|
Originally published In Press as doi:10.1074/jbc.M006634200 on October 13, 2000
J. Biol. Chem., Vol. 276, Issue 18, 15099-15106, May 4, 2001
Activation of Hepatocyte Growth Factor (HGF) by
Endogenous HGF Activator Is Required for Metanephric Kidney
Morphogenesis in Vitro*
Janet
van Adelsberg ,
Swati
Sehgal§,
Andrew
Kukes§,
Christopher
Brady§,
Jonathan
Barasch,
Jun
Yang, and
Yonghong
Huan
From the Columbia University College of Physicians and Surgeons,
Department of Medicine, New York, New York 10032
Received for publication, July 25, 2000, and in revised form, October 12, 2000
 |
ABSTRACT |
The interaction of hepatocyte growth factor (HGF)
with c-Met has been implicated in morphogenesis of the kidney,
lung, mammary gland, liver, placenta, and limb bud. HGF is secreted as
an inactive zymogen and must be cleaved by a serine protease to
initiate Met signaling. We show here that a serine protease specific
for HGF, HGF activator (HGFA), is expressed and activated by the
ureteric bud of the developing kidney in vivo and in
vitro. Inhibition of HGFA activity with serine protease
inhibitors reduced ureteric bud branching and inhibited
glomerulogenesis and nephrogenesis. Activated HGF rescued developing
kidneys from the effects of inhibitors. HGFA was localized around the
tips of the ureteric bud in developing kidneys, while HGF was expressed
diffusely throughout the mesenchyme. These data show that expression of
HGF is not sufficient for development, but that its activation is also
required. The localization of HGFA to the ureteric bud and the
mesenchyme immediately adjacent to it suggests that HGFA creates a
gradient of HGF activity in the developing kidney. The creation and
shape of gradients of activated HGF by the localized secretion of HGF
activators could play an important role in pattern formation by HGF
responsive tissues.
 |
INTRODUCTION |
The interaction of hepatocyte growth factor
(HGF)1 with the receptor
tyrosine kinase c-Met is a prototype of mesenchymal to epithelial
signaling. HGF has mitogenic, motogenic, and morphogenic activities in
a variety of cell types (1-4). It has been implicated in mesenchymal
to epithelial signaling in the development of the kidney, lung, mammary
gland, liver, and placenta (5). In the kidney, HGF is produced solely
by the metanephric mesenchyme (6, 7). The Met receptor is expressed by
metanephric mesenchyme as well as by the epithelium of the ureteric bud
and later by S-shaped bodies and tubules. Neutralizing antibodies
against HGF blocked branching morphogenesis by the ureteric bud in
organ cultures of kidney rudiments and inhibited the early steps in
branching morphogenesis by immortalized ureteric bud cells (UB cells)
in three-dimensional organ culture (7, 8). Antibodies against HGF, in
addition to their effects on branching morphogenesis, inhibited
glomerulogenesis and nephrogenesis.
HGF is a member of the plasminogen family of serine proteases although
it lacks proteolytic activity. Like other members of this group, it is
secreted as an inactive zymogen that must be activated by proteolytic
cleavage at Arg494-Val495 (9-12). A specific
serine protease, HGF activator (HGFA), was purified from serum based on
this biological activity and has been shown to mediate activation of
HGF in injured tissues in vivo (13, 14). Other serine
proteases, including urokinase, factor XIIa, and tissue plasminogen
activator have been shown to activate HGF in vitro, but
their biologic role in HGF activation is unknown (11, 15, 16). HGFA is
expressed in adult liver and is secreted into the blood (14). Like
other serine proteases in the coagulation and fibrinolytic cascades,
HGF activator is secreted as an inactive single chain zymogen. It is
cleaved to the catalytically active, disulfide-linked heterodimer by
thrombin in vitro. The expression of HGFA during embryonic
development is not known. HGF is required for embryonic development
(17, 18), so that activators of HGF must be expressed during
embryogenesis. What might be the source of HGF activators in the
developing metanephric kidney? The organ culture experiments that
revealed a role for HGF in renal development contained no serum and
hence no exogenous HGF activating activity. Therefore, the developing
kidney must contain an endogenous HGF activator. A likely candidate for
this activity is HGFA.
To test the hypothesis that HGFA is responsible for HGF activation
during fetal development, we cloned the murine homolog of the human
HGFA gene. In the earliest stage of renal
development, message for HGFA was found only in
microdissected ureteric bud and was not detected in mRNA extracted
from the adjacent mesenchyme. Immortalized UB cells expressed
HGFA message, protein, and an HGF hydrolyzing activity that
was inhibited by a variety of serine protease inhibitors including
leupeptin. UB cells scattered in response to the single chain zymogen
of HGF; this scattering activity was inhibited by the same
concentrations of leupeptin that blocked HGF activation. Leupeptin at
concentrations that blocked the hydrolysis of HGF by ureteric bud
in vitro inhibited renal morphogenesis in organ culture. The
inhibitory effect of leupeptin could be rescued by activated HGF. These
data show that the activation of HGF in developing kidney is kidney
autonomous and suggest that activation of HGF is regulated by ureteric
bud secretion of HGFA.
 |
MATERIALS AND METHODS |
Sequence of Murine HGFA--
The coding sequence of human HGFA
(GenBankTM accession number D50030) was used to screen the
murine EST data base using the BLAST algorithm (19). Sequences
identified by the initial screen were used to re-interrogate the data
base. By this process, 9 clones were identified and assembled into a
contig. Five of these clones (mx85 g08, uc76a08, mj60f03, mw81a02, and
ma52a08) were purchased from ATCC, characterized by restriction
mapping, and sequenced in both directions. The sequence of murine HGFA
was deposited in GenBankTM (AF224724).
Northern Blotting--
A 942-nucleotide EcoRI,
NarI fragment of IMAGE clone mj60f03 corresponding to
nucleotides 922 to 1864 of the full-length sequence was used as a
probe. The probe was labeled with digoxigenin-UTP by random priming and
used to screen mouse multiple tissue Northern blots
(CLONTECH). For Northern blots of UB cell RNA,
total RNA was isolated from UB cell cultures using RNAzol (Cinna)
according to the manufacturer's instructions. Total RNA (1 µg) was
denatured and transferred to nylon membranes (Immobilon-N, Millipore).
The membrane was hybridized for 16 h at 45 °C and washed with
0.1 × SSC containing 1% SDS at 65 °C. Bound probe was
visualized with alkaline phosphatase and chemiluminescent detection
system according to the manufacturer's instructions (Roche Molecular Biochemicals).
RT-PCR--
RNA was isolated from murine UB cells or from
microdissected rat ureteric buds and mesenchymes using RNAzol (Cinna).
Poly(A) RNA from rat ureteric buds and mesenchymes was purified from
total RNA by affinity chromatography on poly(dT) resin (Oligotex-dT, Qiagen). The microdissected rat kidney rudiments were obtained at
embryonic day 13.5, when the ureteric bud had branched a single time.
This stage of kidney development in the rat is morphologically equivalent to embryonic day 11.5 in murine kidney development.
Primers for RT-PCR of murine HGFA were TGTTCAACCCCAACAACC (forward
primer, nucleotides 1474-1491) and GTAAGCCACACCATTCTTCTC (reverse primer, nucleotides 1838-1818). Total RNA was transcribed into cDNA using avian myeloblastosis virus reverse transcriptase and random hexamers. The cDNA was subjected to 30 cycles of PCR using Taq polymerase (Promega). The annealing temperature
was 59 °C for PCR with the murine template (UB cell RNA) and
54 °C for PCR with the rat template (dissected ureteric bud or
mesenchyme RNA). Amplified DNA fragments were purified from agarose
gels using QIAEX resin (Qiagen) and directly sequenced by the DNA
facility of Columbia University.
Cells, Plasma, Serum, Conditioned Medium, and HGF--
UB cells
(20) were grown in Dulbecco's modified Eagle's medium/F-12 (Life
Technologies, Inc.) with 5% fetal bovine serum (Hyclone) and 1%
ITS+ supplement (insulin, transferrin, selenous acid,
essential fatty acids), from Fisher Scientific. Conditioned medium was
obtained by washing confluent cultures of UB cells three times with
Dulbecco's modified Eagle's medium/F-12 containing no additives. The
cells were incubated for 8 h at 37 °C, and washed again three
times. Twenty-five ml of medium without additives were then incubated with confluent cultures in 150-cm2 flasks for 48 h to
obtain conditioned medium. The conditioned medium was cleared by
centrifugation at 3000 × g for 15 min and concentrated
1000-fold with a Centricon Plus-80 Biomax-8 device (molecular
mass cutoff 8000 daltons, Millipore). Mouse plasma and serum
were purchased from Pelfreez. Activated HGF was obtained from R & D
Systems (NSO HGF). The inactive zymogen of HGF (HGFsc) was a gracious
gift of Dr. George vande Woude (National Institutes of Health,
Bethesda, MD).
Antibodies--
Antibodies raised against peptides derived from
human HGFA were purchased from Santa Cruz Biotechnology. The peptide
used to raise antibody HGFA-L (N-19) is identical in murine and human HGFA (underlined in Fig. 1). Antibodies against human HGF
subunit (N-19 and C-20), WT1 (C-19), and the HGF receptor
met were also obtained from Santa Cruz Biotechnology.
Antibody against phosphotyrosine (4G10) was obtained from Upstate
Biotechnologies. TROMA-1 was obtained from the Developmental Studies
Hybridoma Bank. Cy3-labeled anti-rabbit and fluorescein
isothiocyanate-labeled anti-rat IgG were obtained from Jackson
ImmunoResearch. Alexa 488-labeled anti-rabbit antibody was obtained
from Molecular Probes. For some experiments, TROMA-1 antibodies were
purified by anion exchange chromatography and labeled with Alexa 488 (Molecular Probes) according to the manufacturer's instructions.
Immunoblots--
Proteins were subjected to SDS-PAGE under
reducing conditions and transferred to polyvinylidene difluoride
(Immobilon-P, Millipore). Blots were blocked for 1 h with 10%
instant nonfat dry milk in PBS and then incubated overnight at 4 °C
in primary antibody diluted in 1% bovine serum albumin. Concentrations
of primary antibody were 1/100 for anti-HGF and 1/1000 for
anti-phosphotyrosine and anti-Met. Blots were washed 3 times in 5%
milk and incubated for 45 min in 1:10,000 dilution of
peroxidase-labeled secondary antibody (Jackson ImmunoResearch).
Antibody binding was visualized by chemiluminescence (ECL, Amersham
Pharmacia Biotech).
Assay for HGFA Activity--
Serial dilutions of UB conditioned
medium were incubated for 2 h at 37 °C with 200 µg/ml single
chain HGF (HGFsc). Aliquots of the mixture were removed at various
times and analyzed by SDS-PAGE under reducing conditions.
Immunoprecipitation of Met--
Confluent cultures of UB cells
were incubated overnight in serum-free medium. The next day, HGFsc was
added to the culture medium in the presence or absence of leupeptin or
serum and the cultures were incubated for 15 min at 37 °C. The
cultures were then washed three times in PBS and scraped in SB (150 mM NaCl, 10 mM Tris-HCl, pH 7.4, 10 mM EDTA, Complete protease inhibitors from Roche Molecular
Biochemicals, 1 mM sodium orthovanadate, and 1% Triton
X-100). The extracts were incubated for 30 min at 4 °C and pelleted
for 15 min at 10,000 × g to obtain cleared lysates. Lysates were incubated for 1 h with 1 µg of rabbit anti-Met and then for a second hour with Protein A-Sepharose (Roche Molecular Biochemicals). The precipitates were washed three times with SB and
displayed on a 5% reducing SDS-PAGE. The immunoblots were processed
for with anti-phosphotyrosine as described above except that the blots
were blocked in 1% bovine serum albumin in Tris-buffered saline (150 mM NaCl, 10 mM Tris-HCl, pH 7.4). After
visualization of phosphotyrosine, the blots were stripped with 25 mM glycine, pH 2.5, and 1% SDS and then re-probed with
anti-Met as described above.
Organ Culture of Fetal Kidney Rudiments--
Kidney rudiments
were dissected from timed pregnant Swiss Webster mice at E11.5 when the
ureteric bud had branched once. Organs were explanted onto permeable
supports (Transwell Clear, 3.0-µm pore size, Costar) in
chambers containing 0.25 ml of medium. Cultures were maintained at the
air-water interface in 5% CO2 for 96 h at 37 °C
and then fixed for 10 min in methanol at 20 °C. Kidney rudiments
were grown in Dulbecco's modified Eagle's medium/F-12 containing 1%
ITS+ (Collaborative Research) and no serum. For HGF and
HGFA staining, explants of freshly dissected E12.5 kidneys were
incubated for 3-4 h on Transwells and then processed for confocal microscopy.
Confocal Microscopy of Fetal Kidney Rudiments and Image
Analysis--
Methanol-fixed organ cultures were stained en
bloc as described previously (21). Briefly, the fixed organ
cultures were re-hydrated in PBS and blocked for 6 h in 1% bovine
serum albumin or 10% donkey serum (Jackson ImmunoResearch). The
cultures were incubated in primary antibody for 24-48 h at 4 °C,
washed for 8-24 h in 1% bovine serum albumin, and incubated overnight
in secondary antibody. The cultures were washed for 2-24 h, post-fixed for 10 min with 2% paraformaldehyde, quenched with 50 mM
NH4Cl in PBS, rinsed in PBS, and mounted in ProLong
Antifade (Molecular Probes). The dilutions of primary antibody were:
HGF (C-20 or N-19) 1:100, HGFA-L (N-19) 1:50, WT1 (C-19) 1:50, TROMA-1
1:10. Secondary antibodies were diluted 1:100.
Whole mounts were analyzed by confocal microscopy on a Zeiss 410 laser
scanning confocal microscope equipped with an argon-krypton laser. The
kidney rudiments were visualized with a × 10 or 40 objective on a
Zeiss Axiovert 100 using the 568- and 488-nm laser emission peaks for
excitation. Images were collected using a 515-540-nm band pass and a
590-nm long pass filter set. Each kidney rudiment was scanned 10 times
5-µm apart. The scans were recorded as TIFF files and used for image
analysis as described previously (21).
 |
RESULTS |
Sequence of Murine HGFA--
Interrogation of the data base of
murine ESTs with the coding sequence of human HGFA yielded 9 clones, of
which one (mx85g08) contained the complete coding sequence of murine
HGFA. One clone (uc76a08) had a 47-nucleotide out of frame deletion in
the 5' end. Clone mj60f03 contained the signal sequence which was
followed by a 666-nucleotide in-frame deletion.
The sequence of murine HGFA was 82% identical to that of human HGFA at
both the nucleotide and amino acid levels (Fig.
1). The catalytic domains of the two
proteins were 93% identical, with 18 conservative amino acid
substitutions and a single nonconservative substitution
(Leu553 in mouse for Arg555 in human) in the
COOH-terminal 257 amino acids. The thrombin cleavage site at
Arg405-Ile406 that is required for activation
of HGFA was conserved, as were all the amino acids required for
catalytic activity. The fibronectin, epidermal growth factor, and
Kringle domains were conserved as were the critical cysteines of all
these motifs. The 104 amino acids at the amino-terminal end of the
sequence were the least conserved, with 42 amino acid substitutions and
3 amino acid deletions in the murine relative to the human
sequence.

View larger version (68K):
[in this window]
[in a new window]
|
Fig. 1.
Alignment of amino acid sequences of murine
and human HGFA. Sequences were aligned with Bestfit (GCG,
Wisconsin package, version 8.0) and adjusted manually. Amino acid
differences are shown in bold type. The signal sequence is
italicized. Conserved cysteines are in red type
and the catalytic domain is in blue type. The antibody
binding site is underlined. Conserved motifs are delineated
by boxes: FnII, blue; epidermal growth factor,
maroon (2 repeats); FnI, yellow; kringle,
green. HGFA is activated by cleavage at
Arg405-Ile406, which is at the amino-terminal
end of the antibody-binding site.
|
|
We used the murine HGFA sequence to search the GenBankTM
data base with the BLAST algorithm and identified only human HGFA and a
partial rat HGFA sequence. A human protein similar to HGFA has recently
been identified (22, 23) (GenBankTM accession number
AAB46909). This molecule, hyaluronin-binding protein, was only 38%
identical to murine HGFA at the amino acid level. As our murine HGFA
sequence is 82% identical to the human HGFA sequence, our sequence is
murine HGFA, not the murine hyaluronin-binding protein.
Murine HGFA Was Detected Only in Adult Mouse Liver by Northern
Blotting--
We probed Northern blots of mRNA isolated from fetal
mice and a variety of adult mouse organs and found that HGFA was
expressed only in adult mouse liver (Fig.
2, A). This result is
consistent with the previous finding that human HGFA was expressed only
in adult liver by Northern blotting (14). A single transcript of 2.0 kb
was detected in mouse liver, which contrasts with the situation in man,
where a minor transcript of 3.4 kb was also detected. No HGFA was
detected in Northern blots of total embryo poly(A) RNA. These data
suggested that either HGFA is not expressed in the developing animal or
that it is expressed in concentrations too low for detection by
Northern blotting. In support of the latter hypothesis, we found that 7 of the 9 ESTs for murine HGFA were isolated from embryonic mouse
libraries. We also identified human ESTs for HGFA in adult ovarian
tumor (T72625), fetal liver/spleen (R89811), and a pooled adult
lung/testis/B cell library (AI243638 and AA897612), suggesting that
HGFA is expressed at low levels in a variety of organs during fetal and adult life in man.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 2.
Identification of Hgfa
message by Northern blotting and RT-PCR. A,
multiple tissue Northern blots of poly(A) RNA from embryonic and adult
mouse probed for HGFA expression. A single transcript of 2.0 kb was
identified only in adult murine liver. B, total RNA (1 µg)
isolated from UB or mouse brain probed for expression of HGFA. A single
transcript of 2.0 kb was identified in UB cells. C, RT-PCR
for Hgfa using total RNA isolated from UB cells and poly(A)
purified RNA isolated from microdissected rat ureteric buds
(ureteric bud) and metanephric mesenchyme
(mesenchyme). The expected 345-base pair (bp)
product was amplified from immortalized murine UB cells and
microdissected rat ureteric bud. No product was amplified from control
samples treated with RNase A (not shown) or from microdissected
metanephric mesenchyme.
|
|
Message for HGFA Is Expressed Exclusively in the Ureteric Bud in
Early Renal Development--
To test the hypothesis that HGFA is
expressed during kidney development, we screened poly(A) RNA isolated
from microdissected rat ureteric buds and mesenchymes by RT-PCR. We
found that the predicted 345-base pair fragment was consistently
amplified from the ureteric bud but not from the mesenchyme (Fig. 2,
C). Treatment of RNA with DNase prior to reverse
transcription and PCR did not abolish amplification of this fragment.
However, treatment of the samples with RNase blocked amplification. The
amplified fragment was purified and sequenced. The sequence was
similar, but not identical, to the sequence of murine HGFA. In the area
where the fragment overlapped with a partial rat HGFA sequence
(GI:3116329), the sequence was identical to the rat sequence. Thus, the
amplified fragment arose from rat RNA and could not have been derived
from contamination by murine HGFA plasmid DNA. These data show that, during early renal development, HGFA is expressed exclusively by the
ureteric bud.
Immortalized Ureteric Bud Epithelial Cells Express HGFA Message and
Protein--
To further characterize HGFA in ureteric bud epithelial
cells, we screened an immortalized ureteric bud cell line (UB cells) for HGFA expression. The predicted 345-base pair fragment was amplified
from UB cell RNA by RT-PCR (Fig. 2, C, UB cells).
The sequence of this fragment was identical to the murine HGFA
sequence. A single transcript of 2.0 kb was identified in UB RNA by
Northern blotting using our murine HGFA probe (Fig. 2, B).
These data support the results of the RT-PCR analysis of isolated
ureteric buds and mesenchymes and show that ureteric bud epithelial
cells express HGFA both in vivo and in vitro.
To determine whether UB cells synthesized and secreted HGFA protein, we
probed immunoblots of conditioned medium from UB cells with antibodies
to HGFA. Antibody HGFA-L (N-19) was raised against a peptide at the
amino-terminal end of the 34-kDa catalytic subunit of HGFA
(underlined in Fig. 1). It recognized polypeptides of 99 and
34 kDa in murine plasma, representing the intact, uncleaved high
molecular mass zymogen of HGFA (99 kDa) and the 34-kDa catalytically active form (Fig. 3A). Only
the 34-kDa catalytically active form was detected in serum (Fig.
3A) and in UB cell conditioned medium (Fig. 3B),
suggesting that UB cells are capable not only of secreting but also of
activating HGFA.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 3.
Identification of HGFA protein in murine
plasma, serum, and medium conditioned by UB cells. A,
aliquots of citrated murine plasma or murine serum were probed with
antibody against human HGFA and displayed on a gel under reducing
conditions. Both the 98-kDa zymogen and the 34-kDa activated form of
HGFA were found in plasma, while the serum sample contained only the
activated 34-kDa form of HGFA. B, serial dilutions of UB
conditioned medium were displayed on a gel under reducing conditions.
Blots were probed with antibody to human HGFA. Only the 34-kDa
activated form of murine HGFA was detected in UB conditioned
medium.
|
|
Localization of HGF and HGFA Proteins in Early Renal
Development--
We examined the distribution of HGFA in early kidney
rudiments by confocal microscopy of whole mounts of freshly isolated E12.5 kidneys. We found that HGFA protein was expressed in the ureteric
bud, as shown by the orange staining indicating colocalization of HGFA
(green) and the ureteric bud marker (TROMA-1, red,
arrowhead in Fig. 4A)
(24). In the mesenchyme, HGFA was localized in a reticular pattern
extending 2 to 3 cell diameters from the ureteric bud surface,
consistent with deposition of HGFA, a heparin-binding protein (13), in
the extracellular matrix surrounding the mesenchymal cells adjacent to
the ureteric bud (arrows, Fig. 4A). Staining was
specific for HGFA, as co-incubation of the antibody with the immunizing
peptide blocked HGFA labeling but not labeling with the antibody for
the ureteric bud specific cytokeratin, TROMA-1 (Fig.
4B).

View larger version (112K):
[in this window]
[in a new window]
|
Fig. 4.
Localization of HGFA and HGF in developing
kidneys by confocal microscopy. All kidney rudiments were isolated
at E12.5 and were stained with TROMA-1 (red) to localize the
ureteric bud. A and B, whole mount staining for
HGFA in the absence (A) or presence (B) of a
10-fold molar excess of peptide immunogen. Both photomicrographs are
1-µm optical sections. A, HGFA was found in the
extracellular matrix surrounding mesenchymal cells (arrows).
Staining was particularly intense within two to three cell diameters
from the ureteric bud. The yellow-orange color of the
T-shaped ureteric bud (arrowhead) shows that HGFA
colocalized with the ureteric bud marker, TROMA-1, consistent with its
expression in this tissue. B, peptide competition of HGFA
staining, using a 10-fold molar excess of peptide immunogen. The
peptide blocked staining with antibody to HGFA (green) but
did not affect staining with TROMA-1 (red). Note that
TROMA-1 is red rather than the yellow-orange color
representing colocalization as seen in A. C and
D, projections of 25 optical sections of kidney. The images
were color coded for intensity of fluorescence, where blue
is the lowest intensity and red is the highest intensity. Outline of
the ureteric bud is shown in white for reference.
C, HGFA was concentrated around the T shaped ampulla of the
ureteric bud. D, HGF was found diffusely throughout the
kidney. Scale bar in C is 50 µm.
|
|
Single optical sections suggested that HGFA was concentrated around the
ureteric bud tips (Fig. 4A). To test this hypothesis, serial
optical sections of a kidney rudiment stained for HGFA were optically
summed and projected onto a single plane. These images were displayed
with a pseudocolor algorithm to show the relative intensity of HGFA
staining throughout the rudiment (Fig. 4C). HGFA
immunoreactivity was concentrated around the ampulla of the ureteric
bud, shown outlined in white. The distribution of
HGFA was different from the distribution of HGF (Fig. 4D). HGF was localized throughout the mesenchyme and was not concentrated around the ureteric bud ampulla. This result shows that the high concentration of HGFA around the ureteric bud is not an artifact of the
high local concentration of mesenchymal cells around the ureteric bud.
Conditioned Medium from UB Cells Contains HGFA Activity--
The
identification of a 34-kDa form of HGFA in UB conditioned medium
suggested that UB cells secrete and activate HGFA. To test this
hypothesis, we incubated the uncleaved zymogen of HGF (HGFsc) with
serial dilutions of conditioned medium. HGFsc was completely converted
to the active heterodimer (HGF and HGF ) by 2.4 µg of protein
from UB conditioned medium (Fig.
5A). These data show that UB
cells secrete HGFA and hydrolyze HGFsc to a disulfide-linked
heterodimer. The molecular weights of the HGF subunits produced by UB
conditioned medium are consistent with activation of HGF by hydrolysis
between Arg494 and Val495.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 5.
UB conditioned medium contains an enzyme that
hydrolyzes HGF. A, 200-µg aliquots of the zymogen of
HGF (HGFsc) were incubated with serial dilutions of UB conditioned
medium. HGFsc was completely hydrolyzed by 2.4 µg of protein from UB
conditioned medium, yielding the disulfide-linked 60 kDa (HGF ) and
33-35 kDa (HGF ) heterodimer. The HGF subunit is always present
as a doublet, presumably due to differences in glycosylation.
B, 200-µg aliquots of HGFsc incubated with 2.5 µg of
protein from UB conditioned medium in the presence of serial dilutions
of leupeptin.
|
|
HGFA is a serine protease whose HGF hydrolyzing activity is blocked by
the serine protease inhibitor aprotinin and the serine and cysteine
protease inhibitor leupeptin, but not by the acid protease inhibitor
pepstatin or the aminopeptidase inhibitor bestatin (10, 11, 15). HGF
hydrolysis by 2.5 µg of protein from UB conditioned medium was
inhibited by leupeptin and aprotinin (Table I and Fig. 5B). Bestatin,
EDTA, phosphoramidon, E64, and pepstatin A did not block HGF hydrolysis
by UB conditioned medium.
View this table:
[in this window]
[in a new window]
|
Table I
Effect of serine and cysteine protease inhibitors on HGF hydrolysis by
UB conditioned medium and on kidney development in vitro
Kidney rudiments were dissected on embryonic day 11.5 (E11.5) when the
ureteric bud had contacted the metanephric mesenchyme and branched
once. Rudiments were grown in serum-free culture in the presence of
inhibitors at the concentrations listed below for 4 days. The rudiments
were then fixed and stained for glomerular markers (WT1 or peanut
lectin) and ureteric bud markers (TROMA-1 or Dolichos
bifloris lectin). Two or three rudiments were analyzed for each
experiment, ±S.E.
|
|
Activated HGF binds to the Met receptor tyrosine kinase and increases
cell motility, producing scattering of islands of HGF-responsive cells
in two-dimensional culture. To discover whether the HGF hydrolyzing
enzyme secreted by UB cells produced functionally active, heterodimeric
HGF from the inactive zymogen (HGFsc), we incubated UB cells with HGFsc
in the presence or absence of leupeptin. In serum-free medium without
HGF, UB cells were closely associated in islands with smooth borders
(Fig. 6, A, no
HGF). Activated, heterodimeric HGF produced scattering (Fig. 6,
A, activated HGF) as did an equal concentration of HGFsc
(Fig. 6, scHGF). The scattering activity of HGFsc was
inhibited by 100 and 10 µM leupeptin (Fig. 6A,
100 µM leupeptin and 10 µM leupeptin. Note that the UB cells were
viable after incubation even in high concentrations of leupeptin (100 µM, Fig. 6A).) These data show that UB cells
responded to HGFsc in a leupeptin-dependent manner.

View larger version (88K):
[in this window]
[in a new window]
|
Fig. 6.
UB cells produce activated HGF from HGFsc and
respond to activated HGF by scattering. A, UB cells
were incubated for 16 h in serum-free medium alone (no
HGF), 50 ng/ml activated HGF (activated HGF), 50 ng/ml
HGFsc (scHGF), 50 ng/ml HGFsc + 100 µM
leupeptin, or 50 ng/ml HGFsc + 10 µM leupeptin. The
presence of the active heterodimeric form of HGF in the activated
preparation of HGF was verified by immunoblotting. Activated HGF and
HGFsc both caused scattering of UB cells. Leupeptin at 100 and 10 µM blocked scattering caused by HGFsc, while 1 µM leupeptin was not as effective in blocking scattering.
Leupeptin had no effect on the scattering induced by activated HGF.
B, the HGF receptor met was immunoprecipitated
from UB cells after overnight incubation in serum-free medium. Parallel
cultures were left untreated or incubated with fresh medium containing
10% fetal bovine serum and 50 ng/ml HGFsc. HGFsc with or without
leupeptin were added to additional cultures to yield final
concentrations of 50 ng/ml HGF and 10 µM leupeptin. Met
was immunoprecipated from cell lysates. Immunoblots of precipitated Met
were probed successively with anti-phosphotyrosine (IB: PY)
and then anti-Met (IB:Met). The molecular mass of the
polypeptide was 145 kDa.
|
|
To demonstrate further that UB cells produced the activated form of HGF
from the inactive zymogen HGFsc, the HGF receptor met was
immunoprecipitated from cultures of UB cells (Fig. 6B). The
Met receptor immunoprecipitated from UB cells incubated overnight in
serum-free medium contained little phosphotyrosine
(-HGFsc-serum-leupeptin). HGFsc incubated with fresh medium containing
serum for 15 min stimulated Met autophosphorylation, as predicted from
the observation that serum contains HGFA (+HGFsc +serum-leupeptin). HGF
zymogen incubated with UB cells incubated in serum-free medium
overnight also stimulated Met autophosphorylation, showing that UB
cells were able to activate and respond to HGFsc in the absence of
exogenous HGFA from serum (+HGFsc-serum-leupeptin). Activation of HGF
signaling was substantially inhibited by leupeptin, which blocks the
action of endogenous HGFA (+HGFsc-serum +leupeptin). There was some
activation of Met by HGFsc in the presence of leupeptin, consistent
with the small but detectable amount of activated HGF in the
preparations of HGFsc (Fig. 5A). These biochemical data
provide additional evidence that UB cells activate and respond to the
zymogen of HGF.
Serine Protease Inhibitors Inhibit Branching Morphogenesis and
Nephrogenesis by Blocking the Activation of HGF--
To determine the
role of HGF hydrolysis during nephrogenesis, we incubated organ
cultures of kidney rudiments in protease inhibitors at concentrations
that inhibited the hydrolysis of HGF by ureteric bud conditioned medium
in vitro (Table I; Fig. 6, D and E).
We found that the serine protease inhibitor aprotinin and the serine
and cysteine protease inhibitor leupeptin blocked HGF hydrolysis
in vitro. Aprotinin and leupeptin inhibited development in
rudiments isolated at E11.5 or E12.5 (Fig.
7, B, D, and F, and
Table I). The effect of the serine protease inhibitors was concentration dependent. No consistent effects on renal development were noted with 1 µM aprotinin or leupeptin, but
development was inhibited at 10 µM of either
inhibitor.

View larger version (64K):
[in this window]
[in a new window]
|
Fig. 7.
Kidney development in organ culture is
inhibited by the serine protease inhibitor leupeptin. Kidney
rudiments were dissected on embryonic day 11.5 and incubated in
serum-free medium with (B, D, and F) or without
(A, C, and E) 10 µM leupeptin for 4 days. Renal development was assessed by phase-contrast imaging
(A and B), by staining for the markers TROMA-1
(ureteric bud specific cytokeratin, red) and WT1 (induced
mesenchyme and intense glomerular staining, green)
(C and D), and by staining for WT1 (red) and LTA
(L. tetragonolobus lectin, proximal tubule,
green) (E and F). A and
B, leupeptin caused dysmorphic renal development and reduced
the size of the kidney. C and D, leupeptin
reduced branching morphogenesis by the ureteric bud and reduced the
number of glomeruli. Arrowheads show representative
glomeruli. E and F, the length of the proximal
tubules was greatly reduced by leupeptin. We were unable to count the
proximal tubules in control samples because it was difficult to
identify single tubules reliably due to their convolutions.
|
|
To characterize the effects of serine protease inhibitors on renal
development, we examined ureteric bud branching, glomerulogenesis, and
nephrogenesis. Leupeptin reduced ureteric bud branching to 50% and
aprotinin to 54% of control (Fig. 7, C and D;
Table I). Nephrogenesis assayed by staining with the proximal tubule
marker Lotus tetragonolobus lectin was qualitatively reduced
by leupeptin (Fig. 7, E and F). We were unable to
quantitate the effects of serine protease inhibitors on proximal tubule
formation because it was impossible to reliably distinguish one long,
convoluted proximal tubule from another in the control kidneys.
Proximal tubule length was unambiguously decreased by leupeptin in 2/3 kidneys assayed. Serine protease inhibitors reduced glomerulogenesis (Fig. 6, C and D; Table I). In kidneys isolated
at E11.5, leupeptin reduced the number of glomeruli to 53% and
aprotinin to 56% of control (Table I). In kidneys isolated at E12.5,
leupeptin reduced the number of glomeruli to 53% of control (Fig. 7,
C and D). Thus, blocking the activation of HGF by
either leupeptin or aprotinin inhibited branching morphogenesis by the
ureteric bud, reduced the efficiency of nephrogenesis, and
significantly decreased the number of glomeruli.
To test the specificity of the effects of serine protease inhibitors on
renal development, we examined the effects of E64, a cysteine protease
inhibitor that did not inhibit HGF hydrolysis by ureteric bud
conditioned medium (Table I). E64 had no effect on glomerulogenesis at
concentrations as high as 100 µM, suggesting that the
observed inhibitory effects of the serine and cysteine protease
inhibitor were not nonspecific. Cells incubated in high concentrations
of leupeptin (100 µM, Fig. 6A) or aprotinin
(not shown) were viable as assessed by trypan blue exclusion (not
shown). This result shows that the serine protease inhibitors are not likely to inhibit nephrogenesis by a direct toxic effect.
We used activated, heterodimeric HGF to bypass the effects of the
serine protease blockade by providing the product of HGFA activity.
Activated HGF rescued nephrogenesis in leupeptin-treated kidneys (Fig.
8). Leupeptin-treated kidneys had an
average of 21 ± 2.4 glomeruli (n = 7, S.E.),
which was 53 ± 6% of the number of glomeruli in untreated
control kidneys (40 ± 5, n = 7, S.E.). Kidneys
treated with leupeptin and activated HGF had an average of 34 ± 5 glomeruli (n = 7, S.E.), or 84 ± 11% of the
number of glomeruli in untreated controls. There was no significant
difference between the number of glomeruli in control kidneys compared
with the number of glomeruli in kidneys rescued with activated HGF (p = 0.29). The number of glomeruli in
leupeptin-treated kidneys was significantly decreased compared with
either control (p = 0.015) or HGF-rescued kidneys
(p = 0.04). These data suggest that loss of activated
HGF is responsible for the effects of leupeptin on renal
development.

View larger version (7K):
[in this window]
[in a new window]
|
Fig. 8.
Activated HGF rescues kidney development from
inhibition by leupeptin. Kidney rudiments were dissected on
embryonic day 12.5 and incubated in serum-free medium
(control), in serum-free medium with 10 µM
leupeptin (leupeptin), or in serum-free medium with 10 µM leupeptin and 50 ng/ml activated HGF (leupeptin + HGF). Glomeruli were counted after 4 days in culture by staining
with antibody to WT1. The results were normalized to the number of
glomeruli in control cultures to allow comparison between litters.
Seven or more rudiments from two different litters were analyzed for
each condition. For this experiment, p < 0.05 for
leupeptin versus HGF + leupeptin, p = N.S.
for HGF + leupeptin versus control, and p < 0.002 for leupeptin versus control.
|
|
 |
DISCUSSION |
In this study, we present the sequence of the murine
HGFA gene. We showed that it is expressed solely by the
ureteric bud in early kidney development. Using an immortalized
ureteric bud cell line, we demonstrated that the ureteric bud expresses
HGFA protein and have characterized the HGF hydrolyzing activity and inhibitor profile of ureteric bud derived HGFA. In the developing kidney, HGFA protein was secreted into the mesenchyme around the ampulla at the tips of ureteric bud in proximity to both its substrate, HGF, and the receptor for activated HGF, c-Met. Finally, we
demonstrated, using inhibitors of HGFA, that activation of HGF by HGFA
is required for renal development in vitro.
The identified cDNA is likely to be the murine homolog of
HGFA because it is extremely similar to the sequence of the
human gene. BLAST searches of the GenBankTM data base with
the nucleic acid sequence of HGFA retrieved only the human sequence and
not the sequences of other closely related molecules, for example,
factor XII, urokinase, or the HGFA-like hyaluronin-binding protein. All
the identified functional motifs in murine HGFA are conserved, with the
majority of amino acid substitutions clustering in the amino-terminal
domain between the signal sequence and the fibronectin II motif and
between the kringle and catalytic domains, with the exception of the
protease cleavage site, which was completely conserved. These data
suggest that all of the identified motifs are important for the
biologic function of HGFA. Interestingly, one of the clones we
sequenced (mj50f03) had a 666-nucleotide in-frame deletion at the 5'
end. This deletion removed both fibronectin repeats and the first
epidermal growth factor repeat but preserved the signal sequence, the
kringle and the catalytic domains. This transcript could yield a
functional enzyme with altered matrix binding properties. Mj60f03 was
isolated from a mouse embryo library, raising the possibility that
there is developmentally regulated alternate splicing of the
HGFA gene.
Immortalized ureteric bud cells expressed HGFA message and
protein. The active form of HGFA is a disulfide-linked heterodimer that
is generated from an inactive 99-kDa precursor by a serine protease
(13, 14, 25). The protein secreted by ureteric bud cells was identified
as a 34-kDa polypeptide on reducing gels. We used an antibody was
raised against a peptide from the 34-kDa catalytic domain. One possible
interpretation of this result was that the peptide antibody, which was
raised against a peptide immediately adjacent to the cleavage site,
could recognize only the activated form of HGFA. However, this antibody
recognized both the 99-kDa zymogen and the 34-kDa catalytic domain in
murine plasma. Therefore, the zymogen was not present in the ureteric bud conditioned medium. Addition of the inactive zymogen of HGF to
ureteric bud cells without serum caused cell scattering, indicating that HGFA was secreted and was active. These data suggest that the
ureteric bud not only secretes but also activates HGFA. Further evidence supporting the local activation of HGFA by the ureteric bud
comes from the localization of HGFA in the developing, avascular kidney. The zymogen of HGFA binds weakly to heparin, while the activated form binds quite strongly (13). Thus, the observed concentration of HGFA protein around the ureteric bud suggests that
HGFA was activated soon after it is secreted and therefore did not
diffuse far from the ureteric bud. HGFA is activated by thrombin
in vitro (25). Prothrombin message has been identified in
human and rat kidneys, raising the possibility that the ureteric bud
also secretes and activates prothrombin (26-28).
We found that renal development was impeded by protease inhibitors that
block HGFA activity. These effects were unlikely to be secondary to
cell death produced by the inhibitors because tissue culture cells were
viable in log fold higher concentrations of the inhibitors. Serine
protease inhibitors blocked renal development at the same
concentrations that blocked HGF hydrolysis by ureteric bud-derived
HGFA. A cysteine protease inhibitor had no effect on renal development
and no effect on HGF hydrolysis by HGFA, even at log fold higher
concentrations. These results show that the effects of serine protease
inhibitors were due to inhibition of serine protease(s) not to a
nonspecific effect of protease inhibition in general and suggest that
the protease involved was HGFA.
The effect of serine protease inhibitors was most likely due to the
inhibition of HGF activation. First, the results of serine protease
inhibition-reduced ureteric bud branching, inhibition of
glomerulogenesis, and nephrogenesis are identical to the results of
inhibition of HGF signaling by neutralizing antibody (7). Second, the
effects of serine protease inhibition were overcome by adding the
activated form of HGF. This result suggests that, at least for the
parameters assayed, activation of HGF is the major role of serine
proteases in renal development. Our data do not rule out a more complex
situation in which serine protease inhibitors block some critical,
non-HGFA activity that acts upstream of HGF and that the rescue of
kidney development by activated HGF occurs irrespective of the
inhibition of HGFA. However, this is not the simplest interpretation of
the available data.
Several lines of evidence suggest that HGFA is the most likely
candidate for the target of serine protease inhibitors in developing kidneys. First, HGFA is expressed during early renal development when
our assays were performed and is a potent activator of HGF. Second,
concentrations of inhibitor that blocked HGFA in vitro blocked nephrogenesis in organ culture. Third, the inhibitor profile for both HGFA blockade and inhibition of nephrogenesis was identical. However, other members of the plasminogen activator family, coagulation factor XII, tissue plasminogen activator (tPA), and urokinase (uPA),
are also weak activators of HGF (11, 15, 16). An HGFA-like molecule,
PHBP, has recently been identified and could potentially, based on its
sequence, activate HGF (22, 23). Two of these enzymes, tPA and uPA, are
also expressed in developing kidney (29). Both plasminogen activators
were detected at embryonic day 15.5 and were highly expressed,
particularly uPA, by embryonic day 17.5 in the developing mouse kidney.
Leupeptin does not block HGF hydrolysis by activated uPA, but it does
block the activation of uPA by plasmin (11, 30). Therefore, leupeptin
could indirectly interfere with HGF activation by plasminogen
activators by blocking their activation. Our data suggest that HGFA is
the most likely target of leupeptin and aprotinin, but do not rule out
a role for uPA and tPA and possibly PHBP in the activation of HGF
during early renal development.
HGF and met are important in a variety of morphogenetic
processes, including those of kidney, lung, mammary gland, salivary gland, liver, limb bud patterning, and migration of myogenic precursors (7, 17, 18, 31-34). There is an absolute requirement for HGF and
met in liver, limb bud, and placental morphogenesis, because development of these organs is defective in mice with targeted mutations in either gene (17, 18, 31). Despite the extensive in
vitro evidence suggesting a role for HGF in salivary gland, lung,
and kidney morphogenesis, development of these organs was reportedly
normal in HGF and met null mice although the fetuses were
small. Our data are consistent with the results of the gene targeting
experiments in that some degree of branching morphogenesis, glomerulogenesis, and nephrogenesis did occur in the leupeptin-treated kidneys. The quantitative effects of HGFA blockade suggest that the
small size of HGF and met null kidneys could have been a
primary effect of the null mutation rather than a secondary effect of placental insufficiency.
Surprisingly, in view of the requirement for HGF in myogenic precursor
migration, placental development, and liver morphogenesis during
embryogenesis, we found that HGFA was not highly expressed in the mouse
embryo and could not be detected on Northern blots. This result
suggested that HGFA might be expressed at low levels and in a spatially
regulated manner during development. Our data from the developing
kidney suggests that this is indeed the case. We found HGFA only in the
ureteric bud and in the immediately adjacent mesenchyme by protein
staining and detected HGFA message in the ureteric bud by RT-PCR. A
similar situation exists in the developing gastrointestinal tract,
where RT-PCR was used to demonstrate that HGFA was expressed in the
epithelium but not the mesenchyme (35). The identification of EST's
for HGFA in embryonic mouse provides additional evidence that HGFA is
expressed in the developing embryo.
In both the developing kidney and intestine, HGF was present only in
the mesenchyme and HGFA was confined to the adjacent epithelium. We
found that HGFA was deposited around the ureteric bud, particularly
around the ampulla. The activated form of HGF binds strongly to heparin
(13, 36), so that activated HGF is unlikely to diffuse far from the
site of activation. This observation suggests that the ureteric bud
creates a local gradient of HGF activity and Met signaling. In
preliminary experiments, we have identified both HGF activator
inhibitor-1 and -2 (HAI-1 and HAI-2) in the ureteric bud
(37-39).2 Both HAI-1 and
HAI-2 exist in membrane-anchored and soluble forms, so that there is
additional potential for spatial regulation of HGFA activity in the
developing kidney. These data strongly suggest that the activation of
HGF is tightly controlled during renal development. As HGF-Met
interactions play important developmental roles in a variety of organ
systems, it is likely that similar spatio-temporal control elements are
broadly expressed throughout development. Our data suggest that
activation of the HGF/Met signaling pathway is regulated during
embryogenesis by serine protease cascades whose activity and
localization are highly regulated. The expression of HGF and its
activator in adjacent structures suggest that gradients of HGF activity
are formed during development. The creation and shape of such gradients
could play an important role in pattern formation in HGF-responsive tissues.
 |
ACKNOWLEDGEMENT |
We thank George vande Woude for the generous
gift of HGFsc.
 |
FOOTNOTES |
*
This work was supported in part by March of Dimes Grant
1-FY98-0513. Confocal microscopy was performed at the Confocal
Microscopy Facility of Columbia University, which was established by
National Institutes of Health Shared Instrumentation Grant 1S10 RR10406 and is supported by National Institutes of Health Grant 5-P30-CA13696 as part of the Herbert Irving Cancer Center at Columbia University.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF224724.
Established Investigator of the American Heart Association. To
whom correspondence should be addressed. Tel.: 212-305-4476; Fax:
212-305-3475; E-mail: jsv1@columbia.edu.
§
Partially supported by the Summer Undergraduate Research
Fund project of Columbia University.
Published, JBC Papers in Press, October 13, 2000, DOI 10.1074/jbc.M006634200
2
S. Sehgal, Y. Huan, and J. van Adelsberg,
unpublished observations.
 |
ABBREVIATIONS |
The abbreviations used are:
HGF, hepatocyte
growth factor;
UB cell, ureteric bud cell;
HGFA, hepatocyte growth
factor activator;
EST, expressed tag sequence;
RT-PCR, reverse
transcriptase-polymerase chain reaction;
PAGE, polyacrylamide gel
electrophoresis;
PBS, phosphate-buffered saline;
kb, kilobase(s).
 |
REFERENCES |
| 1.
|
Stoker, M.,
Gherardi, E.,
Perryman, M.,
and Gray, J.
(1987)
Nature
327,
239-242
|
| 2.
|
Montesano, R.,
Schaller, G.,
and Orci, L.
(1991)
Cell
66,
697-711
|
| 3.
|
Montesano, R.,
Matsumoto, K.,
Nakamura, T.,
and Orci, L.
(1991)
Cell
67,
901-908
|
| 4.
|
Nakamura, T.,
Nishizawa, T.,
Hagiya, M.,
Seki, T.,
Simonishi, M.,
Sugimura, A.,
Tashiro, K.,
and Shimizu, S.
(1989)
Nature
342,
440-443
|
| 5.
|
Birchmeier, C.,
and Gherardi, E.
(1998)
Trends Cell Biol.
8,
404-410
|
| 6.
|
Sonnenberg, E.,
Meyer, D.,
Weidner, K. M.,
and Birchmeier, C.
(1993)
J. Cell Biol.
123,
223-235
|
| 7.
|
Woolf, A. S.,
Kolatsi-Joannou, M.,
Hardman, P.,
Andermarcher, E.,
Moorby, C.,
Fine, L. G.,
Jat, P. S.,
Noble, M. D.,
and Gherardi, E.
(1995)
J. Cell Biol.
128,
171-184
|
| 8.
|
Sakurai, H.,
Barros, E. J.,
Tsukamoto, T.,
Barasch, J.,
and Nigam, S. K.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
6279-6284
|
| 9.
|
Naka, D.,
Ishii, T.,
Yoshiyama, Y.,
Miyazawa, K.,
Hara, H.,
Hishida, T.,
and Kitamura, N.
(1992)
J. Biol. Chem.
267,
20114-20119
|
| 10.
|
Gak, E.,
Taylor, W. G.,
Chan, A. M.,
and Rubin, J. S.
(1992)
FEBS Lett.
311,
17-21
|
| 11.
|
Naldini, L.,
Tamagnone, L.,
Vigna, E.,
Sachs, M.,
Hartmann, G.,
Birchmeier, W.,
Daikuhara, Y.,
Tsubouchi, H.,
Blasi, F.,
and Comoglio, P. M.
(1992)
EMBO J.
11,
4825-4833
|
| 12.
|
Lokker, N. A.,
Mark, M. R.,
Luis, E. A.,
Bennett, G. L.,
Robbins, K. A.,
Baker, J. B.,
and Godowski, P. J.
(1992)
EMBO J.
11,
2503-2510
|
| 13.
|
Miyazawa, K.,
Shimomura, T.,
and Kitamura, N.
(1996)
J. Biol. Chem.
271,
3615-3618
|
| 14.
|
Miyazawa, K.,
Shimomura, T.,
Kitamura, A.,
Kondo, J.,
Morimoto, Y.,
and Kitamura, N.
(1993)
J. Biol. Chem.
268,
10024-10028
|
| 15.
|
Shimomura, T.,
Miyazawa, K.,
Komiyama, Y.,
Hiraoka, H.,
Naka, D.,
Morimoto, Y.,
and Kitamura, N.
(1995)
Eur. J. Biochem.
229,
257-261
|
| 16.
|
Mars, W. M.,
Zarnegar, R.,
and Michalopoulos, G. K.
(1993)
Am. J. Pathol.
143,
949-958
|
| 17.
|
Uehara, Y.,
Minowa, O.,
Mori, C.,
Shiota, K.,
Kuno, J.,
Noda, T.,
and Kitamura, N.
(1995)
Nature
373,
702-705
|
| 18.
|
Schmidt, C.,
Bladt, F.,
Goedecke, S.,
Brinkmann, V.,
Zschiesche, W.,
Sharpe, M.,
Gherardi, E.,
and Birchmeier, C.
(1995)
Nature
373,
699-702
|
| 19.
|
Altschul, S. F.,
Madden, T. L.,
Schaffer, A. A.,
Zhang, J.,
Zhang, Z.,
Miller, W.,
and Lipman, D. J.
(1997)
Nucleic Acids Res.
25,
3389-3402
|
| 20.
|
Barasch, J.,
Pressler, L.,
Connor, J.,
and Malik, A.
(1996)
Am. J. Physiol.
271,
F50-F60
|
| 21.
|
Huan, Y.,
and van Adelsberg, J. S.
(1999)
J. Clin. Invest.
104,
1459-1468
|
| 22.
|
Sumiya, J.,
Asakawa, S.,
Tobe, T.,
Hashimoto, K.,
Saguchi, K.,
Choi-Miura, N. H.,
Shimizu, Y.,
Minoshima, S.,
Shimizu, N.,
and Tomita, M.
(1997)
J. Biochem. (Tokyo)
122,
983-990
|
| 23.
|
Choi-Miura, N. H.,
Tobe, T.,
Sumiya, J.,
Nakano, Y.,
Sano, Y.,
Mazda, T.,
and Tomita, M.
(1996)
J. Biochem. (Tokyo)
119,
1157-1165
|
| 24.
|
Piepenhagen, P. A.,
Peters, L. L.,
Lux, S. E.,
and Nelson, W. J.
(1995)
Am. J. Physiol.
269,
C1417-C1432
|
| 25.
|
Shimomura, T.,
Kondo, J.,
Ochiai, M.,
Naka, D.,
Miyazawa, K.,
Morimoto, Y.,
and Kitamura, N.
(1993)
J. Biol. Chem.
268,
22927-22932
|
| 26.
|
Suzuki, K.,
Tanaka, T.,
Miyazawa, K.,
Nakajima, C.,
Moriyama, M.,
Suga, K.,
Murai, M.,
and Yano, J.
(1999)
J. Am. Soc. Nephrol.
10,
S408-S411
|
| 27.
|
Grover, P. K.,
Dogra, S. C.,
Davidson, B. P.,
Stapleton, A. M.,
and Ryall, R. L.
(2000)
Eur. J. Biochem.
267,
61-67
|
| 28.
|
Stapleton, A. M.,
Timme, T. L.,
and Ryall, R. L.
(1998)
Br. J. Urol.
81,
666-671
|
| 29.
|
Sappino, A. P.,
Huarte, J.,
Vassalli, J. D.,
and Belin, D.
(1991)
J. Clin. Invest.
87,
962-970
|
| 30.
|
Lijnen, H. R.,
Zamarron, C.,
Blaber, M.,
Winkler, M. E.,
and Collen, D.
(1986)
J. Biol. Chem.
261,
1253-1258
|
| 31.
|
Bladt, F.,
Riethmacher, D.,
Isenmann, S.,
Aguzzi, A.,
and Birchmeier, C.
(1995)
Nature
376,
768-772
|
| 32.
|
Ohmichi, H.,
Koshimizu, U.,
Matsumoto, K.,
and Nakamura, T.
(1998)
Development
125,
1315-1324
|
| 33.
|
Niranjan, B.,
Buluwela, L.,
Yant, J.,
Perusinghe, N.,
Atherton, A.,
Phippard, D.,
Dale, T.,
Gusterson, B.,
and Kamalati, T.
(1995)
Development
121,
2897-2908
|
| 34.
|
Scaal, M.,
Bonafede, A.,
Dathe, V.,
Sachs, M.,
Cann, G.,
Christ, B.,
and Brand-Saberi, B.
(1999)
Development
126,
4885-4893
|
| 35.
|
Matsubara, Y.,
Ichinose, M.,
Yahagi, N.,
Tsukada, S.,
Oka, M.,
Miki, K.,
Kimura, S.,
Omata, M.,
Shiokawa, K.,
Kitamura, N.,
Kaneko, Y.,
and Fukamachi, H.
(1998)
Biochem. Biophys. Res. Commun.
253,
477-484
|
| 36.
|
Sakata, H.,
Stahl, S. J.,
Taylor, W. G.,
Rosenberg, J. M.,
Sakaguchi, K.,
Wingfield, P. T.,
and Rubin, J. S.
(1997)
J. Biol. Chem.
272,
9457-9463
|
| 37.
|
Delaria, K. A.,
Muller, D. K.,
Marlor, C. W.,
Brown, J. E.,
Das, R. C.,
Roczniak, S. O.,
and Tamburini, P. P.
(1997)
J. Biol. Chem.
272,
12209-12214
|
| 38.
|
Shimomura, T.,
Denda, K.,
Kitamura, A.,
Kawaguchi, T.,
Kito, M.,
Kondo, J.,
Kagaya, S.,
Qin, L.,
Takata, H.,
Miyazawa, K.,
and Kitamura, N.
(1997)
J. Biol. Chem.
272,
6370-6376
|
| 39.
|
Kawaguchi, M.,
Qin, L.,
Shimomura, T.,
Matsumoto, K.,
Denda, K.,
and Kitamura, N.
(1997)
J. Biol. Chem.
272,
27558-27564
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
B. Peruzzi, G. Athauda, and D. P. Bottaro
The von Hippel-Lindau tumor suppressor gene product represses oncogenic beta-catenin signaling in renal carcinoma cells
PNAS,
September 26, 2006;
103(39):
14531 - 14536.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. P. M. Tjin, R. W. J. Groen, I. Vogelzang, P. W. B. Derksen, M. D. Klok, H. P. Meijer, S. van Eeden, S. T. Pals, and M. Spaargaren
Functional analysis of HGF/MET signaling and aberrant HGF-activator expression in diffuse large B-cell lymphoma
Blood,
January 15, 2006;
107(2):
760 - 768.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Yamamoto, L. Cui, K. Johkura, K. Asanuma, Y. Okouchi, N. Ogiwara, and K. Sasaki
Branching ducts similar to mesonephric ducts or ureteric buds in teratomas originating from mouse embryonic stem cells
Am J Physiol Renal Physiol,
January 1, 2006;
290(1):
F52 - F60.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. P. M. Tjin, R. J. Bende, P. W. B. Derksen, A.-P. van Huijstee, H. Kataoka, M. Spaargaren, and S. T. Pals
Follicular Dendritic Cells Catalyze Hepatocyte Growth Factor (HGF) Activation in the Germinal Center Microenvironment by Secreting the Serine Protease HGF Activator
J. Immunol.,
September 1, 2005;
175(5):
2807 - 2813.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. V. Sampogna and S. K. Nigam
Implications of Gene Networks for Understanding Resilience and Vulnerability in the Kidney Branching Program
Physiology,
December 1, 2004;
19(6):
339 - 347.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. P.M. Tjin, P. W.B. Derksen, H. Kataoka, M. Spaargaren, and S. T. Pals
Multiple myeloma cells catalyze hepatocyte growth factor (HGF) activation by secreting the serine protease HGF-activator
Blood,
October 1, 2004;
104(7):
2172 - 2175.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Iida, K. Johkura, R. Teng, S. Kubota, L. Cui, X. Zhao, N. Ogiwara, Y. Okouchi, K. Asanuma, J. Nakayama, et al.
Immunohistochemical Localization of Hepatocyte Growth Factor Activator (HGFA) in Developing Mouse Liver Tissues: Heterogeneous Distribution of HGFA Protein
J. Histochem. Cytochem.,
September 1, 2003;
51(9):
1139 - 1149.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Peek, P. Moran, N. Mendoza, D. Wickramasinghe, and D. Kirchhofer
Unusual Proteolytic Activation of Pro-hepatocyte Growth Factor by Plasma Kallikrein and Coagulation Factor XIa
J. Biol. Chem.,
November 27, 2002;
277(49):
47804 - 47809.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|