 |
INTRODUCTION |
Regulated gene expression is mediated by the combinatorial
interactions of multiple cis-elements in the gene's
promoter. Specific binding of transcriptional factors to the cognate
cis-elements constitute a crucial step in transcription
initiation and, in turn, on the spatial and temporal expression of genes.
Seed storage protein genes provide a model system for the study on the
regulatory mechanisms of plant genes (1), since their expression is
restricted to a specific tissue and stage during seed development.
These specific temporal and spatial expression patterns may be
explained as the result of regulatory assemblies of several
transcriptional activators that recognize the cis-elements implicated in seed-specific expression. Therefore, to understand such
molecular mechanisms, characterization of cis-elements and transcription factors has been performed on many storage protein genes
of several crop plants (2, 3). Despite numerous studies, the mechanism
by which these genes are regulated are poorly understood, since many of
the essential cis-elements have not been identified. This is
especially true in the case of monocot plants, where many of the
promoter analyses of cereal storage protein genes have carried out by
transient assays using particle bombardment or heterologous transgenic
tobacco system (4-6). Dissection analyses of promoter using homologous
stable transgenic plant have been carried out only on glutelin genes of
the rice (7-9).
Endosperm-specific expression of cereal storage protein genes is
regulated by the combinatorial interactions of several
cis-elements (3). Prolamin box (TGTAAAG), GCN4 motif
(TGA(G/C)TCA), AACA motif (AACAAAA), and ACGT motif, which are
conserved in many promoters of cereal seed storage protein genes, have
been characterized as cis-elements involved in
endosperm-specific expression by loss-of-function and gain-of-function
experiments (3).
The GCN4 motif is widely distributed in many promoters of not only seed
storage protein genes but also genes that code for metabolic enzymes
(4). It has been recently demonstrated that it acts as a key element
controlling the endosperm-specific expression. Multimers of the rice
glutelin GCN4 motif can direct endosperm-specific expression in stable
transgenic rice. In contrast, deletion or base substitution of the GCN4
motif in the rice glutelin promoter reduces promoter activity and
alters gene expression pattern (8). The GCN4 motif is often linked
together with the prolamin box (TGTAAAG), which are separated by a few
nucleotides. The two motifs collectively constitute the so called
bifactorial endosperm box found in nearly all cereal prolamin genes
such as wheat glutenin, barley hordein, rye secalin, sorghum kafirin,
and Coix coixin (4, 10, 11). In most rice glutelin genes,
these two motifs are also associated with the AACA motif (12).
Gain-of-function experiments showed that combinations of two motifs
(GCN4 motif and prolamin box, GCN4 motif and AACA motif) are not
sufficient to confer endosperm-specific expression, suggesting that
participation of additional element is required to form a functional
complex of trans-acting factors (6, 13). It has been
recently demonstrated in the rice glutelin GluB-1 gene that
at least three cis-elements containing the GCN4, ACGT, and
AACA motifs within the
197
bp1 proximal promoter are
required as minimal elements to direct endosperm-specific expression
(8, 9).
Maize Opaque-2 (O2) is an endosperm-specific transcription factor
belonging to the basic leucine zipper (bZIP) family that has been shown
to bind to the ACGT motif of maize 22-kDa
-zein promoter and
activates transcription (14). It has been also reported to be involved
in activation of endosperm-specific transcription of b32
ribosome-inactivating protein gene via a distinct
cis-sequence (G(a/t)TGAPyPuTGPu) (15), thus indicating that
the O2 has broad binding specificity. The GCN4 motif has been reported
to be recognized by the O2, resulting in the activation of
transcription (8, 10, 15). In vivo foootprinting of the
promoter region of wheat low molecular weight glutenin (16) and maize
-zein genes (6) in developing endosperm revealed that the region
covering the GCN4 motif and prolamin box are occupied by nuclear
proteins from maturing seeds. In vitro DNase I footprinting
with nuclear proteins from rice maturing seeds and GST-O2 fusion
protein also showed that the sequence covering the GCN4 motif in the
promoter of glutelin genes is specifically protected from DNase I
digestion (8, 17). These findings suggest that O2-like transcription
factor may exist and participate in controlling the endosperm-specific expression of many storage protein genes in cereal seed through the
GCN4 motif.
The cDNA clones encoding transcription factor recognizing the GCN4
motif have been recently isolated and characterized in wheat (5) and
barley (18, 19). These transcription factors, designated SPA, BLZ1, and
BLZ2, transcriptionally activate expression of the storage protein
genes by interacting with the GCN4 motif in the wheat low molecular
weight glutenin and barley B1-hordein promoters. It is interesting to
note that they are expressed in seed-specific manner. cDNA clones
encoding primary sequences showing high homology to the basic domain of
O2 have been also isolated from rice (20, 21), although it has not yet
been examined whether they are involved in transcriptional activation
of storage protein genes through the GCN4 motif. The RITA-1
gene is highly expressed in aleurone and endosperm tissue during seed
maturation (20). The REB cDNA, which shares high homology to maize
Opaque-2 heterodimerizing protein (OHP) (22)and barley BLZ1(18),
specifically binds to the GCCACGT(c/a)AG sequence, designated G/C and
A/G hybrid box, in the
-globulin promoter (21).
It has recently been reported that maize O2, barley BLZ2, and wheat SPA
interact in vitro with another endosperm-specific transcription factor of the Dof class containing a single highly conserved zinc finger DNA binding domain that recognizes the prolamin box motif (11, 23, 24). Such an interaction has been suggested by the
in vivo footprinting of low molecular weight glutelin
promoter and maize
-zein promoter (6, 24).
In this paper, we screened for cDNA clones coding for bZIP
transcription factors from rice seed cDNA library to determine the
trans-factors responsible for transcriptional activation of storage protein genes through the GCN4 motif. Five types of bZIP proteins were isolated and characterized, two of which are completely identical with the RITA-1 (20) and REB (21) transcription factors. All
of the transcription factors are able to bind to the GCN4 motif in the
sequence-specific manner, but only RISBZ1 exhibits high levels of
transcriptional activation through the GCN4 motif using transient
expression assays. The role of RISBZ1 as an important transcriptional
factor in endosperm-specific regulation of storage protein genes is
further supported by the analyses of stable transgenic rice containing
chimeric genes consisting of the RISBZ1 promoter and GUS
reporter gene. We also show that the N-terminal proline-rich domain of
RISBZ1 is required for transcriptional transactivation.
 |
EXPERIMENTAL PROCEDURES |
Plant Materials--
Rice (Oryza sativa
cv. Mangetsumochi) seeds were germinated in tap water, and 14-day-old
leaves and roots were frozen in liquid nitrogen and stored at
80 °C until used. Maturing seeds were harvested from rice grown in
the field.
Screening of a Rice Seed cDNA
Library--
Poly(A)+ RNA was isolated from maturing rice
seeds harvested 6-16 days after flowering (DAF), as described
previously (25). Single-stranded cDNA was synthesized for 1 h
at 42 °C with SuperScriptTM RNase H
reverse
transcriptase (Life Technologies, Inc.) using oligo(dT) 17 as a primer. This cDNA was used as the initial template in a PCR using a forward primer (TCCAA(C/T)(A/C)GIGA(A/G)(A/T)CIGC) and a
reverse primer (GTCCTC(C/T)GCCATCTTCACCTT), sequences conserved in the
basic domain of bZIP transcription factors expressed in cereal seeds.
The PCR conditions were 94 °C for 5 min, followed by three cycles of
1 min at 94 °C, 1 min at 40 °C, and 2 min at 72 °C and then 30 cycles of 1 min at 94 °C, 1 min at 55 °C, and 2 min at 72 °C.
Amplified fragments were inserted into the TA cloning vector (pCRTM
2.1; Invitrogen) and sequences determined by a ABI PrismTM dye
terminator cycle sequencing kit using the ABI PrismTM 310 genetic
analyzer (PE Applied Biosystems). Sequence analyses and data bank
searches were carried out using GENETYX (Software Development Co.,
Ltd.) and the BLAST algorithms, respectively.
Rice cDNA library constructed from poly(A)+ RNA of
maturing seed (6-16 days after flowering) by ZAP
cDNA® synthesis kit (Stratagene) were screened by five
types of PCR fragments under high stringent condition. These DNA
fragments were labeled by MegaprimeTM DNA labeling system (Amersham
Pharmacia Biotech). Prehybridization was carried out at 42 °C in 5×
SSC, 5× Denhardt's solution, 0.1% SDS, 50% formamide, and 100 µg/ml salmon sperm DNA. The filters were washed twice at 55 °C in
2× SSC and 0.1% SDS and twice at 55 °C in 0.1× SSC and 0.1% SDS.
Cloning of Genomic Sequence of RISBZ1 Gene--
To determine the
genomic sequence coding for full length of RISBZ1 cDNA region, four
primers were devised based on RISBZ1 cDNA sequence. The primers
(RIS1f, 5'-ATGGGTTGCGTAGCCGTAGCT-3'; RELr5,
5'-TTGCTTGGCATGAGCATCTGT-3') were used to amplify the 5' portion of the
exon/intron region. Two other primers (RELf2,
5'-GAGGATCAGGCCCATAT-3'; RIS1r, 5'-TCGCTATATTAAGGGAGACCA-3') were used
for amplification of the 3' portion of the gene. Amplification
reactions were performed using Takara LA Taq (Takara) for 30 cycles at 98 °C for 10 s, at 56 °C for 30 s, and
68 °C for 5 min after incubation at 94 °C for 5 min.
The promoter region of RISBZ1 gene was amplified by
thermal asymmetric interlaced PCR according to the method of Liu
et al. (26). Three oligonucleotides (tail-1,
5'-TGCTCCATTGCGCTCTCGGACGAG; tail-2, ATGAATTCGCGAGGGGTTTTCGA; tail-3,
GTTTGGGAGAAATTCGATCAAATGC) complementary to the sense strand of
5'-untranslated region, were used as the specific primers.
Northern Blot Analysis--
Total RNA from different organs
(roots and seedlings) and developing seeds (from 5 to 30 DAF) was
isolated as described (25). Blots were probed using cDNA-specific
region spanning from downstream of the leucine zipper region to
3'-untranslated regions of individual RISBZ cDNA clones.
Hybridization was carried out at 45 °C in 50% formamide, 5× SSC,
0.1% SDS, and 5× Denhardt's solution, and then filters were washed
four times at room temperature in 2× SSC and 0.1% SDS and twice at
55 °C in 0.1× SSC and 0.1% SDS for 30 min each.
Primer Extension Analysis--
Primer extension analysis was
carried out as described by Sambrook et al. (27). A 30-mer
antisense oligonucleotide (ATGGTATGGTGTTCCTAGCACAGGTGTAGC) was labeled
at the 5' end with T4 polynucleotide kinase and
[
-32P]ATP and then used as a primer for a reverse
transcriptase reaction with poly(A)+ RNA using a
SuperScriptTM RNase H
reverse transcriptase (Life
Technologies, Inc.).
Production of Transgenic Rice Plants--
Transgenic rice
plants (O. sativa cv. Kitaake) were generated by
Agrobacterium tumefaciens-mediated transformation as
described previously (28). The 5'-flanking region of the
RISBZ1 gene, located between positions
1674 and +4 and
between positions
1674 and +213, were amplified by PCR using a
forward and a reverse primers containing overhanging PstI
and BamHI recognition sites, respectively. The PCR fragments
were digested with PstI and BamHI and then
introduced into the corresponding sites of pBI 201. After digestion
with PstI and SacI, the chimeric genes composed
of RISBZ1 promoter and GUS reporter gene was cloned into the
Sse8387I and SacI sites of the binary vector
p8C-Hm containing CaMV 35 S promoter/hygromycin phosphotransferase gene.
Expression of the GST Fusion Protein in Escherichia
coli--
The coding sequences for the five RISBZ cDNAs were
amplified by PCR using forward and reverse primers that yielded the
following restriction sites at the termini: RISBZ1,
BamHI-blunt end; RISBZ2, BamHI-XhoI;
RISBZ3, BamHI-SalI; RISBZ4,
BamHI-SalI; and RISBZ5, BamHI-XhoI, respectively.
After digestion, these cDNAs were inserted into the corresponding
sites of pGEX- 4T-3 GST fusion expression vector (Amersham Pharmacia
Biotch). The GST-RISBZ fusion proteins were expressed and isolated as
described (29). After purification by affinity chromatography, GST
fusion proteins were dialyzed overnight against 20 mM
HEPES-KOH, pH 7.9, 50 mM KCl, 1 mM EDTA, and
10% glycerol.
Electrophoretic Mobility Shift Assay (EMSA)--
A 21-base
complementary single-stranded oligonucleotide from
175 to
155
containing an additional TCGA at the 5' end was synthesized and
annealed. These probes were end-labeled with
[
-32P]dCTP by fill-in reaction with Klenow fragment
and fractionated on 5% polyacrylamide native gel. For the mutant
competitors (M1-M7), 21-bp complementary oligonucleotides with
successive mutations by three bases were synthesized and annealed.
EMSAs were performed by the addition of GST-RISBZ1 fusion protein as
described previously (8, 29).The radioactive probe was incubated with
0.5 µg of GST-RISBZ1 fusion proteins in binding buffer for 20 min at
room temperature. For competition assays, 100-fold molar excess of unlabeled competitor DNAs were added to the binding reaction. The
mixture was loaded onto 5% native polyacrylamide gel in 0.25× TBE
(1×: 89 mM Tris-HCl, pH 8.0, 89 mM boric acid,
2 mM EDTA) buffer at room temperature.
Methylation Interference Experiments--
Methylation
interference experiments were carried out as described by Weinberger
et al. (30). The 5'-flanking region between
245 and +18
was digested with SalI and BamHI and then
end-labeled by fill-in reaction with Klenow fragment and
[
-32P]dCTP, and then methylated by dimethylsulfate.
This fragment was incubated with the GST-RISBZ1 fusion protein and
fractionated by electrophoresis on 5% native acrylamide gel. After
free and protein-bound DNA fragments were purified by DEAE-Sephacel
column chromatography, the fragments were electrophoresed on a 6% DNA sequencing gel containing 7 M urea in parallel with a DNA
sequencing ladder.
In Vitro Translation--
Full-length coding region and
truncated cDNAs covering the basic domain of RISBZ1, RISBZ2, and
RISBZ3 were amplified by PCR using a forward primer containing a 5'
NcoI site and a reverse primer containing a termination
codon and BamHI site. After digestion with NcoI
and BamHI, the amplified DNA fragments were inserted into a
pET-8c vector (Novagen). Translation products were prepared by coupled
in vitro transcription/translation system (TNT®
coupled wheat germ extract system, Promega) according to the manufactururer's instructions and used for gel mobility shift assays.
One microgram of amplified DNA was used to produce full-length RISBZ
proteins and truncated RISBZ proteins. For EMSA, 4 µl of the in
vitro translation products were used in the binding reactions.
Construction of Effector Plasmids--
A progressive deletion
series of the RISBZ1 protein from the N terminus was generated by
PCR-based construction. Forward primers corresponding to positions 41, 81, 121, 161, 201, and 235 residues from the N terminus and a reverse
primer corresponding to the C terminus were used for the PCR. These
primers contained an overhanging NcoI (to restore the AUG
initiation codon) and BamHI site at the 5' ends. After
digestion with NcoI and BamHI, PCR fragments were purified by agarose gel electrophoresis. Resulting DNA fragments were
cloned in pRT100 (31). To construct fusion plasmids with the GAL4
DNA-binding domain (positions 1-147), various N-terminal regions of
the RISBZ1 and RISBZ2 proteins were amplified by PCR with
Pfu Taq polymerase (Stratagene) using a forward
primer and the reverse primer containing a BamHI site and a
termination codon + SacI site at the 5' ends, respectively.
PCR fragments were digested with BamHI and SacI
and then purified by 2% agarose gel. These fragments were fused
in-frame downstream of the GAL4 DNA-binding domain in the p35S-564
vector digested with the same restriction enzymes. Introduction of
site-directed mutations in the N-terminal region of the RISBZ1 was
using a PCR-mediated mutagenesis technique (32). After confirmation by
DNA sequencing, the region between amino acid positions 1 and 57 were
amplified by PCR and inserted downstream of the GAL4 DNA binding domain.
Construction of Reporter Plasmid--
1 × 21-bp, 3 × 21-bp, 5 × 21-bp normal GCN4 and 3 × 21-bp mutant GCN4
motif/GUS reporter genes were constructed as described (8). For
construction of monomer and tetramer of 12 bp of normal GCN4
(GCTGAGTCATGA) and mutant GCN4 (GCTtccTCATGA),
double-stranded oligonucleotides were generated by annealing the 12- and 48-base complementary oligonucleotide pairs containing the sticky
ACGT sequence at the 5' end of the sense strand, respectively. These double-stranded oligonucleotides were inserted into the SalI
and StuI sites of
46 CaMV/GUS reporter gene.
Transient Expression Analysis and Enzyme Assays--
Transient
expression in rice callus protoplasts was performed by electroporation
as described previously (8). GUS activities were measured by
fluorometric quantification of 4-methylumbelliferone produced from the
glucuronide precursor according to Jefferson (33). Protein
concentration was determined by Bradford method using a Bio-Rad kit
using bovine serum albumin as a standard.
Histochemical analysis of GUS gene expression was carried out as
described previously (8).
 |
RESULTS |
Isolation of cDNA Clones Encoding bZIP Transcription Factor
from Rice Seed cDNA Library--
Two degenerate primers, designed
based on the highly conserved amino acid sequences, SNRESA and KVKMAED
of the basic region of various O2-like bZIP transcription factors, were
used for reverse-PCR using poly(A)+ RNA isolated from
developing seeds. The resultant PCR products were cloned into TA
cloning vector (pCRTM 2.1), and insert sequences of more than 50 TA
clones were determined. Based on this analysis the amplified fragments,
213 bp long, could be classified into at least five types. Two
nucleotide sequences were almost identical to those of the basic region
of rice RITA-1 (20) and REB cDNAs (21). The five inserts were then
used as probes for screening a cDNA library prepared from rice
maturing seeds to obtain full-length cDNA sequences. The screening
was carried out under high stringency conditions to isolate the
cDNA clones corresponding to each of cDNA fragments used as a
probe. These cDNAs were designated as RISBZ (rice
seed b-Zipper) 1, RISBZ2, RISBZ3,
RISBZ4, and RISBZ5, respectively, according to degrees of their
sequence homology. The sequences of the full-length RISBZ2 and RISBZ3
cDNAs are identical to REB and RITA1 cDNAs isolated from seed
and leaf cDNA libraries, respectively (20, 21).
Identification of New RISBZ cDNAs--
Three RISBZ cDNAs,
RISBZ1, RISBZ4, and RISBZ5, were characterized in detail. RISBZ1
cDNA is 1742 bp long, excluding the poly(A) tail, and contains an
open reading frame encoding a potential protein of 436 amino acids with
a molecular mass of 46491 Da. RISBZ4 and RISBZ5 have open reading
frames, which encode 278 and 295 amino acid residues, respectively. The
deduced molecular mass of the RISBZ4 and RISBZ5 are 29,383 and 31,925 Da.
The primary sequence deduced from the RISBZ1 cDNA is closely
related to the rice REB (21), maize OHP1 and OHP2 (22), and barley BLZ1
(18) (Fig. 1). The degree of overall
amino acid sequence identity between the rice RISBZ1 was 48.2% for
rice REB, 45.7% for barley BLZ1, and 46.6% for maize OHP1. The basic
and leucine zipper regions showed much higher conservation
(73.7-76.3%). The RISBZ4 and RISBZ5 share 88.8% and 47.6%
homologies with that of RITA-1 (RISBZ3) at the amino acid level. The
degree of homology between RISBZ4 and RISBZ5 proteins is 48.2%. The
RISBZ3, -4, and -5 proteins constitute a unique group within the
O2-like transcription factors reported to date. Taken together, RISBZ
cDNAs isolated from rice seed cDNA library are clearly divided
into two groups based on amino acid sequences (Fig. 1). It should be
noted that the N- and C-terminal regions found in the RISBZ1 and -2 proteins are deleted in the RISBZ3, -4, and -5 proteins, which result
in reduction in size of 100-150 amino acids compared with RISBZ1 or
RISBZ2 (Fig. 2).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 1.
Phylogenetic dendrogram of the deduced amino
acid sequences of RISBZ proteins and O2-like bZIP proteins. To
determine their degree of the relatedness and their evolutionary
relationship, the matrix of the primary sequences was calculated using
the CLUSTAL X program.
|
|

View larger version (111K):
[in this window]
[in a new window]
|
Fig. 2.
Comparison of the primary sequences of RISBZ
proteins with those of other maize O2-related proteins.
Shaded boxes indicate the amino acids that share
more than 50% homology among them. The location of putative nuclear
localization signals (NLS A; SV40-like motif) and serine-rich
phosphorylation site of RISBZ1 protein is indicated by a
double line and dashed
line, respectively. The thick bar
indicates the location of the basic domain, which possess a bipartite
nuclear localization signal (NLS B) structure. Leucine repeats are
indicated by the vertical arrows. Amino acid
sequences on which the primers were devised based for generating rice
bZIP proteins are indicated by horizontal arrows.
BLZ1 (18) and BLZ2 (19) were from barley, O2 (15) and OHP1 (34) from
maize, SPA (5) from wheat, O2-sorg from sorghum (38), and O2-coix from
coixin (39).
|
|
The N-terminal regions of RISBZ1 and RISBZ2 proteins are rich in
prolines (Fig. 2). The N-terminal region (residues 1-60) and the
central part upstream of the basic domain of RISBZ1 and -2 are enriched
in acidic amino acids (Fig. 2). These acidic and proline-rich regions
are found in the other O2-related bZIP proteins. These acidic and
proline-rich domains have been implicated in having a role in
transcriptional activation of many transcription factors.
A putative serine-rich phosphorylation site (SGSS), a potential target
sequence of casein kinase II (34), is found between positions 207 and
210 of the RISBZ1 (Fig. 2). Such sequence is also found in the
corresponding region of the RISBZ2 (SSSS), but is deleted in the other
RISBZ primary sequences (Fig. 2). It has recently been reported that
the corresponding site of the maize O2 is phosphorylated, which results
in a loss of DNA binding activity. Interestingly, the extent of O2
phosphorylation level changes during the day-night cycle (35). Thus,
RISBZ1 and -2 may be phosphorylated by a similar mechanism and covalent
modification of these O2-like proteins may be implicated in the
regulation of target genes.
It has been reported that two nuclear localization signals (NLS),
designated NLS A (SV40-like motif) and NLS B (bipartite motif), are
responsible for the nuclear localization of the maize O2 (36). Similar
nuclear localization sequences are found at the corresponding
positions, 118-135 and 238-257 in the RISBZ1 and 118-135 and
234-254 in the RISBZ2 sequences. Given that RISBZ2, -3, -4, or -5 protein could heterodimerize with other members, they might be able to
localize to nuclei. As shown in Fig. 2, it is interesting to note that
the NLS A-like sequence could not be detected in these RISBZ proteins,
whereas the amino acid sequence in the latter region is well conserved.
Thus, putative NLS B sequence may mainly contribute to nuclear
localization of the RISBZ proteins.
Genomic Structure of the RISBZ1 Gene--
The genomic DNA encoding
the promoter and coding sequences of the RISBZ1 protein was isolated by
PCR-based cloning using specific primers of the RISBZ1 cDNA. Based
on the direct alignment of the cDNA and genomic sequences, the
RISBZ1 gene is composed of six exons ranging in size from 72 to 423 bp and five introns ranging in size from 89 to 1294 bp (Fig.
3). All of exon-intron junction sites
obey the GT/AG rule as identified in other eukaryotic genes.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 3.
Comparison of the genomic organization of
genes encoding O2-like bZIP proteins. The exon/intron regions of
rice RISBZ1, barley BLZ1 (18),
Opaque-2 from coixin (CoixO2) (39), sorghum
(SorgO2) (38), and maize (O2) (37) are shown.
Bold and thin lines denote exons and
introns, respectively. Nucleotide numbers represent the
length of the exons and introns.
|
|
The relative organization of the exons and introns is the same as those
of other O2-like bZIP protein genes characterized to date,
i.e. the number of exons and introns is conserved and individual introns occur at relative the same sites as those of the
maize O2 (37, 14), sorghum O2 (38), coix
O2 (39), and barley Blz1 genes (18) (Fig. 3). It
is interesting to note that the first, third, and fifth introns of the
rice gene are much larger, resulting in the rice RISBZ1 gene
being almost twice the size of the maize O2, although rice
genome size is more than 6-fold smaller than that of maize.
The transcription initiation site was determined by primer extension
analysis using poly(A)+ RNA from maturing seeds. The start
site was mapped at position
254 from the ATG start codon (data not
shown). It is interesting to note that there is a short open reading
frame of 31 amino acids in this 245-bp leader sequence preceding the
actual start codon. Short open reading frame (uORF) are also found at
similar positions in the maize O2 (40), wheat SPA
(5), and barley Blz1 (18) and Blz2 (19), although
there is little homology among them.
In the 5'-flanking region, a putative TATA box is located between
positions
30 and
35 from the site of transcription initiation. Three ACGT motifs are found at
63,
123, and
198 from
transcription initiation site, but candidate cis-elements
for other types of transcription factors such as GCN4 motif or AACA
motif involved in seed-specific expression are not detected. In
contrast, Dof recognition sequences (AAAG) are found at many sites.
Thus, these motifs may be responsible for the spatial and temporal
specific expression of RISBZ1 gene. Given that these ACGT
motifs are target sites of RISBZ1 activator, it is suggested that
transcription of the RISBZ1 is autoregulated. However, when
the chimeric gene consisting of RISBZ1 promoter and GUS
reporter gene was cotransfected into rice protoplasts with a CaMV 35 S
promoter/RISBZ1 as an effector, there was no significant
transcriptional activation (data not shown). These results suggest that
the ACGT motifs found in the RISBZ1 promoter may not be the
target sequence of RISBZ1. Thus, a possibility of autoregulation of the
RISBZ1 by its own product may be excluded. Overexpression of
rice prolaimin box binding factor recognizing the AAAG sequence gave
rise to enhancement of transcription of RISBZ1 promoter/GUS
reporter gene. Dof motif (AAAG) may be implicated in this specific
regulation (data not shown).
Tissue Specificity of RISBZ1 mRNAs--
Northern blot analysis
was carried out to examine the expression pattern of these genes during
plant development. Total RNA was prepared from leaves, roots, and seeds
(5, 10, 15, 20, and 30 DAF), electrophoresed on agarose gel, and
transferred to membrane. DNA fragments covering the gene-specific
3'-untranslated region and C-terminal region downstream of the leucine
zipper region of individual cDNA was used as probes. As shown in
Fig. 4, the RISBZ1 gene is
specifically expressed in maturing seeds but is undetectable in other
tissues. The expression of mRNA reaches a maximum level at 5-10
DAF. Such high level of mRNA continues to 15 DAF and then drops off
toward seed maturation. The temporal expression pattern of the
RISBZ1 is slightly different from that of the major storage
protein glutelin genes whose accumulation occurs later during
seed development. The glutelin mRNA is detected from 5 DAF and
reached a maximum level at 15 DAF and then gradually decreased (Fig.
4). These results suggest a possibility that RISBZ1 functions as an
activator of the glutelin genes. Similar expression pattern has been
reported in maize O2 (14), wheat SPA (5), and
barley Blz2 genes (19).

View larger version (61K):
[in this window]
[in a new window]
|
Fig. 4.
Expression pattern of five RISBZ
mRNAs. Total RNAs (30 µg) from roots, seedlings and seeds
during seed development (5, 10, 15, 20, and 30 DAF) were analyzed by
Northern blot analysis using gene-specific sequences downstream of the
leucine zipper region and GluB-1 cording sequence. 25 S
rRNAs are shown as a loading control.
|
|
When accumulation levels of other RISBZ mRNAs were
examined among different tissues and during seed development, it was
shown that the RISBZ2 is ubiquitously expressed in all
tissues examined, although the signal is weak in roots and leaves (Fig.
4). RISBZ3 and RISBZ4 were specifically expressed
in the late stages of maturing seeds (Fig. 4). Their mRNA levels
gradually increase and reach a maximum level at 20 DAF, and then
decrease. RISBZ5 was weakly expressed during seed maturation
compared with the other O2-like genes (Fig. 4). Its mRNA level is
highest at 10 DAF and then declines.
Expression Pattern of the RISBZ1 Promoter/GUS Reporter Gene in
Transgenic Rice--
To assess the expression pattern of the
RISBZ1 gene, flanking region between
1674 and +213 from
the site of transcription initiation was transcriptionally fused to a
GUS reporter gene (Fig. 5A).
This chimeric gene was introduced into the rice genome by
Agrobacterium-mediated transformation. As shown in Fig.
5B, high levels of GUS activity were detected in aleurone
and subaleurone layers of maturing seeds and not in the embryo tissues.
Highly sensitive fluorometric assays also showed that GUS activity was not detected in roots, leaf, stem, and anthers (data not shown). These
findings indicate that the expression of the RISBZ1 gene is
specified to the aluerone and subaleurone tissues. This expression pattern is in contrast with that observed for the RITA-1
(RISBZ3) gene, in which GUS activity is also detected in
vascular bundles of stem and anthers, in addition to its dominant
expression in aleurone and subaleurone layers of maturing seeds
(20).

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 5.
Histochemical analysis of the
RISBZ1 promoter/GUS reporter gene in transgenic rice
seed. A, schematic presentation of the promoter
structure of RISBZ1 fused to the GUS reporter gene.
a and b, the regions between 1674 and +4 and
between 1674 and +213 containing the 5'-untranslated open reading
frame were transcriptionally fused to the GUS reporter gene in a binary
vector and introduced into rice via Agrobacterium
transfection. c, GluB-1 promoter ( 245 to +18)
was fused to a GUS reporter gene and introduced into rice via
electroporation. B, histochemical analysis of GUS expression
in maturing seed. a, RISBZ1 promoter ( 1674 to
+213); b, RISBZ1 promoter ( 1674 to +4);
c, glutelin GluB-1 promoter ( 245 to +18) as a
reference. Seeds from transgenic plants at 15 DAF were longitudinally
cut and incubated in X-Gluc solution at 37 °C for 30 min for the
construct a and 3 h for the constructs b and
c. EN, endosperm; EM, embryo.
C, GUS activity in extracts from maturing seeds of
independent transgenic rice lines. The analysis was performed on seeds
collected at 15 DAF. Promoter constructs are described in
panel A (parts a and
b). Vertical bars indicate mean value.
MU, 4-methylumbelliferone.
|
|
The function of both the translated open reading frame in the
5'-untranslated region and the 5'-untranslated sequence was examined by
comparing GUS activities directed by the construct between
1674 and
+4 lacking the ORF in the 5'-untranslated region as described in Fig.
5A. Irrespective of expectation, loss of uORF sequence
caused 5-10-fold reduction of promoter activity without changing the
expression pattern (Fig. 5C), suggesting a role of the
5'-untranslated region in quantitative regulation. This response
contrasts to that observed in the maize O2, where the
presence of the uORF suppresses expression (40). To examine the
biological function of uORF in the RISBZ1 directly, further frameshift mutational studies of the uORF will be required.
RISBZ1 Protein Only Activates Transcription through GCN4
Motif--
The ability of the five RISBZ proteins to activate
expression from a target GCN4 motif sequence was examined by transient assays. Protoplasts derived from rice calli were transformed with each
of the constructs separately or cotransformed with both constructs and
GUS activity was measured. A construct consisting of the CaMV 35 S
promoter fused to the individual RISBZ and maize O2 coding region was
used in combination with the one and four copies of 12-bp GCN4
motif/GUS or one, three, and five copies of 21-bp GCN4 motif/GUS
reporters as a positive control. As a negative control reporter gene,
4 × 12-bp or 3 × 21-bp mutagenized GCN4 motif/GUS was used.
The individual 12-bp (GCTtc(C/G)TCATGA) or 21-bp
(GTTTTGTCATGGCTtc(C/G)TCATG) mutagenized GCN4 differs from
the normal GCN4 by two nucleotides, which is located within the RISBZ1
or O2 target site (TGA(G/C)TCA). Transfection of the reporter plasmid
DNA or of the effector plasmid DNA alone resulted in weak reporter gene
activity (data not shown). As shown in Table I, part A, high levels of
transactivation of the reporter gene was observed only in the presence
of RISBZ1 or O2 as a positive control. Introduction of mutation into
the GCN4 motif of the reporter gene led to drastic reduction of
transactivation activities (background level or 4% of native one).
These results indicate that the RISBZ1 gene product is able
to activate the reporter gene through binding to the GCN4 motif. The
activation level exhibited similar or slightly higher than that of the
maize O2, and increased in accordance with the copy number of GCN4
motifs. When the activation level was examined using 1-12 copies of
the 21 bp GCN4 motif, GUS activity increased linearly up to 9 copies of
the GCN4 motif (data not shown).
However, when other four RISBZ coding regions were expressed under the
control of CaMV 35 S promoter and used as effector, they only gave rise
to <5% level of that of RISBZ1 and O2 as shown in Table I, part B. It
remains possible that very low transcriptional activity of these four
RISBZs is due to poor protein expression. It is necessary to confirm
protein expression in rice protoplasts by Western analyses. However, it
should be noted that their transactivation abilities are significantly
higher than the levels of negative control (reporter gene only). These
results suggest that only RISBZ1 acts as a functional activator in the
family of RISBZ transcription factors.
Identification of Binding Sites of the RISBZ Transcription
Factors--
We previously showed that the maize O2 protein recognizes
the TGAGTCA GCN4 motif between positions
165 and
160 of the
glutelin GluB-1 promoter (8). Using methylation interference
technique, the recognition site of the rice RISBZ1 in the
GluB-1 promoter was determined. As shown in Fig.
6, the GST-RISBZ1 protein protects a
region between
165 and
160, indicating that this footprinted sequence is identical to the region protected using the maize O2
protein (8). There is no any other protected sites in the region
between
197 and +18, although the ACGT motif (A/G hybrid box) between
79 and
76 is expected as a candidate of target site of bZIP
protein.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 6.
Methylation interference experiments of
RISBZ1 binding to the GCN4 motif in GluB-1
promoter. The GluB-1 promoter fragment from 245
to +18 was labeled on both strands (top and bottom). The both strands
were partially methylated and incubated with GST-RISBZ1 protein. Free
and retarded protein-DNA complex fragments were separated by
polyacrylamide gel electrophoresis. These fragments were eluted from
the gel and then chemically digested with piperidine and applied on
sequencing gel in parallel run with the sequencing ladder of this
fragment. The sequence around the protected region is shown.
|
|
We also examined by EMSAs whether the GCN4 motif is specifically
recognized by the RISBZ1 protein. Binding of GST-RISBZ1 fusion protein
to the 21-bp fragment containing the GCN4 motif was detected as a
retarded band (Fig. 7B). As
shown in Fig. 7A, 21-bp GCN4 motif was sequentially
mutagenized by three bases, and then used as competitors (100-fold
molar excess) in EMSAs. Retarded band was completely abolished by the
presence of a 100-fold molar excess of wild type fragment. It was
revealed that mutagenized nucleotides introduced into any parts of the
GCN4 core motif (TGAGTCA) as a competitor had little or no effect on
the binding of the native fragment, whereas introduction of mutations
flanking the GCN4 motif led to loss of binding (Fig. 7,
B-F). Taken together, the GCN4 core sequence, TGAGTCA, is
critical for the binding activity of RISBZ1, and that RISBZ1 interacts
with the GCN4 motif in sequence-specific manner.

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 7.
EMSA of RISBZ proteins with GCN4 motif.
A, nucleotide sequences of the oligonucleotide used as the
probe and the competitors are depicted. WILD, 21-bp sequence
containing GCN4 motif from GluB-1 promoter ( 175 to 155).
M1-M7, 21-bp sequence with successive mutations by three
bases. GCN4 motif is boxed. B-F, the GST-RISBZ
fusion proteins were used for EMSA with the 21-bp sequence containing
the GCN4 motif: GST-RISBZ1 (B), GST-RISBZ2 (C),
GST-RISBZ3 (D), GST-RISBZ4 (E), and GST-RISBZ5
(F). Competitors were added in 100-fold molar excess.
Lane 1, no protein; lane 2,
no competitor; lanes 3-10, with competitors wild
type (W) and M1-M7.
|
|
Similar work was carried out with the other RISBZ proteins to examine
whether they specifically recognize the GCN4 motif in the same way as
the RISBZ1. As shown in Fig. 7 (B-F), the binding affinity
of individual RISBZ proteins to the GCN4 motif differs slightly from
one another. There was little or no competition with GCN4
oligonucleotides containing mutations in the core motif. It is
interesting to note that oligonucleotides containing mutations outside
of the GCN4 motif did not abolish perfectly the binding of the RISBZ2
and RISBZ5 to the native fragment (Fig. 7, C and F).
Taken together, these results indicate that all of the RISBZ proteins
recognized the GCN4 motif, although with different binding affinities.
RISBZ1 Can Bind the GCN4 Motif as a Homodimer and a
Heterodimer--
The preceding results indicated that these five bZIP
proteins interacted with the GCN4 motif. Since bZIP proteins interact with DNA as a dimer, in vitro protein dimerization assays
were performed. Different portions of three cDNAs, corresponding to full-length or truncated versions of RISBZ1, RISBZ2, and RISBZ3 were
transcribed and translated in vitro using a wheat germ
extract (Fig. 8A). The
translation products were employed in DNA binding studies.
Electrophretic mobility shift assay was utilized to discriminate homodimeric from heterodimeric complexes bound to the target 21-bp GCN4
fragments. As shown in Fig. 8B, when full-length RISBZ1 and truncated RISBZ2 or RISBZ3 were used for this experiment, they exist
not only as homodimers but also as heterodimers with intermediate mobility appearing as new retarded bands. These results indicate that
RISBZ1 protein heterodimerize with one or more members of the RISBZ
family.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 8.
Heterodimerization between RISBZ1 and other
RISBZ proteins. A, schematic representation of plasmid
vectors used as templates for coupled in vitro
transcription/translation. The vectors encode the full-length RISBZ1
protein and the truncated RISBZ2 (RISBZ2s, positions 218-329) and
RISBZ3 (RISBZ3s, positions 126-237). B, heterodimer
formation of RISBZ1 with RISBZ2s or RISBZ3s. Lanes
2, 4, 6, and 8 contain the
individual protein-DNA complexes obtained with the full-length and
truncated proteins. For lanes 3 and 7,
a heterodimeric protein-DNA complex with intermediate mobility is
evident.
|
|
The N-terminal Region of the RISBZ1 Is Involved in Transcriptional
Activation--
To characterize the transcriptional activation domain
of RISBZ1, transient expression system in rice callus protoplasts was used. Different portions of the RISBZ1 gene, expressed under
the control of CaMV 35 S promoter, were tested for their ability to transactivate a reporter plasmid consisting of three copies of 21-bp
GCN4 motif and the
46 core promoter of CaMV 35 S promoter fused to
GUS reporter gene.
A progressive series of deletions in 40 amino acid increments from the
N terminus to the basic domain (position 235) of the RISBZ1 protein
were generated by PCR amplification. The resulting six DNA segments
encoding truncated proteins, 41-436, 81-436, 121-436, 161-436,
201-436, and 235-436) were cloned into pRT100. The transactivation
obtained with the RISBZ1 wild type construct was used as reference and
was set as a relativity of 100%. Deletion of the first 40 amino acids
from the N terminus led to a significant reduction in transactivation
(21% of the intact RISBZ1), suggesting the presence of an activation
domain in this region (Fig. 9). An
additional three deletions to position 161 resulted in gradual decrease
in activities (5% of the intact RISBZ1). When deleted to position 235 upstream of the DNA binding domain (basic domain), the activation
activities were recovered to some extent (17% of the intact RISBZ1)
(Fig. 9). These results suggest that the activation domain occurs
mainly within the N-terminal 40-amino acid sequence.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 9.
Deletion analysis of RISBZ1 protein using a
transient expression assay. The intact RISBZ1 (amino acid
positions 1-436) and deletion derivatives from the N terminus
(41-436, 81-436, 121-436, 161-436, 201-436, and 235-436) were
fused to CaMV 35 S promoter and used as an effector. Each of these
constructs was transfected into rice callus protoplasts together with
the 4 × 12-bp GCN4 motif/GUS reporter gene.
|
|
To further examine whether the N-terminal region between positions 1 and 40 is mainly responsible for transactivation of the RISBZ1 gene expression, we carried out gain-of-function
experiments by fusing the various regions of RISBZ1 to the DNA binding
domain of the yeast transcriptional activator GAL4. As shown in Fig. 10, these chimeric plasmid DNA were
expressed under the control of CaMV 35 S promoter and used as effector
plasmids. These plasmids were cotransfected into rice protoplasts with
a reporter plasmid that contained nine copies of a GAL4-binding site
and the
46 core promoter of CaMV 35 S fused to GUS reporter gene.
Even when the region between positions 1 and 234 was progressively
deleted to position 27 from the C terminus as shown in Fig. 10, these
chimeric genes still conferred high levels of activation similar to
that obtained with the longer peptide containing amino acids 1 and 234. Further deletion of 7 amino acids to position 20 resulted in background
level of activity (2.5%). Furthermore, removal of 8 amino acids from
the N terminus between positions 1 and 57 abolished the activity (Fig.
10). In contrast, when the C-terminal regions (positions 27-57,
positions 81-234, positions 161-234, positions 235-436) were fused
to the DNA binding domain of GAL4, no enhancing effect on transcription
of reporter gene was evident. These results suggest that the
proline-rich domain between positions 1 and 27 rather than the acidic
domains is mainly implicated in transactivation of the RISBZ1.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 10.
Analysis of the transcriptional activation
domain using a transient expression assay. A, reporter
and effector constructs. GAL4/GUS reporter constructs consists of nine
copies of the GAL4 DNA-binding sites linked to a 46 core promoter of
CaMV 35 S and the GUS reporter gene. The effector constructs contain
the GAL4 binding domain fused to N-terminal truncated RISBZ1 protein.
B, effector plasmids encoding the GAL4 DNA-binding domain
(amino acid positions 1-147) fused to several regions upstream of
basic domain of the RISBZ1 were cotransfected into rice callus
protoplasts with the GUS reporter gene containing a GAL4-binding site
fused to the core promoter of CaMV 35 S.
|
|
Difference in Activation Abilities between the RISBZ1 and the
Others--
High level of transactivation ability was observed only
for RISBZ1. The remaining four RISBZ proteins were not capable of transactivating the reporter gene although they were able to bind the
GCN4 motif. To address the molecular mechanisms responsible for
differences in transactivation abilities of the various RISBZ proteins,
domain-swap experiments were carried out between the RISBZ1 and the
RISBZ2 or RISBZ3. The N-terminal region of the RISBZ1 (positions
1-299) upstream of DNA binding basic domain was exchanged with the
corresponding regions of RISBZ2 (positions 1-229) and RISBZ3
(positions 1-137). When the N-terminal region of the RISBZ1 was linked
to the DNA binding domain of the nonfunctional RISBZ2 or RISBZ3, the
transactivation activity levels increased to about 15% and 38% for
that obtained for the intact RISBZ1 (Fig. 11). In light of the fact that RISBZ2
and RISBZ3 have little transactivation ability, the gain of activation
ability by fusing the N-terminal region of the RISBZ1 is significant.
On the other hand, when the N-terminal region of the RISBZ1 was
replaced with the corresponding regions of RISBZ2 or RISBZ3, the high
transactivation ability of the intact RISBZ1 was reduced to slightly
higher levels (25-27% of the intact RISBZ1) than the background level
(16% of the intact) obtained by the basic domain of the RISBZ1 alone
(Fig. 11). The activation domain of the RISBZ1 is mainly attributed to
the N-terminal region upstream of the basic domain.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 11.
Transient expression assay of chimeric RISBZ
proteins between the RISBZ1 and RISBZ2 or RISBZ3. A,
schematic presentation of the structure of effector plasmids. DNA
fragments encoding intact, truncated, and chimeric RISBZ proteins were
cloned into pRT100 (31). pRISBZ1, pRISBZ2, and pRISBZ3 encode
full-length RISBZ1, RISBZ2, and RISBZ3. p RISBZ1, p RISBZ2, and
p RISBZ3 encode C-terminal region of RISBZ1 (amino acid positions
235-436), RISBZ2 (231), and RISBZ3 (140), which contains DNA
binding domain. pRISBZ1-2 or pRISBZ1-3 encode N-terminal region of
RISBZ1 (1) fused to C-terminal region of RISBZ2 (231) or
RISBZ3 (140). pRISBZ2-1 or pRISBZ3-1 encode C-terminal region of
RISBZ1 (235) fused to N-terminal region of RISBZ2 (1) or
RISBZ3 (1). B and C, each of the effector
constructs was transfected into rice callus protoplasts together with
the 5 × 21-bp GCN4 motif/GUS reporter gene. All constructs were
analyzed three times in separate experiments with similar
results.
|
|
These results suggest that the N-terminal region is mainly responsible
for activation of the expression. The low transactivation ability
observed in the RISBZ2 and RISBZ3 may be accounted for by the deletion
or mutations in the activation domain corresponding to that of the
RISBZ1. One explanation for low activation ability of RISBZ3 is that it
completely lacks the region corresponding to the proline-rich
activation domain found in the N-terminal region of RISBZ1 protein.
Similar situation is also applicable to the RISBZ4 and RISBZ5. Another
explanation is that RISBZ2 and RISBZ3 proteins have lower binding
affinity to the GCN4 motif, although results of electrophoretic
mobility shift assay indicate otherwise.
Although the proline-rich domain of RISBZ2 protein shares high homology
to the RISBZ1 domain, RISBZ2's transactivation ability is much lower
than that of RISBZ1. When the corresponding region of RISBZ2 (positions
1-27) was fused to the DNA binding domain of yeast GAL4 and
cotransfected into protoplasts with GCN4 reporter gene, it had little
ability to enhance transcription of the reporter gene.
To address what amino acids in this region contribute to
transactivation ability, individual amino acids of the RISBZ1 protein from positions 1 to 27, which were different from the RISBZ2 protein, was substituted with corresponding amino acid from RISBZ2 protein and
the region from positions 1 to 57 was fused to the GAL4 DNA binding
domain. As shown in Fig. 12, only eight
amino acid differences are seen in the region from positions 1 to 27 between them. These mutations with the exception of the change at
position 7 (M3) resulted in loss of transcriptional activation. It
should be noted that seven different amino acids cause to alternation
of the hydrophobicity pattern, when analyzed by the method of Kyte and
Doolittle (41) (data not shown). Taken together, it is suggested that a
unique tertiary structure is required for activation ability and the alternation of structure may cause to severe effect on activation ability.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 12.
Site-directed mutagenesis of the RISBZ1
transactivation domain. The effector constructs contain the GAL4
DNA binding domain fused to the normal or mutagenized activation domain
of the RISBZ1 between positions 1 and 40. Each of effector constructs
was transfected into rice callus protoplasts together with the GAL4/GUA
reporter gene. Amino acid residues of the RISBZ1 different from those
of the RISBZ2 are underlined.
|
|
 |
DISCUSSION |
RISBZ1 Recognizing the GCN4 Motif Is a Functional Transcription
Factor Required for Endosperm-specific Expression of Storage Protein
Genes--
The GCN4 motif is widely distributed in many promoters of
cereal seed storage protein genes such as wheat glutenin, rye secalin, and barley hordein, as well as rice glutelin (10, 11). It was first
found that the GCN4 motif functions as a seed-specific element, since
multimers of GCN4 from the pea lectin gene directed seed-specific
expression in transgenic tobacco (42). Involvement of GCN4 motif in
endosperm-specific expression or nitrogen response has been reported
for the barley hordein (4, 19), wheat low molecular weight glutenin
(5), and maize 27-kDa
-zein genes (6).
Several lines of evidence indicate that the GCN4 motif acts as a
central role in determining endosperm-specific expression of rice
storage protein glutelin genes (8). (a) Progressive 5'
deletion of the glutelin GluB-1 gene showed that loss of the GCN4 motif resulted in background levels of promoter activities. (b) Substitutive mutation of the GCN4 motif in the minimum
native promoter gave rise to remarkable reduction of promoter
activities and alternation of expression pattern. (c)
Multimers of a 21-bp fragment containing the GCN4 motif conferred
aleurone- and subaleurone-specific expression in maturing seeds of
transgenic rice, when fused to the
46 core promoter of CaMV 35 S
linked to the GUS reporter gene.
The GCN4 motif is recognized by maize O2 (8, 10, 43), wheat SPA (5),
and barley BLZ1 (18) and BLZ2 (19) transcription factors. Activation of
transcription by these transcriptional factors through the GCN4 motif
was demonstrated in both in vitro using transient assays as
well as in planta using transgenic plants. EMSAs and
methylation interference experiments showed that the O2 binds to the
GCN4 motif in a sequence-specific manner (8, 10). These results suggest
that a bZIP protein functionally similar to O2 may exist in rice and
participate in controlling the endosperm-specific expression of
glutelin genes through binding to the GCN4 motif. The presence of
transcription factor binding to the GCN4 motif in the rice maturing
seed has been suggested by Kim and Wu (17).
Izawa et al. (20) first isolated a cDNA clone coding for
a bZIP protein, RITA-1, from rice, which is significantly expressed in
aleurone tissue during seed maturation. Although its expression pattern
is similar to that observed for the seed storage protein genes, RITA-1
(RISBZ3) is unlikely to be involved in the expression of the glutelin
genes, since its capacity to transactivate a GCN4 motif-containing
reporter gene was much lower than that obtained with O2 (Table
I). A cDNA clone encoding a novel
bZIP protein, REB, has also been isolated from rice maturing seed
cDNA library (21). Nakase et al. (21) showed that the
GCCACGTc/aAG sequence in the 26-kDa
-globulin promoter, designated
G/C and A/G hybrid box, is recognized by the GST-REB protein by gel
retardation assays. As shown here, it should be noted that very low
levels of transactivation via the GCN4 motif were also observed for
this transcription factor, even when it is used as an effector (Table
I, part B). Taken together, these results suggest that these two rice
bZIP proteins may not be candidates for functional transactivators of
expression of glutelin genes, thus suggesting that there may be other
unidentified other O2-like bZIP proteins in rice maturing seeds, which
may be implicated in the transcriptional activation.
View this table:
[in this window]
[in a new window]
|
Table I
Transient expression assay of GCN4 motif/GUS reporter genes in rice
callus protoplasts
Part A, 1 × 12-bp, 4 × 12-bp, 1 × 21-bp, 3 × 21-bp, and 5 × 21-bp GCN4 motif/GUS genes were used as reporters.
The effect of RISBZ1 (+RISBZ1) or Opaque2 (+Opaque2) expression under
the control of CaMV 35 S promoter is shown. As a negative control,
4 × 12-bp and 3 × 21-bp mGCN4/GUS reporter gene were used.
The results are the average of at least three replicates. Part B, each
of the effector constructs was electroporated into protoplast in the
presence of the 4 × 12-bp GCN4 motif/GUS reporter gene with three
replicates.
|
|
Using the conserved basic domain sequences characteristic of the
O2-like bZIP proteins, we screened a rice maturing seed cDNA library to isolate functional bZIP protein sharing high transactivation ability. Of O2-like bZIPs isolated, only RISBZ1 functions as a transcriptional activator at comparable or slightly higher levels of
transcriptional activation via the GCN4 motif than the O2 (Table I,
part A). This result suggests that the RISBZ1 is involved in gene
regulation of many storage proteins. This transcriptional activator
constitutes a small multigene family consisting of at least five copies
per haploid genome, which includes the RITA-1 (RISBZ3) and the REB
(RISBZ2). The members of this RISBZ family can be clearly classified
into two groups based on their sequence similarities. It is interesting
to note that the RISBZ1 protein shares high amino acid sequence
homology to the REB (RISBZ2), irrespective of difference in activation ability.
When the binding site of the RISBZ1 was examined in the 5'-flanking
region of the glutelin GluB-1 gene between
197 and +18 using a methylation interference experiment, it was shown that the G
residue of both strands covering the GCN4 motif (TGAGTCA) between
165
and
160 were specifically protected. It is noteworthy that the ACGT
motif (GTACGTGC) between
81 and
75 was not recognized by RISBZ1.
This motif (A/G hybrid box), which is involved in quantitative regulation of glutelin gene (9), likely binds a different bZIP transcription factor than RISBZ1 protein. The footprinted sequence of
RISBZ1 is identical to the region protected by maize O2 protein (8).
Taken together, the RISBZ1 specifically binds to this site and
transactivates the expression of glutelin GluB-1 gene.
Binding specificity was further confirmed by gel retardation
experiments and transient expression assays using rice protoplasts. Nucleotide substitutions in the GCN4 motif not only abolish the binding, but also its response to transactivation by RISBZ1 in transient assays. Taken together, these findings indicate that the GCN4
motif is recognized by the RISBZ1 in a sequence-specific manner.
It was demonstrated by Northern blot analysis that the
RISBZ1 gene is specifically expressed in seed-specific
manner, which precedes the expression of glutelin genes. Tissue
specificity was further examined by histochemical analysis using
homologous stable transgenic rice (Fig. 5). When the promoter of the
RISBZ1 gene fused to the GUS reporter gene was introduced
into rice plants, it specifically directs the expression of the
reporter gene in endosperm tissue. The GUS reporter gene is highly
expressed in aleurone and subaleurone layers. It should be noted that
this spatial expression is very similar to that observed for the
glutelin promoter, suggesting the participation of the RISBZ1 protein
in regulation of the glutelin genes.
It has been studied that the maize O2 protein has a broad binding
specificity (20). It can activate the expression of 22-kDa
-zein
(14), 14-kDa
-zein (44), b32 (15), and cytosolic pyruvate
orthophosphate dikinase (45) by interacting with the TCCACGT(a/c)R(a/t)
and GATGYRTGG sequences of their promoters. When it was examined
whether these O2 target sequences are recognized by the rice RISBZ1
protein, it also highly activated the expression of 22-kDa
-zein and
b32 genes through binding to these target sequences (data not shown).
Furthermore, the RISBZ1 protein preferentially binds to G/C and A/G
hybrid boxes and activates transcription (data not shown). These
results indicate that RISBZ1 exhibits broad binding affinity similar to
that displayed by maize O2.
It is noteworthy that the RISBZ1 protein is involved in transcriptional
activation of not only the glutelin genes but also other storage
protein genes such as 13-kDa prolamin and 26-kDa
-globulin genes
(data not shown). These rice storage protein genes contain a A/G or G/C
hybrid box, which is recognized by RISBZ1 (data not shown).
Participation of the RISBZ1 in regulation of several genes is
comparable to that of the maize O2. Taken together, these data suggest
that these activators play a general role in expression of several
genes during seed maturation.
Characterization of the DNA-binding Domain--
Plant bZIP
proteins associate with DNA binding site as either a homodimer or
heterodimer. The dimerization domains are
-helical structures
characterized by a periodic repeat of leucine every seventh amino acid,
which forms a parallel coiled-coil structure (46). It has been
demonstrated that heterodimers between Fos and Jun (47) or between Myc
and Max (48) bind their target sequence with higher affinities than
either homodimeric complex. It has been demonstrated that heterodimer
formation generates an expanded repertoire of regulatory potential for
gene expression.
We examined whether RISBZ1 binds to its target sites in
vitro as either a homodimer or heterodimer as reported in other
members of the bZIP proteins. We showed that RISBZ2 (REB) or RISBZ3
(RITA-1) is able to form heterodimer complexes with RISBZ1 (Fig. 8).
The dimerization capability of these transcription factors may result from a lower negative charge distribution in the zipper region as
suggested by Menkes and Cashmore (49), showing that a high negative
charge distribution at the "g" position close to leucines (position
d) prevented the subunits from forming a homodimer. It is noted that
amino acid residues at positions d and g in zipper regions are highly
conserved among RISBZ1, RISBZ2, BLZ1, OHP1, and O2. Given that most of
RISBZ proteins are implicated in the regulation of rice seed storage
proteins genes through binding to the GCN4 motif, they may act only as
heterodimer partner of the RISBZ1 protein in vivo, since the
other RISBZ proteins besides the RISBZ1 protein lacks a functional
activation domain and fails to transactivate gene expression. Contrary
to expectations, coexpression of RISBZ1 and other members in
vitro had no effect on activation level through the GCN4 motif
(data not shown). A similar situation has been observed for the maize
OHP1 (32). One explanation for heterodimer formation is that
transactivation of genes may be modulated by the formation of
heterodimers among members of RISBZ family with different DNA binding
properties. This scenario is likely to occur because all RISBZ proteins
are expressed in the endosperm and can bind to the GCN4 motif. It has
been demonstrated that the heterodimeric complex may have a
significantly different affinity for binding site than either protein
as a homodimeric complex. Heterodimerization with RISBZ1 may
demonstrate the complex nature of the transcription factor interactions
at the C box, G box, or A/C box element as well as GCN4 motif and
contribute to the complexity of the regulatory network of expression of
seed storage protein genes. Furthermore, hetrodimerization between RISBZ1 and the other RISBZ proteins may contribute to the spatial and
temporal expression of storage protein genes by attenuating the
activation ability through heterodimeric complex formation. For
instance, expression of RISBZ3 and -4 during the late stages of seed
development (Fig. 4), and their dimerization with RISBZ1 may be
responsible for decreased transcription of the glutelin genes during
this period.
RISBZ1 Protein Has a Unique Activation Domain That Is Distinct from
Other Plant bZIP Proteins--
Transcriptional activation domains have
been classified into acidic, Gln-, Pro-, and Ser/Thr-rich domains based
on their amino acid composition/properties (50). In contrast to the DNA
binding domains, the amino acid sequences comprising these activation domains are not conserved. The domains responsible for transactivation have been defined in detail for the maize O2 (51). A single acidic
domain between amino acids 63 and 74 is the main contributor for
transcriptional activation. The activation domains of the barley BLZ1
and BLZ2 are also located in the N-terminal region, although not
identified to the amino acid level (18, 19). Although sequences rich in
acidic amino acids are found at the corresponding regions in all the
RISBZ proteins, our gain-of-function assays using the GAL4 DNA binding
domain clearly indicated that these regions are not involved in gene
activation. In contrast, it was demonstrated that the proline-rich
region within the N-terminal 27 amino acids of RISBZ1 protein functions
as transcriptional activation domain. However, it is interesting to
note that the corresponding region of the RISBZ2 is not able to
transactivate transcription, although it shares high degree of homology
to that of the RISBZ1 protein (conservation of 19 out of 27 amino
acids). Substitutive mutational analysis of the eight amino acids that differ between RISBZ1 and RISBZ2 revealed