|
Originally published In Press as doi:10.1074/jbc.M009249200 on January 30, 2001
J. Biol. Chem., Vol. 276, Issue 17, 14434-14442, April 27, 2001
PDX-1 Is Required for Activation in Vivo from a
Duodenum-specific Enhancer*
Mary R.
Dusing,
Elizabeth A.
Florence, and
Dan A.
Wiginton
From the Department of Pediatrics, Division of Developmental
Biology, University of Cincinnati College of Medicine and Children's
Hospital Research Foundation, Cincinnati, Ohio 45229
Received for publication, October 10, 2000, and in revised form, December 21, 2000
 |
ABSTRACT |
The purine metabolic gene adenosine deaminase
(ADA) is expressed along a defined spatiotemporal pattern in the
developing mammalian small intestine, where high-level
expression is limited to the villous epithelium of the duodenum. This
activation is observed in rodents as the intestine completes the final
maturation resulting in adult crypt-villus structures at 2-3 weeks
postpartum. A regulatory module responsible for this pattern of
expression has been identified in the second intron of the human ADA
gene. Of the multiple duodenal proteins that can interact with this small duodenal enhancer region, the studies contained in this work
describe the identification of five of these proteins as the dispersed
homeobox protein PDX-1. This transcription factor exhibits a profile of
expression in the small intestine similar to that observed for ADA,
making it an ideal candidate factor for the duodenum-specific ADA
enhancer. Loss of PDX-1 binding, via a PDX-1 mutated enhancer
transgenic construction, resulted in complete loss of high-level
activation in the duodenum, demonstrating the absolute requirement for
this factor in vivo. However, co-transfection experiments
suggest that other proteins that bind the enhancer are also required
for enhancer function because PDX-1 alone was incapable of
significant transactivation.
 |
INTRODUCTION |
Many molecular events and interactions are required in the complex
process of organogenesis of the gut. All of these events must be
regulated within both space and time to result in a functional gastrointestinal tract. The lining of the vertebrate small intestine is
an epithelial monolayer of endodermal origin that is folded into
finger-like projections called villi and recessed pits called crypts.
This monolayer is composed of four differentiated cell lineages. The
majority of cells are enterocytes that express a wide range of genes
required for digestion and absorption. Also present throughout the
epithelium are enteroendocrine cells that secrete peptide hormones and
a variety of growth factors, goblet cells that secrete mucous, and
Paneth cells that express defensins. All four cell types are derived
from a small number of anchored stem cells located near the crypt base
(1, 2). As cells migrate away from the stem cells, the process of
lineage allocation begins. Paneth cells differentiate and migrate to
the base of the crypts. The remaining cell types migrate from the
proliferative compartment in the crypt onto the surface of the
villus as they complete terminal differentiation. The constant
production of differentiating daughter cells by the stem cells causes
the movement of fully differentiated cells along the length of the
villus. At the tip of the villus, cells are either sloughed into the
intestinal lumen or undergo apoptosis (3). Lineage allocation and
terminal differentiation occur along this crypt-to-villus
(C/V)1 axis throughout the
length of the intestine.
Along its length, the small intestine is traditionally divided into
three sections: duodenum, jejunum (sometimes subdivided into proximal
and distal), and ileum. Although each differentiated cell type is
produced along the length of the intestine, a particular cell type can
manufacture widely differing gene products that result in
functional demarcations that correspond to the physical demarcations.
Development from duodenum to ileum is often referred to as
anterior-to-posterior (A/P) development. Both C/V and A/P development
are regulated with respect to developmental time. The A/P positional
identity is established early in embryogenesis and is maintained
throughout the life of the organism (4). The intestinal epithelium
begins as a cuboidal monolayer of endodermal epithelium devoid of
crypt/villus structures. An initial wave of development resulting in
primitive crypt/villus structures begins at 8 weeks of gestation in
humans and shortly before birth in mice. Maturation of the epithelium
into adult crypt/villus structures is completed by 12 weeks of
gestation in humans (5, 6) and 2-3 weeks after birth in mice (7).
To delineate some of the underlying mechanisms involved in determining
positional identity along the A/P axis, lineage allocation along the
C/V axis, and the developmental timing of both, we have chosen to use a
purine metabolic gene, adenosine deaminase (ADA), as a model. ADA is
expressed in a well-defined pattern that is conserved among mammals (8,
9). Within the intestine, high-level ADA expression is limited to the
proximal small intestine, the duodenum, along the A/P axis. Within the
duodenum of both mice and humans, high levels of ADA are limited to the
villous epithelium, where expression is found in the enterocyte
lineage of terminally differentiated cells along the C/V axis (10, 11).
High-level, duodenum-specific expression also exhibits developmental
regulation. In mice, increased ADA levels are observed at the
suckling-weaning transition, coinciding with terminal formation of
adult crypt/villus structures (10, 12, 13). A similar developmental
pattern has been assumed for humans but has not been shown because this differentiation event occurs in utero. It is supported by
the fact that duodenal ADA levels are quite high at birth in
humans.2
The region responsible for this pattern of expression is located in the
second intron of the human ADA gene. Transgenic mice containing an
enhancer fragment from this region of intron 2 express a linked
reporter gene in a manner identical to that of the endogenous ADA gene
along both the A/P and C/V axes of development. Both the reporter gene
and ADA exhibit high-level expression limited to the duodenal
enterocytes of the villous epithelium. The enhancer contains multiple
DNase I-hypersensitive sites in the duodenum, of which one is
predominant, hypersensitive site D (13). The region containing
hypersensitive site D has been observed to be absolutely required for
enhancer function. Removal of this small region of DNA results in a
specific and total loss of duodenum-specific activation. DNase I
footprinting analysis showed that this segment of 319 bp was able to
interact with multiple proteins from duodenal nuclear extract (14).
Sequence analysis of these footprinted regions for transcription factor
consensus binding sites yielded a list of both ubiquitous and
intestinally restricted factors as potential candidates. In this study,
we identify the factor PDX-1 as a protein bound to multiple sites
within the ADA enhancer. Studies that demonstrate the absolute
requirement of PDX-1 for enhancer function in vivo are also
presented. The identification of this protein and investigation of its
role in enhancer function are vital steps to modeling how ADA is
regulated along each axis of development in the intestine.
 |
EXPERIMENTAL PROCEDURES |
Preparation of Intestinal Nuclear Extracts for EMSA
Experiments--
All materials, rotors, solutions, etc. are at 4 °C
unless otherwise stated. All buffers (except buffer D) were
supplemented with 0.5 mM PEFABLOC (Roche Molecular
Biochemicals), 1 µg/ml aprotinin, 1 µg/ml leupeptin, 130 µM bestatin, 1 µg/ml pepstatin A, and 0.5 mM dithiothreitol. A 2-cm3 segment of frozen
human duodenum or 30-40 FVB/N mouse duodena were harvested,
split lengthwise, and washed vigorously in buffer A (50 mM
N-acetyl-L-cysteine, 320 mM sucrose,
50 mM HEPES-KOH, pH 7.9, 25 mM KCl, 5 mM MgCl2, 1 mM CaCl2,
and 1% milk powder) on ice. Tissues were transferred to a new aliquot
of buffer A (20-25 ml) and homogenized briefly (for about 5 s)
with an Ultra Turrax homogenizer after addition of every 10 duodena.
Mild homogenization prevented disruption of the muscular layer that was
subsequently removed by filtering the homogenate through spectra-por
mesh and then homogenized for 20-30 strokes in a ground glass
homogenizer. Nuclei were pelleted at 2,000 rpm at 4 °C in a Beckman
JS13.1. The pellet was washed twice in 10 ml of buffer A and
resuspended in 3 ml of buffer A, which was then mixed with 60 ml of
buffer B (2.2 M sucrose, 50 mM HEPES-KOH, pH
7.9, 25 mM KCl, 5 mM MgCl2, and 1 mM CaCl2). The nuclei were layered equally over
15 ml of buffer B and spun in a Beckman SW28 rotor for 1 h at
50,000 rpm at 4 °C. The supernatant was aspirated, and the pellet
was resuspended in 10 ml of buffer C (20 mM HEPES-KOH, pH
7.9, 25% glycerol, 0.42 M NaCl, 1.5 mM
MgCl2, and 0.2 mM EDTA). Resuspended nuclei
were lysed by homogenization, mixed for 30 min on ice, and spun at 15,000 rpm at 4 °C for 30 min in a Beckman SW60 rotor.
Nuclear proteins were precipitated with NH4SO4
and collected by centrifugation for 25 min at 35,000 rpm at 4 °C in
the SW60 rotor. The protein pellet was resuspended in 0.5-1.0
ml of buffer D (20 mM HEPES-KOH, pH 7.9, 20% glycerol, 0.1 M KCl, and 0.2 mM EDTA) and dialyzed against
buffer D. Protein concentrations were assessed using Bio-Rad protein
assay (Bio-Rad).
Oligonucleotides--
All oligonucleotides were synthesized at
the University of Cincinnati DNA core facility and are as shown in Fig.
1. Mutated oligonucleotide sequences are identical to the wild type
oligonucleotides, except for the double point mutations listed in Table
I. P1 oligonucleotide sequence is GCCCTTAATGGGCCAAACGGCA (15). Opposite
strand DNAs were resuspended and mixed in equimolar amounts. DNA
mixtures were heated to 90 °C for 10 min and then slow cooled to
25 °C to duplex. An aliquot was diluted to 10 pmol/µl and served
as 100× competitor in gel shift experiments. Another aliquot was purified through 4% Biogel (Qbiogene, Carlsbad, CA) and the DNA isolated using the Mermaid kit (Qbiogene). This purified
oligonucleotide preparation was quantitated, diluted to 0.5 pmol/µl,
and used as labeling stock.
In Vitro Transcription/Translation of PDX-1--
The plasmid
pKK4 containing the PDX-1 cDNA was a gift from Dr. Helena Edlund
(16). It was linearized with HindIII and used as a template
for in vitro transcription/translation using TNT T7-coupled
reticulocyte lysate (Promega, Madison, WI) as per the manufacturer's instructions.
EMSA--
0.5 pmol of gel-purified, duplexed oligonucleotide was
labeled using -32P (6000 Ci/mmol) and polynucleotide
kinase. Labeled oligonucleotides were purified using Sephadex G-25 spin
columns (Roche Molecular Biochemicals) in a volume of 50 µl. Binding
reactions contained 5 µl of 5× buffer E (125 mM
Tris, pH 8.0, 32.5 mM MgCl2, 2.5 mM dithiothreitol, 2.5 mM EDTA, 250 mM KCl, and
0.6 µg/µl bovine serum albumin), 0.5 µl of
poly(dI·dC)/poly(dA·dT) (2 µg/µl), 10 µl of nuclear
extract or extract diluted with buffer D (as in nuclei preparation),
and competitor oligonucleotide and/or antibody as needed plus water to
a final volume of 24 µl. Binding reactions were incubated for 15 min
on ice, after which 1 µl of probe (10 fmol at 40,000-80,000 cpm) was
added, and incubation was continued for 15 min on ice. The entire
reaction mixture was loaded onto a 6% polyacrylamide gel and
electrophoresed at 4 °C, 30 mA in 1× glycine buffer (50 mM Tris base, 0.38 M glycine, and 2 mM EDTA). Gels were dried in vacuo and exposed
to x-ray film overnight. Anti-PDX-1 antibody was the generous gift
of Dr. Helena Edlund.
Plasmid Constructions and Mutagenesis--
pALTER-1
(Promega) was digested with SmaI, and BsiWI
linkers (New England BioLabs, Beverly, MA) were ligated to form
pALTER-1 BsiWI. The 319-bp BsiWI fragment
containing the enhancer was isolated from pALT 3.4( )Dmut (14) and
ligated into BsiWI-digested pALTER-1 to form pALTER 319+.
Single-stranded DNA was produced from this phagemid, and site-directed
mutagenesis was performed according to the Altered sites protocol
(Promega). Successive rounds of mutagenesis were used to introduce all
of the double point mutations shown in Table I into the enhancer
fragment. The mutated BsiWI enhancer fragment was sequenced
in its entirety to ensure fidelity of both the mutated sites and the
remaining sequences. The mutated enhancer fragment was liberated with
BsiWI and ligated into BsiWI-cut p5'acba L117 D
(14) to generate p5'acba L117 PDX mut. The target vector for
co-transfection analysis is the plasmid described previously as
p5'acba 3 (13). A Rous sarcoma virus-driven PDX-1 expression vector
and the control target pInsulin-CAT were a generous gift from Dr.
Helena Edlund (16). The empty expression vector pRSV0 was made from the
PDX-1 expression vector by removing the PDX-1 cDNA and religating
the plasmid. pGEM 4Z was from Promega.
Transgene Fragments, Mice, and Analysis--
Transgenes listed
as wild type and enhancer have been described previously and
characterized as TG V and TG XIII, respectively (13, 14). p5'acba L117
PDX mut was digested with NdeI and PvuI. The
resulting 18,471-bp fragment was isolated and purified as described
previously (13). Transgenic mice were made by microinjection at both
the Cincinnati Children's Hospital Research Foundation and the
University of Cincinnati core facilities. Analysis of F1
mice was performed between 4 and 6 weeks. CAT assays, protein determination, and copy number analysis were performed as described previously (13). Tissues assayed included tongue, esophagus, stomach,
duodenum, jejunum, ileum, colon, liver spleen, and thymus for each line.
Transient Transfection Analysis--
CHO-K1 (CRL 9618)
cells were cultured in Ham's F-12 media with 10% fetal bovine
serum, 0.05 units of penicillin, and 0.05 µg/ml streptomycin. DNA was
introduced into cells at 60-70% confluence by LipofectAMINE
transfection (Life Technologies, Inc.) according to the manufacturer's
instructions using 7 µl of LipofectAMINE/sample. 0.1 µg of the
target plasmid (p5'acba 3 (13) or pInsulin-CAT) was added alone, with
0.1 µg of the PDX expression vector (pRSV-PDX) or with 0.1 µg of
the empty expression vector (pRSV-0). A constant amount of DNA (2 µg)
was added to each transfection by making up the difference using pGEM
4Z. Transfections were performed twice in duplicate. Cells were washed
5 h after transfection and harvested 48 h after transfection.
The cell extract was assayed for CAT and protein concentration as
described previously (17).
 |
RESULTS |
All the information necessary to direct high-level
duodenum-specific expression in a pattern similar to that of the
endogenous ADA gene along each axis of intestinal development
(cephalocaudal, crypt/villus, and temporal) is contained within a
3.4-kb enhancer fragment from intron 2 of the human ADA gene. A
subregion of 319 bp within this segment that is absolutely required for
enhancer function in the duodenum is shown in Fig.
1A. Regions protected in DNase
I footprinting experiments (14) are shown on the sequence in Fig.
1A as gray-shaded boxes. Sequences within the
footprinted regions were examined by TRANSFAC transcription factor
database search (18) to identify putative binding sites for common
transcription factors. Sequences from these protected regions were also
subjected to analysis using a search file created in our laboratory
containing DNA sequences implicated in the transcriptional regulation
of other genes expressed in the intestine. Among the potential binding sites identified within the footprinted regions are five sequence motifs similar to the known binding site for the pancreatic-duodenum homeobox factor PDX-1 (YHTTAATK) (15, 19) and to known PDX-1 binding
sites such as one from the rat insulin promoter (P1) (15). The sequence
of these PDX-like motifs and the P1 sequence are shown in Fig.
1B.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 1.
Sequence of the ADA duodenal enhancer.
The sequence of the human ADA duodenal enhancer is shown in
A. Numbers above the
sequence correspond to residues of the ADA gene sequence
(GenBankTM accession number M13792). Asterisks
mark the nucleotide residues altered from the published sequence to
create two BsiWI restriction sites. The sequence between
these sites was determined to contain a duodenum-specific enhancer
(13). Sequences within the enhancer protected from DNase I digestion by
duodenal nuclear extracts in footprinting experiments are shown as
gray-shaded boxes, FP 1-FP 5. Oligonucleotides
used as probes for EMSA are indicated by black bars.
Oligonucleotides are named after the footprint in which they reside.
Oligonucleotides FP 4 and FP 5 are found in footprint regions 4 and 5, respectively. Oligonucleotides FP 2a, FP 2c, and FP 2d are all found in
footprint region 2. The oligonucleotide FP 5 was synthesized with both
the endogenous sequence and the BsiWI altered sequence. In
B, the sequences of the five PDX-1 type motifs are compared
with a known PDX-1 binding site from the rat insulin promoter P1. The
name of the oligonucleotide containing each site is also shown.
|
|
Five Independent PDX-1 Binding Sites Are Located in the ADA
Enhancer--
The ability of the PDX-1 motifs within the footprinted
regions to bind PDX-1 and possibly other proteins was assessed by EMSA. Oligonucleotides from both DNA strands encompassing either the entire
footprint or a subregion of each footprint were synthesized, duplexed,
and gel-purified to use as EMSA probes. The location of each
oligonucleotide probe is shown as a solid black line in Fig.
1A. Footprint region 2 contained three PDX-type motifs that were separated into oligonucleotides FP 2a, FP 2c, and FP 2d. Footprint
region 4 is within the oligonucleotide called FP 4. Likewise, footprint
region 5 is located within oligonucleotide FP 5. This oligonucleotide
contains one of the double point mutations created to remove the
enhancer (14). The FP 5 oligonucleotide was synthesized with both the
wild type and BsiWI sequences and used as a probe in gel
shift experiments. EMSAs showed no differences in complexes formed
using either oligonucleotide (data not shown). Gel shifts presented in
this work use the wild type oligonucleotide.
Initial experiments were designed to examine the ability of PDX-binding
motifs found in footprint regions 2 (three sites), 4, and 5 to produce
shifted complexes using mouse duodenal nuclear extracts. Production of
these extracts was designed to enrich epithelial contribution and
minimize the contribution from the underlying intestinal musculature.
Results of these gel shift experiments using oligonucleotides
containing putative PDX sites, FP 2a, FP 2c, FP 2d, FP 4, and FP 5, are
shown in Fig. 2. Each of these
oligonucleotides and the P1 oligonucleotide was labeled with
32P and used as a probe. As mentioned above, P1 contains a
known PDX-1 binding site. Each probe was allowed to react with either 10 µl of buffer only (Fig. 2A, lanes 1, 3, 5, 7, 9, and
11) or 10 µl of buffer containing 10 µg of mouse
duodenal nuclear extract (Fig. 2A, lanes 2, 4, 6, 8, 10, and
12). A trio of shifted complexes is observed using the P1
probe (Fig. 2A, lane 2). A similar trio of shifted complexes
can be observed for each of the ADA enhancer PDX-motifs, although the
intensity of these complexes varies among the sites. Other shifted
complexes were observed as well, often superimposed over the three
PDX-like complexes. These complexes were subjected to competition
experiments (Fig. 2B) as well as antibody supershift
experiments (Fig. 2C). As can be seen clearly in Fig.
2B, the addition of 100-fold molar excess of unlabeled P1
oligonucleotide to the binding reaction containing each of these probes
prevents (Fig. 2B, lanes 2, 4, 6, and
10) or significantly reduces (Fig. 2B, lane
8) formation of these three complexes. This competition is
specific for the P1 oligonucleotide and was not observed when a
nonspecific oligonucleotide or an oligonucleotide with a binding site
for a different homeodomain protein (Cdx) was used as competitor in the
binding reactions (data not shown). Addition of an anti-PDX-1 antibody
to the reactions prohibited formation of the complexes with each probe
(Fig. 2C, lanes 3, 6, 9, 12, and 14). Because the
PDX-1 antibody is directed against the DNA binding domain of PDX-1, a
DNA-protein interaction is prevented, and no complexes or supershifted
complexes are formed. A similar effect was not observed upon addition
of a nonspecific antibody (Fig. 2C, lanes 2, 5, 8, and
11). These results confirm that the three shifted complexes
observed are due to PDX-1 binding to these enhancer sequences. Each of
the three complexes seems to react like PDX-1 alone in gel shift
experiments. All three complexes were always observed in roughly equal
amounts regardless of the amount of nuclear extract or the particular
preparation of extract used in the assay. This suggests that each
complex is the result of a single protein bound to the
oligonucleotides, and that protein is PDX-1. PDX-1 phosphoproteins have
been reported in cells from pancreatic lineages with apparent molecular
weights of 30,000, 42,000, 45,000, and 50,000. The relative
proportion of each phospho-PDX-1 is consistent within a given cell type
but varies between different lineages (20). Similar studies have not
been done with PDX-1 from the duodenum. However, it seems likely that
the three PDX-1 complexes observed in gel shifts using duodenal nuclear
extract are due to the presence of three variously sized phosphorylated
species of PDX-1 from the duodenum. This would explain the presence of
three protein complexes that behave like PDX-1 alone and are always
present in the same relative ratio.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 2.
EMSA with mouse duodenal nuclear
extract. Oligonucleotides containing each of the ADA PDX-1 site
motifs (FP 2a, FP 2c, FP 2d, FP 4, and FP 5) as well as an
oligonucleotide containing the PDX-1 site from rat insulin promoter
(P1) were labeled and used as probes for EMSA. In A, each
oligonucleotide is shown as unreacted probe (lanes 1, 3, 5, 7, 9, and 11) and probe in the presence of 10 µg of
mouse duodenal nuclear extract, MDNE (lanes 2, 4, 6, 8, 10, and 12). A similar pattern of shifted bands is
observed for each oligonucleotide. The same probes were used in
B. Each lane in B contains probe and 10 µg of
extract. Lanes 2, 4, 6, 8, and 10 also contain a
100-fold molar excess of unlabeled P1 as competitor. All lanes in
C contain 10 µg of MDNE. These experiments confirm
that these shifted complexes (lanes 1, 4, 7, 10, and
13) are PDX-1 by their ability to react with a
PDX-1-specific antibody (lanes 3, 6, 9, 12, and
14) but not with a nonspecific antibody (lanes 2, 5, 8, and 11).
|
|
Mutations Specifically Ablate PDX-1 Binding--
A number
of different mutations were introduced into the oligonucleotide
sequences at various positions and assessed by gel shift for the effect
each had on complex formation (data not shown). Mutations that
eliminated only the PDX-1 complexes and not the non-PDX-1 complexes are
shown in Table I as the bold lowercase letters in the sequences labeled 2a mut, 2c mut, 2d mut, 4 mut, and 5 mut. Gel shifts using these mutated oligonucleotides, in comparison to
wild type oligonucleotides, are shown in Fig.
3. PDX-1 protein was produced by in
vitro transcription/translation from a linearized plasmid
containing PDX-1 cDNA (16) and used in the gel shift experiment
shown in Fig. 3A. Each wild type oligonucleotide was used as
a probe and was able to form a PDX-1-specific complex upon addition of
the PDX-1 protein (Fig. 3A, lanes 1, 3, 6, 8, and
11) that co-migrated with the PDX-1 complex produced by the P1 oligonucleotide and PDX-1 protein (Fig. 3A, lanes
5 and 10). Additional non-PDX-1 complexes were also
observed with some of the oligonucleotides. In contrast, the
oligonucleotides containing the PDX-1 binding site mutations shown in
Table I were unable to interact with the PDX-1 protein and hence did
not produce this complex (Fig. 3A, lanes 2, 4, 7, 9, and 12), confirming the ability of these mutations
to ablate PDX-1 binding.
View this table:
[in this window]
[in a new window]
|
Table I
Mutations to PDX-1 motifs
Mutations were introduced into the PDX-type motifs (2a, 2c, 2d, 4, and
5) and are designated by the bold lowercase letters in the sequences
beneath (2a mut, 2c mut, 2d mut, 4 mut, and 5 mut). These mutations
were incorporated into oligonucleotides identical to the wild type
sequences, except for the base pairs noted.
|
|

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 3.
Mutations to the PDX-1 motif eliminate PDX-1
but not other nuclear proteins from complex formation. In
vitro transcribed translated PDX-1 protein was used to test the
efficaciousness of mutations. The resulting EMSA is shown in
A. Each lane contains an equal amount of PDX-1 protein. The
wild type oligonucleotides (lanes 1, 3, 6, 8, and
11) produce a PDX-1 shifted complex, marked with an
asterisk, which co-migrates with a shifted band produced by
the P1 oligonucleotide (lanes 5 and 10). EMSA
with each of the mutated oligonucleotides fails to produce this band
(lanes 2, 4, 7, 9, and 12). 10 µg of
MDNE is used in each lane of B. The indicated PDX-1
shifted complexes produced with the wild type oligonucleotide FP 2c
(lanes 1 and 4), FP 2d (lane 6), FP 4 (lane 10), or FP 5 (lane 14) are competed or
reduced by the addition of 100-fold molar excess of unlabeled self
(lanes 2) or unlabeled P1 oligonucleotide (lanes
7 and 12). The unlabeled mutant oligonucleotide, when
used as a competitor, failed to compete the PDX-1 shifted complexes
(lanes 3, 8, 11, and 15) but did compete for
other shifted complexes produced, as can be seen by the band labeled
with an asterisk. Finally, the mutant oligonucleotides were
labeled and used as probes in EMSA experiments (lanes 5, 9, 13, and 16). These mutant oligonucleotides were unable
to produce the shifted PDX-1 complexes but retained the ability to bind
various other shifted complexes unrelated to PDX-1.
|
|
The final objective of these mutational studies was an enhancer
fragment devoid of PDX-1 sites but with all other potential binding
sites intact. As described above, studies using translated PDX-1
protein identified mutations that eliminated PDX-1 binding. To assess
possible alterations to other protein binding sites, a gel shift using
the mutated oligonucleotides as competitor and/or probes was repeated
using mouse duodenal nuclear extract (Fig. 3B). This extract
can generate a more complex set of bands that is more representative of
the wide range of proteins, in addition to PDX-1, that can interact
with these sequences in vivo. Each lane in Fig.
3B contains 10 µg of mouse duodenal nuclear extract. Shifted complexes formed with wild type FP 2c oligonucleotide are shown
in lane 1. The faster migrating complexes are PDX-1. The
slower mobility complex marked with an asterisk is not
PDX-1. Addition of 100-fold excess of the unlabeled wild type
oligonucleotide reduces all complexes (Fig. 3B, lane 2).
Addition of excess unlabeled mutant oligonucleotide, 2c mut, does not
compete the PDX-1 complexes but does compete the slower mobility
complex marked with an asterisk (Fig. 3B,
lane 3). Comparison of the complexes formed when the wild
type FP 2c and the mutant 2c mut oligonucleotides are used as probes
(Fig. 3B, lane 4 versus lane 5) shows that both
form the slower mobility complex marked with an asterisk,
whereas only the wild type forms the PDX-1 complexes. Examination of
the sequence in this oligonucleotide reveals a GATA-type binding site,
WGATAR (21). This site has recently been shown to bind a GATA protein from duodenal nuclear extract that results in the formation of the
complex marked with an
asterisk.3
Multiple shifted complexes were also produced with the FP 2d oligonucleotide (Fig. 3B, lane 6). PDX-1
complexes could be competed by the addition of excess unlabeled P1
oligonucleotide (Fig. 3B, lane 7) that contains a
wild type PDX-1 binding site, but not by the addition of excess
unlabeled mutant oligonucleotide 2d mut (Fig. 3B, lane
8). The shifted complexes produced by the mutant oligonucleotide
2d mut (lane 9) look identical to those in lane 7 produced by the wild type oligonucleotide in the presence of excess
unlabeled P1 oligonucleotide (i.e. in the absence of PDX-1 complexes). This suggests that the mutation to ablate the PDX-1 binding
site has not affected the binding sites for these other unknown
proteins. Analysis of the sequences within these oligonucleotides suggests that these bands may be the result of another bound
homeodomain protein. Shifted complexes produced by FP 4 oligonucleotide
(Fig. 3B, lane 10) are competed by P1 (Fig.
3B, lane 12) but not by mutant oligonucleotide 4 mut (Fig. 3B, lane 11). The mutant
oligonucleotide no longer binds PDX-1 but retains the faint non-PDX-1
complexes like those observed with the wild type oligonucleotide (Fig.
3B, lane 13). Of the complexes formed with FP 5 oligonucleotide (Fig. 3B, lane 14), only the
non-PDX-1 complexes are competed by the addition of excess unlabeled
mutant oligonucleotide 5 mut (Fig. 3B, lane 15).
This oligonucleotide, 5 mut, does not bind PDX-1 (Fig. 3B,
lane 16) but does retain other non-PDX-1 complexes. FP 2a
interacted with duodenal nuclear extract to produce only the PDX-1
complexes (Fig. 2). 2a mut did not compete or form these complexes
(data not shown). It is clear from these results that the mutations
introduced into the PDX-1 binding sites do eliminate PDX-1 binding
without disrupting other observed protein complexes. Although these
mutations were chosen with great care, it remains possible that these
mutations might eliminate binding of other factors absent from this
extract such as factors that bind these sequences during earlier stages
of development or in other regions of the intestine that act as repressors.
Transgenic Mice Containing a PDX-1 Mutated Enhancer Do Not
Maintain Duodenum-specific Activation--
To examine the effects of
loss of PDX-1 binding at the enhancer in vivo, a transgene
containing a PDX-1 mutated enhancer was constructed. The 319-bp
BsiWI fragment shown in Fig. 1 containing the duodenal
enhancer was subcloned into pALTER-1 (Promega) and subjected to
multiple rounds of site-directed mutagenesis to introduce the mutations
from Table I into the enhancer. Mutations were confirmed by sequencing
the enhancer in its entirety, and the enhancer was subcloned back into
its native location and orientation within a 13-kb intragenic fragment
analyzed previously in other transgene experiments (13, 14). The
location of the duodenal enhancer relative to the human ADA gene is
shown in Fig. 4A, where the
enhancer is represented as an open bar in intron 2. The
transgene designated as wild type (wt) contains the enhancer
in its native orientation and location within this 13-kb segment. The
transgene designated as enhancer contains the
same fragment with the 319-bp enhancer fragment deleted. The transgene
designated as PDX mutant is identical to the wt transgene
with the exception of the PDX-1 binding site ablation mutations
(denoted by the asterisks in the open box). This
transgene also contains the base pair changes used to create the
BsiWI sites flanking the enhancer. Each transgene also
contains 3.8 kb of human ADA promoter/5' flank and the CAT coding
sequence.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 4.
Loss of PDX-1 binding to the enhancer
in vivo results in loss of activation in the
duodenum. A shows the location of the duodenal enhancer
(designated by an open box) within the second intron of the
human ADA gene. Three transgenic constructions are shown that contain
the human ADA promoter/5'-flanking region attached to the CAT reporter
gene. 3' of the CAT coding sequences, each contains an equivalent 13 kb
intragenic segment of DNA surrounding the enhancer. The transgene
designated as wt contains the enhancer in this 13.0 kb
fragment as it is found in the human gene. The transgene designated as
enhancer contains a 319-bp deletion of the
enhancer region shown in Fig. 1. The final transgene is identical to
the wild type transgene, with the exception of point mutations of the
PDX-binding sites (specified by asterisks) corresponding to
those shown in Table I. B shows a comparison of duodenal
reporter gene activity normalized to transgene copy number for multiple
lines of mice containing these transgenes (note the log scale). Results
with the wt and enhancer have been published previously (13, 14)
and are included here for comparison. Duodenal CAT activity/copy in
mice containing the wt transgene ( ) ranges from 1,400 to 31,000. Duodenal CAT activity/copy in mice containing the enhancer fragment
( ) shows greatly decreased activity that ranges from 0 to 0.13. Mice
containing the PDX mutant enhancer ( ) show a similar and striking
reduction in CAT activity/copy that ranges from 0 to 180.
|
|
A minimum of two adult F1 mice for each independent
transgenic line were analyzed for CAT activity in various tissues.
Protein concentrations and transgene copy numbers were also assessed. All transgenic CAT activities reported are normalized to both protein
concentration and transgene copy number, expressed in units of
pmol/h/100 µg of protein/transgene copy, and are shown in Fig.
4B and Table II. Duodenal CAT
activity/copy for two previously reported transgenes is included for
comparison (13, 14). Duodenal CAT activity/copy (Fig. 4B) in
mice containing the wt enhancer (Fig. 4B, ) ranges from
1,400-31,000, with a median activity of 9,100. In every line of these
transgenic mice, the duodenum is the site of highest reporter gene
activity, usually by 100-1,000-fold (Table II). Deletion of the
enhancer (Fig. 4B, enhancer, ) resulted in
a transgene with significantly reduced duodenal CAT activity/copy in
every line. Duodenal CAT activity/copy for these transgenic mice ranges
from 0-1.3, with a median activity of 0.48. This represents only
0.005% of the median wild type enhancer activity. In these mice, the
duodenum was never observed to be the tissue of highest expression. In
fact, expression in the duodenum was often 100-1,000-fold lower than
that in the tissue with the highest CAT activity (Table II). Values for
other tissues were similar to those seen for other nonduodenal tissues
in mice with the wild type transgene (Table II). Transgenic mice
containing the mutated enhancer (Fig. 4B, PDX
mutant, ) also exhibit very reduced duodenal reporter gene
activity ranging from 0-180, with a median CAT activity/copy of 18.5. This value represents 0.2% of the median wild type activity. For all
but two lines, duodenal CAT activity/copy is 100-10,000-fold lower
than the activity in the tissue with the highest expression (Table II).
One line (Table II, PDX mutant, line 5) had duodenum as the tissue of
highest expression by only a slight margin. In this line, all tissues
had very similar low levels of activity. This expression pattern is not
one of true duodenal activation such as was observed in the wild type
transgenes but rather seems to be evidence of very low-level expression
in every tissue. In another line (Table II, PDX mutant, line 3) the
duodenum had much higher activity (180 units/copy) than was observed in
the duodenum from any other PDX mutant line. However, all tissues
examined in line 3 (Table II) had similar moderate levels of activity
ranging from 83-220 units/copy. This pattern of expression could
easily be the result of transgene insertion near a ubiquitous enhancer or in a region of chromatin permissive to expression. As a
whole, the results observed clearly show that the mutations
introduced that ablate PDX-1 binding in vitro, and by
inference in vivo as well, eliminate the enhancer's ability
to activate consistent, high-level, duodenum-specific transcription,
demonstrating an absolute requirement for PDX-1 in vivo.
View this table:
[in this window]
[in a new window]
|
Table II
Tissue CAT activities of wt, enhancer, and PDX mutant transgenic
mice
CAT activities normalized to transgene copy number and expressed as
pmol/h/100 µg/transgene copy from various transgenic tissues are
shown. Tissues not assayed are designated with a hyphen. Duodenal CAT
values for wt and transgene, thymic CAT values for wt enhancer
transgene, and the highest tissue CAT values for enhancer have been
reported previously (13, 14).
|
|
Co-transfection of PDX-1 with the Enhancer Does Not Result in
Activation--
In a co-transfection transient assay, PDX-1 has been
shown to modestly activate transcription through a PDX-1 binding site in the proximal region of the insulin promoter (16, 22). The ability of
PDX-1 to function similarly from the ADA enhancer binding sites was
tested in co-transfection experiments. A target plasmid containing 3.8 kb of the human ADA promoter/5'-flanking sequence, the CAT reporter
gene, and a 3.4-kb fragment of intron 2 including the duodenal enhancer
(Fig. 5A; Ref. 13) was
produced. This construction places the enhancer and associated PDX-1
binding sites at a remote location somewhat analogous to the position it occupies in the ADA gene. A Rous sarcoma virus-driven PDX-1 expression vector was obtained (16). The PDX-1 cDNA was removed to
create an empty expression vector. Multiple transfections into CHO-K1 cells were performed in duplicate with the target plasmid only, the target plasmid plus the empty vector, or the target plasmid
plus the PDX-1 expression vector. Samples were harvested 48 h
after transfection, and the extracts were assayed for CAT activity and
protein concentration. All CAT activities reported are normalized to
protein concentration and expressed in pmol/h/100 µg protein. The
results for the ADA-CAT target plasmid are shown in Fig. 5A.
No significant difference was observed among the target alone (Fig.
5A, ), the target plus the empty expression vector (Fig.
5A, ), and the target plus the PDX-1 expression vector (Fig. 5A, ). By contrast, in co-transfection experiments
using an insulin promoter-CAT construction (16) as the target plasmid (Fig. 5B), a consistent 2-3-fold increase in CAT activity
was observed upon co-transfection with the PDX-1 expression vector ( ) over either the insulin-CAT target alone ( ) or the target plus
the empty expression vector ( ). These results are similar to those
published for other transfection studies using these plasmids (16).
PDX-1 protein was readily discernible by gel shifts using extracts made
from cells containing the expression vector (data not shown).
Therefore, it was concluded that PDX-1 alone was insufficient to cause
a detectable activation, much less the sizable activation that is
characteristic of this enhancer.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 5.
PDX-1 co-transfection. Either an ADA-CAT
target plasmid (A) or an insulin-CAT target plasmid
(B) was used in transient transfections into CHO-K1
cells using LipofectAMINE. Each target plasmid was transfected alone
( ) or co-transfected with an empty expression vector ( ) or a
PDX-1 expression vector ( ), and the resulting CAT activities
(pmol/h/100 µg) from cell extracts are shown.
|
|
These studies have identified five sites for nuclear protein binding
within a duodenum-specific enhancer that bind the homeodomain protein
PDX-1. PDX-1 alone was incapable of activating the ADA enhancer in
co-transfection experiments. A number of other nuclear proteins also
have the ability to interact with this enhancer. It seems likely that
some of these bind the enhancer to modulate transcription in either
concordance with or opposition to PDX-1. Specific removal of PDX-1 from
this potential multiprotein complex bound at the enhancer via
site-directed mutagenesis results in either severely limited activation
or complete enhancer inactivation in vivo. Therefore,
although insufficient to activate transcription by itself, PDX-1
clearly plays an integral role in the transactivation mediated by this
enhancer in the duodenum.
 |
DISCUSSION |
Many genes expressed in the intestine share similar expression
profiles along the various axes of development. Along the A/P axis,
some show rather homogeneous expression throughout the intestine, whereas others are more spatially limited. The same observation can be
made along the C/V axis. Transporters and metabolic enzymes, such as
ADA, are absent from the proliferative crypt compartment and only
become expressed at the C/V juncture as cells complete differentiation.
Others are expressed only in the crypts and are extinguished at the C/V
juncture. A similar phenomenon occurs with respect to developmental
timing of gene expression. Many embryonic genes are silenced around the
time of birth. In rodents, activation at the suckling-weaning
transition is also common for many genes including ADA. Common
underlying mechanisms are thought to be responsible for these
similarities in expression pattern observed among genes in intestine.
It has been proposed that mechanisms controlling A/P, C/V, or
developmental timing are independent of one another in the intestine
(23, 24). The most likely mechanistic basis for these differences is
the delicate interplay of factors bound to tissue-specific
cis-regulatory elements within each respective gene.
We have begun to identify proteins that interact with a
duodenum-specific enhancer module that defines high-level
transcription, villous epithelial-specific expression, and activation
simultaneous with the final maturation of the small intestine at about
2 weeks of age. A disproportionately high number of binding sites for one specific factor are present within this enhancer. Within the entire
40 kb of ADA gene sequence, only a few poor matches to this sequence
exist outside the 319-bp enhancer. The presence of five good site
matches within such a small piece of DNA seemed significant at the
outset. We have shown here that the homeotic protein PDX-1 binds these
sites and that these sites are required in vivo for enhancer
function. PDX-1 is found in only a few tissues in adults including the
pancreas and duodenal villous epithelium (16, 25-27). Evidence from
targeted mutagenesis experiments eliminating PDX-1 in mice (28, 29)
shows that it plays a key role in pancreas development because null
mice are apancreatic. These mice also contain numerous defects of the
small intestine limited to the duodenum, where crypt/villus structures
fail to form, and the epithelium maintains an immature cuboidal
phenotype. Within the pancreas, expression of PDX-1 is limited to the
islet cell lineage, where it has been implicated in the regulation of
numerous islet-specific genes including insulin (19, 30, 31),
somatostatin (25, 32), elastase (33-35), and islet amyloid polypeptide
(36). A similar role for PDX-1 in intestinal gene regulation has not been established.
Along not only the A/P axis of the intestine but the C/V axis of the
duodenum as well, there is a good correlation between the location of
high-level ADA expression and the location of PDX-1 expression. Both
are limited to the duodenum along the A/P axis. Expression of both is
also limited along the C/V axis of development to the villous
epithelium and is absent from the crypts, lamina propria, and
underlying musculature (27). There are many other genes expressed in
the intestine with profiles similar to ADA. Two of these, elastase I
(33, 34, 37) and calbindin D9K (38, 39), have regulatory sequences that
have been defined. Both genes are expressed at high levels in the
duodenum. Calbindin also shares the same C/V (38) and developmental
(39) patterns of expression as ADA, with minor exceptions. The promoter
sequences for each have also been observed to contain sites that can
bind PDX-1 in vitro (33, 34, 37, 40). As of yet, no
functional studies for either of these sites have been published.
However, it seems likely that PDX-1 plays a role in defining the
expression pattern for each of these genes in the intestine along the
A/P axis and perhaps the C/V axis of development.
Despite the absolute requirement for PDX-1, it alone is not sufficient
for the profile observed. There are tissues or developmental time
points where PDX-1 is expressed and ADA remains at basal levels such as
in islet cells or in embryonic proximal gut (29), suggesting that PDX-1
alone is not sufficient to drive the expression observed in the
duodenum. Co-transfection experiments clearly demonstrate that PDX-1
alone is incapable of transactivation from the ADA enhancer. Little has
been observed regarding the role of PDX-1 in intestinal gene
regulation. However, much can be inferred from studies examining how
PDX-1 operates in islet-specific gene expression. More recent studies
of various pancreas-specific promoters show that high-level activation
is dependent on the presence of PDX-1 and numerous other proteins
(41-44). A distinct but analogous group of factors may share the same
role in PDX-1 activation of duodenal-specific genes. In the pancreas,
PDX-1 has been observed to interact synergistically with a number of
other homeodomain DNA-binding proteins such as MEIS, Pbx, and Pax (32,
35, 43-45) and basic helix-loop-helix and E-box proteins E47 and E2
(41, 42, 44) in the process of lineage allocation in the pancreas. In
these cases, it is the absence or presence of specific binding partners
that determines gene expression within a given cell type. High-level
activation is only observed when PDX-1 and one of these factors are
both bound (44). Analogous binding partners for PDX-1 in the duodenum
have yet to be identified. Within the ADA enhancer, there are no
consensus E-box binding sites, CANNTG; therefore, interaction with
these types of proteins would have to occur independent of their
binding to the DNA. A potential Pbx-1 type binding site exits in
footprint 2 within the FP 2d oligonucleotide used in gel shift
experiments, and an unidentified complex was produced with this probe.
However, the Pbx-1 site overlaps the PDX-1 site and is on the other
face of the DNA strand. This location does not intuitively seem like
one that would foster protein-protein interaction. This sequence
contains a long AT tract resembling other sequences known to bind the
ubiquitous factor HMG I (Y) (46-48). HMG I (Y) has recently
been shown to stabilize the protein-protein interaction between PDX-1
and E47, thereby increasing synergistic activation (44). Perhaps it
performs a similar function in the ADA enhancer between PDX-1 and an as yet unidentified binding partner.
At least one factor known to play a role in intestinal gene
transcription that can interact with PDX-1 has been identified. PDX-1
has been shown to interact with the intestine-specific homeodomain protein Cdx 2 (49). Interestingly, within the ADA enhancer, there is
one Cdx-type binding site that is closely juxtaposed to the multiple
PDX-1 sites within FP 2 between oligonucleotides 2a and 2c (13, 14).
The relative spacing of the Cdx and three PDX-1 binding sites to one
another suggests that they would all reside on the same face of the DNA
strand such that protein-protein interactions could be facilitated.
This same region also contains the identified GATA binding site. The
multiplicity of these binding sites (three PDX-1 sites, one Cdx
binding site, and one GATA binding site) closely juxtaposed within 50 bp might foster an interaction between these proteins in a manner
analogous to those observed with PDX-1 and numerous other proteins in
pancreas-specific genes. None of the PDX-1 complexes formed in gel
shift experiments with the duodenal extract are the result of
simultaneous binding of both PDX-1 and Cdx or PDX-1 and GATA because
the addition of excess Cdx or GATA consensus oligonucleotides had no
effect on the formation of these complexes (data not shown).
Studies designed to address the identity of the remaining enhancer
binding proteins are underway. The specific functions of these proteins
and how they interact with each other and PDX-1 will give us invaluable
information about intestinal gene regulation along each of its
developmental axes. This knowledge will be useful for deciphering what
is involved in the intestinal patterning of the ADA gene and
potentially many other intestinal genes as well.
 |
ACKNOWLEDGEMENTS |
We thank Dr. Helena Edlund for the generous
gift of anti-PDX-1 antibodies and various plasmids for the
co-transfection experiments. We also thank Patrick Ryan, Lara Picard,
and Sharon Lowe for technical assistance and maintenance of the mouse colony.
 |
FOOTNOTES |
*
This work was supported by National Institute of Diabetes
and Digestive and Kidney Disease Grant DK-52343 (to D. A. W.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 513-636-4547;
Fax: 513-636-4317; E-mail: dan.wiginton@chmcc.org.
Published, JBC Papers in Press, January 30, 2001, DOI 10.1074/jbc.M009249200
2
D. A. Wiginton, unpublished results.
3
M. R. Dusing, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
C/V, crypt-to-villus;
A/P, anterior-to-posterior;
ADA, adenosine deaminase;
bp, base pair(s);
EMSA, electrophoretic mobility shift assay;
CAT, chloramphenicol acetyltransferase;
kb, kilobase;
wt, wild type MDNE,
mouse duodenal nuclear extract.
 |
REFERENCES |
| 1.
|
Potten, C. S.,
and Loeffler, M.
(1990)
Development (Camb.)
110,
1001-1020
|
| 2.
|
Potten, C. S.,
Booth, C.,
and Pritchard, D. M.
(1997)
Int. J. Exp. Pathol.
78,
219-243
|
| 3.
|
Potten, C. S.
(1997)
Am. J. Physiol.
273,
G253-G257
|
| 4.
|
Gutierrez, E. D.,
Grapperhaus, K. J.,
and Rubin, D. C.
(1995)
Am. J. Physiol.
269,
G500-G511
|
| 5.
|
Seidman, E. G.,
and Walker, W. A.
(1987)
Paediatric Gastroenterology
, Blackwell Scientific Publications, Melbourne, Australia
|
| 6.
|
Lev, R.
(1981)
Textbook of Gastroenterology and Nutrition in Infancy
, pp. 57-75, Raven Press, New York
|
| 7.
|
Moog, F.
(1981)
Textbook of Gastroenterology and Nutrition in Infancy
, pp. 139-147, Raven Press, New York
|
| 8.
|
Adams, A.,
and Harkness, R. A.
(1976)
Clin. Exp. Immunol.
26,
647-649
|
| 9.
|
Van der Weyden, M. B.,
and Kelley, W. N.
(1976)
J. Biol. Chem.
251,
5448-5456
|
| 10.
|
Chinsky, J. M.,
Ramamurthy, V.,
Fanslow, W. C.,
Ingolia, D. E.,
Blackburn, M. R.,
Shaffer, K. T.,
Higley, H. R.,
Trentin, J. J.,
Rudolph, F. B.,
Knudsen, T. B.,
and Kellems, R. E.
(1990)
Differentiation
42,
172-183
|
| 11.
|
Witte, D. P.,
Wiginton, D. A.,
Hutton, J. J.,
and Aronow, B. A.
(1991)
J. Cell Biol.
115,
179-190
|
| 12.
|
Lee, P. C.
(1973)
Dev. Biol.
31,
227-233
|
| 13.
|
Dusing, M. R.,
Brickner, A. G.,
Thomas, M. B.,
and Wiginton, D. A.
(1997)
J. Biol. Chem.
272,
26634-26642
|
| 14.
|
Dusing, M. R.,
Brickner, A. G.,
Lowe, S. Y.,
Cohen, M. B.,
and Wiginton, D. A.
(2000)
Am. J. Physiol.
279,
G1080-G1093
|
| 15.
|
Ohlsson, H.,
Thor, S.,
and Edlund, T.
(1991)
Mol. Endocrinol.
5,
897-904
|
| 16.
|
Ohlsson, H.,
Karlsson, K.,
and Edlund, T.
(1993)
EMBO J.
12,
4251-4259
|
| 17.
| Aronow, B., Lattier, D., Silbiger, R., Dusing, M., Hutton, J., Jones,
G., Stock, J., McNeish, J., Potter, S., Witte, D., and Wiginton, D. Genes Dev. 3, 1384-1400
|
| 18.
|
Heinemeyer, T.,
Chen, X.,
Karas, H.,
Kel, A.,
Kel, O.,
Liebich, I.,
Meinhardt, T.,
Reuter, I.,
Schacherer, F.,
and Wingender, E.
(1999)
Nucleic Acids Res.
27,
318-322
|
| 19.
|
Boam, D. S.,
and Docherty, K.
(1989)
Biochem. J.
264,
233-239
|
| 20.
|
Heimberg, H.,
Bouwens, L.,
Heremans, Y.,
Van De Casteele, M.,
Lefebvre, V.,
and Pipeleers, D.
(2000)
Diabetes
49,
571-579
|
| 21.
|
Orkin, S. H.
(1992)
Blood
80,
575-581
|
| 22.
|
Serup, P.,
Petersen, V.,
Pedersen, E.,
Edlund, H.,
Leonard, J.,
Petersen, J.,
Larsson, L.,
and Madsen, O.
(1995)
Biochem. J.
310,
997-1003
|
| 23.
|
Sweetser, D. A.,
Birkenmeier, E.,
Hoppe, P.,
McKeel, D.,
and Gordon, J.
(1988)
Genes Dev.
2,
1318-1332
|
| 24.
|
Markowitz, A. J.,
Wu, G. D.,
Birkenmeier, E. H.,
and Traber, P. G.
(1993)
Am. J. Physiol.
265,
G526-G539
|
| 25.
|
Leonard, J.,
Peers, B.,
Johnson, T.,
Ferrreri, K.,
Lee, S.,
and Montminy, M. R.
(1993)
Mol. Endocrinol.
7,
1275-1283
|
| 26.
|
Miller, C. P.,
McGehee, R. E., Jr.,
and Habener, J. F.
(1994)
EMBO J.
13,
1145-1156
|
| 27.
|
Guz, Y.,
Montminy, M. R.,
Stein, R.,
Leonard, J.,
Gamer, L. W.,
Wright, C. V.,
and Teitelman, G.
(1995)
Development (Camb.)
121,
11-18
|
| 28.
|
Jonsson, J.,
Carlsson, L.,
Edlund, T.,
and Edlund, H.
(1994)
Nature
371,
606-609
|
| 29.
|
Offield, M. F.,
Jetton, T. L.,
Labosky, P. A.,
Ray, M.,
Stein, R. W.,
Magnuson, M. A.,
Hogan, B. L.,
and Wright, C. L.
(1996)
Development (Camb.)
122,
983-995
|
| 30.
|
Shushan, E. B.,
Cerasi, E.,
and Melloul, D.
(1999)
DNA Cell Biol.
18,
471-479
|
| 31.
| Ferber, S., Halkin, A., Cohen, H., Ber, I., Einav, Y., Goldberg, I.,
Barshack, I., Seijffers, R., Kopolovic, J., Kaiser, N., and Karasik, A. (2000) Nat. Med. 6568-6572
|
| 32.
|
Andersen, F. G.,
Jensen, J.,
Heller, R. S.,
Petersen, H. V.,
Larsson, L. I.,
Madsen, O. D.,
and Serup, P.
(1999)
FEBS Lett.
445,
315-320
|
| 33.
|
Rose, S. D.,
Kruse, F.,
Swift, G. H.,
MacDonald, R. J.,
and Hammer, R. E.
(1994)
Mol. Cell. Biol.
14,
2048-2057
|
| 34.
|
Kruse, F.,
Rose, S. D.,
Swift, G. H.,
Hammer, R. E.,
and MacDonald, R. J.
(1995)
Mol. Cell. Biol.
15,
4385-4394
|
| 35.
|
Swift, G. H.,
Liu, Y.,
Rose, S. D.,
Bischof, L. J.,
Steelman, S.,
Buchberg, A. M.,
Wright, C. V.,
and MacDonald, R. J.
(1998)
Mol. Cell. Biol.
18,
5109-5120
|
| 36.
|
Watada, H.,
Kajimoto, Y.,
Kaneto, H.,
Matsuoka, T.,
Fujitani, Y.,
Miyazaki, J.,
and Yamasaki, Y.
(1996)
Biochem. Biophys. Res. Commun.
229,
746-751
|
| 37.
|
Swift, G. H.,
Rose, S. D.,
and MacDonald, R. J.
(1994)
J. Biol. Chem.
269,
12809-12815
|
| 38.
|
Warembourg, M.,
Perret, C.,
and Thomasset, M.
(1986)
Endocrinology
119,
176-184
|
| 39.
|
Thomasset, M.,
Parkes, C. O.,
and Cuisinier-Gleizes, P.
(1982)
Am. J. Physiol.
243,
E483-E488
|
| 40.
|
Barley, N. F.,
Prathalingam, S. R.,
Zhi, P.,
Legon, S.,
Howard, A.,
and Walters, J. R.
(1999)
Biochem. J.
341,
491-500
|
| 41.
|
Peers, B.,
Leonard, J.,
Sharma, S.,
Teitelman, G.,
and Montminy, M. R.
(1994)
Mol. Endocrinol.
8,
1798-1806
|
| 42.
|
Glick, E.,
Leshkowitz, D.,
and Walker, M. D.
(2000)
J. Biol. Chem.
275,
2199-2204
|
| 43.
|
Goudet, G.,
Delhalle, S.,
Biemar, F.,
Martial, J. A.,
and Peers, B.
(1999)
J. Biol. Chem.
274,
4067-4073
|
| 44.
|
Ohneda, K.,
Mirmira, R. G.,
Wang, J.,
Johnson, J. D.,
and German, M. S.
(2000)
Mol. Cell. Biol.
20,
900-911
|
| 45.
|
Asahara, H.,
Dutta, S.,
Kao, H. Y.,
Evans, R. M.,
and Montminy, M.
(1999)
Mol. Cell. Biol.
19,
8219-8225
|
| 46.
|
Bustin, M.,
Lehn, D. A.,
and Landsman, D.
(1990)
Biochim. Biophys. Acta
1049,
231-243
|
| 47.
|
Grosschedl, R.,
Giese, K.,
and Pagel, J.
(1994)
Trends Genet.
10,
94-100
|
| 48.
|
Grosschedl, R.
(1995)
Curr. Opin. Cell Biol.
7,
362-370
|
| 49.
|
Heller, R. S.,
Stoffers, D. A.,
Hussain, M. A.,
Miller, C. P.,
and Habener, J. F.
(1998)
Gastroenterology
115,
381-387
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
E. A. Maier, M. R. Dusing, and D. A. Wiginton
Temporal Regulation of Enhancer Function in Intestinal Epithelium: A ROLE FOR ONECUT FACTORS
J. Biol. Chem.,
October 27, 2006;
281(43):
32263 - 32271.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. R. West and P. S. Oates
Decreased sucrase and lactase activity in iron deficiency is accompanied by reduced gene expression and upregulation of the transcriptional repressor PDX-1
Am J Physiol Gastrointest Liver Physiol,
December 1, 2005;
289(6):
G1108 - G1114.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. A. Maier, M. R. Dusing, and D. A. Wiginton
Cdx Binding Determines the Timing of Enhancer Activation in Postnatal Duodenum
J. Biol. Chem.,
April 1, 2005;
280(13):
13195 - 13202.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Wang, R. Fang, L. C. Olds, and E. Sibley
Transcriptional regulation of the lactase-phlorizin hydrolase promoter by PDX-1
Am J Physiol Gastrointest Liver Physiol,
September 1, 2004;
287(3):
G555 - G561.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-I. Leong, C. L Bowlus, J. Tallkvist, and B. Lonnerdal
Iron supplementation during infancy--effects on expression of iron transporters, iron absorption, and iron utilization in rat pups
Am. J. Clinical Nutrition,
December 1, 2003;
78(6):
1203 - 1211.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-S. Annicotte, E. Fayard, G. H. Swift, L. Selander, H. Edlund, T. Tanaka, T. Kodama, K. Schoonjans, and J. Auwerx
Pancreatic-Duodenal Homeobox 1 Regulates Expression of Liver Receptor Homolog 1 during Pancreas Development
Mol. Cell. Biol.,
October 1, 2003;
23(19):
6713 - 6724.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. Dusing, E. A. Florence, and D. A. Wiginton
High-level activation by a duodenum-specific enhancer requires functional GATA binding sites
Am J Physiol Gastrointest Liver Physiol,
June 1, 2003;
284(6):
G1053 - G1065.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. E. Uveges, Y. Shan, B. E. Kramer, D. C. Wight, and L. M. Parysek
Intron 1 Is Required for Cell Type-Specific, But Not Injury-Responsive, Peripherin Gene Expression
J. Neurosci.,
September 15, 2002;
22(18):
7959 - 7967.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. B. Madison, L. Dunbar, X. T. Qiao, K. Braunstein, E. Braunstein, and D. L. Gumucio
cis Elements of the Villin Gene Control Expression in Restricted Domains of the Vertical (Crypt) and Horizontal (Duodenum, Cecum) Axes of the Intestine
J. Biol. Chem.,
August 30, 2002;
277(36):
33275 - 33283.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|