|
Originally published In Press as doi:10.1074/jbc.M007854200 on January 24, 2001
J. Biol. Chem., Vol. 276, Issue 17, 14350-14358, April 27, 2001
Identification and Characterization of a Novel Nuclear Factor of
Activated T-cells-1 Isoform Expressed in Mouse Brain*
Simon
Plyte §,
Marianna
Boncristiano ,
Elena
Fattori¶,
Federico
Galvagni ,
Silvia Rossi
Paccani**,
M. Bernardetta
Majolini ,
Salvatore
Oliviero ,
Gennaro
Ciliberto¶,
John L.
Telford§§, and
Cosima T.
Baldari¶¶
From the Departments of Evolutionary Biology and Molecular
Biology, University of Siena, and the §§ Chiron
Research Center, Via Fiorentina 1, 53100 Siena, Italy, and ¶ IRBM,
Via Pontina km 30.600, 00040 Pomezia, RM, Italy
Received for publication, August 28, 2000, and in revised form, December 29, 2000
 |
ABSTRACT |
The nuclear factor of activated T-cells
(NFAT) family transcription factors play a key role in the control of
cytokine gene expression in T-cells. Although initially identified in
T-cells, recent data have unveiled unanticipated roles for NFATs
in the development, proliferation, and differentiation of other
tissues. Here we report the identification, cDNA cloning, and
functional characterization of a new isoform of NFAT1 highly expressed
in mouse brain. This isoform, which we named NFAT1-D, is identical to
NFAT1 throughout the N-terminal regulatory domain and the portion of
the Rel domain which includes the minimal region required for specific
binding to DNA and interaction with AP-1. The homology stops sharply
upstream of the 3'-boundary of the Rel homology domain and is followed
by a short unique C-terminal region. NFAT1-D was expressed at high
levels in all brain districts and was found as a constitutively active
transcription complex. Transfection of a NFAT/luciferase reporter in
the neuronal cell line PC12, which also expresses NFAT1-D, showed that
these cells expressed a constitutive NFAT activity that was enhanced
after nerve growth factor-induced differentiation but was resistant to
the immunosuppressant cyclosporin A. NFAT1-D was, however,
inducibly activated in a cyclosporin A-sensitive manner when expressed
in T-cells, suggesting that the activity of NFAT proteins might be
controlled by their specific cellular context.
 |
INTRODUCTION |
Initially described as a transcriptional complex that bound a
T-cell antigen receptor
(TCR)1 response element on
the interleukin (IL)-2 gene enhancer, nuclear factor of activated
T-cells (NFAT) is a family of transcription factors crucially involved
in the regulation of cytokine gene expression in T-cells (1). NFAT
activity is strongly unregulated after TCR triggering; however,
receptor engagement can be bypassed by a combination of phorbol esters
and calcium ionophores, which activate protein kinase C and
induce a rise in intracellular calcium ions, respectively. This dual
requirement reflects the subunit composition of NFAT factors, which
includes a cytoplasmic and a nuclear component. In resting cells, NFAT
is found as a cytosolic protein phosphorylated on serine residues.
After an elevation in intracellular calcium ions, the
calmodulin-dependent phosphatase calcineurin is activated
and dephosphorylates NFAT, exposing a nuclear localization sequence
near the N terminus of NFAT and resulting in its translocation to the
nucleus (2-5). This process is exquisitely sensitive to the
immunosuppressants cylosporin A (CsA) and FK506, which interact with
specific cytosolic receptors and form complexes that bind with high
affinity to calcineurin and lock it in an inactive conformation (6-8).
In the nucleus NFAT assembles in cooperative DNA-binding complexes with
dimers of the AP-1 family of transcription factors (4, 9).
Complementation studies using constitutively active mutants of
signaling proteins have shown that the calcium/calcineurin and the
Ras/protein kinase C/mitogen-activated protein kinase pathways are
integrated at the level of NFAT proteins (10, 11).
The NFAT family of transcription factors includes to date five members,
NFAT1 (also named NFATp or NFATc2), NFAT2 (also named NFATc or NFATc1),
NFAT3 (also named NFATc4), NFAT4 (also named NFATc3), and the recently
identified atypical member NFAT5 (12-18). All NFAT proteins share a
conserved DNA binding domain, which shows a weak similarity with the
DNA binding domain of Rel family proteins (RHD) and permits interaction
with Fos/Jun heterodimers at composite DNA binding sites on a number of
cytokine gene enhancers (1). The N-terminal region shows significant
homology among NFAT1-4 and is characterized by a number of features
important for regulation, including a nuclear localization sequence,
the sites of interaction with calcineurin, and a highly conserved SP
repeat region
(SPXXSPXXSPXXXXX(D/E)(D/E), which is
likely to be the target of kinase/phosphatase activity (1).
Furthermore, the N-terminus of NFAT1 has been functionally
characterized as a transactivation domain and, like the corresponding
regions of NFAT2-4, contains at least one acidic/hydrophobic patch
that resembles those implicated in transactivation by acidic activation
domains (1). In agreement with a regulatory role for the N-terminal NFAT homology region, NFAT5, which lacks this region, has a
calcineurin-independent constitutive nuclear localization in a number
of cell types, including T-cells (14). NFAT family members differ
widely at their C termini, as they are expressed mostly as multiple
isoforms generated by either alternative splicing or, as recently shown
for NFAT2, by alternative polyadenylation (19). The difference in
transactivation activity among NFAT isoforms appears related to the
presence, in specific isoforms, of an additional transactivation domain in the C-terminal region (20).
Although initially characterized in T-cells, NFAT family members are in
some instances broadly expressed not only in other cells of the immune
system, but also in ontogenically distinct tissues. While NFAT2
expression is mostly restricted to T and B-cells and NFAT4 to
thymocytes (12, 18), NFAT1, NFAT3, and NFAT5 are found in many tissues
in both man and mouse (12-14, 21, 22), and unanticipated roles for
these factors have been unveiled in development, proliferation, and
differentiation of a number of tissues. For example, NFAT1 has been
shown to be a repressor of chondrogenesis (23), whereas NFAT2 was found
to be essential for heart development (24, 25). Furthermore, a number
of data suggest a potential role for NFAT factors in myogenesis and
adipogenesis (26, 27). Specific NFAT family members are also expressed in the brain. NFAT1 has been detected in the mouse olfactory bulb and
in a neuronal cell line (22), and NFAT3- and NFAT5-specific mRNA
has also been detected at high levels in the brain (13, 14). Recently
NFAT3 has been shown to translocate to the nucleus and activate
NFAT-dependent transcription in response to electrical activity or potassium depolarization in pyramidal neurons, suggesting a
role for NFAT3 in hippocampal synaptic plasticity and memory (28).
Hence, NFAT factors might be implicated in brain development and
function. Here we report the cDNA cloning and characterization of a
new NFAT1 isoform highly expressed and constitutively active in mouse
brain, initially suggested by the presence of high levels of
constitutive luciferase activity in the brain of a NFAT/luciferase (NFAT/luc) reporter transgenic mouse.
 |
MATERIALS AND METHODS |
Plasmids, Antibodies, and Glutathione S-Transferase Fusion
Proteins--
The NFAT/luc reporter contains a trimer of the distal
NFAT binding site on the IL-2 enhancer upstream of the gene encoding firefly luciferase, as well as the bacterial neo gene for
G418 selection of eukaryotic cells (29). The plasmid pRDII, containing the bacterial gene encoding chloramphenicol acetyltransferase under the
control of a multimer of a nuclear factor- B binding site (30), was
used as a transfection control. A pGEX construct containing the
cDNA encoding the Rel homology domain of NFAT1 and the retroviral
vector pEGZ-HA-NFATp containing the gene encoding murine NFAT1-C were a
kind gift of Edgar Serfling and Andris Avots. The plasmid
pcDNAamp/NFAT1-D contains the cDNA encoding NFAT1-D under the
control of the cytomegalovirus early enhancer in the mammalian
expression vector pcDNAamp (Invitrogen, Groningen, Holland). The
full-length NFAT1-D cDNA was obtained by RT-PCR from mouse brain.
The primers were designed to add an HindIII site 5' of the
ATG initiation codon and an XbaI site 3' of the stop
codon for directional cloning into pcDNAamp. The nucleotide
sequence of the cDNA was checked by automatic sequencing. The
plasmid pGFP/NFAT1-D was obtained by subcloning the
HindIII-XbaI fragment from pcDNAamp/NFAT1-D into the corresponding sites of the polylinker of pEGFP-C3
(CLONTECH, Palo Alto, CA).
Polyclonal antibodies against NFAT1 were purchased from Upstate
Biotechnology (Lake Placid, NY) and Santa Cruz Biotechnology Inc.
(Santa Cruz, CA). An anti-NFAT1 mAb, which recognizes a specific epitope in the N-terminal region of NFAT1 (22), was purchased from
Affinity Bioreagents (Golden, CO). The anti-NFATx and anti-NFATc1 mAbs
were a kind gift from Gerald R. Crabtree. The cDNA encoding amino
acid residues 619-673 of NFAT1-D, corresponding to the unique C-terminal region, was obtained by RT-PCR from total brain RNA. The
primers were designed to provide the RT-PCR product with a BamHI restriction site at the 5'-end and by an in-frame
termination codon and an EcoRI restriction site at the
3'-end. The RT-PCR product was purified, digested with BamHI
and EcoRI, and cloned in the corresponding sites of the
polylinker of the bacterial expression vector pGEX-2T (Amersham
Pharmacia Biotech Italia srl, Milan, Italy). The glutathione
S-transferase fusion protein was affinity purified using
glutathione-Sepharose 4B (Amersham Pharmacia Biotech Italia) according
to the manufacturer's instructions and used to raise a polyclonal
anti-NFAT1-D antiserum in rabbits. The anti-human CD3 mAb OKT3 and
anti-mouse CD3 mAb 145-2c11 were affinity purified on a protein G
column (Amersham Pharmacia Biotech Italia) from hybridoma supernatants
(ATCC). The anti-murine V 8.1 mAb F23.1 (31) was kindly provided by
Ed Palmer.
Generation and Analysis of Transgenic Mice--
The
2.8-kilobase NotI-XhoI restriction
fragment isolated from the plasmid NFAT/luc was microinjected into
fertilized C57BL/6xDBA eggs and transgenic mice generated as described
previously (32). Founder mice were back-crossed to C57BL/6 mice. Three
positive founder lines were established. Total genomic DNA purified
from the tail of the founders was assayed for the presence of the
NFAT/luc transgene by Southern blot using as a probe a
NotI-XhoI restriction fragment from NFAT/luc
labeled with [32P]dCTP by random priming. Alternatively,
the transgene was identified by PCR of genomic DNA using
luciferase-specific primers. Luciferase activity in the transgenic
progeny was determined as described (33) on peripheral blood
lymphocytes purified by Ficoll gradient centrifugation and subsequent
overnight incubation in medium to remove adherent monocytes and
macrophages and was then subsequently activated with a combination of
50 ng/ml PMA and 250 ng/ml A23187. Identification of the transgenic
progeny from the NFAT/luc line harboring a functional insertion of the
transgene was routinely carried out using the latter methodology.
T-cell activation by CD3 cross-linking on solid substrate was carried
out as described previously (29) using the anti-mouse CD3 mAb
1452c11. Mouse organs (recovered from mice bled previously under
anesthesia to remove contamination by circulating lymphocytes) were
assayed for luciferase activity after homogenization in a Polytron
homogenizer in 3% Triton X-100, 20 mM Tris-HCl, pH 8, 150 mM NaCl (in the presence of 0.2 mg/ml sodium orthovanadate,
1 µg/ml leupeptin, aprotinin, and pepstatin, and 10 mM
phenylmethylsulfonyl fluoride). Protein concentrations in the cleared
lysates were determined using a kit from Pierce (Rockford, IL) and
bovine serum albumin as a standard. Luciferase activities were
determined using a kit from Promega Italia srl (Milan, Italy) and
normalized to the protein content.
cDNA Cloning and Analysis, Northern Blots, and RT-PCR--
A
uni-Zap-XR mouse brain library (Stratagene GmbH, Heidelberg, Germany)
was screened using a probe derived from the Rel domain of mouse NFAT1.
Basically, 106 phage particles were plated onto NZY soft
agar plates together with infection-competent Escherichia
coli (XL-1 strain pretreated with 10 mM
MgCl2, 0.2% maltose) and grown overnight at 37 °C. Phage plaques were transferred in duplicate to nitrocellulose membranes
and lysed by treatment for 2 min with 1.5 M NaCl, 0.5 M NaOH followed by 1.5 M NaCl, 0.5 M Tris-HCl, pH 8.0 (5 min), and washed in 0.2 M
Tris-HCl, pH 7.5, 2 × SSC. Filters were baked at 80 °C for
3 h, prehybridized overnight at 42 °C in 5 × SSPE, 5 × Denhardt's solution, 30% deionized formamide, 1% SDS, and 200 µg/ml denatured salmon sperm DNA, and subsequently probed by
hybridization overnight at 42 °C in the same solution using a
fragment of DNA generated by PCR from the Rel domain of NFAT1 and
labeled by random priming with [32P]dCTP. Filters were
washed once in 2 × SSPE at room temperature for 10 min, twice in
0.5 × SSPE, 0.5% SDS at 55 °C for 20 min, and once in
0.5 × SSPE, 0.5% SDS at room temperature for 10 min and then
exposed to x-ray film overnight at 80 °C with an intensifying screen. Positive plaques were isolated and phage particles recovered in
SM buffer containing 1% chloroform. These were then used in a
secondary and tertiary screening to obtain pure positive clones. The
cDNA was recovered by the plasmid rescue technique and then sequenced.
Total RNA was extracted from mouse brain homogenized in a Dounce
homogenizer, using guanidinium isothiocyanate. Northern blot analysis
was carried out by standard protocols using a PCR probe corresponding
to the unique 3'-portion of the NFAT1-D cDNA and labeled with
[32P]dCTP by random priming. The multiple mouse tissue
Northern blot was purchased from CLONTECH and
hybridized first with the same NFAT1-D-specific probe and subsequently
with an actin probe according to the manufacturer's instructions.
RT-PCR of total brain RNA or of RNA extracted from mouse splenocytes or
a mouse T-cell hybridoma was carried out on a Perkin Elmer Life
Sciences 2400 thermal cycler (Norwalk, CT) using primers specific for
the unique 3'-portion of NFAT-1D cDNA and kits from Takara Shutzo
Co. (Shiga, Japan) and Sigma Aldrich srl (Milan, Italy). The
specificity of the PCR products was confirmed by automatic sequencing.
Alternatively, to clone the 5'-portion of NFAT1-D, reverse
transcription of total RNA and subsequent PCR amplification were
carried out in one step using the One-Step RT-PCR Kit
(CLONTECH) according to the manufacturer's instructions. NFAT1-D-specific first strand cDNAs were generated using two different primers mapping to the unique 3'-terminus of the
coding region (5'-GGCAGAATGTTACAGAGC-3') and to the 3'-untranslated region (5'-TGTTACAGAGCCAGCAGC-3'), respectively. A 660-base pair fragment spanning NFAT1 cDNA from the ATG initiation codon to codon
220 in the conserved N-terminal domain was subsequently amplified by
PCR. PCR products were separated by agarose gel electrophoresis and
recovered using a kit from Qiagen GmbH (Hilden, Germany). Automatic
sequencing was performed on both strands of the RT-PCR products. The T
to C transition at codon 78 was confirmed on independent RT-PCR
products. A full-length cDNA was subsequently obtained by RT-PCR
and completely sequenced. The cDNA sequence encoding NFAT1-D has
been submitted to GenBank (accession number AF289078).
Nuclear Extracts and Gel Mobility Shift Assays--
Nuclear
extracts were obtained from mouse tissues and from mouse C2C12 muscle
cells. Tissues and cells were washed twice with phosphate-buffered
saline and homogenized in buffer A (10 mM HEPES pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl
fluoride) with a Dounce homogenizer (pestle B). The homogenate was
centrifuged for 30 s in a microfuge. The pellet containing the
nuclei was resuspended in 3 volumes of ice-cold buffer C (20 mM HEPES pH 7.9, 0.4 M NaCl, 1 mM
EDTA, 1 mM EGTA, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride), and the tube was rocked
at 4 °C for 15 min. The nuclear extract was centrifuged for 2 min at
maximum speed at 4 °C, and the supernatant obtained was frozen in
aliquots at 80 °C. The probe and competitors for gel mobility
shift assays were obtained by annealing the following oligonucleotides: NFAT-F (GGGAAAGAAAGGAGGAAAAAGTGTTTCATACAG) and NFAT-R
(TGGTTCTGTATGAAACACTTTTTCCTCCTTTCTT) for the probe (NFAT); NFATm-F
(GGGAAAGAAAGGAGAAAAAAATTTTTAATACAG) and NFATm-R
(TGGTTCTGTATTAAAAATTTTTTTCTCCTTTCTT) for the cold competitor NFATm; B7
(AGCTAAGCATGAGTCAGACAC) and B8 (GATCGTGTCTGACTCATGCTT) for the
aspecific competitor (Asp). Binding reactions and electrophoresis of
the complexes were performed as described previously (34). 0.5 µl of
an antibody raised against the NFAT1 Rel homology domain (anti-mouse
NFATp, Upstate Biotechnology), anti-NFATc1/NFAT2 (kindly provided
by Gerald R. Crabtree), or anti-NFAT1-D was added to the binding
mixture as indicated.
Cell Lines and Transfections, Luciferase Assays, Confocal
Microscopy--
The mouse T-cell hybridoma 58hCD4 expressing the
3BBM74 TCR (35), kindly provided by Ed Palmer, and the human
T-lymphoma line Jurkat were grown in RPMI supplemented with 7.5%
defined bovine serum (HyClone Laboratories, Logan, UT). The neuronal
line PC12 (ATCC) was grown in 5% bovine serum and 5% equine serum
(HyClone Laboratories). Jurkat cells were transiently transfected with DEAE/dextran and activated either by CD3 cross-linking on a secondary antibody-coated plate using the anti-CD3 mAb OKT3 or by a combination of 50 ng/ml PMA and 250 ng/ml A23187 as described previously (29).
Transfection control samples were activated with 50 ng/ml PMA. CsA
(Sandoz, East Hanover, NJ) was added at a final concentration of 500 ng/ml 15 min before activation. Cells were collected 8 h after
activation and processed for luciferase and chloramphenicol acetyltransferase assays as described (29, 33). Relative luciferase activities were normalized to protein content of each sample and to the
levels of chloramphenicol acetyltransferase activity in the
transfection controls. All samples were in duplicate, and transfections
were repeated three to five times. PC12 cells were either transiently
transfected by DEAE/dextran as above or stably transfected by
electroporation and selected in G418 as described previously for Jurkat
cells (36). PC12 differentiation was achieved by plating the cells on
collagen-coated plastic in the presence of 10 ng/ml nerve growth factor
(a kind gift of Stefano Alemà) for 1 week. Confocal microscopy
was carried out on Jurkat cells transiently transfected with the
pEGFP/NFAT1-D construct, either as such or after treatment for 10, 20, and 40 min with 500 ng/ml A23187, in the presence or absence of 500 ng/ml CsA, using a Leica Microsystems confocal microscope (Heidelberg, Germany).
Immunoprecipitations and Immunoblots--
Brain lysates were
obtained by homogenization in a Dounce homogenizer in 1% Triton X-100,
20 mM Tris-HCl, pH 8, 150 mM NaCl in the
presence of 0.2 mg/ml sodium orthovanadate, 1 µg/ml leupeptin, aprotinin, and pepstatin, and 10 mM phenylmethylsulfonyl
fluoride. T-cell hybridoma lysates were obtained as described (29).
When required, T-cells were activated by anti-TCR antibody
cross-linking in solution as described (29). Equal amounts of proteins
were subjected to SDS-polyacrylamide gel electrophoresis, transferred to nitrocellulose filters, and probed by immunoblot.
Peroxidase-labeled secondary antibodies were revealed by
chemiluminescence using reagents from Pierce. NFAT1-D was
immunoprecipitated from brain lysates using the polyclonal anti-NFAT1-D
antiserum and protein A-Sepharose (Pharmacia Amersham Biotech) as
described (29). Prestained molecular weight markers were purchased from
Life Technologies Italia srl.
 |
RESULTS AND DISCUSSION |
Generation and Characterization of a NFAT-Luc Reporter
Mouse--
Reporter mice have been shown to be a powerful tool for the
study of development, activation, and differentiation of immune cells
in vivo (37-40). To generate reporter transgenic mice for NFAT, a construct encoding firefly luciferase under the control of a
trimer of the distal NFAT binding site on the IL-2 gene enhancer was
used for microinjection (Fig.
1A). This construct has been used extensively in Jurkat cells both for transient transfection assays
and for generating stable transfectants, and has been shown to be
strongly inducible in response to TCR agonists, as well as to a
combination of phorbol esters and a calcium ionophore (10 and
references therein). Five positive founders were identified by Southern
blot analysis of genomic DNA (data not shown). Of these, three were
found to have a germline transmission of the transgene, as shown by
both Southern blot and PCR analysis of genomic DNA of the F1 progeny
(Fig. 1B and data not shown). Productive insertion of the
transgene was assayed by quantitating luciferase activity in peripheral
blood lymphocytes maximally stimulated in vitro with a
combination of PMA and A23187. As shown in Fig. 1B,
induction of NFAT-dependent luciferase activity was
detected in only one of the three founders, from which a stable
transgenic line was derived and used for subsequent studies.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 1.
Generation and identification of NFAT/luc
transgenic mice. Panel A, scheme of the NFAT/luc
transgene. Panel B, ethidium bromide staining of the PCR
products obtained by amplification of genomic DNA from a nontransgenic
mouse (lane 1) and from three founders (lanes
2-4), using primers specific for the luciferase gene. The
identity of the PCR products, which migrated at the expected size of
900 base pairs, was confirmed by nucleotide sequencing. The
numbers below each lane indicate the luciferase
values obtained on purified peripheral blood lymphocytes from the same
mice after activation with a combination of PMA and A23197 for 16 h.
|
|
The extent and time course of NFAT activation in transgenic thymocytes,
splenocytes, and lymph node T-cells were determined following
activation for different times with either immobilized anti-CD3 mAb or
by a combination of PMA and A23187. As shown in Fig.
2, NFAT activation was transient and
peaked sharply at 12 h in response to either stimulation, the only
exception being an anticipated response of thymocytes to
pharmacological stimulation. Qualitatively and quantitatively similar
results were obtained reproducibly on thymocytes and splenocytes from
these mice, whereas the response of lymph node T-cells was
quantitatively variable, possibly reflecting priming by previous
exposure of the mice to environmental antigens (data not shown).
Nevertheless, NFAT activation in T-cells faithfully reproduces the
transient response of NFAT to T-cell-activating stimuli, indicating
that this mouse line can be used as a tool for the analysis of
physiological responses to antigen in normal mouse lymphocytes.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 2.
Time course of NFAT-dependent
luciferase expression in lymphoid organs of NFAT/luc transgenic
mice. The relative luciferase activity in lymphocyte extracts from
thymus, spleen, and lymph node of a representative NFAT/luc mouse is
shown. Cells were activated for the times indicated either by
cross-linking the TCR·CD3 complex using an anti-CD3 mAb
(top panel) or with a combination of PMA and A23187
(bottom panel).
|
|
Expression of a Constitutive NFAT Activity in Mouse
Brain--
NFAT family members are expressed broadly in many tissues;
however, expression in tissues other than lymphocytes has in many cases
been shown only at the RNA level and has mostly not been related to
activity. Because all NFAT factors recognize similar DNA binding
motifs, we reasoned that expression of luciferase activity in NFAT/luc
mice in body districts other than the immune system might be indicative
of expression of functional NFAT proteins. We therefore assayed a panel
of tissues from these mice for luciferase activity. As shown in Fig.
3A, high levels of luciferase
activity were reproducibly found in the brain. Furthermore, low but
significant luciferase activity was found consistently in the eye. On
the other hand, in two out of eight mice analyzed, a high level of luciferase activity was found in the skin, whereas no activity was
detectable in the skin of the remaining mice (Fig. 3A and data not shown), suggesting that the NFAT activity detected in the skin
might either be inducible or be expressed by migrating cells, such as
dendritic cells. This phenomenon is being characterized and will be the
topic of another paper. Here we have characterized further the NFAT
activity found in the brain.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 3.
Luciferase activity in different organs of
NFAT/luc mice. Panel A, relative luciferase activity in
extracts from different organs of a representative NFAT/luc mouse.
Panel B, relative luciferase activity in extracts from
sequential sections of the brain of a representative NFAT/luc mouse,
dissected along the antero-posterior axis (samples 1-7).
1, olfactory bulb; 2 and 3, sequential
sections of the forebrain; 4, midbrain; 5, pons;
6, cerebellum; 7, medulla oblongata.
|
|
Expression of transgene-encoded luciferase in the brain might reflect
insertional activation of the transgene, unrelated to NFAT. To rule out
this possibility, NFAT activity in nuclear extracts of total brain and
isolated cerebellum from nontransgenic mice was assayed by
electrophoretic mobility shift. As shown in Fig. 4A, a gel shift of a labeled
oligonucleotide spanning the distal NFAT binding site on the IL-2 gene
enhancer was observed using nuclear extracts from both brain and
cerebellum. As expected, a weak binding activity, strongly up-regulated
after stimulation by a combination of PMA and A23187, was detected in
nuclear extracts from mouse splenocytes. The gel shift of the labeled nucleotide in the presence of nuclear extracts from brain and cerebellum was abolished by the addition of excess unlabeled
oligonucleotide but not by a similar oligonucleotide mutated at
critical residues for NFAT binding nor by an unrelated oligonucleotide
(Fig. 4B). Furthermore, the specific oligonucleotide was
supershifted by an antibody to the Rel homology domain of NFAT1, which
is highly conserved among all NFAT family members (Fig. 4C).
A faster migrating species whith a similar binding specificity for NFAT
was observed both in brain and cerebellum (Fig. 4), possibly reflecting
the existence of additional NFAT members or NFAT-related proteins in
these tissues. Hence the luciferase activity detected in the brain of
NFAT/luc mice reflects a constitutive NFAT activity in mouse brain.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 4.
Characterization of NFAT activity in mouse
brain. Panel A, nuclear extracts used in the
electrophoretic mobility shift assay were obtained from normal mouse
brain and cerebellum and from resting splenocytes or splenocytes
maximally activated with a combination of PMA and A23187. A nuclear
extract from untreated C2C12 cells was used as a negative control. The
oligonucleotide corresponds to the distal NFAT binding site on the
murine IL-2 gene promoter. Panel B, the specificity of the
NFAT binding activity in the brain and cerebellum was assessed using as
competitor an excess of either unlabeled specific oligonucleotide or a
specific oligonucleotide carrying substitutions at positions critical
for DNA binding (NFATm), or an aspecific oligonucleotide
(asp). Panel C, the specificity of the NFAT
binding activity in the brain and cerebellum was assessed in a
supershift assay using a polyclonal antibody specific for the Rel
homology domain of NFAT1.
|
|
Identification and Cloning of a Novel NFAT1 Isoform in Mouse
Brain--
Expression and costitutive activity of NFAT1 in the mouse
olfactory bulb has been reported previously (22). NFAT3 has also been
shown to be expressed in hippocampal neurons, albeit inducibly (28).
Furthermore, the mRNA encoding a novel atypical family member,
NFAT5, has also been detected in brain (14). Quantitation of luciferase
activity along the antero-posterior axis of the brain of these mice
showed (Fig. 3B) that luciferase was expressed not only in
the olfactory bulb (bar 1) but in all brain districts, with
the lowest levels in the hindbrain (bars 5-7), suggesting that the constitutive NFAT activity responsible for luciferase expression in the brain of NFAT/luc mice might result from the combined
activity of different family members and/or to a previously unidentified NFAT factor.
To assess this possibility, we screened a mouse brain cDNA library
using the Rel homology domain of NFAT1 as a probe. Three positive
clones ( 1 and the identical clones H1/H7) were isolated independently, and their nucleotide sequences were determined. As shown
in Fig. 5, the longest sequence compiled
from overlapping clones contained an open reading frame of 458 codons.
The N-terminal portion of the predicted translation product of the open
reading frame showed a 100% identity with NFAT1, with the exception of one nonconservative substitution at residue 287 of the published sequence resulting from a single base change. This region included part
of the NFAT homology domain and most of the Rel homology domain
(residues 216-618 of NFAT1). The homology stopped abruptly downstream
of the minimal DNA binding domain in the Rel homology region (41). The
55-amino acid residue C-terminal peptide encoded by the open reading
frame did not show significant homology with any other sequence in the
GenBank and EMBL data bases (Fig. 5A). The cDNA ended
with a poly(A) tail (Fig. 5A). Furthermore, a cDNA clone
of the same length as 1 was isolated from a brain cDNA library
from a different mouse strain, ruling out the possibility of a
recombination artifact (data not shown). The 100% identity of the
5'-portion of the open reading frame with the central portion of NFAT1
suggested that we had isolated a partial cDNA encoding a novel
isoform of NFAT1. To assess this point, we carried out a RT-PCR using
for first strand cDNA synthesis a primer mapping in the unique
3'-portion of the cDNA, and for amplification a pair of primers
designed to span NFAT1 cDNA from the initial ATG to codon 223 (Fig.
5A). The RT-PCR gave a fragment of the expected size (not shown), and
nucleotide sequence determination confirmed the identity of this
fragment with the 5'-end of the cDNA encoding NFAT1, with the
exception of a T to C transition at codon 78, resulting in a non
conservative substitution as compared with the published sequence. A
full-length cDNA was subsequently obtained by RT-PCR. The
full-length cDNA sequence and predicted translation product are
shown in Fig. 5B.

View larger version (83K):
[in this window]
[in a new window]
|
Fig. 5.
Cloning and nucleotide sequence of mouse
NFAT1-D cDNA. Panel A, cloning of NFAT1-D cDNA.
Partial cDNA clones were obtained from a mouse brain cDNA
library. Clones H1/H7 and 1 are partially overlapping. The
5'-portion of the cDNA was obtained by RT-PCR using as primer for
first strand synthesis RT1 or RT2, which map in the unique region of
NFAT1-D, and as amplification primers two oligonucleotides mapping in
the 5'-region of NFAT1. A scheme of the full-length NFAT1-D cDNA
showing its homologies with NFAT1 (gray and checkered
boxes) and its unique 3'-region (white box) is shown at
the bottom of the panel. Panel B,
nucleotide sequence and deduced amino acid sequence of NFAT1-D
cDNA. The unique region is underlined. Nucleotide
sequences are numbered on the left, and amino
acid sequences are on the right. The star denotes
the stop codon.
|
|
The cDNA encodes a protein of 673 amino acid residues, which is
identical to NFAT1 up to residue 618 (with the exception of the
substitutions L78P and P287L) and thus represents a novel NFAT1
isoform, presumably generated by alternative splicing, as is the case
for most known isoforms of NFAT family members (1). Because there are
three known isoforms of NFAT1, named from A to C, we propose to name
this new isoform NFAT1-D (or NFATc2-D, or NFATp-D according to the
alternative nomenclatures). The region of homology of NFAT1-D with the
other NFAT1 isoforms spans the N-terminal NFAT homology region, which
is responsible for transactivation and interaction with calcineurin and
contains the phosphorylatable serine residues that modulate NFAT
activity through the opposite activities of GSK-3 and calcineurin (3,
4, 42). It also includes the minimal region of the Rel homology domain
required for DNA binding (41). Although NFAT1-A, B, and C differ at
their C-termini, the homology among these isoforms extends beyond the Rel homology domain into the C-terminal transactivation domain. On the
contrary, NFAT1-D lacks the whole C-terminal transactivation domain as
well as the last 19 residues of the Rel homology domain, suggesting
that NFAT1-D might be subject to a distinct regulation strategy.
Expression of NFAT1-D in Brain and PC12 Cells--
Northern blot
analysis of total brain RNA using as a probe a PCR amplification
product spanning the unique 3'-portion of the NFAT1-D cDNA showed
that NFAT1-D is expressed in brain but not in T-cells (Fig.
6A). This was confirmed by
RT-PCR analysis of brain and T-cell RNA using primers specific for the
same region of the cDNA (Fig. 6A). Furthermore,
hybridization of poly(A)+ RNA from a panel of adult mouse
tissue revealed that, in addition to the brain, NFAT1-D-specific RNA
was expressed in heart and liver but was undetectable in lung, skeletal
muscle, testis, kidney, and spleen (Fig. 6B). The transcript
found in the brain was of the expected size of ~2.6 kilobases,
whereas a single 2.8-kilobase transcript was found in the liver,
and four longer transcripts of about 3.4, 4.0, 4.4, and 5.5 kilobases were found in the heart, suggesting the existence of
multiple NFAT1-D mRNA isoforms.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 6.
Expression of NFAT1-D in mouse tissues.
Panel A, left, Northern blot (top) and
RT-PCR (bottom) analysis of NFAT1-D mRNA expression in
mouse brain and in a mouse T-cell hybridoma activated with a
combination of PMA and A23187. The RT-PCR product (whose identity was
confirmed by nucleotide sequencing) was obtained by amplification of
the unique 3'-region of NFAT1-D and was used as a probe for the
Northern blot shown above. The migration of 28 S and 18 S rRNA in the
same gel is shown. Right, immunoblot analysis of cell
extracts from similar samples using a polyclonal antiserum raised
against a glutathione S-transferase fusion protein
containing the unique C-terminal region of NFAT1-D. The migration of
molecular mass markers is indicated. Panel B,
Northern blot analysis of NFAT1-D mRNA expression in mouse tissues.
The migration of molecular mass markers is shown. Reprobing with actin
cDNA confirmed that similar amounts of RNA were loaded in each lane
(data not shown).
|
|
Immunoblot analysis of brain lysates using an antiserum to a
glutathione S-transferase fusion protein containing the
unique C-terminus of NFAT1-D showed that NFAT1-D was translated as a protein of the expected molecular mass of 70 kDa (Fig. 6A).
The identity of the protein was further confirmed by
immunoprecipitation of NFAT1-D from brain lysate using the antiserum
specific for the unique C-terminus, followed by immunoblot with a
monoclonal antibody specific for an epitope mapping close to the N
terminus of NFAT1 (data not shown). All brain districts were found to
express NFAT1-D (data not shown), in agreement with the luciferase
expression data shown in Fig. 2. Furthermore, immunoblot analysis, as
well as RT-PCR, showed that the neuronal line PC12 also expressed
NFAT1-D (Fig. 7A and data not
shown).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 7.
Functional characterization of NFAT1-D in
mouse brain. Panel A, immunoblot analysis of brain or
PC12 extracts using either the anti-NFAT1-D antiserum or an anti-NFAT2
monoclonal antibody. Panel B, supershift assay using mouse
brain nuclear extracts and antibodies specific for either NFAT1-D or
NFAT2.
|
|
To assess whether other NFAT family members might contribute to the
NFAT activity found in the brain, brain expression of some other NFAT
factors was tested by immunoblot. As shown in Fig. 7A, NFAT2
was also expressed in the brain but not in PC12 cells, suggesting that
cells other than neurons, such as glial cells, might be responsible for
its expression. Alternatively, neuronal NFAT2 activity might have been
turned off in PC12 cells following transformation. As expected, no
NFAT4 was found either in brain or in PC12 cells (data not shown). To
assess whether NFAT1-D or NFAT2, or both, contributed to the expression
of the luciferase activity in NFAT/luc mice, a supershift experiment using brain nuclear extract was carried out in the presence of either a
monoclonal antibody against NFAT2 or the polyclonal antiserum specific
for NFAT1-D. As shown in Fig. 7B, both antibodies induced supershift of the labeled oligonucleotide, indicating that in addition
to NFAT-1D, NFAT2 and potentially other NFAT family members are
constitutively active in mouse brain. This possibility is supported by
the observation that a combination of the two antibodies failed to
shift the NFAT complex completely (data not shown).
Differential Regulation of NFAT Activity in Neuronal Cells and in
T-cells--
The electrophoretic mobility shift assays showed a
constitutive binding activity of both NFAT1-D and NFAT2 in brain. A
constitutive activity of NFAT1, correlated to the expression of a NFAT1
isoform of a molecular mass identifying it as NFAT1-A, was also
described in the mouse olfactory bulb (22). In T-cells, the activity of both NFAT1 and NFAT2 is inducible only in response to T-cell-activating stimuli. Specifically, increased concentrations of intracellular calcium ions result in activation of calcineurin, which permits nuclear
translocation of NFAT by dephosphorylation of the negatively regulatory
serine residues in the N-terminal NFAT homology domain (6). This
process is exquisitely sensitive to the immunosuppressant CsA (7, 8).
To investigate the regulation of NFAT activity in neuronal cells,
NFAT-driven luciferase expression was tested in the neuronal cell line
PC12. These cells express both NFAT1-D (Fig. 7A) and an
NFAT1 isoform of a molecular mass identifying it as NFAT1-A (22). PC12
cells were either transiently or stably transfected with the NFAT/luc
construct. 8 out of 12 PC12 clones stably transfected with NFAT/luc
expressed significant levels of luciferase, indicating that NFAT
activity is constitutive in neuronal cells, in agreement with the
constitutive expression of an NFAT1 binding activity in nuclear lysates
of PC12 cells (22). Similar data were obtained in transiently
transfected cells (data not shown). Treatment of stably transfected
PC12 cells with CsA for up to 72 h did not affect NFAT activity,
as shown by the unaltered levels of luciferase expression (Fig.
8A), whereas the same
treatment completely suppressed the inducible NFAT activity in a
similar Jurkat T-cell stable transfectant (Ref. 10 and data not shown).
On the other hand, a significant enhancement in
NFAT-dependent luciferase expression was measured in stably transfected PC12 cells that had been induced to differentiate by
treatment with nerve growth factor. Adding CsA to differentiated PC12
cells did not alter luciferase activity (Fig. 8A). In
support of these data, immunoblot analysis of nuclear and cytosolic
extracts of PC12 cells, either untreated or treated for 24 h with
CsA, revealed significant levels of NFAT1-D in the nucleus, regardless of the presence of CsA (Fig. 8B), again suggesting that at
least some NFAT factors in neuronal cells are regulated differently compared with T-cells.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 8.
Regulation of NFAT1-D activity in neuronal
cells. Panel A, relative luciferase activity in
extracts of three PC12 clones stably transfected with the NFAT/luc
construct. Basal levels of luciferase activity in the three clones were
17.7, 3.7, and 2.9 RLU/106 cells, respectively. Activities
are presented as the percent of untreated stably transfected PC12
cells. Cells were either left untreated or treated with 500 ng/ml CsA
for the indicated times. The same experiment was carried out on the
same cells after differentiation by treatment for 7 days with nerve
growth factor on collagen-coated plates. NGF, nerve growth
factor. Panel B, immunoblot analysis of nuclear
(n) and cytosolic (c) extracts of PC12 cells,
either untreated or treated with 500 ng/ml CsA for 24 h. Equal
amounts of proteins were loaded in each lane. The migration
of molecular mass markers is indicated.
|
|
To understand whether NFAT1-D regulation depends on its cellular
context, the cDNA encoding full-length NFAT1-D was cloned into a
mammalian expression vector under the control of a strong constitutive
promoter and transiently cotransfected in Jurkat T-cells together with
the NFAT/luc reporter. A similar construct encoding NFAT-1C, which is
known to be regulated in T-cells, was used as a control. As shown in
Fig. 9A, ectopic expression of NFAT1-D, while not affecting the basal transcription of the reporter gene, resulted in significant up-regulation of the levels of luciferase activity induced by a combination of PMA and a calcium ionophore and
dependent on endogenous NFAT proteins. This enhancement was completely
abrogated by treatment with CsA, indicating that, when expressed in
T-cells, NFAT1-D is regulated like endogenous NFAT proteins. As
expected, similar results were obtained by overexpression of NFAT1-C
(Fig. 9A).

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 9.
Regulation of NFAT1-D activity in
T-cells. Panel A, relative luciferase activity in
Jurkat T-cells transiently transfected with either empty vector or
vectors encoding NFAT1-C or NFAT1-D, and activated for 8 h with a
combination of PMA and A23187 in the presence or absence of 500 ng/ml
CsA. Luciferase activities have been normalized to the chloramphenicol
acetyltransferase activities in transfection controls. The data show
the results of two independent experiments, each with duplicate
samples. Panel B, confocal microscopy of Jurkat cells
transiently transfected with a NFAT1-D/GFP fusion protein and activated
for 40 min with A23187 (ION) in the absence or in the
presence of 500 ng/ml CsA.
|
|
To confirm further the differential regulation of NFAT1-D in neuronal
cells and T-cells, the cDNA encoding NFAT1-D was tagged with green
fluorescent protein and transiently transfected in Jurkat cells. Cells
were subsequently activated with the calcium ionophore A23187 either in
the absence or in the presence of CsA. The subcellular localization of
the NFAT1-D/GFP fusion protein was analyzed by confocal microscopy. The
results are presented in Fig. 9B. As opposed to neuronal
cells, when expressed in T-cells NFAT1-D was confined to the cytosol in
the absence of stimulation, whereas it rapidly translocated to the
nucleus in response to increased intracellular calcium flux. The
inducible nuclear translocation of NFAT1-D was completely abrogated by
CsA (Fig. 9A). Hence the activity of NFAT1-D is not
intrinsically constitutive, but it is regulated in a tissue-specific
manner. Interestingly, although expression of both NFAT1 and NFAT3 has
been detected in many cell types, the activity of these factors appears
to be consistently dependent on calcineurin activation through a
calcium-dependent, CsA-sensitive mechanism, as reported for
skeletal muscle cells, vascular smooth muscle cells, cardiomyocytes,
adipocytes, and hippocampal neurons (21, 26-28, 43). A similar
regulation of NFAT2 has been described in cardiac endothelial cells
(24, 25). On the other hand, NFAT1-A (22), NFAT1-D, and NFAT2 all
appear to be constitutively active in the brain. A different balance in
the positive and negative components regulating NFAT factors, primarily
calcineurin and GSK3, might underlie the high basal NFAT activity in
mouse brain.
 |
ACKNOWLEDGEMENTS |
We acknowledge Sonia Grassini for technical
assistance, Cristina Ulivieri for assistance and advice on the confocal
microscopy, Silvia Guidotti for automatic sequencing, Aldo Muzzi for
oligonucleotide synthesis, and Giancarlo Benocci for secretarial
assistance. We also thank Ed Palmer and Jerry Crabtree for the
antibodies, Stefano Alemà for nerve growth factor and for useful
suggestions, and Edgar Serfling and Andris Avots for reagents and
productive discussions.
 |
FOOTNOTES |
*
This work was supported in part by the Italian
Association for Cancer Research (AIRC), Telethon Grant E. 651, the
Ministero per l'Università e la Ricerca Scientifica e Techologica
(MURST), and the University of Siena (Piano di Ateneo per la Ricerca
(PAR).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF289078.
The first two authors contributed equally to this work.
§
Recipient of a long term European Molecular Biology Organization
fellowship. Present address: Pharmacia and Upjohn SpA, Viale Pasteur
10, 20014 Nerviano Milan, Italy.
**
Recipient of a fellowship from the University of Siena.

Recipient of an Italian Federation for Cancer Research
(FIRC) fellowship.
¶¶
To whom correspondence should be addressed.
Tel.: 39-0577-232-873; Fax: 39-0577-232-898; E-mail
baldari@unisi.it.
Published, JBC Papers in Press, January 24, 2001, DOI 10.1074/jbc.M007854200
 |
ABBREVIATIONS |
The abbreviations used are:
TCR, T-cell antigen
receptor;
IL, interleukin;
NFAT, nuclear factor of activated T-cells;
CsA, cyclosporin A;
luc, luciferase;
GST, glutathione
S-transferase;
RT, reverse transcription;
PCR, polymerase
chain reaction;
mAb, monoclonal antibody;
PMA, phorbol 12-myristate
13-acetate;
GFP, green fluorescent protein.
 |
REFERENCES |
| 1.
|
Rao, A.,
Luo, C.,
and Hogan, P. G.
(1997)
Annu. Rev. Immunol.
15,
707-747
|
| 2.
|
Beals, C. R.,
Clipstone, N. A.,
Ho, S. N.,
and Crabtree, G. R.
(1997)
Genes Dev.
11,
824-834
|
| 3.
|
Clipstone, N. A.,
and Crabtree, G. R.
(1992)
Nature
357,
695-697
|
| 4.
|
Jain, J.,
McCaffrey, P. G.,
Miner, Z.,
Kerppola, T. K.,
Lambert, J. N.,
Verdine, G. L.,
Curran, T.,
and Rao, A.
(1993)
Nature
365,
352-355
|
| 5.
|
Loh, C.,
Shaw, K. T.,
Carew, J.,
Viola, J. P.,
Luo, C.,
Perrino, B. A.,
and Rao, A.
(1996)
J. Biol. Chem.
271,
10884-10891
|
| 6.
|
Crabtree, G. R.
(1999)
Cell
96,
611-614
|
| 7.
|
Flanagan, W. M.,
Corthesy, B.,
Bram, R. J.,
and Crabtree, G. R.
(1991)
Nature
352,
803-807
|
| 8.
|
Liu, J.,
Farmer, J. D., Jr.,
Lane, W. S.,
Friedman, J.,
Weissman, I.,
and Schreiber, S. L.
(1991)
Cell
66,
807-815
|
| 9.
|
Jain, J.,
Valge-Archer, V. E.,
Sinskey, A. J.,
and Rao, A.
(1992)
J. Exp. Med.
175,
853-862
|
| 10.
|
Baldari, C. T.,
Heguy, A.,
and Telford, J. L.
(1993)
J. Biol. Chem.
268,
2693-2698
|
| 11.
|
Woodrow, M.,
Clipstone, N. A.,
and Cantrell, D.
(1993)
J. Exp. Med.
178,
1517-1522
|
| 12.
|
Ho, S. N.,
Thomas, D. J.,
Timmerman, L. A.,
Li, X.,
Francke, U.,
and Crabtree, G. R.
(1995)
J. Biol. Chem.
270,
19898-19907
|
| 13.
|
Hoey, T.,
Sun, Y. L.,
Williamson, K.,
and Xu, X.
(1995)
Immunity
2,
461-472
|
| 14.
|
Lopez-Rodriguez, C.,
Aramburu, J.,
Rakeman, A. S.,
and Rao, A.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
7214-7219
|
| 15.
|
McCaffrey, P. G.,
Luo, C.,
Kerppola, T. K.,
Jain, J.,
Badalian, T. M.,
Ho, A. M.,
Burgeon, E.,
Lane, W. S.,
Lambert, J. N.,
Curran, T.,
Verdine, G. L.,
Rao, A.,
and Hogen, P. G.
(1993)
Science
262,
750-754
|
| 16.
|
Masuda, E. S.,
Naito, Y.,
Tokumitsu, H.,
Campbell, D.,
Saito, F.,
Hannum, C.,
Arai, K.,
and Arai, N.
(1995)
Mol. Cell. Biol.
15,
2697-2706
|
| 17.
|
Northrop, J. P.,
Ho, S. N.,
Chen, L.,
Thomas, D. J.,
Timmerman, L. A.,
Nolan, G. P.,
Admon, A.,
and Crabtree, G. R.
(1994)
Nature
369,
497-502
|
| 18.
|
Park, J.,
Takeuchi, A.,
and Sharma, S.
(1996)
J. Biol. Chem.
271,
20914-20921
|
| 19.
|
Chuvpilo, S.,
Zimmer, M.,
Kerstan, A.,
Glockner, J.,
Avots, A.,
Escher, C.,
Fischer, C.,
Inashkina, I.,
Jankevics, E.,
Berberich-Siebelt, F.,
Schmitt, E.,
and Serfling, E.
(1999)
Immunity
10,
261-269
|
| 20.
|
Luo, C.,
Burgeon, E.,
and Rao, A.
(1996)
J. Exp. Med.
184,
141-147
|
| 21.
|
Boss, V.,
Abbott, K. L.,
Wang, X. F.,
Pavlath, G. K.,
and Murphy, T. J.
(1998)
J. Biol. Chem.
273,
19664-19671
|
| 22.
|
Ho, A. M.,
Jain, J.,
Rao, A.,
and Hogan, P. G.
(1994)
J. Biol. Chem.
269,
28181-28186
|
| 23.
|
Ranger, A. M.,
Gerstenfeld, L. C.,
Wang, J.,
Kon, T.,
Bae, H.,
Gravallese, E. M.,
Glimcher, M. J.,
and Glimcher, L. H.
(2000)
J. Exp. Med.
191,
9-22
|
| 24.
|
de la Pompa, J. L.,
Timmerman, L. A.,
Takimoto, H.,
Yoshida, H.,
Elia, A. J.,
Samper, E.,
Potter, J.,
Wakeham, A.,
Marengere, L.,
Langille, B. L.,
Crabtree, G. R.,
and Mak, T. W.
(1998)
Nature
392,
182-186
|
| 25.
|
Ranger, A. M.,
Grusby, M. J.,
Hodge, M. R.,
Gravallese, E. M.,
de la Brousse, F. C.,
Hoey, T.,
Mickanin, C.,
Baldwin, H. S.,
and Glimcher, L. H.
(1998)
Nature
392,
186-190
|
| 26.
|
Abbott, K. L.,
Friday, B. B.,
Thaloor, D.,
Murphy, T. J.,
and Pavlath, G. K.
(1998)
Mol. Biol. Cell
9,
2905-2916
|
| 27.
|
Ho, I.-C.,
Kim, H. H.-J.,
Spiegelman, B. M.,
and Glimcher, L. H.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
15537-15541
|
| 28.
|
Graef, I. A.,
Mermelstein, P. G.,
Stankunas, K.,
Neilson, J. R.,
Deisseroth, K.,
Tsien, R. W.,
and Crabtree, G. R.
(1999)
Nature
401,
703-708
|
| 29.
|
Milia, E.,
Di Somma, M. M.,
Baldoni, F.,
Chiari, R.,
Lanfrancone, L.,
Pelicci, P. G.,
Telford, J. L.,
and Baldari, C. T.
(1996)
Oncogene
13,
767-775
|
| 30.
|
Fan, C. M.,
and Maniatis, T.
(1989)
EMBO J.
8,
101-110
|
| 31.
|
Staerz, U. D.,
Rammensee, H. G.,
Benedetto, J. D.,
and Bevan, M. J.
(1985)
J. Immunol.
134,
3994-4000
|
| 32.
|
Fattori, E.,
Della Rocca, C.,
Costa, P.,
Giorgio, M.,
Dente, B.,
Pozzi, L.,
and Ciliberto, G.
(1994)
Blood
83,
2570-2579
|
| 33.
|
Baldari, C. T.,
Di Somma, M. M.,
Majolini, M. B.,
Ulivieri, C.,
Milia, E.,
and Telford, J. L.
(1998)
Biologicals
26,
1-5
|
| 34.
|
Galvagni, F.,
Cartocci, E.,
and Oliviero, S.
(1998)
J. Biol. Chem.
273,
33708-33713
|
| 35.
|
Bäckström, B. T.,
Milia, E.,
Peter, A.,
Jaureguiberry, B.,
Baldari, C. T.,
and Palmer, E.
(1996)
Immunity
5,
437-447
|
| 36.
|
Pacini, S.,
Ulivieri, C.,
Di Somma, M. M.,
Isacchi, A.,
Lanfrancone, L.,
Pelicci, P. G.,
Telford, J. L,
and Baldari, C. T.
(1998)
J. Biol. Chem.
273,
20487-20493
|
| 37.
|
Brombacher, F.,
Schafer, T.,
Weissenstein, U.,
Tschopp, C.,
Andersen, E.,
Burki, K.,
and Baumann, G.
(1994)
Int. Immunol.
6,
189-197
|
| 38.
|
Naramura, M.,
Hu, R.-J.,
and Gu, H.
(1998)
Immunity
9,
209-216
|
| 39.
|
Rincon, M.,
and Flavell, R. A.
(1994)
EMBO J.
13,
4370-4381
|
| 40.
|
Rincon, M.,
and Flavell, R. A.
(1997)
Mol. Cell. Biol.
17,
1522-1534
|
| 41.
|
Jain, J.,
Burgeon, E.,
Badalian, T. M.,
Hogan, P. G.,
and Rao, A.
(1995)
J. Biol. Chem.
270,
4138-41345
|
| 42.
|
Beals, C. R.,
Sheridan, C. M.,
Turck, C. W.,
Gardner, P.,
and Crabtree, G. R.
(1997)
Science
275,
1930-1934
|
| 43.
|
Xia, Y.,
McMillin, J. B.,
Lewis, A.,
Moore, M.,
Zhu, W. G.,
Williams, R. S.,
and Kellems, R. E.
(2000)
J. Biol. Chem.
275,
1855-1863
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
T. Nguyen, R. Lindner, A. Tedeschi, K. Forsberg, A. Green, A. Wuttke, P. Gaub, and S. Di Giovanni
NFAT-3 Is a Transcriptional Repressor of the Growth-associated Protein 43 during Neuronal Maturation
J. Biol. Chem.,
July 10, 2009;
284(28):
18816 - 18823.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. K. Robbs, A. L. S. Cruz, M. B. F. Werneck, G. P. Mognol, and J. P. B. Viola
Dual Roles for NFAT Transcription Factor Genes as Oncogenes and Tumor Suppressors
Mol. Cell. Biol.,
December 1, 2008;
28(23):
7168 - 7181.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Paccani, F. Tonello, R. Ghittoni, M. Natale, L. Muraro, M. M. D'Elios, W.-J. Tang, C. Montecucco, and C. T. Baldari
Anthrax toxins suppress T lymphocyte activation by disrupting antigen receptor signaling
J. Exp. Med.,
February 7, 2005;
201(3):
325 - 331.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Ahamed, R. T. Venkatesha, E. B. Thangam, and H. Ali
C3a Enhances Nerve Growth Factor-Induced NFAT Activation and Chemokine Production in a Human Mast Cell Line, HMC-1
J. Immunol.,
June 1, 2004;
172(11):
6961 - 6968.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Boncristiano, S. R. Paccani, S. Barone, C. Ulivieri, L. Patrussi, D. Ilver, A. Amedei, M. M. D'Elios, J. L. Telford, and C. T. Baldari
The Helicobacter pylori Vacuolating Toxin Inhibits T Cell Activation by Two Independent Mechanisms
J. Exp. Med.,
December 15, 2003;
198(12):
1887 - 1897.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Gerber, D. Hall, T. Miyakawa, S. Demars, J. A. Gogos, M. Karayiorgou, and S. Tonegawa
Evidence for association of schizophrenia with genetic variation in the 8p21.3 gene, PPP3CC, encoding the calcineurin gamma subunit
PNAS,
July 22, 2003;
100(15):
8993 - 8998.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Tabuchi, H. Sakaya, T. Kisukeda, H. Fushiki, and M. Tsuda
Involvement of an Upstream Stimulatory Factor as Well as cAMP-responsive Element-binding Protein in the Activation of Brain-derived Neurotrophic Factor Gene Promoter I
J. Biol. Chem.,
September 20, 2002;
277(39):
35920 - 35931.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. S. Scott, S. Malcomber, and P. O'Hare
Nuclear Translocation and Activation of the Transcription Factor NFAT Is Blocked by Herpes Simplex Virus Infection
J. Virol.,
October 15, 2001;
75(20):
9955 - 9965.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Paccani, M. Boncristiano, C. Ulivieri, M. M. D'Elios, G. Del Prete, and C. T. Baldari
Nonsteroidal Anti-inflammatory Drugs Suppress T-cell Activation by Inhibiting p38 MAPK Induction
J. Biol. Chem.,
January 4, 2002;
277(2):
1509 - 1513.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|