|
Originally published In Press as doi:10.1074/jbc.M100132200 on January 22, 2001
J. Biol. Chem., Vol. 276, Issue 17, 14393-14399, April 27, 2001
Overproduction of Bacterial Protein Disulfide Isomerase (DsbC)
and Its Modulator (DsbD) Markedly Enhances Periplasmic Production of
Human Nerve Growth Factor in Escherichia coli*
Yoichi
Kurokawa ,
Hideki
Yanagi, and
Takashi
Yura§
From the HSP Research Institute, Kyoto Research Park, Kyoto
600-8813, Japan
Received for publication, January 8, 2001
 |
ABSTRACT |
Production of eukaryotic proteins with
multiple disulfide bonds in the Escherichia coli periplasm
often encounters difficulty in obtaining soluble products with native
structure. Human nerve growth factor (NGF) contains three disulfide
bonds between nonconsecutive cysteine residues and forms insoluble
aggregates when expressed in E. coli. We now report that
overexpression of Dsb proteins known to catalyze formation and
isomerization of disulfide bonds can substantially enhance periplasmic
production of NGF. A set of pACYC184-based plasmids that permit
dsb expression under the araB promoter were
introduced into cells carrying a compatible plasmid that expresses NGF.
The efficiency of periplasmic production of NGF fused to the OmpT
signal peptide was strikingly improved by coexpression of DsbCD or
DsbABCD proteins (up to 80% of total NGF produced). Coexpression of
DsbAB was hardly effective, whereas that of DsbAC increased the total
yield but not the periplasmic expression. These results suggest
synergistic roles of DsbC and DsbD in disulfide isomerization that
appear to become limiting upon NGF production. Furthermore, recombinant
NGF produced with excess DsbCD (or DsbABCD) was biologically active
judged by the neurite outgrowth assay using rat PC12 cells.
 |
INTRODUCTION |
The periplasm of Escherichia coli contains enzymes that
can assist protein folding such as Dsb
(disulfide bond formation) proteins
(1-6), like endoplasmic reticulum of eukaryotes, and can provide an
oxidative environment potentially useful for production of heterologous
secretory proteins (e.g. eukaryotic cytokines and
peptide hormones) that have a number of disulfide bonds (1, 7). Such
proteins can be secreted to the E. coli periplasm as in
frame fusion proteins with a bacterial signal peptide (8-10). It is
often difficult, however, to obtain good yields of proteins by
periplasmic production for a number of reasons (4, 9, 10). By promoting
protein translocation (through the inner membrane) with altered
translocation machinery (11, 12) or with coexpression of
secretion-promoting factors such as molecular chaperones
(e.g. SecB) (4, 9, 10), appreciable improvements
were made for some proteins that contain relatively simple patterns of
disulfide bonds. However, eukaryotic secretion proteins often exhibit
multiple and complex patterns of disulfide bonds (7), and such
structural features have been thought to create difficulties in
obtaining active proteins, because incorrect disulfide bond formation
is likely to yield inactive and insoluble products (13).
Recent studies revealed several novel enzymes and factors involved in
disulfide bond formation in the E. coli periplasm, which include at least four proteins, DsbA, DsbB, DsbC, and DsbD (4, 5,
14-17). These Dsb proteins contain one or more highly conserved thioredoxin-like Cys-Xaa-Xaa-Cys motifs that are crucial for the activity of disulfide oxidoreductases (5, 18). DsbA is a periplasmic
enzyme that can act on nascent polypeptide chains in the formation of
disulfide bonds during their folding (16, 19, 20). DsbC is another
periplasmic enzyme known as a disulfide isomerase and can convert
aberrant disulfide bonds to correct ones (16, 21-24). DsbB and DsbD
are associated with the inner membrane and modulate activities of DsbA
and DsbC, respectively (14, 15, 24, 25). Thus, an efficient chain of
reactions for disulfide bond formation and isomerization seems to be
operated in the periplasm during normal growth.
Based on the above findings, overexpression of Dsb proteins has been
employed to increase efficiency of periplasmic expression of a number
of heterologous proteins with multiple disulfide bonds in E. coli (4, 9, 10). So far, only limited success was reported;
periplasmic expression of some proteins was improved by coexpression of
DsbA, together with addition of reduced glutathione or
N-acetylcysteine to the medium (26). DsbC can become
overloaded upon production of heterologous proteins with multiple
disulfide bonds, leading to insufficient conversion of aberrant
disulfide bonds to the correct forms (4, 7, 27). A dsbC
deletion reduced the production of urokinase (15) or insulin-like
growth hormone I (28) that has disulfide bonds formed between
nonconsecutive cysteine residues but hardly affected production of
alkaline phosphatase or OmpA (15) or human growth hormone that has
disulfide bonds between consecutive cysteine residues (28). These
results indicated potentially important roles of DsbC in folding of
proteins carrying multiple disulfide bonds, especially those involving
nonconsecutive cysteine pairs. It should be noted that DsbC exhibits a
disulfide reductase activity (the active site cysteine residues must be kept reduced to attack incorrectly formed disulfide bonds and catalyze
isomerization (14, 15, 24)) in the highly oxidative periplasmic
environment as compared with the endoplasmic reticulum of eukaryotes
(2, 5, 13); the difference in the redox environment between the two
compartments may be responsible for inefficient expression of some
eukaryotic proteins in E. coli (13). The redox potential of
the active site of DsbC is controlled by DsbD (14, 15, 24) in a fashion
quite distinct from that of protein disulfide isomerase regulated by
reduced glutathione in eukaryotes (5, 13, 29).
In this study, we systematically examined the effects of ìcontrolled
coexpression of sets of Dsb proteins on periplasmic production of human
nerve growth factor (NGF).1 NGF carries three
disulfide bonds with nonconsecutive cysteine pairs and was previously
shown to aggregate upon periplasmic expression in E. coli
(30). The set of newly constructed plasmids provided convenient means
of assessing the effects of controlled coexpression of dsb
genes on specific target proteins expressed from compatible plasmids.
The results revealed a striking enhancement of periplasmic production
of NGF, particularly when both DsbC catalyzing the isomerization and
its membrane-associated modulator DsbD are simultaneously overexpressed.
 |
EXPERIMENTAL PROCEDURES |
Bacterial Strains and Plasmids--
E. coli K12
strain JM109 (F , recA1,
endA1, gyrA96, thi-1,
supE44, relA1, (lac proAB), (F' traD36, proAB,
lacIq lacZ M15), mcrA)
(Takara, Kyoto, Japan) was used as the expression host
throughout the experiments. DM391 (dsbB null mutant of
CA8000) (31) and SR2612 (dsbD null mutant of MC4100) (14)
were kindly provided by D. Missiakas. Plasmid pT7Blue® was purchased
from Novagen. Expression vector
pARK2 for Dsb proteins was
constructed by inserting a fragment of pTrc99A containing a
rrnBT1T2 terminator region into a derivative of pAR3,
pACYC184-based arabinose-inducible expression plasmid compatible with
ColE1-derived plasmids (32). Expression vectors for the target protein
NGF are derivatives of pTrc99A (Amersham Pharmacia Biotech),
which allowed expression of NGF fused in frame to downstream of OmpA,
OmpT, or MalE signal peptide, respectively, under controls of the
trc promoter and the lacIq repressor and
designated pTrc-OmpA, pTrc-OmpT, and pTrc-MalE, respectively. Vectors carrying
each of the signal sequences (synthetic oligonucleotides) were
constructed, and the coding region of the NGF gene (R & D Systems) was
inserted downstream of pTrc-OmpA, pTrc-OmpT, and pTrc-MalE, and the
resulting plasmids were designated pTrc-OmpA-NGF, pTrc-OmpT-NGF, and
pTrc-MalE-NGF, respectively. Some codons rarely used in E. coli were replaced by those used more frequently to improve
translational efficiency of the mature form of the NGF gene; TCA
(Ser1 and Ser2), CCC (Pro5), and
AGG (Arg9) were replaced by AGC, CCG, and CGC, respectively.
Construction of Dsb Expression Plasmids--
Each dsb
gene (plus the respective or slightly modified Shine-Dalgarno sequence)
was cloned by polymerase chain reaction (PCR) as follows:
dsbA, dsbB, and dsbC genes were
amplified with KOD DNA polymerase (Toyobo, Osaka, Japan), and
dsbD was amplified with LA Taq DNA polymerase
(Takara, Kyoto, Japan) and cloned into pT7Blue®. dsbA was
amplified using 5' CGGGAGCTCATCGGAGAGAGTAGA 3' and 5'
GGCCCGGGAATTATTATTTTTTCTCGGA 3' as primers and pSK220 (33) as template,
and the PCR product was digested with SacI and
AvaI, purified, and cloned into the
SacI-AvaI site of pT7Blue®. Similarly,
dsbB was amplified using 5'
GGCCCGGGCTGCGCACTCTATGCATATTGCAGGG 3' and 5'
GGCATATGGATTATTAGCGACCGAACAGATCACG3' as primers and pSS51 (34) as
template, and the PCR product was digested with AvaI and
NdeI, purified, and cloned into the
AvaI-NdeI site of pT7Blue®. dsbC was
amplified using 5' GGCATATGAGGAGGAAGATTTATGAAGAAAGG3' and 5'
CCGTCGACGATTATTATTTACCGCTGGTCATTTTTTGGTGTTCG 3' as primers and Kohara
clone number 468 as template, and the PCR product was digested with
NdeI and SalI, purified, and cloned into the NdeI-SalI site of pT7Blue®. dsbD was
amplified using 5' CCGTCGACGAGGCCGACATGCAGCTGCCGCAAGGCGTCTGGC 3' and 5'
CCGCATGCTTATCACGGTTGGCGATCGCGC 3' as primers and Kohara clone
number 648 as template, and the PCR product was digested with
SalI and SphI, purified, and cloned into the
SalI-SphI site of pT7Blue®. The structure of the
resulting plasmids were confirmed by sequencing and designated
pT7dsbA, pT7dsbB, pT7dsbC, and
pT7dsbD, respectively. Plasmids carrying an artificial
subset of the dsb genes in four combinations were then
constructed. The SacI-AvaI fragment (~0.6 kbp)
of pT7dsbA was inserted into the
SacI-AvaI site of pT7dsbB or
pT7dsbC to yield pT7dsbAB or pT7dsbAC,
respectively. The SalI-SphI fragment (~1.5 kbp)
of pT7dsbD was inserted into the
SalI-SphI site of pT7dsbB or
pT7dsbC to yield pT7dsbBD or pT7dsbCD,
respectively. For construction of the entire set of dsbABCD
genes, the SacI-NdeI fragment (~1.1 kbp) of
pT7dsbAB was inserted into the
SacI-NdeI site of pT7dsbCD to yield
pT7dsbABCD.
Each subset of the genes obtained above was placed under the control of
the araB promoter and the araC regulatory gene on a pACYC184-based vector (pARK2); the SacI-HindIII
fragment of pT7dsbAB, pT7dsbAC,
pT7dsbBD, pT7dsbCD, or pT7dsbABCD was
inserted into the SacI-HindIII site of pARK2,
yielding pDbAB1, pDbAC1, pDbBD1, pDbCD1, or pDbABCD1, respectively.
pDbABCD2 is a kanamycin-resistant version of pDbABCD1 that was
constructed by inserting the BstBI-BstBI fragment
of pDbABCD1 (~4.8 kbp) into pAR3kan carrying kanamycin (instead of chloramphenicol) resistance gene.
Culture Conditions and Protein Expression--
E.
coli JM109 cells carrying an NGF expression plasmid such as
pTrc-OmpT-NGF and a pDb plasmid were grown in L broth (35) supplemented
with ampicillin (50 µg/ml) and chloramphenicol (34 µg/ml) at
37 °C. When a culture reached 20 Klett units (number 66 filter), Dsb
proteins were induced by adding L-arabinose to the medium,
and 30 min later, NGF was induced by adding 50 µM isopropyl- -D-thiogalactopyranoside (IPTG). All chemicals
were of analytical grade supplied by Wako Pure Chemical (Osaka, Japan) or Nacalai Tesque (Kyoto, Japan).
Fractionation of Proteins--
Samples of cells (200 µl) were
harvested by centrifugation, and periplasmic proteins were obtained by
osmotic disruption of spheroplasts; cells were first resuspended into
100 µl of 30 mM Tris-HCl (pH 8.0), 20% sucrose, lysozyme
was added to 0.1 mg/ml, and cells were incubated at 4 °C for 30 min.
After adding MgCl2 to 50 mM, the sample was
centrifuged at 20,000 × g for 10 min, and the
supernatant was taken as periplasmic fraction. The spheroplast pellet
was resuspended in 100 µl of 5 mM MgCl2,
sonicated for 10 min, centrifuged at 100,000 × g at
4 °C for 1 h on a Beckman TLA 120.2 rotor, and the supernatant
was withdrawn as the cytoplasmic fraction. The resulting pellet was
resuspended in 100 µl of 5 mM MgCl2, 1%
octylglucoside, incubated at 4 °C for 10 min, and centrifuged again
at 100,000 × g at 4 °C for 1 h. The
supernatant was used as the membrane fraction, and the pellet was used
as the insoluble fraction. Whole-cell proteins were prepared separately by precipitating a portion (200 µl) of the culture directly with trichloroacetic acid (36).
Analysis of Proteins--
Each of the above fractions was
resuspended in SDS sample buffer, either directly or after
trichloroacetic acid precipitation and washing with acetone, and
heat-treated essentially as described (37). Proteins
(corresponding to equal optical density) were analyzed by SDS
polyacrylamide gel electrophoresis (PAGE) followed by visualization
with Coomassie Brilliant Blue or by immunoblotting with specific
polyclonal antibody against NGF (Santa Cruz Biotechnology, Inc.), DsbA
(kindly donated by Y. Akiyama), -lactamase (5 Prime 3 Prime,
Inc., Boulder, CO), alkaline phosphatase (Nordic Immunological Laboratories), or DnaJ (StressGen, Inc.). The detection system used was
either horseradish peroxidase-conjugated anti-rabbit or -mouse antibody
and an ECL kit (Amersham Pharmacia Biotech) or alkaline
phosphatase-conjugated anti-rabbit or -mouse antibody, nitroblue
tetrazolium chloride, and 5-bromo-4-chloro-3-indolyl phosphate
(Bio-Rad, Inc.). Quantification was carried out by an Intelligent
Quantifier apparatus (BioImage Systems Co., Tokyo, Japan).
Bioassay for NGF Activity--
E. coli JM109 cells
carrying pTrc-OmpT-NGF and pDbCD1 (or pDbABCD1 or vector alone) was
grown in L broth (400 ml × 2) and induced for expression of Dsb
proteins followed by that of OmpT-NGF for 8 h. Cells were
harvested and washed with 0.85% NaCl, and 4 g of wet cells were
resuspended in 40 ml of buffer containing 0.1% (v/v) protease
inhibitor mixture (Sigma). Periplasmic fraction was prepared and
concentrated by a Centiprep 10 concentrator (Amicon), and the buffer
was adjusted to 10 mM Tris-HCl (pH 8.0), 1 mM
EDTA and adsorbed to Affi-prep Polymixin Matrix (Bio-Rad) by shaking overnight on a rotary shaker at 4 °C. After centrifugation at 10,000 × g for 10 min, the supernatant was dialyzed
against 20 mM Tris-HCl (pH 8.0), 1 mM EDTA and
applied to a DEAE Toyopearl column (Tosoh, Tokyo, Japan). After washing
the column with the same buffer containing 0.2 M KCl, NGF
was eluted with the buffer containing 0.5 M KCl. The eluate
was concentrated on a Centricon 10 concentrator (Amicon) to ~2 ml and
dialyzed against 20 mM Tris-HCl (pH 8.0), 1 mM
EDTA. This procedure removed >80% of proteins without apparent loss
of activity.
The partially purified NGF thus obtained was assayed for activity
by adding serial dilutions of sample to rat pheochromocytoma (PC12)
cells (30) grown in RPMI 1640 medium (Life Technologies, Inc.)
supplemented with 5% fetal bovine serum and 10% horse serum using
24-well collagen-coated plates. Mouse NGF (Biomedical Technologies Inc.) served as a standard for comparison. Neurite outgrowth was observed under a microscope after incubation of plates at 37 °C in
5% humidified CO2 for 7 days.
 |
RESULTS |
Construction of the dsb Expression Plasmids--
The
dsbA, dsbB, dsbC, and dsbD
genes were cloned and tandemly joined in various combinations to obtain
artificial operons under the araB promoter on a
pACYC184-based plasmid, pARK2. Each of the dsb genes
contained the entire coding region with short flanking regions on both
sides including a putative Shine-Dalgarno sequence but not a
transcription terminator. Several pairwise combined genes
(dsbAB, dsbAC, dsbCD, and
dsbBD) and the complete set of genes (dsbABCD)
were initially cloned on a high copy plasmid as described under
"Experimental Procedures." Each set of the genes was then placed
under the araB promoter controlled by the araC
regulatory gene on pARK2 vector, and the resulting plasmids were
designated pDbAB1, pDbAC1, pDbBD1, pDbCD1, and pDbABCD1 (Fig. 1). These plasmids are compatible with
ColE1-type plasmids generally used for expression of recombinant
proteins.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 1.
Construction of Dsb expression plasmids.
Organizations of clustered dsb genes are schematically
shown. The dsb genes were cloned and tandemly joined on the
pT7Blue® vector and placed under the control of the araB
promoter on a pARK2 expression vector as described under
"Experimental Procedures."
|
|
When L-arabinose was added to an L broth culture of
E. coli carrying each of the expression plasmids, the
respective Dsb proteins were induced to various levels depending on the
arabinose concentration used (Fig.
2B). DsbA protein (21 kDa) was
detected by Western blotting with DsbA-specific antibody, whereas DsbC
protein (24 kDa) was detected by staining with Coomassie Brilliant Blue
on SDS-PAGE (Fig. 2A), although the mobility observed was
appreciably slower than that predicted from the primary structure as
observed previously by Missiakas et al. (21). On the other
hand, expression of DsbB and DsbD from the plasmids was confirmed by
their abilities to complement the defective phenotypes (higher
sensitivity to dithiothreitol or to CuSO4) of the
respective deletion mutants (data not shown). The growth of host
bacteria carrying pDbABCD1 that can express all the Dsb proteins was
not affected significantly by addition of L-arabinose up to
200 µg/ml, which was adopted as the standard condition.

View larger version (72K):
[in this window]
[in a new window]
|
Fig. 2.
Expression of Dsb proteins from the
expression plasmids. Strain JM109 carrying each of the Dsb
expression plasmids or the vector (pARK2) was grown in L broth
containing chloramphenicol (34 µg/ml) at 37 °C, and Dsb proteins
were induced with L-arabinose for 1 h. Expression of
Dsb proteins was analyzed by SDS-PAGE using a 12.5% acrylamide gel
followed by staining with Coomassie Brilliant Blue (upper
panels) or by immunoblotting of the same gel using DsbA-specific
antibody (lower panels). Numbers to the
left indicate molecular mass (kDa) of protein markers
(Bio-Rad). A, expression of DsbA and DsbC proteins with 200 µg/ml of L-arabinose. The asterisk (*) represents a
nonspecific band and not DsbC. B, dependence of Dsb
expression on L-arabinose concentration.
|
|
Inhibition of Cell Growth by NGF and Its Relief by Dsb
Coexpression--
The human NGF gene was fused with a signal peptide
of ompA, ompT, or malE to facilitate
membrane transport and was expressed in JM109 cells. When these NGF
fusion proteins were induced by adding 0.1 mM IPTG at
37 °C, their production was detected within 30 min, gradually
increased for about 90 min, and cell growth was retarded depending on
the kind of signal peptide used. When the ompA or
malE signal was used, a marked growth inhibition was observed, whereas the ompT signal caused only slight
inhibition (Fig. 3A). Such
differential effects of the various signal peptides suggested that
certain anomaly in membrane transport of NGF fusion protein caused
inhibition of cell growth. Indeed, the amount of periplasmic enzyme
-lactamase was clearly reduced upon induction of OmpA-NGF or
MalE-NGF (data not shown).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 3.
Effects of NGF production and overexpression
of Dsb proteins on cell growth. A, effects of
production of NGF fused with diverse signal peptides. Derivatives of
strain JM109 carrying pTrc-OmpA-NGF ( ), pTrc-OmpT-NGF ( ),
pTrc-MalE-NGF( ), or pTrc-OmpT vector ( ) were grown in L broth
containing ampicillin at 37 °C. When the culture reached 20 Klett
units, expression of NGF was induced by adding 50 µM
IPTG. B, effects of coexpressing OmpT-NGF and DsbABCD. JM109
cells carrying both pTrc-OmpT-NGF and pDbABCD1 ( ) or pTrc-OmpT-NGF
and pACYC184 vector ( ) were grown in L broth containing ampicillin
and chloramphenicol at 37 °C, and when the culture reached 20 Klett
units, expression of Dsb proteins was induced by
L-arabinose (L-ara; 200 µg/ml),
followed by induction of OmpT-NGF with 50 µM IPTG after
30 min.
|
|
We then introduced the Dsb expression plasmid (pDbABCD1) into the
above strains and examined the effects of Dsb coexpression on cell
growth. The growth inhibition observed upon OmpA-NGF or MalE-NGF
expression was found to be exacerbated when Dsb proteins were
coexpressed; no clones carrying both the OmpA-NGF and pDbABCD1 (or
pDbAB1) expression plasmids were obtained even after prolonged incubation. Although a clone carrying both OmpA-NGF and pDbCD1 expression plasmids was obtained, no accumulation of NGF or
-lactamase was observed (data not shown). In contrast, the slight
but significant growth inhibition observed upon OmpT-NGF expression was
completely relieved when the Dsb proteins were coexpressed by addition
of L-arabinose (Fig. 3B). These results
suggested that OmpT-NGF fusion protein can be successfully transported
to the periplasm at least to some extent and that membrane transport of
this, as well as other periplasmic proteins, is enhanced by
overproduction of Dsb proteins in the periplasm.
Effects of Dsb Coexpression on the Production and Localization of
NGF--
To determine whether overexpression of the Dsb proteins
enhances production of NGF possibly through assisting the folding of
OmpT-NGF, various sets of Dsb proteins were coexpressed from the
expression plasmids, and their effects on the amount of OmpT-NGF produced and on periplasmic localization were compared. Coexpression of
DsbAB or DsbCD should enhance the efficiencies of either disulfide bond
formation or isomerization, respectively, whereas that of DsbAC
increases both the disulfide bond formation and isomerization activities. Under these conditions, coexpression of OmpT-NGF did not
affect the levels of DsbA and DsbC significantly (data not shown).
As shown in Fig. 4, the control cells
carrying the pACYC184 vector produced NGF of which about 30% was found
in the periplasmic fraction after induction for 3.5 h (lanes
1 and 6). Coexpression of DsbAB hardly affected the
total or periplasmic expression of NGF (lanes 2 and
7), whereas that of DsbAC increased the total yield nearly
2-fold but hardly increased the periplasmic production (lanes
3 and 8). Essentially the same result was obtained when the level of DsbAC coexpression was further enhanced by using a higher
concentration of arabinose (data not shown). In contrast, coexpression
of DsbCD enhanced the total NGF production by about 2-fold and the
periplasmic expression by about 3-fold over the vector control; namely,
about 60% of total NGF was recovered in the periplasm (lanes
4 and 9). Even higher periplasmic production of NGF
(~80%) was observed when all the Dsb proteins (DsbABCD) were
overexpressed (lanes 5 and 10). In the presence
of excess DsbCD or DsbABCD (but not DsbAB), NGF was significantly
stabilized, which probably explains the increase in total NGF
production (data not shown).

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 4.
Effects of coexpression of different subsets
of Dsb proteins on OmpT-NGF production. Derivatives of strain
JM109 carrying both pTrc-OmpT-NGF and a Dsb expression plasmid (or
pACYC184 vector) were grown in L broth, and expression of Dsb proteins
and OmpT-NGF was induced as described in the legend to Fig. 3. After
induction of OmpT-NGF for 3.5 h, whole-cell proteins (lanes
1-5) and periplasmic proteins (lanes 6-10) were
prepared separately from equal volumes of each culture. Proteins were
analyzed by SDS-PAGE (15% gel) followed by immunoblotting for NGF and
-lactamase (Bla) and quantified as described under
"Experimental Procedures." Values shown below the
blots indicate amounts of NGF obtained relative to that
found in whole-cell proteins from the vector control (lane
1).
|
|
Effects of Varying Levels of DsbABCD Coexpression on Localization
of NGF--
To further assess the effects of DsbABCD coexpression on
OmpT-NGF production, we varied the level of Dsb coexpression and analyzed its effect on distribution of NGF into several distinct subcellular fractions. The extent of Dsb coexpression, within the range
tested, hardly affected the total amount of NGF produced, whereas NGF
obtained in the periplasmic fraction increased markedly with increasing
level of Dsb coexpression (Fig.
5A), concomitant with the
decrease in the insoluble fraction (Fig. 5B). Again, about
80% of the total NGF produced was found in the periplasm at the
maximum Dsb coexpression. Only the band with mobility characteristic of
the mature NGF was detected, suggesting that the signal peptide was
effectively removed from the precursor OmpT-NGF by processing. The
periplasmic fraction analyzed contained most of -lactamase and
alkaline phosphatase as expected but very little cytoplasmic protein,
DnaJ (Fig. 5A). Thus, NGF found in the periplasmic fraction most probably represents soluble forms of protein that had been successfully processed and correctly folded in the periplasm.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 5.
Effects of varying levels of DsbABCD
coexpression on intracellular distribution of OmpT-NGF. Strain
JM109 carrying both pTrc-OmpT-NGF and pDbABCD1 was grown, and Dsb
proteins and OmpT-NGF were induced as described in the legend to Fig.
3. After a 1-h induction of OmpT-NGF, cells were collected,
fractionated, and analyzed as described under "Experimental
Procedures." A, effects of Dsb coexpression level on the
periplasmic expression of OmpT-NGF. Whole-cell proteins (lanes
1-4) and periplasmic proteins (lanes 5-8) were
analyzed by SDS-PAGE (15% gel) followed by immunoblotting with a
mixture of antibodies against NGF, DnaJ, -lactamase
(Bla), alkaline phosphatase (PhoA) and PhoA-conjugated
secondary antibody. B, effects of Dsb coexpression level on
the intracellular localization of OmpT-NGF. Whole-cell proteins
(W), periplasm (P), cytoplasm (C),
membrane (M), and insoluble fractions (I) were
prepared from equal volume of cultures, analyzed by SDS-PAGE,
immunoblotted as in A, except that the secondary antibody
used was horseradish peroxidase-conjugated antibody, and quantified as
described under "Experimental Procedures." Cytoplasmic fraction is
not shown, because the amount of NGF detected was negligible for all
cultures examined.
|
|
Periplasmic Production of Active NGF by Dsb Coexpression--
To
further substantiate the above possibility, we determined the
biological activity of soluble NGF found in the periplasm by using
neurite outgrowth assay with rat PC12 cells. To remove proteins toxic
to the cells while minimizing possible denaturation or refolding of NGF
produced, the periplasmic fraction was concentrated without salt
precipitation followed by treatments with affinity and ion-exchange
columns. Bioassays with serial dilutions of product revealed that NGF
found in the periplasm upon DsbCD (or DsbABCD) overexpression exhibit
activity comparable with that of authentic mouse NGF (Fig.
6, B and C). On the
other hand, the NGF recovered from similar periplasmic fraction
obtained without overexpression of Dsb proteins, even after 4-fold
concentration, failed to show any detectable activity (Fig.
6A), indicating that NGF produced under these conditions is
hardly active. These results strongly suggest that NGF produced and
transported to the periplasm in E. coli become biologically
active only when assisted by extensive overexpression of DsbCD (or
DsbABCD).

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 6.
Bioassay for NGF produced under Dsb
overexpression. PC12 cells were treated with partially purified
recombinant NGF (100 ng/ml) produced in the absence (A) or
presence of excess DsbCD (B) or authentic mouse NGF (100 ng/ml) (C). Microscopic observation was made after a 7-day
incubation.
|
|
 |
DISCUSSION |
We have constructed a set of versatile plasmids for controlled
expression of Dsb proteins to assess the effects of coexpression on
periplasmic production of recombinant proteins in E. coli. These plasmids permit coordinate induction of different sets of Dsb
proteins by manipulating their expression levels and timing independently from that of the target recombinant protein. The maximum
extents of overproduction for DsbA and DsbC proteins were severalfold
higher than the normal levels but hardly affected cell growth under the
conditions employed.
Among the three signal peptides tested, the OmpT signal turned out to
be most effective for producing soluble NGF with apparently little
effects on translocation of periplasmic proteins and host cell growth,
and the slight inhibitory effect on growth was overcome by
overexpressing the whole set of Dsb proteins (Fig. 3). In contrast, when the OmpA or MalE signal was used, marked growth inhibition was
observed upon induction of NGF presumably because of defective membrane
transport of secretory proteins; however, this defect was not rescued
by overproduction of Dsb proteins. Although the mechanism of secretion
defects remains obscure, the N terminus of mature NGF containing three
consecutive serine residues tends to form a -turn structure and
could be involved in translocation inhibition of NGF precursor. The
present results revealed that such inhibition can be alleviated by
using an appropriate signal peptide.
Among the subsets of Dsb proteins tested, coexpression of DsbCD but not
DsbAB was effective and that of DsbABCD was most effective for
obtaining soluble NGF in the periplasm (Fig. 4). Thus, although coexpression of DsbAB alone has little effect, that of both DsbAB and
DsbCD are highly effective perhaps through synergistic function between
two pairs of proteins in assisting folding of NGF. Although DsbCD could
assist transport of the target protein directly or indirectly by
pulling the precursor into the periplasm (17), it seems more likely
that overexpressed DsbCD proteins efficiently promoted isomerization of
aberrant disulfide bonds formed on nascent NGF, thus yielding correctly
folded products. Sone et al. (16) demonstrated that
overexpressed DsbC acts as disulfide isomerase on the mutant alkaline
phosphatase, which contains aberrant disulfide bonds formed between
consecutive cysteine residues. However, only a limited success was
reported on disulfide isomerase-assisted periplasmic production of
heterologous proteins that contain multiple disulfide bonds between
nonconsecutive cysteine residues (nonconsecutive-type) (17, 29). The
success probably depends not only on overexpression of the DsbC
isomerase but also on maintaining the disulfide-reductase activity of
DsbC in the oxidized environment of periplasm. Coexpression of rat
protein disulfide isomerase in E. coli significantly
increased the total yield of bovine pancreatic trypsin inhibitor, which has three disulfide bonds of nonconsecutive type but failed to reduce
the amount of incorrectly folded products (29). When DsbC was
overexpressed with insulin-like growth hormone I, which also has three
nonconsecutive disulfide bonds, the total or insoluble products
increased but not the periplasmic products, despite the fact that the
active site cysteine residues of DsbC were kept partially reduced
(17).
In the course of the present study, Qiu et al. (38) reported
production of a soluble and active human tissue plasminogen activator
that has 527 amino acid residues and 17 nonconsecutive disulfide bonds
in the E. coli periplasm by overexpressing DsbC (38).
However, in this case, overexpressed DsbC might act stoichiometrically rather than catalytically, and the inactivated DsbC could inhibit the
membrane transport of precursor DsbC and other proteins essential for
cell growth. The present results based on the differences between DsbAC
and DsbCD coexpression suggested that overexpression of DsbC is
necessary but not sufficient for obtaining maximum periplasmic
production of NGF; coexpression of DsbC with DsbD, which is presumably
required for regenerating DsbC, appeared to be crucial for efficient
isomerization of disulfide bonds in the E. coli periplasm.
Consistent with this proposal, expression of a bovine pancreatic
trypsin inhibitor containing three disulfide bonds
(nonconsecutive-type) yielded intermediates mostly with aberrant
disulfide bonds in a dsbD deletion mutant (14). Similarly, the yield of active human placental alkaline phosphatase was low, whereas bacterial alkaline phosphatase was normally produced in the
dipZ (dsbD) mutant presumably because of
formation of aberrant disulfide bonds (39). It thus seems clear that
DsbD, as well as DsbC, can become overloaded upon overexpression of
heterologous proteins having multiple disulfide bonds.
Because the increasing levels of DsbABCD coexpression enhance the
amount of soluble NGF found in the periplasm with concomitant decrease
in insoluble products, the overproduced Dsb proteins are most likely to
enhance the periplasmic folding of NGF by preventing aggregation.
Coexpression of DsbAB was hardly effective in this respect, suggesting
that enhanced disulfide-forming activity alone is not sufficient
for facilitating the protein folding. In contrast, coexpression of
DsbAC, DsbCD, or DsbABCD markedly enhanced the total amount of NGF
produced (Fig. 4). Overexpression of DsbC therefore appears to protect
the product in some way from proteolysis; in fact, the NGF product was
stabilized in the presence of excess DsbCD or DsbABCD proteins. On the
other hand, increased periplasmic production of NGF was observed only
when DsbC and DsbD were simultaneously coexpressed (DsbCD or DsbABCD).
This suggests that DsbC can assist conversion of aberrant disulfides of
NGF to the native form but cannot release native, soluble products in
the absence of sufficient amounts of DsbD. The results of bioassay
revealed that recombinant NGF produced with DsbCD overexpression has
activity similar to that of authentic NGF, suggesting that correct
folding of NGF was efficiently catalyzed by overexpressed DsbCD
proteins. Detailed mechanisms of disulfide isomerization including the
mode of modulation of DsbC activity by DsbD or other factors should
have important bearings on further understanding and improving of
periplasmic production of recombinant proteins that require complex
disulfide bond formation.
After completion of this work, two laboratories reported correction of
the primary structure of DsbD (40, 41), which indicated that
translation of the dsbD gene begins at a start codon 76 codons upstream of that previously thought. Because the present
expression plasmids were constructed on the basis of previously
reported gene structure, the excess DsbD proteins obtained here lack
the N-terminal 76 amino acid residues (including 26 possible signal sequences). However, the dsbD gene used did complement the
defective phenotype of dsbD null mutant, and overexpression of DsbCD
(but not DsbAC) exerted distinct effects on the periplasmic expression of NGF (Fig. 4), suggesting active participation of the excess DsbD
produced; the truncated DsbD should retain all the cysteine residues
that may be required for the disulfide oxidoreductase activity. We
therefore believe that the essential finding and conclusion of this
work remains unaffected, although the effect of DsbD overexpression
observed here may have been underestimated.
In conclusion, our results strongly suggest that disulfide bond
isomerization of NGF can be efficiently and synergistically catalyzed
by overexpression of DsbC and its modulator DsbD. Excess DsbC protein
appears to be successfully transported to the periplasm, and its
activity can be effectively maintained by simultaneous supply of excess
DsbD. We also found recently that periplasmic production of horseradish
peroxidase containing multiple disulfide bonds and unstable in E. coli is much improved by overexpressing Dsb proteins (42). The Dsb
coexpression plasmids such as those reported here should prove useful
for studying production of heterologous proteins with multiple
disulfide bonds and prone to aggregation or degradation upon secretion
to the periplasm.
 |
ACKNOWLEDGEMENTS |
We thank Koreaki Ito, Yoshinori Akiyama,
and Michio Sone for providing DsbA antibody, as well as for
discussions, Satish Raina and Dominique Missiakas for kindly
providing the dsb deletion mutants, Shin-ichi Yokota and
Toshio Kaido for technical guidance in cell culture and providing PC12
cells, and Koichi Igarashi and Masaaki Kanemori for helpful
suggestions. We also thank Masako Nakayama, Hideaki Kanazawa, and
Seiji Takahara for technical assistance.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Present address: Dept. of Bioscience, Fukui Prefectural
University, 4-1-1 Kenjojima, Matsuoka-cho, Fukui 910-1195, Japan.
§
To whom correspondence should be addressed: 12 Hazamacho,
Shugakuin, Sakyo-ku, Kyoto 606-8071, Japan. Tel./Fax: 81-75-781-7828; E-mail: tayura@ip.media.kyoto-u.ac.jp.
Published, JBC Papers in Press, January 22, 2001, DOI 10.1074/jbc.M100132200
 |
ABBREVIATIONS |
The abbreviations used are:
NGF, nerve growth
factor;
PCR, polymerase chain reaction;
IPTG, isopropyl- -D-thiogalactopyranoside;
PAGE, polyacrylamide
gel electrophoresis;
kbp, kilobase pair.
 |
REFERENCES |
| 1.
|
Wulfing, C.,
and Pluckthun, A.
(1994)
J. Mol. Biol.
242,
655-669
|
| 2.
|
Wulfing, C.,
and Pluckthun, A.
(1994)
Mol. Microbiol.
12,
685-692
|
| 3.
|
Bardwell, J. C.
(1994)
Mol. Microbiol.
14,
199-205
|
| 4.
|
Georgiou, G.,
and Valax, P.
(1996)
Curr. Opin. Biotechnol.
7,
190-197
|
| 5.
|
Missiakas, D.,
and Raina, S.
(1997)
J. Bacteriol.
179,
2465-2471
|
| 6.
|
Thomas, J. G.,
Ayling, A.,
and Baneyx, F.
(1997)
Appl. Biochem. Biotechnol.
66,
197-238
|
| 7.
|
Joly, J. C.,
and Swartz, J. R.
(1994)
Biochemistry
33,
4231-4236
|
| 8.
|
Izard, J. W.,
and Kendall, D. A.
(1994)
Mol. Microbiol.
13,
765-773
|
| 9.
|
Hockney, R. C.
(1994)
Trends. Biotechnol.
12,
456-463
|
| 10.
|
Makrides, S. C.
(1996)
Microbiol. Rev.
60,
512-538
|
| 11.
|
Perez-Perez, J.,
Marquez, G.,
Barbero, J. L.,
and Gutierrez, J.
(1994)
Biotechnology
12,
178-180
|
| 12.
|
Perez-Perez, J.,
Barbero, J. L.,
Marquez, G.,
and Gutierrez, J.
(1996)
J. Biotechnol.
49,
245-247
|
| 13.
|
Walker, K. W.,
and Gilbert, H. F.
(1994)
J. Biol. Chem.
269,
28487-28493
|
| 14.
|
Missiakas, D.,
Schwager, F.,
and Raina, S.
(1995)
EMBO J.
14,
3415-3424
|
| 15.
|
Rietsch, A.,
Belin, D.,
Martin, N.,
and Beckwith, J.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
13048-13053
|
| 16.
|
Sone, M.,
Akiyama, Y.,
and Ito, K.
(1997)
J. Biol. Chem.
272,
10349-10352
|
| 17.
|
Joly, J. C.,
Leung, W. S.,
and Swartz, J. R.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
2773-2777
|
| 18.
|
Chivers, P. T.,
Laboissiere, M. C.,
and Raines, R. T.
(1996)
EMBO J.
15,
2659-2667
|
| 19.
|
Alksne, L. E.,
and Rasmussen, B. A.
(1996)
J. Bacteriol.
178,
4306-4309
|
| 20.
|
Alksne, L. E.,
Keeney, D.,
and Rasmussen, B. A.
(1995)
J. Bacteriol.
177,
462-464
|
| 21.
|
Missiakas, D.,
Georgopoulos, C.,
and Raina, S.
(1994)
EMBO J.
13,
2013-2020
|
| 22.
|
Shevchik, V. E.,
Bortoli-German, I.,
Robert-Baudouy, J.,
Robinet, S.,
Barras, F.,
and Condemine, G.
(1995)
Mol. Microbiol.
16,
745-753
|
| 23.
|
Zapun, A.,
Missiakas, D.,
Raina, S.,
and Creighton, T. E.
(1995)
Biochemistry
34,
5075-5089
|
| 24.
|
Rietsch, A.,
Bessette, P.,
Georgiou, G.,
and Beckwith, J.
(1997)
J. Bacteriol.
179,
6602-6608
|
| 25.
|
Bardwell, J. C.,
Lee, J. O.,
Jander, G.,
Martin, N.,
Belin, D.,
and Beckwith, J.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
1038-1042
|
| 26.
|
Wunderlich, M.,
and Glockshuber, R.
(1993)
J. Biol. Chem.
268,
24547-24550
|
| 27.
|
Ostermeier, M.,
and Georgiou, G.
(1994)
J. Biol. Chem.
269,
21072-21077
|
| 28.
|
Joly, J. C.,
and Swartz, J. R.
(1997)
Biochemistry
36,
10067-10072
|
| 29.
|
Ostermeier, M.,
De Sutter, K.,
and Georgiou, G.
(1996)
J. Biol. Chem.
271,
10616-10622
|
| 30.
|
Fujimori, K.,
Fukuzono, S.,
Kotomura, N.,
Kuno, N.,
and Shimizu, N.
(1992)
Biosci. Biotechnol. Biochem.
56,
1985-1990
|
| 31.
|
Missiakas, D.,
Georgopoulos, C.,
and Raina, S.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
7084-7088
|
| 32.
|
Perez-Perez, J.,
and Gutierrez, J.
(1995)
Gene
158,
141-142
|
| 33.
|
Akiyama, Y.,
Kamitani, S.,
Kusukawa, N.,
and Ito, K.
(1992)
J. Biol. Chem.
267,
22440-22445
|
| 34.
|
Kishigami, S.,
and Ito, K.
(1996)
Genes Cells
1,
201-208
|
| 35.
|
Tobe, T.,
Ito, K.,
and Yura, T.
(1984)
Mol. Gen. Genet.
195,
10-16
|
| 36.
|
Yamamori, T.,
and Yura, T.
(1982)
Proc. Natl. Acad. Sci. U. S. A.
79,
860-864
|
| 37.
|
Yano, R.,
Nagai, H.,
Shiba, K.,
and Yura, T.
(1990)
J. Bacteriol.
172,
2124-2130
|
| 38.
|
Qiu, J.,
Swartz, J. R.,
and Georgiou, G.
(1998)
Appl. Environ. Microbiol.
64,
4891-4896
|
| 39.
|
Beck, R.,
and Burtscher, H.
(1994)
Protein Expression Purif.
5,
192-197
|
| 40.
|
Stewart, E. J.,
Katzen, F.,
and Beckwith, J.
(1999)
EMBO J.
18,
5963-5971
|
| 41.
|
Chung, J.,
Chen, T.,
and Missiakas, D.
(2000)
Mol. Microbiol.
35,
1099-1109
|
| 42.
|
Kurokawa, Y.,
Yanagi, H.,
and Yura, T.
(2000)
Appl. Environ. Microbiol.
66,
3960-3965
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J.-Y. Kim, E. A. Fogarty, F. J. Lu, H. Zhu, G. D. Wheelock, L. A. Henderson, and M. P. DeLisa
Twin-Arginine Translocation of Active Human Tissue Plasminogen Activator in Escherichia coli
Appl. Envir. Microbiol.,
December 1, 2005;
71(12):
8451 - 8459.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Segatori, P. J. Paukstelis, H. F. Gilbert, and G. Georgiou
Engineered DsbC chimeras catalyze both protein oxidation and disulfide-bond isomerization in Escherichia coli: Reconciling two competing pathways
PNAS,
July 6, 2004;
101(27):
10018 - 10023.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|