Originally published In Press as doi:10.1074/jbc.M008568200 on January 31, 2001
J. Biol. Chem., Vol. 276, Issue 17, 14514-14523, April 27, 2001
Yes-associated Protein and p53-binding Protein-2 Interact through
Their WW and SH3 Domains*
Xavier
Espanel
and
Marius
Sudol
From the Department of Biochemistry and Molecular Biology, Mount
Sinai School of Medicine, New York, New York 10029-6574
Received for publication, September 19, 2000, and in revised form, January 11, 2001
 |
ABSTRACT |
To understand the role of the
Yes-associated protein (YAP), binding partners of its WW1 domain were
isolated by a yeast two-hybrid screen. One of the interacting proteins
was identified as p53-binding protein-2 (p53BP-2). YAP and p53BP-2
interacted in vitro and in vivo using their WW1
and SH3 domains, respectively. The YAP WW1 domain bound to the YPPPPY
motif of p53BP-2, whereas the p53BP-2 SH3 domain interacted with the
VPMRLR sequence of YAP, which is different from other known SH3
domain-binding motifs. By mutagenesis, we showed that this unusual SH3
domain interaction was due to the presence of three consecutive
tryptophans located within the
C strand of the SH3 domain. A
point mutation within this triplet, W976R, restored the binding
selectivity to the general consensus sequence for SH3 domains, the
PXXP motif. A constitutively active form of c-Yes was
observed to decrease the binding affinity between YAP and p53BP-2 using
chloramphenicol acetyltransferase/enzyme-linked immunosorbent
assay, whereas the overexpression of c-Yes did not modify
this interaction. Since overexpression of an activated form of c-Yes
resulted in tyrosine phosphorylation of p53BP-2, we propose that the
p53BP-2 phosphorylation, possibly in the WW1 domain-binding motif,
might negatively regulate the YAP·p53BP-2 complex.
 |
INTRODUCTION |
WW domains are small modules that mediate protein/protein
interactions (1, 2). The major features of the WW domain primary structure are (i) two conserved tryptophans spaced by 20-22 amino acids within the 40-amino acid long domain, (ii) a block of two or
three aromatic amino acids located centrally between the two signature
tryptophans, and (iii) a conserved proline located +3 to the second
conserved tryptophan (3). The three antiparallel
strands of WW
domains form a hydrophobic patch that binds proline-rich or
proline-containing motifs (4). Based on the ligand-binding specificity,
one can divide WW domains into five groups. Group I WW domains bind to
the core sequence PPXY (2, 5). Group II WW domains interact
with a long stretch of prolines interrupted by a leucine (6, 7). Group
III WW domains bind to PPR-containing motifs (8). Group IV WW domains
interact with phosphoserine that is followed by a proline (9). Group V
WW domains interact with polyprolines interrupted by a glycine and
flanked by arginine (10). A WW-like fold was identified in the
platelet-derived growth factor receptor subfamily of tyrosine kinases
(11).
SH3 domains are composed of 50-70 amino acids forming a
structure containing multiple
sheets (12). These modules also mediate protein/protein interactions through proline-rich motifs. Based
on the binding specificity, the SH3 domains are divided into three
major groups. Group I SH3 domains interact with
basic-X-hydrophobic-proline-X-hydrophobic-proline (+X
PX
P), whereas Group II binds to
hydrophobic-proline-X-hydrophobic-proline-X-basic (
PX
PX+). Group III SH3 domains represented
by the Eps8 family members select ligands with PXXDY
consensus cores (13).
Yes-associated protein
(YAP),1 the first protein in
which a WW domain was identified, is a phosphoprotein of 65 kDa that
interacts with the SH3 domain of the c-yes proto-oncogene
product, a non-receptor tyrosine kinase of the Src family. YAP
expression is ubiquitous, with a high expression in ovaries (14). YAP
has two isoforms: a short form (YAP) that possesses only one WW domain
(WW1) and a long form (LYAP) that has two WW domains (WW1 and WW2)
(Fig. 1A). In addition, there
is a PDZ domain-binding motif, TWL, at the carboxyl-terminal end of YAP
that allows the interaction with a submembranous scaffolding protein,
EBP50 (ERM-binding phosphoprotein) (15). Since the modular structure of YAP is reminiscent of
adaptor-type signaling proteins, we have decided to identify cognate
partners of YAP to understand its molecular function. Using the human
YAP WW1 domain to screen a mouse embryonic expression library, we have
previously identified two putative ligand proteins: WW domain-binding protein (WBP)-1 and WBP-2 (2). The analysis of these two ligands showed
that the YAP WW1 domain binds to the PPXY core sequence (PY
motif). Recently, it has been shown that YAP can also interact with
polyomavirus enhancer binding protein-2
(PEBP-2
), a
transcription factor (16).

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic representations of
protagonists. A, modular organization of YAP and
p53BP-2 proteins. SB, SH3 domain-binding motif;
PB, PDZ domain-binding motif; CC, coiled-coil
region; PY, PPXY motif. B, schematic
representation of the major constructs used in this study. Mutant
constructs are symbolized by m within the concerned
drawings. For PY mutations, partial sequences with the
underlined point mutation are shown. GBT,
DNA-binding domain of GAL4 (yeast expression vector); GAD,
activation domain of GAL4; DB, DNA-binding domain of GAL4
(mammalian expression vector).
|
|
In this report, using yeast two-hybrid screening, we identified another
YAP WW1 domain partner, p53-binding protein-2 (p53BP-2) (17).
Originally, p53BP-2 was isolated as one of two proteins that interact
with the wild-type p53 tumor suppressor protein, but not with a mutant
form, in a yeast two-hybrid screen (17). In fact, the most common point
mutations of p53 found in cancers prevent p53/p53BP-2 interaction if
they are located in the DNA-binding domain (18). Human p53BP-2,
composed of 1005 amino acids, possesses a PY motif, four ankyrin
repeats, and one SH3 domain at the carboxyl-terminal end (Fig.
1A). Using the two-hybrid system and x-ray diffraction, it
has been shown that the fourth ankyrin repeat and the SH3 domain of
p53BP-2 interact with the DNA-binding domain of p53, thus preventing the interaction between DNA and p53 (17, 18). The p53BP-2 SH3 domain
does not interact with p53 via a PXXP or PXXDY
consensus motif. Like p53, p53BP-2 is part of a protein network since
it has been shown that p53BP-2 can also interact with Bcl-2 (an
anti-apoptotic protein), protein phosphatase-1
, NF-
B subunit p65
(a transcription factor), and APCL (adenomatous
polyposis coli-like) protein (a tumor suppressor-like protein) (19-22). These interactions are mutually exclusive and can be competed by p53.
We show here that the interaction between p53BP-2 and YAP is dependent
on the presence of the YAP WW1 and p53BP-2 SH3 domains. Using the
SPOT technique, the binding motifs of these two domains were
mapped. The p53BP-2 YPPPPY sequence was required for interaction with
the YAP WW1 domain, and the YAP VPMRLRK peptide bound to the p53BP-2
SH3 domain. The unusual SH3 domain-binding motif seemed to be due to
the presence of three consecutive tryptophans within the
C sheet of
the SH3 domain. By CAT/ELISA, we confirmed that YAP was a putative
transcription factor and that the interaction between YAP and p53BP-2
occurred in vivo. In addition, overexpression of a
constitutively active form of c-Yes phosphorylated, directly or
indirectly, p53BP-2. We also provided evidence that this
phosphorylation might decrease or abolish the binding between YAP and
p53BP-2.
 |
EXPERIMENTAL PROCEDURES |
Yeast Two-hybrid Screening--
The screening was performed with
a Matchmaker kit from CLONTECH. We used the human
brain library from CLONTECH, in which cDNAs were cloned into the pGAD-10 vector (GenBankTM/EBI
accession number U13188) at the EcoRI site using an
EcoRI linker (CCGGAATTCCGG). Baits were cloned into the
pGBT-BSE vector, which corresponds to a modified pGBT9 vector
(GenBankTM/EBI accession number U07646): the sequence
between EcoRI and BamHI was replaced by
GAATTGGGATCCCCGGGTGAATTCAGATCC
(the old EcoRI and BamHI sites are in italic and
the new BamHI and EcoRI sites are underlined).
Confirmation of interactions was performed in the pGAD-BSE vector,
which corresponds to the pGAD-424 vector (GenBankTM/EBI
accession number U07647) modified the same way as the pGBT9 vector.
DNA Constructs--
pDBGAL4-BSE was obtained by inserting the
HindIII-EcoRI fragment corresponding to the
DNA-binding domain of GAL4 coming from the pGBT-BSE vector into the
pcDNA3.1(+) vector (Invitrogen).
pGBT-BSE (GBT), pGAD-BSE (GAD), pGEX-2TK (GST), and pDBGAL4-BSE
(DB) Constructs--
GBT-YAPWW1 (where GBT is the GAL4
DNA-binding domain (yeast expression vector)), GAD-YAPWW1 (where GAD is
the GAL4 activation domain), and GST-YAPWW1 correspond to the human
cDNA region (nucleotides 758-926; GenBankTM/EBI
accession number P46937) coding for the YAP WW1 domain (amino acids
162-217) (2). The GST-YAPWW1-P202A construct is the GST-YAPWW1 plasmid
with the substitution P202A (23).
DB-HYAP6 (where DB is the GAL4 DNA-binding domain (mammalian expression
vector)) possesses the BamHI-EcoRI fragment of
human YAP, which corresponds to the full-length cDNA, except that
for the first methionine, we added a BamHI linker
(GGATCCCCGCATATGGATCC). DB-HYAP6
AD (amino
acids 1-344) corresponds to XhoI
(partial)-HindIII digestion of the DB-HYAP6 construct. After
treatment with Klenow fragment, the vector was self-ligated.
GST-WBP-1 corresponds to the PY motif (GTPPPPYTVG) of mouse WBP-1
(amino acids 170-179) (2). DB-BP-2 was obtained by ligating the
AvrII-XbaI (blunted by Klenow) fragment of human
p53BP-2 into the pDBGAL4-BSE vector at the BamHI and
EcoRI (blunted by Klenow) sites. To maintain the reading
frame, we cloned the BamHI/AvrII linker
(GGATCCGTCTTGCCCGGCCCTAGG). GAD-PY5,
GBT-PY5, GST-PY5, and DB-PY5 contain the PY motif (amino acids
729-768) of human p53BP-2 cDNA (GenBankTM/EBI
accession number U58334) (24).
GST-A4 to GST-A11 correspond to PY5 with a point mutation. They were
obtained by PCR using the XE-BamHI primer
(5'-ACTTAGGGATCCAATCCAGAGGCTCCACATGTGC-3') and the
primer possessing the point mutation and the natural cloning site,
ApaI. The PCR fragments were then inserted into GST-PY5 at
the BamHI and ApaI sites.
GST-Cterm and DB-Cterm were obtained by PCR using the
XE-BamHI primer (see above) and the EX-Stop-SmaI
primer (5'-ATCTATCCCGGGTTTCAGGCCAAGCTCCTTTG-3') on p53BP-2
cDNA. The PCR fragment was cloned into pGEX-2TK at the
BamHI and SmaI sites. This construct expresses
the last quarter of p53BP-2 (amino acids 729-1005). DB-Cterm A9
corresponds to the insertion of the BamHI-SmaI
fragment of mutant GST-Cterm (Y751A) into the pDBGAL4-BSE vector at the
BamHI and EcoRI (blunted) sites.
GST-Cterm
SH3 and DB-Cterm
SH3 were made from the GST-Cterm
construct partially digested by BssHII and then blunted with
Klenow fragment. After digestion by SmaI, the vector was
religated. This construct produces the region between amino acids 729 and 978 of p53BP-2.
GST-Cterm W976R corresponds to the GST-Cterm construct in which
the TaqI-SmaI fragment was replaced by the PCR
product obtained from the EX-p53BP-2-SmaI primer
(GAATTCCCGGGTCAGGCCAAGCTTCTTTGTCTTGGTTT) and the
XE-WR-TaqI primer
(GAAATCGAATGGTGGAGGGCTCGCCTTAATGATAAGGAG). GST-Cterm L990Y was made by replacing the
BsaAI-SmaI fragment of GST-Cterm by the PCR
product issued from the EX-p53BP-2-SmaI primer (see above)
and the XE-LY-BsaAI primer
(ATGTTCCACGTAACTACCTGGGACTGTACC). GST-Cterm
W976R-L990Y was made the same way as the GST-Cterm L990Y construct, but
instead of inserting the PCR fragment into the GST-Cterm construct, we
used the GST-Cterm W976R construct.
HYAP6 corresponds to the BamHI-EcoRI fragment of
human YAP cloned into the pcDNA3.1(
)/hygromycin vector
(Invitrogen) at the XbaI and EcoRI sites. We used
an XbaI/BamHI linker
(TCTAGATACCGGTCGCCACCATGGATCC). HYAP6
AD was
obtained from the HYAP6 construct digested by XhoI and
HindIII and treated with Klenow fragment of polymerase I and then self-ligated. HYAP6 W199F corresponds to the HYAP6 construct in
which the point mutation was introduced by the W199F primer (CCTGGGGTCCTGGAATGTTGTTGTC; italics show the mutation) using
a double-stranded site-directed mutagenesis kit (Amersham Pharmacia Biotech).
BP-2 is the full coding sequence of human p53BP-2
(BamHI-XbaI) cloned into the pcDNA3.1(+)
vector at the BamHI and XbaI sites. The Yes and
Yes Y535F constructs correspond to the full coding sequence of mouse
c-Yes (wild type and mutant, respectively) cloned into the
MluI sites of the pMIK-Neo vector (a kind gift from Dr. Maruyama, University of Tokyo). The pG5CAT vector
(CLONTECH) encodes the CAT reporter gene downstream
of the E1B minimal promoter containing five binding sites for GAL4.
Cell Culture and Transfection--
Human embryonic kidney (HEK)
293 cells were cultivated in Dulbecco's modified Eagle's medium
(BioWhittaker, Inc.) containing 10% fetal calf serum, 100 units/ml
penicillin/streptomycin, and 2.5 µg/ml amphotericin B at 37 °C in
a 5% CO2 incubator. Cells were transfected in duplicates
using the calcium phosphate method as described previously
(25).
CAT/ELISA--
The protein concentration of transfected samples
was measured by the BCA protein assay kit (Pierce). Per experiment, we
used the same amount of protein, which was normalized to the sample with the lowest protein concentration. We then followed the Roche Molecular Biochemicals kit procedure for CAT quantification. For transfection efficiency, we transfected 1 µg of SV40-LacZ (26) construct/60-mm dish. The
-galactosidase assays were carried out
with 45 µl of the protein extract used for CAT/ELISA in the presence
of 100 µl of o-nitrophenyl
-D-galactopyranoside buffer (60 mM
Na2HPO4, 40 mM
NaH2PO4, 10 mM KCl, 1 mM MgCl2, and 50 mM
-mercaptoethanol) and 100 µg of o-nitrophenyl
-D-galactopyranoside. CAT/LacZ corresponds to the ratio
of CAT absorbance to LacZ absorbance (27).
GST Purification--
Bacteria were transfected with different
DNA constructs cloned into the pGEX-2TK vector. The GST fusion proteins
were induced by 1 mM
isopropyl-
-D-thiogalactopyranoside for 2 h at
30 °C. GST fusion proteins were extracted and purified on
glutathione-Sepharose beads (Amersham Pharmacia Biotech) as described
previously (24).
Pull-down Experiments--
Chicken brains were lysed in
radioimmune precipitation assay buffer (10 mM Tris, pH 7.5, 300 mM NaCl, 0.1% SDS, 1% Triton X-100, 5 mM
EDTA, and 1% sodium deoxycholate) in the presence of the protease
inhibitor mixture CompleteTM (Roche Molecular
Biochemicals). After clarification by centrifugation, lysates were
diluted 10 times in Tween buffer (50 mM Tris, pH 7.4, 100 mM NaCl, 1 mM EDTA, 0.1% Tween 20, and 1%
bovine serum albumin) with protease inhibitors (CompleteTM)
and incubated at 4 °C for 14 h under agitation with GST fusion protein (50 µg) bound to glutathione beads. The beads were washed three times with Tween buffer without bovine serum albumin.
Anti-MBP-2 Antibody--
We expressed human p53BP-2 from amino
acids 480 to 626 as a GST fusion protein (GST-Ab). This construct was
obtained by PCR using the XE-Ab-BamHI primer
(5'-ACATGGGGATCCACCGTGGCAGCAAGTTCAATA-3') and the
EX-Ab-SmaI primer
(5'-ATCTATCCCGGGTGAATATTTGGCCCATTAGGACC-3'). Several
milligrams of this construct were purified on glutathione beads,
cleaved by thrombin (Amersham Pharmacia Biotech) from the GST part, and
run on SDS-polyacrylamide gel (12.5%). The protein band of the
expected molecular mass was cut and directly sent to Covance for
injections into rabbits and antibody production. Immune serums were
combined and purified on column of GST-Ab coupled to CNBr-activated
Sepharose beads (Amersham Pharmacia Biotech) as described previously
(28).
Western Blots--
Protein samples in loading buffer (25%
glycerol, 62.5 mM Tris, pH 6.8, 5 µg/ml bromphenol blue,
2.5%
-mercaptoethanol, and 1% SDS) were run on SDS-polyacrylamide
gels and then electrotransferred to nitrocellulose membranes. Blots
were blocked for 1 h at room temperature in 20 mM
Tris, pH 7.5, 150 mM NaCl, and 0.05% Tween 20 with either
5% low-fat dried milk or 3% bovine serum albumin (for the 4G10
antibody). For Western immunoblotting, anti-YAP (29), anti-MBP-2, and
4G10 (anti-phosphotyrosine from Upstate Biotechnology, Inc.) antibodies
were diluted 1:2000. After 1 h, membranes were washed with the
same buffer. The blots were incubated for 1 h at room temperature
with either horseradish peroxidase-conjugated anti-rabbit or anti-mouse
antibody (1:8000 dilution; Amersham Pharmacia Biotech). For
visualization of the signal, we used the enhanced chemiluminescence kit
from PerkinElmer Life Sciences.
Immunoprecipitation of p53BP-2--
HEK 293 cells were lysed in
radioimmune precipitation assay buffer. About 200 µg of protein were
incubated with anti-MBP-2 antibody (diluted 1:20) for 1 h at
4 °C under agitation, and then protein A-agarose beads were added
and incubated for 1 h. The beads were washed once with radioimmune
precipitation assay buffer and then twice with phosphate-buffered saline.
GST Radiolabeling--
The pGEX-2TK vector codes for GST fusion
proteins harboring a protein kinase A site. GST fusion proteins (50 µg) were radiolabeled with [
-32P]ATP by protein
kinase A from bovine heart (Sigma) according to the protocol previously
described (24).
SPOT Techniques--
Peptides were synthesized on a derivatized
cellulose membrane provided by Genosys Biotechnologies, Inc. (30, 31).
The blots were blocked in Western wash solution (10 mM
Tris, pH 7.4, 0.1% Triton X-100, and 150 mM NaCl) plus 1×
blocking buffer (Genosys Biotechnologies, Inc.) for 2 h at 4 °C
under agitation. Radiolabeled GST fusion proteins (50 µg) were then
added to the blocking solution for 14 h at 4 °C under constant
shaking. Washes were performed with Western wash solution. Before
autoradiography, filters were dried at room temperature.
Far Western Blots--
After electrotransfer, nitrocellulose
membranes were blocked in Western wash solution plus 5% low-fat dried
milk for 1 h at 4 °C. Radiolabeled GST fusion proteins were
added in the same solution. After 14 h at 4 °C under agitation,
membranes were extensively washed with Western wash solution.
 |
RESULTS |
The WW1 Domain of YAP Binds at Least Four Different
Proteins--
To better understand the function of YAP, we searched
for protein partners that could interact with its interaction module, the WW1 domain. We used the first amino-terminally located WW domain of
YAP because this domain is present in the two isoforms of YAP. In
previous studies, we had isolated two putative ligand proteins (WBP-1
and WBP-2) that interacted in vitro with the YAP WW1 domain
(2). To address the question of whether other proteins could interact
with the WW1 domain of YAP, pull-down experiments on cell lysates using
GST-YAPWW1 fusion protein were performed. As controls, GST alone and
the GST-YAPWW1-P202A mutant, which is known to render the domain
inactive for binding to PPXY-containing WBP-1 (23), were
used. After separation on SDS-polyacrylamide gel, the precipitated
proteins were transferred to nitrocellulose membranes and probed with
radioactively labeled GST-YAPWW1. As shown in Fig.
2, there were four major specific
proteins of 120, 100, 90, and 40 kDa that were pulled-down from chicken
brain extracts by the human YAP WW1 domain. Proteins of the same
molecular masses were pulled-down by GST-YAPWW1 from mouse brain and
HeLa cell protein extracts (data not shown).

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 2.
The YAP WW1 domain precipitates four major
proteins. Shown is a far Western blot of GST pull-down experiments
with chicken brain extracts incubated with GST alone, GST-YAPWW1, or
GST-YAPWW1-P202A. Upper panel, precipitated proteins were
run on SDS-polyacrylamide gel (10.5%), electrotransferred to
nitrocellulose membrane, and then probed with
32P-radiolabeled YAP WW1 domain. Lower panel,
GST calibration is shown. Western immunoblotting was carried out with
anti-GST antibody. Molecular mass markers are on the right side.
|
|
The YAP WW1 Domain Selects p53BP-2 in the Yeast Two-hybrid
Screen--
To identify binding partners of the YAP WW1 domain that
were visualized in the pull-down assays shown in Fig. 2, a yeast
two-hybrid screen was used. A human brain cDNA library was probed
with the YAP WW1 domain engineered as bait (GBT-YAPWW1). After
screening ~1.5 × 106 clones, 16 clones that were
positive on selection medium and in a
-galactosidase colorimetric
assay were obtained. The following clones were then isolated: the
NADH-ubiquinone oxidoreductase (amino acids 41-174), kinesin-5 (amino
acids 27-176), the KIAA0870 protein with a shifted reading frame (one
time), an unknown sequence (three times), an empty pGAD vector (four
times), and p53BP-2 (amino acids 517-1005; which was isolated seven
times). With the exception of p53BP-2, none of the isolated
clones contained the expected PPXY motif for binding to the
WW1 domain of YAP. In addition, the alignment of inserts for all the
remaining clones revealed no apparent consensus sequence that could be
considered as a core for an alternative motif for binding to the WW1
domain of YAP. With the exception of p53BP-2, we considered all the
remaining clones as false positives. In addition, isolation of p53BP-2
with its PPPPYP confirmed the following: (i) the results of Pirozzi et al. (32), who showed, after a data bank screen, that the peptide of p53BP-2 containing the PY motif can interact in
vitro with the YAP WW1 domain, and (ii) our previous in
vitro results aimed at definition of the optimal core of the YAP
WW1 binders through screening peptide repertoires displayed on phage
(33). Indeed, we have shown that the peptides containing PPPYP
cores display the highest affinity for the WW1 domain of human and
mouse YAP (33).
To further confirm the complex formation between YAP and p53BP-2, the
interaction between GBT-YAPWW1 and the p53BP-2 proline-rich motif (PY5)
fused to the GAL4 transactivation domain (GAD-PY5) was assayed. In
parallel, we did the reverse experiment, in which PY5 was fused to the
DNA-binding domain of GAL4 (GBT-PY5), whereas the YAP WW1 domain was
fused to the GAL4 transactivation domain (GAD-YAPWW1). As shown in Fig.
3, the PY motif of p53BP-2 by itself could interact with the YAP WW1 domain in both ways, whereas a mutant
of the YAP WW 1 domain, YAFE-LH10 (L190W and H192G), did not interact
with the PY5 construct (data not shown) (24). As positive control, we
repeated and confirmed the previous results reported by Field and
co-workers (17) using p53 fused to the GAL4 DNA-binding domain (pVA3)
and pGAD-Cterm, which corresponds to the carboxyl-terminal part of
p53BP-2 from the PPXY motif to the end of the protein
(amino acids 729-1005) (data not shown).

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 3.
The YAP WW1 domain interacts with p53BP-2 in
a yeast two-hybrid assay. The PY5 motif was sufficient to interact
with YAP WW1 domain. Yeast cotransfected with the YAP WW1 domain and
the PY5 motif can grow on medium without Leu, Trp, and His.
|
|
The PY Motif and SH3 Domain of p53BP-2 Are Required for Efficient
YAP Precipitation--
To map the region of p53BP-2 that interacts
with YAP, two different GST fusion proteins of p53BP-2 (GST-PY5
and GST-Cterm) were expressed. As depicted in Fig.
4A, GST-PY5 and GST-Cterm precipitated the two YAP isoforms (doublet) from chicken brain extracts, whereas the PY motif of WBP-1 or GST alone could not. The
same result was obtained with human cellular extracts. Therefore, the
PY motif by itself is also sufficient to precipitate YAP. It is
interesting to note that Cterm has a higher affinity for YAP than for
PY5 alone, suggesting that another region in GST-Cterm can interact
with YAP to stabilize this complex.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 4.
The p53BP-2 SH3 domain increases the
precipitation of YAP. A, GST, GST-WBP-1, GST-PY5, and
GST-Cterm were incubated with chicken brain lysates. Upper
panel, after running on SDS-polyacrylamide gel (10.5%) and
electrotransfer to nitrocellulose, the blot was probed with anti-YAP
antibody. Lower panel, GST calibration is shown. The same
blot were stripped and reprobed with anti-GST antibody. B,
the same experiment as in A was performed, except that
different GST constructs were used for the pull-down experiment:
GST-PY5, GST-Cterm, and GST-Cterm SH3.
|
|
Since YAP interacts with the SH3 domain of c-Yes, we hypothesized that
the SH3 domain of p53BP-2 might also interact with YAP. To address
this, the SH3 domain was rendered inactive by deleting the last two
strands of the p53BP-2 SH3 domain from the GST-Cterm construct
(GST-Cterm
SH3), and the GST pull-down experiments were repeated. As
shown in Fig. 4B, the p53BP-2 SH3 domain interacted,
directly or indirectly, with YAP since the precipitation efficiency of
the GST-Cterm
SH3 construct was lower compared with that of the
GST-Cterm construct.
The SH3 Domain of p53BP-2 Interacts with YAP through a
Non-consensus Binding Motif--
To determine whether the SH3 domain
of p53BP-2 interacts with YAP directly, 15-mer peptides that cover the
entire sequence of human YAP with 10 amino acids overlapping between
two consecutive peptides were synthesized. The peptides were covalently
attached to a cellulose membrane through their C termini as described
in the SPOT technique (31). The membrane was then probed with the radiolabeled GST-Cterm fusion protein containing the SH3 domain of
p53BP-2. As shown in Fig. 5A,
the p53BP-2 SH3 domain bound to YAP through two peptides, spots 16 and
17, whereas the GST-Cterm
SH3 construct did not interact with any
spot, as expected (data not shown). Spots 16 and 17 shared the
PQTVPMRLRK sequence, which did not contain the general consensus
sequence PXXP or PXXDY for binding to SH3
domains. As controls, we also synthesized the p53-derived peptide
CNSSCMGGMNRRPIL, which was previously shown to bind to the p53BP-2 SH3
domain (18), and two peptides (LASRPLPLLPNASPG and VPLGRPEIPLRKSLP)
that were identified previously in a phage display screen as strong
binders to the Src and p53BP-2 SH3 domains, respectively (34). As
negative controls, we generated mutant variants of the same peptides
with a Pro-to-Ala point mutation to destroy the PXXP motif.
In addition, a hot spot mutation (R248W) within the p53-derived peptide
was generated. This mutation was shown to abrogate the p53·p53BP-2
complex (18). As depicted in Fig. 5B, the Src-binding motif
did not interact with the p53BP-2 SH3 domain, whereas both the
phage-selected binding peptide for p53BP-2 and the p53 peptide were
positive in this binding assay. Interestingly, the affinity of the
p53BP-2 SH3 domain for YAP was higher than that for p53 (A
and B in Fig. 5 come from the same experiment and the same
autoradiogram). As expected, the point mutation R248W in the p53
sequence abrogated this interaction; but surprisingly, the mutation P6A
in the artificial motif did not, and only a slight decrease was
observed. Taken together, these data suggest that the p53BP-2 SH3
domain interacts with a non-consensus binding motif in which basic
amino acids seem to be important.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 5.
The p53BP-2 SH3 domain interacts directly
with YAP through the VPMRLR peptide. A, 15-mer peptides
representing full-length human YAP protein were synthesized on a SPOT
membrane. Each spot overlaps the next one by 10 amino acids. The spot
sequence is shown in the right panel. The first and last
spots are in boldface. Numbers above the sequence indicate
the beginning of the corresponding spot, whereas numbers below the
sequence represent the end of the peptide. The membrane was probed with
GST-Cterm radiolabeled with 32P in the left
panel. B, shown are controls: SH3 domain-binding
motifs. The SPOT membrane was probed with radiolabeled GST-Cterm.
Sequences of the spots are shown on the right. I,
III, and V correspond to wild-type sequences, and
II, IV, and VI are mutant sequences
(mutations are in boldface). Underlined prolines
show the positions of the PXXP motifs. C, shown
are the results from progressive alanine fill-up and alanine scan. The
SPOT membrane was hybridized with GST-Cterm.
|
|
To map the minimal binding motif for the p53BP-2 SH3 domain,
progressive alanine substitution and alanine scan analyses on the YAP
sequence were performed using the SPOT peptide assay. As shown in Fig.
5C, the minimal length sequence required for the interaction
between the SH3 domain of p53BP-2 and YAP was the VPMRLR peptide. We
noticed that the longer sequence, PQTVPMRLRK, bound better.
Interestingly, a single point mutation (R87A) abolished the interaction
with the p53BP-2 SH3 domain, reminiscent of the p53 R248W mutant (Fig.
5B), suggesting again that the basic amino acid at this
position could be critical for binding.
A Point Mutation (W976R) in the p53BP-2 SH3 Domain Switches the
Binding Specificity to the PXXP Motif--
By simple comparison of all
SH3 domain sequences available in the data bank, two amino acid
positions were identified that might explain why the SH3 domain of
p53BP-2 does not require the PXXP or PXXDY motif
to bind to YAP, but instead selects the VPMRLR core as its cognate
ligand. First, the SH3 domain of p53BP-2 is unique in having
three tryptophans in a row located in the
C strand (see Table
I for a partial listing). Second, the SH3
domain of p53BP-2 does not have the consensus tyrosine (or aromatic
amino acid) within the
E strand. Interestingly, the latter
difference is also observed in the sequence of the SH3 domain of Eps8,
which interacts with a unique binding motif, the PXXDY
peptide, and represents the third group of specificity for SH3 domains
(13). To address the potential role of these two singularities in the binding specificity of the SH3 domain of p53BP-2, point mutations in
the
C and
E strands were introduced. Toward this end, we mutated
Trp976 to Arg and Leu990 to Tyr separately and
together within the GST-Cterm construct (containing the p53BP-2 SH3
domain). Trp976 was replaced by Arg due to the fact that
charged amino acids are very often present at this position in other
SH3 domains (Table I). The binding properties of these mutants were
assayed by the SPOT technique. As depicted in Fig.
6, the GST-C-term W976R mutant, as well
as the double mutant GST-C-term W976R-L990Y, interacted weakly with SH3
domain-binding peptide-2 of YAP (referred to as SB2; NVPQTVPMRLRKLP).
In contrast, they bound strongly to a SB2 peptide in which a
PXXP motif had been artificially introduced (NVQPTVPMRLRKLP). The L990Y mutant behaved
similarly to the wild type, which bound SB2 as well as the SB2 mutant
engineered for the presence of the PXXP motif. The mutation
R87A in the SB2 motif abolished the interaction with the three SH3
domain mutants as well as with wild-type SH3. Therefore, constructs
possessing the W976R mutation belong to Group II of SH3 domains
(PXXPXR). Neither the wild type nor these three
mutants interacted with the PXXDY (Eps8 binder) or
RXLPXXP (Src binder) motif (data not shown). In
summary, these data suggest that a new binding specificity for SH3
domains, as represented by the SH3 domain of p53BP-2, could be
determined by the third consecutive Trp within the
C strand of the
domain. We suggest that the SH3 domain of p53BP-2 may represent a new
group of specificity for SH3 domains (Group IV).
View this table:
[in this window]
[in a new window]
|
Table I
Amino acid comparison of SH3 domains
Shown is a partial listing of SH3 domains. Arrows indicate the
positions of p53BP-2 strands. Conserved amino acids are shown in
gray; similar amino acids are inverted shown in black. The human (h)
KIAA0771 clone is closely related to murine (m) p53BP-2. Asterisks
localize the two major differences between the p53BP-2 SH3 domain and
other SH3 domains. PLC , phospholipase C .
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 6.
Trp976 within the p53BP-2 SH3
domain is responsible for binding to non-consensus SH3 domain-binding
motifs. Four SPOT membranes hybridized with four different probes:
GST-Cterm (Cterm), GST-Cterm W976R (WR),
GST-Cterm L990Y (LY), and GST-Cterm W976R-L990Y
(WR-LY). The sequences of the three spots are shown.
Underlined amino acids indicate the mutations within the SB2
motif.
|
|
Mapping of the Minimal Sequence of p53BP-2 Required for Binding to
YAP--
To better understand the interaction between the YAP WW1
domain and the p53BP-2 PY motif, the PY5 core and its flanking
sequences were further characterized. Using the SPOT technique, we
showed that the nanopeptide
Y1P2P3Y4P5P6P7P8Y9
represents the optimal sequence to interact with the WW1 domain of YAP
(Fig. 7, A and B).
To analyze the importance of each amino acid in the sequence, we
performed an alanine scan using the SPOT peptide binding assay and
pull-down experiments. From the SPOT binding data, the
YXPPXYP motif (underlined
characters are essential) appeared necessary for efficient binding to
the YAP WW1 domain (Fig. 7C). Since, on SPOT membranes, only
short peptides (amino acids 10-15) that are covalently attached to a
cellulose support can be analyzed, we wanted to verify the
YXPPXYP consensus sequence with another technique. The alanine scan was repeated by performing site-directed mutagenesis on the proline-rich insert in the GST-PY5 construct. The
scan was restricted to the
Y4P5P6P7P8Y9P10
sequence. The GST-PY5 mutants were analyzed for their capacity to
precipitate YAP from chicken brain lysates. Interestingly, the
consensus sequence generated in pull-down experiments differed slightly
from the consensus sequence generated by the SPOT peptide binding
assay. We pointed to four essential amino acids,
YPPPXY, in the
proline-rich core of p53BP-2 for the YAP pull-down experiment (Fig.
7E). Since the GST-PY5 mutant proteins, when blotted on
membranes and probed with radiolabeled YAP WW1 domain, displayed the
same consensus sequence as that shown in the SPOT binding assay (data
not shown), we think that the discrepancy observed between SPOT and
pull-down experiments may reflect the differences in structural
constrains of peptide ligands. For the SPOT technique, binding occurs
on the membrane, whereas for the pull-down experiments, binding occurs in solution. The pull-down experiments seem to be closer to the physiological conditions. We conclude that the
YPPPXY motif is the
minimal sequence required for the YAP WW1 domain/p53BP-2 interaction in
solution.

View larger version (75K):
[in this window]
[in a new window]
|
Fig. 7.
Mapping the YAP WW1 domain-binding
motif. A-C, SPOT membranes containing all or part of
the PY motif were probed with radiolabeled GST-YAPWW1. Left
panels, short exposures (30 s); middle panels, long
exposures (10 min); right panels; spot numbers.
A, mapping of the minimal binding site for the YAP WW1
domain. The PY motif sequence spanning amino acids 734-763 was
synthesized as a 12-mer with an offset of one amino acid. B
and C, alanine scan and alanine progressive substitutions,
respectively, of the best binding motif: EYPPYPPPPYPS. D,
sequences of spots. E, pull-down experiments with different
GST-PY5 mutants (GST-A4 to GST-A11) incubated with chicken brain
extracts. After run and transfer, the membrane was probed with anti-YAP
antibody (upper panel). For calibration, the membrane was
stripped and reprobed with anti-GST antibody (lower
panel).
|
|
p53BP-2 and YAP Interact in Vivo--
Since p53BP-2 is a
cytoplasmic protein (21) and YAP is present in both the cytoplasm and
the nucleus (15, 16), these two proteins may interact in
vivo. Recently, Ito and co-workers (16) have shown that YAP
harbors a transcriptional activation domain within its
carboxyl-terminal region. We decided to reproduce this result and
consider a transcriptional assay as a biological "readout" for the
YAP·p53BP-2 complex. The DNA-binding domain of GAL4 was fused to YAP
(DB-HYAP6) and cotransfected with a reporter construct containing the
CAT gene downstream of five GAL4-binding sites, pG5CAT. As shown in
Fig. 8A, DB-HYAP6 drove the
CAT expression in a dose-dependent manner. This
transcriptional activity was dependent on the activation domain of YAP
since its deletion within the construct DB-HYAP6 (DB-HYAP6
AD) did
not lead to CAT expression. As a control, the overexpression of HYAP6
did not activate CAT transcription.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 8.
Mammalian two-hybrid assays. HEK 293 cells were transfected with the pG5CAT vector (0.5 µg) alone or in
association with other DNA constructs. CAT production was analyzed with
the CAT/ELISA kit. As a control and internal calibration, we
cotransfected with an invariable reporter gene, SV40-LacZ (1 µg).
Each experiment was performed in duplicate. A, YAP possesses
transcriptional activity. 2 µg of DB-GAL4, BP-2, DB-BP-2, HYAP6, or
DB-HYAP6 AD were transfected and assayed for CAT production.
B and E, the expression of BP-2, DB-BP-2, and all
the different mutants or constructs of YAP was checked by Western
immunoblotting. C, YAP and p53BP-2 interact in
vivo. DB-BP-2 (0.5 µg) was transfected with the pcDNA vector
alone (0.25 µg) or with HYAP6 (0.25 µg) (left panel);
DB-HYAP6 (0.25 µg) was cotransfected with the vector alone (2 µg)
or with BP-2 (2 µg) (right panel). D, the PY5
motif and the SH3 domain are required for efficient interaction with
YAP. Different constructs of p53BP-2 fused to the DNA-binding domain of
GAL4 (0.5 µg of DB-BP-2, 0.4 µg of DB-Cterm, 0.4 µg of DB-Cterm
A9, 0.4 µg of DB-Cterm SH3, or 0.33 µg of DB-PY5) were
transfected with or without 0.25 µg of HYAP6. The variation in CAT
production observed in the upper panel was not due to the
absence of YAP since Western immunoblotting revealed similar YAP
expression levels (lower panel). The same is true for
E, in which different constructs of YAP (0.25 µg of HYAP6,
0.25 µg of HYAP6 W199F, or 0.2 µg of HYAP6 AD) were cotransfected
with DB-Cterm (0.5 µg).
|
|
In the same experimental system, we investigated whether p53BP-2 also
possesses transcriptional activity. As shown in Fig. 8A,
full-length p53BP-2 fused to the DNA-binding domain of GAL4 (DB-BP-2)
did not activate the transcription of CAT, suggesting that p53BP-2 does
not possess transcriptional activity.
The cotransfection of DB-BP-2 and HYAP6 led to CAT production (Fig.
8C), which was dose-dependent for YAP DNA (data
not shown). This result suggests that these two proteins interact
together in vivo. The reverse cotransfection, DB-HYAP6 with
different amounts of p53BP-2 DNA, did not modify the amount of CAT
produced by DB-HYAP6 alone (Fig. 8C).
Interestingly, the interaction of p53BP-2 and YAP in vivo
was drastically increased when only the carboxyl-terminal part of p53BP-2 was used (DB-Cterm). This difference in activation of CAT by
the C terminus of p53BP-2 versus full-length p53BP-2
proteins might be due to the instability of full-length p53BP-2, as
previously documented (21). As expected, the strength of binding
between YAP and p53BP-2 was dependent on the presence of the WW and SH3 domains (Fig. 8, D and E).
Overexpression of a Constitutively Active Form of Yes Modifies the
Binding Affinity between YAP and p53BP-2--
Since YAP was first
described as a Yes-interacting protein, we investigated the effect of
Yes overexpression on the interaction between YAP and p53BP-2. To
address the issue concerning the involvement of the Yes kinase
activity, a constitutively active form of c-Yes kinase, the mutant
Y535F, was also used. The cotransfection of the DB-Cterm·HYAP6
complex with the Yes Y535F mutant led to a decrease in CAT production
in a dose-dependent manner, whereas wild-type Yes, under
the same conditions, did not change the amount of CAT (Fig.
9A). Since the Yes Y535F
mutant did not change the transcriptional activity of DB-HYAP6 (Fig.
9B), we concluded that the kinase activity of Yes decreases
the affinity between YAP and p53BP-2. The same results were obtained
with a constitutively active Src mutant, Y527F (data not shown). Taken
together, these data suggest that at least two non-receptor tyrosine
kinases, namely Yes and Src, can decrease, directly or indirectly, the interaction between YAP and p53BP-2.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 9.
Effect of an activated form of c-Yes on
YAP/p53BP-2 interaction. CAT/ELISA was carried out on HEK 293 cells using the same conditions as described for Fig. 8. A,
Yes Y535F disrupts the interaction between YAP and DB-Cterm. The same
ratio of HYAP6 (0.25 µg) to DB-Cterm (0.5 µg) was cotransfected
with the pMIK-Neo vector alone (1 µg; Vector) or with
different pMIK-Neo-Yes constructs. B, Yes Y535F does not
reduce YAP transcriptional activity. DB-HYAP6 (0.25 µg) was
cotransfected with pMIK-Neo (1 µg; Vector) or
pMIK-Neo-Yes-Y535F.
|
|
The in Vitro Binding of YAP to p53BP-2 Is Negatively Regulated by
Phosphorylation--
Since non-receptor tyrosine kinases could
directly modulate the binding affinity between YAP and p53BP-2, we
investigated the tyrosine phosphorylation status of p53BP-2, knowing
that YAP is not a phosphotyrosine, but a phosphoserine protein (29). As
depicted in Fig. 10, p53BP-2 was highly
phosphorylated on its tyrosine(s) when the active mutant of c-Yes, but
not the wild type, was overexpressed. This observation suggests that
non-receptor tyrosine kinases can phosphorylate p53BP-2 either directly
or indirectly.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 10.
Yes Y535F phosphorylates p53BP-2 directly or
indirectly. HEK 293 cells were transfected with DB-BP-2 (0.5 µg)
and HYAP6 (0.25 µg) plus vector pMIK-Neo alone, pMIK-Neo-Yes, or
pMIK-Neo-Yes-Y535F (2 µg for the three constructs). 36 h after
transfection, the cells were lysed, and p53BP-2 was immunoprecipitated
using anti-MBP-2 antibody. Samples were run on SDS-polyacrylamide gel
(10.5%) and transferred to nitrocellulose. Phosphotyrosines were
detected with the 4G10 antibody (upper panel).
Immunoprecipitation of p53BP-2 was checked by Western immunoblotting
with anti-MBP-2 antibody (lower panel).
|
|
Since the PY5 motif of p53BP-2 possesses four phosphorylatable
amino acids
(YPPYPPPPYPS), the
consequences of their phosphorylation on binding affinity were
investigated. We were also interested whether the MAPK cascade would be
implicated in the consequences of the serine phosphorylation. Using the
SPOT technique, each tyrosine or serine, alone or in combination, was
replaced by its phosphorylated form, by an acidic amino acid to mimic
the negative charge (Asp), or by a neutral amino acid (Asn). As shown
in Fig. 11, substitution of
Tyr9 by phosphotyrosine or any other amino acid abolished
the binding of the YAP WW1 domain. Moreover, the Ser11
phosphorylation reduced the binding to the WW1 domain, whereas the Asp
or Asn substitution of Ser11 did not affect the binding.
Interestingly, the individual phosphorylation of Tyr1 or
Tyr4 did not seem to modify the interaction, whereas any
combination of these two Tyr residues with any combination of
Ser11 abolished the binding. Since we do not know which
residue(s) is phosphorylated in vivo, these data only
suggest that the interaction between YAP and p53BP-2 may be negatively
regulated by tyrosine/serine phosphorylation.

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 11.
Phosphorylation of the PY5 motif prevents
YAP WW1 domain binding. A, a SPOT membrane containing
the PY motif under different forms of phosphorylation was incubated
with radiolabeled GST-YAPWW1. Upper panel, short exposure
(30 s); lower panel, long exposure (10 min). B,
shown are spot numbers. C, shown are spot sequences.
Substitutions are underlined. J, phosphoserine;
Z, phosphotyrosine.
|
|
 |
DISCUSSION |
In this study, we identified a new partner of YAP: p53BP-2. We
showed that this interaction occurs both in vitro and
in vivo as proven by GST pull-down experiments and yeast and
mammalian two-hybrid assays. Unfortunately, we failed to
co-immunoprecipitate these two proteins, despite YAP and p53BP-2
immunoprecipitation by their respective antibodies (data not shown).
The other groups working on p53BP-2 have not been able to show any
co-immunoprecipitation with this protein (17, 19-21). According to
their data, one possible explanation would be the instability of
p53BP-2 (21). In our CAT/ELISA, the difference in the CAT produced by
DB-BP-2·HYAP6 or DB-Cterm·HYAP6 could also be explained by the
full-length p53BP-2 instability (Fig. 8D). However, we
cannot exclude other possibilities such as full-length p53BP-2 could
exist in different states of conformations/complexations/phosphorylations during the cell cycle, leading to a narrow window where YAP and p53BP-2 could interact. A
closed conformation of p53BP-2 involving its SH3 domain and a binding
motif upstream of the PY motif would explain the difference observed in
Fig. 8D between DB-BP-2 and DB-Cterm. This scenario is
likely since a motif similar to the YAP SB2 peptide is present in the
amino-terminal part of p53BP-2:
VPLREK (amino acids 322-327). Such
hypotheses need to be further investigated.
Our data show that an efficient interaction between YAP and p53BP-2
requires both the YAP WW1 and p53BP-2 SH3 domains. By pull-down and
SPOT experiments, we have found that the PPXY binding motif,
previously established by us, is not sufficient for an efficient
interaction with the YAP WW1 domain. In the p53BP-2 context, the YAP
WW1 domain requires the YPPPXY peptide to interact with
p53BP-2. Interestingly, a similar peptide, YLPPXY, is
present in polyomavirus enhancer binding protein-2
(PEBP-2
), a
transcription factor that also binds to YAP (16). A BLAST search using
the YPPPXY sequence showed that other proteins possess this
very motif, such as the transcription factor Egr-1/KROX-24 (YPPPAY),
suggesting that these proteins could also interact with the YAP WW1
domain or related WW domains. This observation is in agreement with
multiple protein bands observed in the pull-down experiments done with the YAP WW1 domain (Fig. 2). It is worthwhile to mention that p53BP-2
was also precipitated by GST-YAPWW1, but it was not one of the four
major bands in Fig. 2 (data not shown). The fact that p53BP-2 did not
appear as a major ligand in this assay supports our hypothesis that SH3
and WW domains are both required for a stable and strong interaction
since only the WW1 domain of YAP (without the SB2 motif) was used in
the pull-down experiments. The identification of these other partners
would be helpful to fully understand the function of YAP.
Besides the WW domain/PY motif interaction, the p53BP-2 SH3 domain
binds to YAP via the VPMRLR peptide, a non-consensus SH3 domain-binding
motif (PXXP or PXXDY). The single substitution of
the third tryptophan (Try976) by an arginine in the
C
sheet prevents the mutant SH3 domain from interacting with a
non-PXXP binding motif. This finding suggests that the
presence of three tryptophans (or perhaps three aromatic amino acids)
in a row within the
C sheet is responsible for the SH3 domain
interaction with a non-PXXP binding motif. This result is
not in contradiction to the RPXXPXXR consensus
binding motif of the p53BP-2 SH3 domain previously obtained by phage
display (34) because this consensus sequence was obtained from a biased library, in which the PXXP motif was fixed
(X6PXXPX6). To
confirm our data, it would be interesting to perform phage display,
with a non-biased library, on the W967R mutant as well as the wild type. It would also be very informative to extend the study to the few
other SH3 domains possessing three aromatic residues in a row.
We have shown that the c-Yes kinase led to p53BP-2 tyrosine
phosphorylation and to a diminution of the binding affinity between YAP
and the carboxyl-terminal region of p53BP-2. From SPOT data, we found
that tyrosine phosphorylation of the PY motif can either preserve
(Tyr1 and Tyr4) or disrupt (Tyr9)
binding to the YAP WW1 domain (Fig. 11), suggesting a sensitive regulation by tyrosine kinase(s). Considering that the MAPK cascade activated by non-receptor tyrosine kinases might also be involved, we
showed that the serine phosphorylation within the PY motif (Ser11) decreases the interaction with the YAP WW1 domain.
It would be interesting to identify which amino acid(s) is
phosphorylated in vivo and to mutate it to study the effect
of c-Yes overexpression on the YAP·p53BP-2 complex.
All evidence points to p53 as not being part of the YAP·p53BP-2
complex because of the following. (i) The p53BP-2 SH3 domain is
required for its interaction with YAP and p53; and (ii) in a yeast
three-hybrid system, we failed to demonstrate a tripartite complex:
p53·Cterm·YAPWW1 (data not shown). Taken together, these data
suggest that there would be a competition between YAP and p53 for
binding to p53BP-2, as has been described with the other partners of
p53BP-2 (17, 19-21).
The role of p53BP-2 is still confusing. Some authors propose that
p53BP-2 is a pro-apoptotic protein (21), whereas others conclude that
p53BP-2 overexpression does not lead to apoptosis, but impedes
G2/M transition (20). This discrepancy could be due to the
cell types used by the authors. Our data suggest a link between the
activation of non-receptor tyrosine kinases and the release of p53BP-2
from its binding with YAP, allowing p53BP-2 to regulate p53 activity.
Acknowledgments--
We thank Sonny Cheang and Hillary Linn for
preparation of the SPOT membranes, Sahng-June Kwak for the Yes and Yes
Y535F constructs, and Marie Kosco-Vilbois and Kate Biblowitz for
valuable comments on the manuscript.
 |
FOOTNOTES |
*
This work was supported by Grants CA45757 and AR45626 from
the National Institutes of Health and by Grant RG0234 from the Human
Frontier Science Program Organization.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Serono Pharmaceutical
Research Inst., 14, chemin des Aulx, Plan-Les-Ouates, 1228 Geneva,
Switzerland. Tel.: 41-22-706-9788; Fax: 41-22-794-6965; E-mail:
xavier.espanel@serono.com.
Published, JBC Papers in Press, January 31, 2001, DOI 10.1074/jbc.M008568200
 |
ABBREVIATIONS |
The abbreviations used are:
YAP, Yes-associated
protein;
WBP, WW domain-binding protein;
p53BP-2, p53-binding
protein-2;
CAT/ELISA, chloramphenicol
acetyltransferase/enzyme-linked immunosorbent assay;
GST, glutathione
S-transferase;
PCR, polymerase chain reaction;
HEK, human
embryonic kidney;
MAPK, mitogen-activated protein kinase.
 |
REFERENCES |
| 1.
|
Bork, P.,
and Sudol, M.
(1994)
Trends Biochem. Sci.
19,
531-533
|
| 2.
|
Chen, H. I.,
and Sudol, M.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
7819-7823
|
| 3.
|
Sudol, M.
(1996)
Prog. Biophys. Mol. Biol.
65,
113-132
|
| 4.
|
Macias, M. J.,
Hyvonen, M.,
Baraldi, E.,
Schultz, J.,
Sudol, M.,
Saraste, M.,
and Oschkinat, H.
(1996)
Nature
382,
646-649
|
| 5.
|
Rentschler, S.,
Linn, H.,
Deininger, K.,
Bedford, M. T.,
Espanel, X.,
and Sudol, M.
(1999)
Biol. Chem.
380,
431-442
|
| 6.
|
Ermekova, K. S.,
Zambrano, N.,
Linn, H.,
Minopoli, G.,
Gertler, F.,
Russo, T.,
and Sudol, M.
(1997)
J. Biol. Chem.
272,
32869-32877
|
| 7.
|
Bedford, M. T.,
Chan, D. C.,
and Leder, P.
(1997)
EMBO J.
16,
2376-2383
|
| 8.
|
Bedford, M. T.,
Sarbassova, D.,
Xu, J.,
Leder, P.,
and Yaffe, M. B.
(2000)
J. Biol. Chem.
275,
10359-10369
|
| 9.
|
Lu, P.-J.,
Zhou, X. Z.,
Shen, M.,
and Lu, K. P.
(1999)
Science
283,
1325-1328
|
| 10.
|
Komuro, A.,
Saeki, M.,
and Kato, S.
(1999)
J. Biol. Chem.
274,
36513-36519
|
| 11.
|
Irusta, P. M.,
and DiMaio, D.
(1998)
EMBO J.
17,
6912-6923
|
| 12.
|
Xu, W.,
Harrison, S. C.,
and Eck, M. J.
(1997)
Nature
385,
595-602
|
| 13.
|
Mongiovi, A. M.,
Romano, P. R.,
Panni, S.,
Mendoza, M.,
Wong, W. T.,
Musacchio, A.,
Cesarini, G.,
and Di Fiore, P. P.
(1999)
EMBO J.
18,
5300-5309
|
| 14.
|
Sudol, M.,
Chen, H. I.,
Bougeret, C.,
Einbond, A.,
and Bork, P.
(1995)
FEBS Lett.
369,
67-71
|
| 15.
|
Mohler, P. J.,
Kreda, S. M.,
Boucher, R. C.,
Sudol, M.,
Stutts, M. J.,
and Milgram, S. L.
(1999)
J. Cell Biol.
147,
879-890
|
| 16.
|
Yagi, R.,
Chen, L. F.,
Shigesada, K.,
Murakami, Y.,
and Ito, Y.
(1999)
EMBO J.
18,
2551-2562
|
| 17.
|
Iwabuchi, K.,
Bartel, P. L.,
Li, B.,
Marraccino, R.,
and Fields, S.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
6098-6102
|
| 18.
|
Gorina, S.,
and Pavletich, N. P.
(1996)
Science
274,
1001-1005
|
| 19.
|
Helps, N. R.,
Barker, H. M.,
Elledge, S. J.,
and Cohen, P. T.
(1995)
FEBS Lett.
377,
295-300
|
| 20.
|
Naumovski, L.,
and Cleary, M. L.
(1996)
Mol. Cell. Biol.
16,
3884-3892
|
| 21.
|
Yang, J. P.,
Hori, M.,
Takahashi, N.,
Kawabe, T.,
Kato, H.,
and Okamoto, T.
(1999)
Oncogene
18,
5177-5186
|
| 22.
|
Nakagawa, H.,
Koyama, K.,
Murata, Y.,
Morito, M.,
Akiyama, T.,
and Nakamura, Y.
(2000)
Cancer Res.
60,
101-105
|
| 23.
|
Chen, H. I.,
Einbond, A.,
Kwak, S. J.,
Linn, H.,
Koepf, E.,
Peterson, S.,
Kelly, J. W.,
and Sudol, M.
(1997)
J. Biol. Chem.
272,
17070-17077
|
| 24.
|
Espanel, X.,
and Sudol, M.
(1999)
J. Biol. Chem.
274,
17284-17289
|
| 25.
|
Espanel, X.,
Le Cam, L.,
North, S.,
Sardet, C.,
Brun, G.,
and Gillet, G.
(1998)
Oncogene
17,
585-594
|
| 26.
|
Kalderon, D.,
Roberts, B. L.,
Richardson, W. D.,
and Smith, A. E.
(1984)
Cell
39,
499-509
|
| 27.
|
Herbomel, P.,
Bourachot, B.,
and Yaniv, M.
(1984)
Cell
39,
653-662
|
| 28.
|
Sudol, M.,
and Hanafusa, H.
(1986)
Mol. Cell. Biol.
6,
2839-2846
|
| 29.
|
Sudol, M.
(1994)
Oncogene
9,
2145-2152
|
| 30.
|
Frank, R.,
and Doring, R.
(1988)
Tetrahedron
44,
6031-6040
|
| 31.
|
Blankenmeyer-Menge, B.,
Nimitz, B.,
and Frank, R.
(1990)
Tetrahedron
31,
1701-1704
|
| 32.
|
Pirozzi, G.,
McConnell, S. J.,
Uveges, A. J.,
Carter, J. M.,
Sparks, A. B.,
Kay, B. K.,
and Fowlkes, D. M.
(1997)
J. Biol. Chem.
272,
14611-14616
|
| 33.
|
Linn, H.,
Ermekova, K. S.,
Rentschler, S.,
Sparks, A. B.,
Kay, B. K.,
and Sudol, M.
(1997)
Biol. Chem.
378,
531-537
|
| 34.
|
Sparks, A. B.,
Rider, J. E.,
Hoffman, N. G.,
Fowlkes, D. M.,
Quillam, L. A.,
and Kay, B. K.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
1540-1544
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
B. V. V. G. Reddy and K. D. Irvine
The Fat and Warts signaling pathways: new insights into their regulation, mechanism and conservation
Development,
September 1, 2008;
135(17):
2827 - 2838.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Katz, H. Benyamini, S. Rotem, M. Lebendiker, T. Danieli, A. Iosub, H. Refaely, M. Dines, V. Bronner, T. Bravman, et al.
Molecular basis of the interaction between the antiapoptotic Bcl-2 family proteins and the proapoptotic protein ASPP2
PNAS,
August 26, 2008;
105(34):
12277 - 12282.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Rotem, C. Katz, H. Benyamini, M. Lebendiker, D. Veprintsev, S. Rudiger, T. Danieli, and A. Friedler
The Structure and Interactions of the Proline-rich Domain of |