-7-H/H) were incubated with 0.3 mM RGDS and a 1:100 dilution of mAb 10-758 or a class-matched control antibody for 30 min at 37 °C. The cells were then incubated with a 1:10 dilution of FITC-labeled goat anti-mouse IgG for an additional 30 min. Antibody binding was assessed by flow cytometry.



    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Although fibrinogen appears to bind to alpha IIbbeta 3 exclusively via sequences located at the carboxyl-terminal end of the fibrinogen gamma -chain (5, 6), peptides containing an RGD motif are competitive inhibitors of fibrinogen binding to alpha IIbbeta 3 (4). Moreover, despite chemical cross-linking experiments suggesting that the gamma -chain and RGD-containing peptides bind to different subunits of the alpha IIbbeta 3 heterodimer (16, 38), competitive binding measurements indicate that the peptides bind to alpha IIbbeta 3 in a mutually exclusive manner (39), implying either that the peptides bind to same site or that the binding sites interact allosterically. Hu et al. (40), using plasmon resonance spectroscopy to study the effect of RGD ligands on fibrinogen binding to alpha IIbbeta 3, concluded that fibrinogen and RGD ligands bind to separate sites on alpha IIbbeta 3, but suggested that there is an allosteric relationship between the two. Using chimeras of RGD-insensitive rat alpha IIbbeta 3 and RGD-sensitive human alpha IIbbeta 3, we found that sensitivity to the inhibitory effects of the tetrapeptide RGDS was determined by the origin of the third and fourth amino-terminal repeats of alpha IIb. We also found little difference in the affinity of alpha IIbbeta 3 on human and rat platelets for fibrinogen. Thus, our data suggest that rather than directly affecting fibrinogen binding, species differences in the third and fourth alpha IIb repeats affect an allosteric change that regulates fibrinogen binding to alpha IIbbeta 3.

Ligand binding to alpha IIbbeta 3 is thought to involve regions located in the amino-terminal portions of both alpha IIb and beta 3 (8), although much of this evidence is indirect. The beta 3 region encompasses amino acids 95-223 (9) and includes the RGD-cross-linking site located in the vicinity of amino acids 109-171 (38) as well as an array of oxygenated residues whose fold may resemble that of the ligand-binding metal ion-dependent adhesion sites (MIDAS) present in integrin I domains (11). It is noteworthy that the deleterious effect of an Arg214 right-arrow Trp mutation, located in the midst of this sequence, can be reversed by exposing alpha IIbbeta 3 to DTT, suggesting that the presence of Trp at residue 214 does not prevent fibrinogen binding to alpha IIbbeta 3 directly, but rather obscures the fibrinogen-binding site (41).

It is also noteworthy that the location of the binding site for RGD-containing peptides in integrins is uncertain, and there is evidence for binding sites in both alpha - and beta -subunits. For example, proteins corresponding to the fourth through seventh amino-terminal repeats of alpha 5 and alpha IIb bind to fibronectin III fragment-(8-10) and to fibrinogen, respectively, in an RGD- dependent manner (42, 43). Conversely, experiments using chemical and photoaffinity cross-linking, site-directed mutagenesis, synthetic integrin and RGD-containing peptides, and mAbs have identified regions in the amino-terminal portion of beta 1- and beta 3-subunits that recognize the RGD motif (11, 38, 44-46). Based on these observations, one possible explanation for our results is simply that RGDS does not bind to either rat alpha IIb or rat beta 3. However, we found that first, the sensitivity of alpha IIbbeta 3 composed of human subunits or of a human alpha -subunit and rat beta -subunit to RGDS was equivalent, and second, binding of mAb 10-758 to human beta 3 was induced by RGDS to an equal extent regardless of whether alpha IIb was human, rat, or a human-rat chimera. Thus, our data imply that RGDS binds to both human and rat alpha IIbbeta 3 and that differences in its inhibitory potency are due to differences in allosteric events that follow RGDS binding.

The portion of alpha IIb implicated in ligand binding has also been localized to the amino-terminal third of the molecule (15) and includes the fibrinogen gamma -chain peptide-cross-linking site at amino acids 294-314 (16). In addition, a number of naturally occurring and laboratory-induced mutations involving amino acids 145, 183, 184, 189, 190, 191, 193, and 224 have been described that impair alpha IIbbeta 3 function, suggesting that these residues interact with alpha IIbbeta 3 ligands (18-20). Of note, residues 183-224 are located in the third alpha IIb repeat (25). Because our data suggest that the third repeat is involved in the allosteric regulation of fibrinogen binding to alpha IIbbeta 3, it is possible that mutation of the residues listed above interferes with this allosteric change, rather than directly perturbing the fibrinogen-binding site.

The tertiary structure of integrins has yet to be determined. Based on computer modeling, Springer (31) proposed that the amino-terminal portion of integrin alpha -subunits folds into a seven-bladed beta -propeller configuration, with each of the blades corresponding to a beta -sheet formed from four anti-parallel beta -strands located within each of the amino-terminal repeats. Loops connecting the beta -strands would be located on either the upper or low surface of the proposed propeller such that residues in three loops in human alpha IIb between Arg147 and Tyr166, Val182 and Leu195, and His215 and Gly233, connecting portions of the third and fourth propeller blades, would be juxtaposed in one quadrant of the upper surface of the propeller (21). Comparison of the amino acid sequence of the loops in human alpha IIb with that of the analogous portions of rat alpha IIb (47) indicates that the putative second loop is fully conserved, whereas the first and third loops would be only 50% homologous. Thus, it is possible that amino acid sequence differences between human and rat alpha IIb in the putative first and third loops could be responsible for the differences in sensitivity of human and rat alpha IIbbeta 3 to RGD-containing peptides.

Alterations in the tertiary and/or quaternary structure of integrins regulate their affinity, and possibly their avidity, for ligands. Recent nuclear magnetic resonance spectroscopic and x-ray crystallographic studies of the I domain of alpha L emphasize the importance of changes in the conformation of the alpha -subunit amino terminus in integrin function (48, 49). I domains are present in nine integrin alpha -subunits, where they are inserted between the second and third amino-terminal repeats (49). In alpha L and alpha M, ligands such as ICAM-1-3 (intercellular adhesion molecule) bind to a divalent cation-containing MIDAS motif on the upper I domain surface (50-53). In the I domain of alpha L, residues distal to the MIDAS motif, lining a cleft formed by the seventh alpha -helix and the central beta -sheet, regulate ligand binding to alpha Lbeta 2 allosterically (49) and constitute the binding site for the alpha Lbeta 2 inhibitor lovastatin (48). In addition, mutations in the amino- and carboxyl-terminal linker sequences that connect the I domain to the rest of alpha L either activate or inactivate I domain function (49), implying that the changes in I domain conformation that regulate its function are transmitted from the amino-terminal portion of alpha L to the I domain via these sequences. In the case of alpha IIbbeta 3, agonist-induced changes in tertiary structure are essential for its function (2). Our results indicate that an allosteric change in the third and fourth amino-terminal repeats of alpha IIb, a portion of alpha IIb located immediately downstream from the I domain insertion site in I domain-containing integrins, regulates ligand binding to alpha IIbbeta 3. Thus, by extrapolation, our data suggest that allosteric changes involving the third and fourth alpha -subunit repeats may be a general mechanism by which ligand binding to integrins is regulated.


    ACKNOWLEDGEMENTS

We thank Dr. H. Miyazaki for providing mAb P34 and Dr. Bohumil Bednar (Merck Research Laboratories) for providing mAb 10-758.


    FOOTNOTES

* This work was supported in part by Grant HL40387 from the National Institutes of Health (to J. S. B. and M. P.) and by a generous contribution from the Plummer Family (to M. P.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

** To whom correspondence should be addressed: Children's Hospital of Philadelphia, 34th St. and Civic Center Blvd., Philadelphia, PA 19104. Tel.: 215-590-3574; Fax: 215-590-3889; E-mail: poncz@email.chop.edu.

Published, JBC Papers in Press, January 18, 2001, DOI 10.1074/jbc.M011511200


    ABBREVIATIONS

The abbreviations used are: CHO, Chinese hamster ovary; mAb, monoclonal antibody; FITC, fluorescein isothiocyanate; DTT, dithiothreitol.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES


1. Hynes, R. O. (1987) Cell 48, 549-554
2. Bennett, J. S. (1996) Trends Cardiovasc. Med. 16, 31-36
3. Kloczewiak, M., Timmons, S., and Hawiger, J. (1982) Biochem. Biophys. Res. Commun. 107, 181-187
4. Gartner, T. K., and Bennett, J. S. (1985) J. Biol. Chem. 260, 11891-11894
5. Weisel, J. W., Nagaswami, C., Vilaire, G., and Bennett, J. S. (1992) J. Biol. Chem. 267, 16637-16643
6. Farrell, D. H., and Thiagarajan, P. (1994) J. Biol. Chem. 269, 226-231
7. Lefkovits, J., Plow, E., and Topol, E. (1995) N. Engl. J. Med. 332, 1553-1559
8. Puzon-McLaughlin, W., Kamata, T., and Takada, Y. (2000) J. Biol. Chem. 275, 7795-7802
9. Lin, E. C. K., Ratnikov, B. I., Tsai, P. M., Carron, C. P., Myers, D. M., Barbas, C. F., III, and Smith, J. W. (1997) J. Biol. Chem. 272, 23912-23920