Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M011525200 on February 2, 2001

J. Biol. Chem., Vol. 276, Issue 18, 15275-15283, May 4, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/18/15275    most recent
M011525200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Duchêne, A.-M.
Right arrow Articles by Wintz, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Duchêne, A.-M.
Right arrow Articles by Wintz, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Overlapping Destinations for Two Dual Targeted Glycyl-tRNA Synthetases in Arabidopsis thaliana and Phaseolus vulgaris*

Anne-Marie DuchêneDagger §, Nemo Peeters, André DietrichDagger , Anne CossetDagger , Ian D. Small, and Henri WintzDagger ||

From the Dagger  Institut de Biologie Moléculaire des Plantes du CNRS, Université, CNRS Université Louis Pasteur, 12 Rue du Général Zimmer, F-67084 Strasbourg Cedex, France and the  Station de Génétique et d'Amélioration des Plantes, Institut National de la Recherche Agronomique, Route de St.-Cyr, F-78026 Versailles Cedex, France

Received for publication, December 20, 2000, and in revised form, February 1, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In plant mitochondria, some of the tRNAs are encoded by the mitochondrial genome and resemble their prokaryotic counterparts, whereas the remaining tRNAs are encoded by the nuclear genome and imported from the cytosol. Generally, mitochondrial isoacceptor tRNAs all have the same genetic origin. One known exception to this rule is the group of tRNAGly isoacceptors in dicotyledonous plants. A mitochondrion-encoded tRNAGly and at least one nucleus-encoded tRNAGly coexist in the mitochondria of these plants, and both are required to allow translation of all four GGN glycine codons. We have taken advantage of this atypical situation to address the problem of tRNA/aminoacyl-tRNA synthetase coevolution in plants. In this work, we show that two different nucleus-encoded glycyl-tRNA synthetases (GlyRSs) are imported into Arabidopsis thaliana and Phaseolus vulgaris mitochondria. The first one, GlyRS-1, is similar to human or yeast glycyl-tRNA synthetase, whereas the second, GlyRS-2, is similar to Escherichia coli glycyl-tRNA synthetase. Both enzymes are dual targeted, GlyRS-1 to mitochondria and to the cytosol and GlyRS-2 to mitochondria and chloroplasts. Unexpectedly, GlyRS-1 seems to be active in the cytosol but inactive in mitochondrial fractions, whereas GlyRS-2 is likely to glycylate both the organelle-encoded tRNAGly and the imported tRNAGly present in mitochondria.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Aminoacyl-tRNA synthetases (aaRSs)1 play a crucial role in protein synthesis by catalyzing the addition of amino acids to their cognate tRNAs. In plants, protein synthesis occurs in three cellular compartments: the cytosol, the mitochondria, and the chloroplasts. All tRNAs and aaRSs necessary for mRNA translation have to be present in these three compartments. In photosynthetic plants, cytosolic tRNAs are all nucleus-encoded, and chloroplastic tRNAs are all chloroplast-encoded (1). By contrast, plant mitochondrial tRNAs have several genetic origins. Some are nucleus-encoded and imported from the cytosol. The others are mitochondrion-encoded and show 70-75% identity with their prokaryotic counterparts and less than 60% identity with their cytosolic counterparts. These mitochondrion-encoded tRNAs are of two types: the "native" tRNAs derived from authentic mitochondrial tRNA genes and the "chloroplast-like" tRNAs that are 97-100% identical to their chloroplast counterparts. The genes corresponding to the latter originated from the chloroplast and were inserted into the mitochondrial genome during evolution. The number of tRNAs in each category (imported, native, or chloroplast-like) and their identity can vary from one plant species to another (2, 3).

Higher plant aaRSs are all encoded by the nuclear genome and post-translationally addressed to the different subcellular compartments. The fidelity of translation relies in part on the specificity of the aminoacylation reaction catalyzed by the aaRSs. Thus, strong coevolution is expected between the aaRSs and their cognate tRNAs (4, 5). A few plant genes coding for mitochondrial aaRSs have been characterized, and it appears that the aaRSs used in mitochondrial translation have, in general, the same genetic origin as their substrate tRNAs. This is the case for tRNAsAla, tRNAsThr, and tRNAsVal and their cognate aaRSs in Arabidopsis thaliana. These tRNAs are most likely to be imported from the cytosol into mitochondria in A. thaliana, because the corresponding genes are absent from the mitochondrial genome (6), and they were shown to be imported into mitochondria in other plants such as potato (3). Similarly, cytosolic alanyl-tRNA synthetase (7), threonyl-tRNA synthetase, and valyl-tRNA synthetase (8) are also imported into mitochondria. In all three cases, the mitochondrial form and the cytosolic form of the enzyme are encoded by the same gene. Similarly, dual targeting to mitochondria and chloroplasts was observed for methionyl- (9), histidyl- (10), cysteinyl-, and asparaginyl-tRNA synthetase (11), whereas the corresponding mitochondrial tRNAs were shown to be encoded by native (initiator tRNAMet, tRNACys) or chloroplast-like (elongator tRNAMet, tRNAHis, tRNAAsn) genes present in the mitochondrial genome (6).

An organelle-encoded native tRNAGly(GCC) is present in mitochondria of the dicotyledonous plants A. thaliana (6, 12), potato (Solanum tuberosum) (13), and common bean (Phaseolus vulgaris) (14). Because this tRNA cannot read all four GGN glycine codons, at least one other tRNAGly is required in mitochondria for translation to occur, and a tRNAGly(UCC) was shown to be imported from the cytosol into S. tuberosum and P. vulgaris mitochondria (14). Coexistence of imported and organelle-encoded isoacceptor tRNAs in mitochondria has been reported only in a very few cases, i.e. tRNAsIle in higher plants (2) and tRNAsIle, tRNAsThr, and tRNAsVal in Marchantia polymorpha (15). The presence of isoacceptor tRNAs with different genetic origins in plant mitochondria raises the problem of the coevolution between tRNAs and aaRSs. In this work, we show that, along with the coexistence in the organelles of a cytosolic and a native mitochondrial tRNAGly, two different glycyl-tRNA synthetases are imported into mitochondria in dicotyledonous plants. Both are dual targeted proteins, one to the cytosol and mitochondria (called glycyl-tRNA synthetase-1 (GlyRS-1)) and the other to chloroplasts and mitochondria (called GlyRS-2). Unexpectedly, GlyRS-1 was shown to be active in the bean cytosol but not in mitochondria, whereas GlyRS-2 was able to aminoacylate either nuclearly or mitochondrially encoded tRNAsGly.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Inverse PCR-- A. thaliana total DNA was extracted from whole plants according to Dellaporta et al. (16), digested with BglII, self-ligated, and used as a template for PCR amplification (17) with divergent oligonucleotides AM10 (5'-GCGGGATCCGGATCGGAGCGATGGAGATTGGG-3'; the BamHI site for cloning is underlined) and AM12 (5'-CGCTCTAGAGGCTTCCCGTGCAGCTAAACCAG-3'; the XbaI site for cloning is underlined) (see Fig. 1A).

Primer Extension-- Total RNA was extracted from 3-week-old A. thaliana plants (18), and poly(A+) RNA was prepared using a PolyATtract mRNA isolation system IV kit (Promega, Madison, WI). Primer extensions were performed with oligonucleotide AM16 (5'-GGATCGGAGCGATGGAGATTGGG-3') (see Fig. 1A) and with 1 µg of poly(A+) RNA or 12 µg of total RNA (17). Sequencing reactions were primed with oligonucleotide AM16 (17).

Computer Predictions of Subcellular Targeting-- Predictions of intracellular targeting of proteins were made using ChloroP, MITOPROT, Predotar, PSORT, or TargetP.

Isolation of Mitochondria and Chloroplasts-- Isolation of organelles from A. thaliana plants gave a very poor yield, and extensive cytosolic contamination was observed. Organelles were therefore mainly isolated from bean, and to a lesser extent from wheat and potato. Mitochondria were extracted from 3-week-old A. thaliana plants, from 5-day-old etiolated bean hypocotyls or wheat plantlets, or from potato tubers in extraction buffers containing 0.6 M mannitol, 0.3 M sucrose, or 0.3 M mannitol, respectively, as an osmoticum (19) and were purified on continuous polyvinylpyrrolidone/Percoll gradients (20). For A. thaliana mitochondria, a second, discontinuous polyvinylpyrrolidone/Percoll gradient was necessary to reduce cytosolic contamination (14). Chloroplasts were extracted from leaves of 6-day-old bean plants (21).

For protease treatment, mitochondria were incubated in the presence of 100 µg/ml proteinase K for 5 min at room temperature and 10 min on ice. Upon addition of 2 mM phenylmethylsulfonyl fluoride, organelles were recovered by centrifugation through a cushion of 27% (w/v) sucrose, 20 mM Hepes-KOH, pH 7.5, 1 mM phenylmethylsulfonyl fluoride. For subfractionation, mitochondria were resuspended in 5 mM potassium phosphate buffer, pH 7.5, and incubated on ice for 20 min to disrupt the outer membrane. Gentle homogenizing with a plunger was applied several times during incubation to help release of the outer membrane. The suspension was subsequently loaded on a 15/32/45/52% sucrose step gradient in a 10 mM potassium phosphate buffer, pH 7.5, containing 2 mM EDTA and 0.2% (w/v) bovine serum albumin and centrifuged for 20 min at 125,000 × g. The outer membrane fraction and the mitoplasts were recovered at the 15/32% interface and the 45/52% interface, respectively. Both were washed in 10 mM potassium phosphate, pH 7.5, 0.3 M sucrose, 1 mM EDTA, 0.1% (w/v) bovine serum albumin, 5 mM glycine and pelleted for 10 min at 175,000 × g. Mitoplasts were resuspended in the same buffer and disrupted by three freeze/thaw cycles and two sonication cycles of 10 s. The suspension was successively centrifuged for 5 min at 2500 × g, to eliminate the remaining undisrupted material, and for 30 min at 175,000 × g, to separate the inner membrane fraction from the matrix.

Protein Extracts-- Denatured protein extracts for SDS-polyacrylamide gel electrophoresis were prepared in 10 mM Tris-HCl, pH 7.5, 5 mM EDTA, 0.3% (w/v) SDS, 5% (v/v) beta -mercaptoethanol. Enzymatic extracts for aminoacylation and chromatography were prepared according to Maréchal-Drouard et al. (22).

Aminoacylation Assays-- Aminoacylations (19) were performed in the presence of 10-4 M [3H]glycine and 3 µg/µl yeast or Escherichia coli total tRNA, 0.15 µg/µl bean total leaf, mitochondrial, or chloroplastic tRNA (22), or 0.04 µg/µl in vitro transcribed tRNAGly.

Green Fluorescent Protein (GFP) Targeting Analysis-- The sequence corresponding to the N terminus of GlyRS-1 (nucleotides 616-810 in Fig. 1A) was amplified by PCR using the A. thaliana cDNA as a template and oligonucleotides SIGM.5 (5'-GATCTCTAGAAAAATGCGCATCTTCTCTACA-3'; the XbaI site is underlined) and SIGM.3 (5'-CATGCTCGAGAGTTACCCTGAGCTTCGAC-3'; the XhoI site is underlined). To fuse this sequence with the GFP gene, the PCR products were cloned into the SpeI/SalI sites of pOL-GFP-S65C (11), generating pSYGM in which the first AUG of the GlyRS-1 sequence was in a favorable context for initiation of translation. The sequence corresponding to the N terminus of GlyRS-2 (GenBankTM accession number AJ003069, nucleotides 32-275) was amplified by PCR using A. thaliana total DNA as a template and oligonucleotides SIGO.5 (5'-GATCTCTAGAAAAATGGCCATCCTCCATT-3'; the XbaI site is underlined) and SIGO.3 (5'-CATGCTCGAGCCTGGAGGCGTTGAA-3'; the XhoI site is underlined). The PCR products were cloned into the SpeI/SalI sites of pOL-GFP-S65C, generating pSYGO. The complete expression cassette containing the cauliflower mosaic virus 35S promoter, the GFP fusion, and the cauliflower mosaic virus 35S terminator was cut out of pSYGM and pSYGO with HindIII and cloned into the binary vector pGPTV-kan (23). The resulting plasmids, pNP7 and pNP8, respectively, were used to transform the Agrobacterium tumefaciens LBA4404 strain (Life Technologies, Inc.).

Transformation was performed by infiltration of Nicotiana benthamiana leaves (24) with a suspension of A. tumefaciens carrying pNP7 or pNP8. After 25-30 h, protoplats were prepared (25) from the infiltrated leaves. Protoplasts were stained with a mitochondria-specific dye (MitoTrackerTM, CMTMRos, Molecular Probes, Eugene, OR) and analyzed using an epifluorescence microscope (9).

In Vitro Import into Isolated Mitochondria-- The sequence corresponding to the N terminus of GlyRS-1 (nucleotides 616-742 in Fig. 1A) was first amplified by PCR using the A. thaliana cDNA clone as a template and oligonucleotides AM26 (5'-CGCGCCATGGGCATCTTCTCTACATTCGTCTTTCATCGC-3'; the NcoI site is underlined) and AM36 (5'-CGCGGATCCTCGGCGTCAATCGGAATCTGGATC-3'; the BamHI site is underlined). This introduced a point mutation at position 735, replacing the second AUG codon with an AUU isoleucine codon. The PCR products were cloned into the NcoI/BamHI sites of pCK-GFP3 (9), yielding a GFP fusion. The obtained plasmid was named pAM160. The EcoRI/HindIII fragments from pAM160 and pSYGO (see above), which contained the tobacco etch virus translation leader, the GlyRS-1 or GlyRS-2 N terminus, the GFP gene, and the cauliflower mosaic virus 35S terminator, were cloned into pBlueScript-KS (Stratagene, La Jolla, CA). These constructs were used as templates for in vitro transcription/translation carried out with a TNTTM coupled reticulocyte lysate system (Promega) in the presence of [35S]methionine. Import of 35S-labeled fusion proteins into purified potato mitochondria was performed according to Wischmann and Schuster (26) and analyzed by SDS-polyacrylamide gel electrophoresis.

Overexpression of GlyRS-1 in E. coli-- The sequence of the cytosolic form (690 amino acids) of GlyRS-1 was amplified by PCR using the A. thaliana cDNA as a template and oligonucleotides AM19 (5'-CGCGCCATGGACGCCACCGAGCAGTCTCTC-3'; the NcoI site is underlined) and AM20 (5'-GGCGGATCCGTCTGCAGCAGCAGAAGAATG-3'; the BamHI site is underlined) and cloned into pQE60 (Qiagen, Hilden, Germany). The resulting plasmid, pAM147, was used to transform the E. coli TG2 strain (17). Overexpression in E. coli was induced with 2 mM isopropyl-1-thio-beta -D-galactopyranoside. Protein extraction under denaturing conditions was performed according to the manufacturer's instructions. Extracts were fractionated by SDS-polyacrylamide gel electrophoresis. The polypeptide corresponding to GlyRS-1 was electroeluted from the gels (27) and injected into rabbits to raise antibodies. Alternately, native enzymatic extracts (22) were prepared from the E. coli strain overexpressing GlyRS-1 and used for liquid chromatography fractionation.

Western Blot Analysis-- Proteins were separated by SDS-polyacrylamide gel electrophoresis, electrotransferred onto ImmobilonTM-P membranes (Millipore, Bedford, MA), and submitted to immunological detection following classical protocols (17). Antisera were used at a 1/5000 dilution. Antibodies against mitochondrial superoxide dismutase were a gift from Dirk Inzé (Gent, Belgium), and antibodies against alpha -tubulin were from Amersham Pharmacia Biotech. Antisera against bean chloroplastic leucyl-tRNA synthetase were obtained previously (28). Binding of the primary antibodies was revealed by chemiluminescence using peroxidase-conjugated secondary antibodies and ECL reagents (Amersham Pharmacia Biotech).

Liquid Chromatography-- Enzymatic extracts were fractionated by medium pressure chromatography on a 1-ml POROS 20 PE hydrophobic column (PerSeptive Biosystems, Framingham, MA) driven by a BioLogic integrated system (Bio-Rad). The samples (1 mg of proteins) adjusted to 1.5 M ammonium sulfate were loaded at 1 ml/min on the column equilibrated with a 20 mM Tris-HCl buffer, pH 7.5, containing 1.5 M ammonium sulfate, 1 mM MgCl2, 5% (v/v) 1,2-propanediol, 0.1 mM EDTA, 5 mM beta -mercaptoethanol, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM diisopropylfluorophosphate. After washing with the same buffer (5 ml), elution was performed at 1 ml/min with a linear ammonium sulfate gradient (10 ml, 1.5 to 0 M). Fractions of 0.33 ml were collected, and aliquots were submitted to aminoacylation assays and Western blot analyses.

Enzymatic extracts were also fractionated on a 1.3-ml UNOTM-Q1 anion exchange column (Bio-Rad). The samples were loaded at 0.5 ml/min on the column equilibrated with a 20 mM Tris-HCl buffer, pH 7.5, containing 10 mM NaCl, 1 mM MgCl2, 5% (v/v) 1,2-propanediol, 0.1 mM EDTA, 5 mM beta -mercaptoethanol, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM diisopropylfluorophosphate. Elution was performed at 0.7 ml/min with a 15-ml linear gradient from 10 to 500 mM NaCl, followed by a 5-ml linear gradient from 500 to 1000 mM NaCl. Fractions of 0.5 ml were collected.

Preparation of tRNA Transcripts-- Constructs encoding tRNAsGly were amplified by PCR with the relevant primers (see below) so that the tRNA gene sequence was directly fused to the T7 RNA polymerase promoter at the 5' terminus and to a BstNI site at the 3' terminus. PCR products were cloned into the EcoRI or EcoRI/BamHI sites of pUC19. After BstNI digestion, in vitro transcription of these constructs with T7 RNA polymerase yielded mature sized, unmodified tRNA transcripts with a 3' CCA end (29). The following oligonucleotides were used as primers (EcoRI and BamHI sites are underlined; the T7 RNA polymerase promoter or BstNI site is in italics): for mitochondrial native tRNAGly(GCC), 5' AGCAAGAATTCGAATTGTAATACGACTCACTATAGCGGAAATAGCTTAATGGTAG 3' and 5' GTACAGAATTCCCTGGAGCGGAAGGAGGGACTTGAAC 3'; for cytosolic tRNAGly(GCC), 5' AGCAAGAATTCGAATTGTAATACGACTCACTATAGCACCAGTGGTCTAGTGGTAG 3' and 5' GTACAGAATTCCCTGGTGCACCAGCCGGGAATCGAAC 3'; for cytosolic tRNAGly(UCC), 5' GCAAGAATTCGAATTGTAATACGACTCACTATAGCGTCTGTAGTCCAACGGTTAG 3' and 5' CGCGGATCCTGGTGCGTCTGCCGGGAGTCGAAC 3'.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Characterization of an A. thaliana Eukaryotic-type GlyRS, GlyRS-1-- By analysis of cDNAs and inverse PCR products, we characterized a eukaryotic-type GlyRS gene in A. thaliana (GenBankTM accession number AJ002062) (30), and we termed this gene GlyRS-1. For this, an A. thaliana cDNA library (Strasbourg, France) was screened using as a probe an A. thaliana expressed sequence tag clone (GenBankTM accession number 117F7T7) (31) showing similarity with known GlyRS genes. Several incomplete cDNAs, lacking the 5' end, were recovered from this screening. The 5' region of the gene (Fig. 1A) was cloned from A. thaliana genomic DNA by using inverse PCR. Southern blot analysis (17) of total A. thaliana DNA digested with PstI, BglII, or EcoRI suggested that the GlyRS-1 gene is a single copy gene (data not shown), which was confirmed with the availability of the complete A. thaliana genomic sequence ((32); see the Arabidopsis Genome Initiative web site). A second gene showing similarities with GlyRS-1 and other eukaryotic GlyRS sequences was previously identified in the A. thaliana genome (GenBankTM accession number AC002534). However, this second gene was considered to be a pseudogene, because the sequence is partial, it contains a number of frameshifts, and no corresponding expressed sequence tags could be detected.


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 1.   Structure and expression of the A. thaliana GlyRS-1 gene. The 5' end and upstream region of the GlyRS-1 gene are presented in A. Mapped 5' ends of transcripts (+1) and positions of initiation codons (ATG) are underlined. The sequences corresponding to oligonucleotides AM12 and AM10/AM16 are also underlined. Primer extension analysis of the GlyRS-1 mRNA (B) was performed with AM16 and with 12 µg of total (lane 1) or 1 µg of poly(A+) (lane 2) A. thaliana RNA. Arrows indicate the major products synthesized. A sequencing ladder is shown on the right.

The full GlyRS-1 coding sequence is 729 amino acids long. It is similar to other known eukaryotic GlyRS sequences (more than 45% amino acid identity and 60% similarity with Homo sapiens, Bombyx mori, and Caenorhabditis elegans GlyRS sequences) and presents no obvious similarity with prokaryotic GlyRS sequences such as the E. coli GlyRS, suggesting a cytosolic localization. A multiple alignment of GlyRS sequences is available on our web site devoted to A. thaliana tRNAs and aminoacyl-tRNA synthetases (web site address available from the corresponding author). The high level of similarity between GlyRS-1 and eukaryotic GlyRSs suggests that the native enzyme probably has an alpha 2 quaternary structure, like other eukaryotic GlyRSs. The presence of a mitochondrial targeting peptide at the N-terminal end of the coding sequence was predicted by computer analysis. MITOPROT, Predotar, PSORT, and TargetP gave a score of 0.88, 0.90, 0.76, and 0.91, respectively, for a mitochondrial localization. Alignment of the GlyRS-1 amino acid sequence with that of the other GlyRS sequences starts around the end of the potential targeting sequence. It should also be noticed that a dual localization in the cytosol and in mitochondria was proposed for two homologs of GlyRS-1, in humans (33, 34) and in Saccharomyces cerevisiae (35).

Expression of the GlyRS-1 gene was investigated by primer extension. The results shown in Fig. 1B indicate that there are two major transcripts with different 5' ends that map 22 nucleotides upstream and 15 nucleotides downstream, respectively, of the first putative AUG initiation codon. The sequence shows a second in-frame AUG, 40 codons downstream of the first initiator AUG. This second AUG maps near the position corresponding to the C-terminal end of the predicted mitochondrial targeting peptide. The 5' end of the shortest mRNA is located upstream of the second in-frame AUG codon, which could thus be used to initiate translation on this transcript, leading to the synthesis of a short, cytosolic form of GlyRS-1 (690 amino acids, 76 kDa). Translation of the long transcript could generate a long protein (729 amino acids, 80 kDa) with a putative mitochondrial targeting peptide.

Reexamination of a Second A. thaliana GlyRS Gene (GlyRS-2)-- An expressed GlyRS gene of prokaryotic-type (GenBankTM accession number AJ003069) was characterized by Uwer et al. (36) upon analysis of an A. thaliana embryo development mutant due to a unique insertion of a DsA transposable element. The corresponding protein, which is 1068 amino acids long, has no significant similarity with GlyRS-1 but presents regions similar to the alpha  and beta  subunits of E. coli GlyRS (59% identity with the alpha  subunit and 36% identity with the beta  subunit), so that a dimeric structure of GlyRS-2 would reflect the tetrameric alpha 2beta 2 structure of E. coli GlyRS. An alignment of the GlyRS-2 sequence with other GlyRS sequences is also available on our web site. Prediction of the subcellular localization run with ChloroP, Predotar, and TargetP gave a score of 0.57, 0.98, and 0.82, respectively, for a chloroplastic localization of GlyRS-2, and this enzyme was indeed shown to be imported into chloroplasts (36). However, the corresponding GlyRS mutant has an embryo lethal phenotype. Embryo growth was stopped between the globular and heart stages of embryonic development, and germination of mutant seeds was never observed. Such a phenotype was not expected for a plastid enzyme, and the function of this GlyRS during plastidic translation does not provide a direct hint to its role during embryogenesis (36). Indeed, Uwer et al. (36) did not exclude another localization, and further prediction analyses with MITOPROT gave a score of 0.95 for a mitochondrial localization of GlyRS-2. With PSORT, no clear prediction for mitochondrial or chloroplastic targeting was obtained.

Subcellular Localization of GlyRS-1 and GlyRS-2 as Implied by Targeting of GFP Fusions-- As an in vivo approach to analyze the intracellular localization of GlyRS-1, the sequence encoding the first 65 amino acids of this enzyme was fused upstream to, and in frame with, an enhanced jellyfish (Aequorea victoria) GFP reporter gene. When transiently expressed in N. benthamiana cells, this construct yielded fluorescence associated with mitochondria (Fig. 2, panels 2a and 2b), demonstrating that the N terminus of GlyRS-1 is an active mitochondrial targeting peptide in vivo.


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 2.   Expression of GFP fusions in N. benthamiana cells. Fluorescence was observed at × 100 magnification with a Nikon Eclipse E800 epifluorescence microscope. In panels 1, 2a, and 3a, GFP fluorescence was observed using a GFP band pass filter set (excitation, 460-500 nm; band pass emission, 510-560 nm). In panel 3c, red chlorophyll autofluorescence was observed using a long pass filter set (excitation, 460-500 nm; long pass emission, 510 nm). In panels 2b and 3b, fluorescence of the mitochondria-specific dye (MitoTrackerTM) was observed using a TRITC filter set (excitation, 540/25 nm; emission, 605/55 nm). Panel 1 corresponds to unfused GFP. Panels 2a and 2b correspond to the GlyRS-1 N terminus-GFP fusion. Panels 3a, 3b, and 3c correspond to the GlyRS-2 N terminus-GFP fusion.

Because potential dual targeting of GlyRS-2 to mitochondria and chloroplasts was predicted by computer analyses, a similar approach was developed for this enzyme. The sequence encoding the first 81 amino acids of the GlyRS-2 polypeptide was fused in frame to the 5' end of the GFP gene. When this construct was expressed in N. benthamiana cells, fluorescence was associated with both chloroplasts and mitochondria (Fig. 2, panels 3a, 3b, and 3c), indicating that the GlyRS-2 presequence is able to promote dual targeting to both organelles in vivo.

Mitochondrial Localization of GlyRS-1 and GlyRS-2 as Implied by in Vitro Import into Isolated Mitochondria-- The large size of the GlyRS-1 (80 kDa) and GlyRS-2 (117 kDa) polypeptides was expected to be unfavorable both for coupled in vitro transcription/translation and for in vitro import into mitochondria. Thus, these experiments were carried out with constructs corresponding to fusions between the GlyRS N-terminal sequences and GFP. In vitro transcription/translation of the chimeric genes yielded a 32-kDa fusion protein for the GlyRS-1 construct (Fig. 3A, lane 1) and a 35-kDa product for the GlyRS-2 construct (Fig. 3B, lane 1). In the presence of mitochondria, these products were partially processed into polypeptides of 27 and 30 kDa, respectively (Fig. 3, A and B, lane 2), which corresponded to the Mr of the fusion proteins upon cleavage of the predicted GlyRS targeting sequence. The addition of proteinase K to the import medium reduced the signals corresponding to the preproteins but did not affect the signals corresponding to the processed proteins that were protected (Fig. 3, A and B, lane 3). The addition of valinomycin, which is known to inhibit mitochondrial protein import, prevented the formation of the processed proteins (Fig. 3, A and B, lanes 4 and 5). When the same experiment was performed with unfused GFP, no interaction with mitochondria was observed, because no labeled protein was associated with mitochondria after incubation and centrifugation through a sucrose cushion (data not shown). These results showed that the GlyRS-1 and GlyRS-2 presequences can promote in vitro protein import into isolated mitochondria.


View larger version (68K):
[in this window]
[in a new window]
 
Fig. 3.   In vitro protein import into isolated mitochondria. The GlyRS-1 N terminus-GFP fusion (A) and the GlyRS-2 N terminus-GFP fusion (B) were in vitro translated (lane 1) and incubated for 30 min at 25 °C with mitochondria (lanes 2-5). Mitochondria were treated with valinomycin prior to import (lanes 4 and 5) and/or submitted to proteinase K digestion after import (lanes 3 and 5). Migration of the chimeric preproteins (pre) and of the processed polypeptides (m) is indicated.

Subcellullar Localization of GlyRS-1 as Deduced from Western Blot Analysis-- The cytosolic form of GlyRS-1 was overexpressed in E. coli and purified to raise polyclonal antibodies. Western blots were performed with A. thaliana total and mitochondrial proteins. Cross-contaminations were checked with antisera against mitochondrial superoxide dismutase (Fig. 4IB) for mitochondrial contamination or alpha -tubulin (Fig. 4IC) for cytosolic contamination. An immunoreactive protein of about 76 kDa was detected both in total and in mitochondrial protein extracts when using the antiserum against GlyRS-1 (Fig. 4IA). The size of the detected protein was in accordance with the calculated Mr of the cytosolic form and the processed mitochondrial form of the enzyme. Faster migrating polypeptides revealed with the GlyRS-1 antiserum in mitochondrial extracts (Fig. 4IA) might reflect some degradation.


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 4.   Western blot analyses. Immunodetection of GlyRS-1 (A), mitochondrial superoxide dismutase (B), alpha -tubulin (C), and chloroplastic leucyl-tRNA synthetase (D) was performed with total (pt) and mitochondrial (mt) protein extracts from A. thaliana plantlets (panel I), with bean total leaf (lt), total hypocotyl (ht), chloroplastic (cp), and mitochondrial protein extracts (panel II), with protein extracts from untreated (-K) and proteinase K-treated (+K) bean mitochondria (panel III), and with total (t), soluble (s), membrane (m), inner membrane (im), or outer membrane (om) protein extracts from bean mitochondria or mitoplasts (panel IV). The chemiluminescence reaction in panel IIIC was developed for a much longer time to visualize residual contamination of mitochondrial proteins with alpha -tubulin.

An immunoreactive protein of the same size was also found in the cytosol and in mitochondria when using bean total and mitochondrial enzymatic extracts in Western blot analyses with the GlyRS-1 antiserum (Fig. 4IIA). This observation implies that a homolog of A. thaliana GlyRS-1 is present in bean and is dual targeted to the cytosol and to mitochondria, although it does not completely exclude the possibility that the cytosolic form and the mitochondrial form derive from two highly similar genes in bean. Cross-contaminations between cytosolic and mitochondrial extracts were checked as before (Fig. 4, IIB and IIC), whereas chloroplastic contamination was checked with an antiserum against chloroplast leucyl-tRNA synthetase (Fig. 4IID). Based on these observations, further experiments were developed with protein extracts from bean, because isolation of clean A. thaliana mitochondria was quite inefficient. Isolated bean mitochondria were treated with proteinase K before protein extraction. Such a treatment strongly reduced residual cytosolic contamination, as checked by immunodetection with the alpha -tubulin antiserum (Fig. 4IIIC), but did not affect the signal obtained with the antibodies against GlyRS-1 (Fig. 4IIIA), confirming that GlyRS-1 was present inside mitochondria. Submitochondrial localization of GlyRS-1 was then analyzed. Isolated bean mitochondria were lysed, and total membranes were separated from the soluble fraction by centrifugation. GlyRS-1 was essentially detected in the soluble fraction by Western blot analysis (Fig. 4IV). Finally, mitochondria were submitted to an osmotic shock to release the outer membrane, which was separated from the remaining mitoplasts on a step gradient. Lysis of the mitoplasts and centrifugation allowed us to recover the matrix and the inner membrane fraction. GlyRS-1 was found only in the matrix fraction and was not significantly associated with the outer membrane or the inner membrane (Fig. 4IV).

Subcellular Localization of GlyRS-1 and GlyRS-2 as Assessed by Chromatographic Fractionation-- Following Western blot analysis (Fig. 4II), the enzymatic extracts from bean leaves, mitochondria and chloroplasts, as well as an enzymatic extract from an E. coli strain overexpressing the cytosolic form of A. thaliana GlyRS-1, were fractionated by chromatography on a hydrophobic column (POROS 20 PE) in standardized conditions. Proteins were eluted with a decreasing ammonium sulfate gradient. Collected fractions were tested for GlyRS activity using E. coli or yeast tRNAs and [3H]glycine as substrates and submitted to immunodetection with the antiserum against GlyRS-1. The activity of the overexpressed GlyRS-1 reached its maximum in fractions 12-14 of the elution profile and was followed by a second peak corresponding to E. coli GlyRS (Fig. 5A). GlyRS-1 efficiently glycylated yeast tRNAs but very poorly glycylated E. coli tRNAs. Two peaks of GlyRS activity were also obtained with enzymatic extracts from bean leaves (Fig. 5B). The first peak matched the elution of the overexpressed GlyRS-1 (Fig. 5A), reaching its maximum with fractions 13/14 and showing efficient glycylation of yeast tRNAs versus E. coli tRNAs. The presence of the bean GlyRS-1 in these fractions was confirmed by Western blot analysis using anti-GlyRS-1 antibodies (Fig. 5C). It should be noted that the high ammonium sulfate concentrations present in the fractions at that point of the gradient were inhibitory for aminoacylation, and desalting of fractions 12-15 resulted in a 7-fold higher activity. The second peak of GlyRS activity, which reached its maximum with fractions 29/30, corresponded to glycylation of either yeast or E. coli tRNAs, with a more efficient recognition of the latter (Fig. 5B). Similar results were obtained with an enzymatic extract from green A. thaliana plantlets (data not shown), thus validating the use of bean for these analyses. Chromatographic fractionation of bean chloroplast enzymatic extracts, which were supposed to contain GlyRS-2 (36), on the hydrophobic column yielded only one peak of GlyRS activity (Fig. 5D), corresponding to the second peak in the elution profile obtained with enzymatic extracts from bean leaves. This peak, with a maximum GlyRS activity in fractions 28-30 and a better recognition of E. coli tRNAs versus yeast tRNAs, was therefore likely to be representative of GlyRS-2. Finally, the elution profile obtained upon fractionation of bean mitochondrial enzymatic extracts (Fig. 5E) was the same as for chloroplast extracts, showing only one peak of GlyRS activity, which matched the presumed GlyRS-2 elution. Together with the in vivo targeting analyses (Fig. 2) and the in vitro import experiments (Fig. 3), these results imply that GlyRS-2 is dual targeted to both chloroplasts and mitochondria. Unexpectedly, the peak of GlyRS-1 activity detected upon fractionation of enzymatic extracts from bean leaves or A. thaliana plantlets could not be recovered upon hydrophobic chromatography of bean mitochondrial extracts, although in vivo targeting studies (Fig. 2), in vitro import experiments (Fig. 3), and Western blot analyses (Fig. 4) had unambiguously shown the import of GlyRS-1 into mitochondria. Moreover, the GlyRS-1 protein was clearly detected in the bean mitochondrial enzymatic extracts prior to chromatographic fractionation (Fig. 4IIA). Probing with the anti-GlyRS-1 antiserum revealed that, during hydrophobic chromatography of mitochondrial extracts, elution of the GlyRS-1 polypeptide occurred at the very end of the fractionation (around fraction 32; Fig. 5F), while washing the column with buffer devoid of ammonium sulfate, and not in fractions 13/14 as expected (see Fig. 5, B and C). Elution from this type of column occurs according to the hydrophobic characteristics of the proteins. From these experiments, it seems that GlyRS-1 is active and quite hydrophilic in cytosolic extracts but becomes inactive and hydrophobic in mitochondrial extracts.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 5.   Hydrophobic column chromatography of GlyRS activities. Fractionation is presented for enzymatic extracts from an E. coli strain overexpressing GlyRS-1 (A), bean leaves (B and C), bean chloroplasts (D), and bean mitochondria (E and F). Column fractions were analyzed for GlyRS activity (A, B, D, and E) in the presence of [3H]glycine and yeast total tRNAs (dotted lines) or E. coli total tRNAs (full lines) and for reactivity with the antibodies against GlyRS-1 on Western blots (C and F). T corresponds to an unfractionated bean total leaf protein extract run as a control.

To determine to what extent the above behavior of GlyRS-1 was an effect due to the hydrophobic column, enzymatic extracts from bean leaves and mitochondria were fractionated by chromatography on an anion exchange column (UNO-Q1). As done previously, an enzymatic extract from an E. coli strain overexpressing the cytosolic form of A. thaliana GlyRS-1 was used as a control. The overexpressed GlyRS-1 was eluted in fractions 9-13 (Fig. 6A). With the bean leaf extract, two peaks of GlyRS activity were again obtained (Fig. 6B). One peak reached its maximum with fraction 10, matching the elution of GlyRS-1 (Fig. 6A) and showing an efficient glycylation of yeast tRNAs. The second peak reached its maximum with fraction 16, with a more efficient glycylation of E. coli versus yeast tRNAs. Anti-GlyRS-1 antibodies gave a signal with fractions 10-12 on Western blots (Fig. 6C). This suggested that the first peak corresponded to GlyRS-1 and the second to GlyRS-2. With the bean mitochondrial extract, still only one peak of activity, corresponding to GlyRS-2, was obtained (Fig. 6D). In this case, the GlyRS-1 polypeptide was detected by Western blotting in the fractions around fraction 12 (Fig. 6E), as expected from the profile obtained with the total leaf extract, but no detectable activity was associated with these fractions even in the presence of bean total or mitochondrial tRNAs.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 6.   Anion exchanger column chromatography of GlyRS activities. Fractionation is presented for enzymatic extracts from an E. coli strain overexpressing GlyRS-1 (A), bean leaves (B and C), bean mitochondria (D and E), and wheat mitochondria (F and G). Column fractions were analyzed for GlyRS activity (A, B, D, and F) in the presence of [3H]glycine and yeast total tRNAs (dotted lines) or E. coli total tRNAs (full lines) and for reactivity with the antibodies against GlyRS-1 on Western blots (C, E, and G). T corresponds to an unfractionated bean leaf protein extract run as a control. For graphical convenience, GlyRS activity values obtained in the presence of yeast total tRNAs were divided by 3 in A and 10 in B.

Based on quantitative analysis of the signals on Western blots, the absence of GlyRS-1 activity in the chromatographic profiles of mitochondrial extracts was unlikely to reflect a too weak concentration of the enzyme in the column fractions. The absence of GlyRS-1 activity could not be explained by an effect of the chromatography, because similar results were obtained with two different types of column. As a further step toward understanding these unexpected observations made with dicotyledons, we switched the analyses to another class of plants. According to the data available for wheat (Triticum aestivum) and maize (Zea mays), all mitochondrial tRNAsGly seem to be imported from the cytosol in monocotyledonous angiosperms (3, 37). An active GlyRS of cytosolic type, like GlyRS-1, was therefore expected to be present in mitochondria of monocotyledons, considering substrate specificity and tRNA/aaRS coevolution. Wheat total (data not shown) and mitochondrial (Fig. 6, F and G) enzymatic extracts were prepared and fractionated on the anion exchange column. The same elution profiles were obtained for both extracts, showing two peaks of GlyRS activity. The first peak reached its maximum in fraction 12 (Fig. 6F), and the anti-GlyRS-1 antibodies recognized in these fractions a polypeptide of the expected size (Fig. 6G), suggesting the existence of an active equivalent of the bean and A. thaliana GlyRS-1 in wheat, both in the cytosol and in mitochondria. The inactivation of GlyRS-1 in mitochondrial extracts therefore appeared not to be a systematic behavior of the enzyme or an artifact produced by our experimental procedures. However, it was obvious from the column elution profiles (Fig. 6F) that, even in wheat, GlyRS-1 makes a very minor contribution to the total GlyRS activity present in mitochondria. The main activity showed up as a second peak having its maximum in fractions 15-17. The shouldered shape of this second peak, the aminoacylation ratio of yeast versus E. coli tRNAs along the different fractions, and the fact that recognition of a wheat-specific polypeptide smaller than GlyRS-1 by the anti-GlyRS-1 antibodies preferentially matched the second half of the peak (Fig. 6G) raised the possibility that at least two other forms of GlyRS are present in wheat mitochondria.

Substrate Specificity of GlyRS-1 and GlyRS-2-- Fractions containing only GlyRS-1 activity obtained upon chromatography of a bean total enzymatic extract on either the hydrophobic or the anion exchange column were used to characterize the tRNA recognition specificity of GlyRS-1. A bean chloroplast enzymatic extract, which contained only GlyRS-2, was used to characterize the tRNA recognition specificity of GlyRS-2. Despite its prokaryotic features revealed by a strong similarity to the bacterial GlyRS, GlyRS-2 was able to glycylate bean total (mainly cytosolic), chloroplastic, and mitochondrial tRNAs with little difference in efficiency (Fig. 7A). Moreover, the aminoacylation efficiency in the presence of GlyRS-2 was the same for in vitro transcripts of a mitochondrial tRNAGly(GCC), a cytosolic tRNAGly(UCC), and a cytosolic tRNAGly(GCC) (Fig. 7C). GlyRS-2 would therefore be sufficient to charge both the native, organelle-encoded tRNAGly(GCC) and the imported tRNAGly(UCC) in mitochondria of dicotyledonous plants, unless post-transcriptional modifications not present in our in vitro transcripts alter tRNA recognition in vivo (e.g. Ref. 38). By contrast, aminoacylation of bean chloroplastic or mitochondrial tRNAs in the presence of GlyRS-1 appeared to be five times less efficient, as compared with bean total tRNAs (Fig. 7A). GlyRS-1 was also three times less efficient in glycylating the in vitro mitochondrial tRNAGly(GCC) transcript versus the two cytosolic tRNAGly transcripts.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 7.   Aminoacylation assays with partially purified bean GlyRS fractions. A, relative initial charging rate of different total tRNA samples (chloro., chloroplasts; mito., mitochondria) in the presence of an enzymatic extract containing either GlyRS-1 or GlyRS-2. Values are expressed relative to the rate obtained with total bean leaf tRNAs (1 = 1.7 pmol of [3H]glycyl-tRNA/min) for the tests with GlyRS-1 and to the rate obtained with total bean chloroplast tRNAs (1 = 4.9 pmol of [3H]glycyl-tRNA/min) for the tests with GlyRS-2. Because both enzymatic extracts were only enrichment intermediates, no conclusion could be drawn as to the relative specific activity of GlyRS-1 and GlyRS-2. B and C, the activity of GlyRS-1 (B) or GlyRS-2 (C) was tested in the presence of [3H]glycine and cytosolic tRNAGly(UCC) transcript (Cyto(UCC)), cytosolic tRNAGly(GCC) transcript (Cyto(GCC)), or mitochondrial tRNAGly(GCC) transcript (Mito(GCC)).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In this work, we show that two different GlyRSs are imported into A. thaliana and P. vulgaris mitochondria. Moreover, these enzymes are both dual targeted, the first one, GlyRS-1, to the cytosol and to mitochondria and the second, GlyRS-2, to chloroplasts and mitochondria, underlining the complexity of the relations between cell compartments. GlyRS-1 is similar to eukaryotic enzymes, whereas GlyRS-2 presents similarities with E. coli GlyRS. This situation is original and puzzling, especially because GlyRS-1 is imported but inactive in bean mitochondria, and GlyRS-2 appears to be sufficient to charge all tRNAsGly in mitochondria of dicotyledonous plants. The latter results were unexpected, considering the identity elements previously defined for tRNAGly, i.e. position N73, the first three base pairs of the acceptor stem (1:72, 2:71, 3:70), as well as positions C35 and C36 in the anticodon (39). The most striking difference between prokaryotic and eukaryotic tRNAsGly is the discriminator base at position 73, which is phylogenetically conserved as U in prokaryotes and as A in eukaryotes. In A. thaliana, N73 is a U in the native mitochondrial tRNAGly and an A in the three cytosolic tRNAsGly. Because GlyRS-2 is similar to E. coli GlyRS, the same specificity was expected for these two enzymes. E. coli GlyRS was shown to aminoacylate E. coli tRNAGly 18-fold more efficiently than yeast tRNAGly (40), whereas both tRNAs were good substrates for plant GlyRS-2. A 73Uright-arrowA mutation in the E. coli tRNAGly transcript was responsible for an 11-fold loss in the charging efficiency by E. coli GlyRS (40), but GlyRS-2 does not seem to be sensitive to the nucleotide at position 73. Plant GlyRS-2 therefore appears to be a prokaryotic-like enzyme with new specificities. So far, in plant mitochondria, the genetic origin of aaRSs seemed to coincide with that of their cognate tRNAs, and cytosolic-like mitochondrial aaRSs were associated with imported cytosolic tRNAs (7, 8). The prokaryotic-type GlyRS-2 potentially charges a mitochondrion-encoded tRNAGly and a nucleus-encoded tRNAGly, and the presence of this somehow atypical enzyme in mitochondria of dicotyledonous plants reveals new and complex aspects of tRNA/aaRS coevolution.

Several tentative explanations can be considered to account for the absence of GlyRS-1 activity in mitochondrial extracts. Among these, misfolding, or post-translational modification, of the protein during or after mitochondrial import is a possible cause. Phosphorylation (e.g. Refs. 41 and 42), acetylation (e.g. Refs. 43 and 44), isoprenylation (45), disulfide bond formation (46), and unidentified covalent modifications (47) have been shown to be associated with higher plant mitochondria. Changes in phosphorylation or acetylation should lead to the addition or lack of charges and to a shift in the elution from the anion exchanger, as compared with that of the cytosolic GlyRS-1 detected in total extracts. Significant glycosylation would affect the electrophoretic behavior, whereas addition of lipid derivatives would tend to promote anchoring into the membrane fraction, which is clearly not the case. Intersubunit disulfide bond formation looks plausible but has no obvious reason to increase the hydrophobicity of the protein versus the putative cytosolic GlyRS-1 alpha 2 dimer. Alternatively, it is possible that the lack of significant GlyRS-1 activity observed in bean hypocotyl mitochondria is specific for this plant tissue or this plant species or that GlyRS-1 is only active in mitochondria upon certain developmental conditions. However, the fact that wheat mitochondrial extracts contain significant but limited GlyRS-1 activity strengthens the idea that, whatever the reasons are for its lack of activity in the organelles of some species, the role of GlyRS-1 is not to make a major contribution to the aminoacylation of mitochondrial tRNAsGly. Therefore, one wonders why GlyRS-1 is imported into the organelles. An attractive hypothesis would be that this enzyme is required for import of cytosolic tRNAsGly into mitochondria. Two different mechanisms have been proposed for mitochondrial tRNA import. The first one, which seems to apply for trypanosomatids, is a direct import of the tRNAs through the mitochondrial membranes via receptor(s) and a specific channel (48). The second mechanism, which has been proposed to account for the mitochondrial import of the single cytosolic tRNALys(CUU) in yeast, is a co-import of the tRNA with protein factors, and in particular the corresponding aminoacyl-tRNA synthetase (49). In plants, it was shown that a point mutation in a normally imported tRNA, tRNAAla(UGC), blocked both the aminoacylation of this tRNA by alanyl-tRNA synthetase and its import into mitochondria in vivo (29). Although recent studies in Xenopus laevis and in yeast imply that proofreading might prevent or impair nuclear export of inactive tRNAs (50, 51), these observations suggest a role of alanyl-tRNA synthetase, and more generally of aaRSs, in plant mitochondrial tRNA import. One can speculate that mitochondrial import of tRNAGly isoacceptors is perhaps mediated by GlyRS-1. Considering that unfolding steps are implicated in mitochondrial protein import (e.g. Refs. 52-54), the conformation of GlyRS-1 might be modified during these processes, so that tRNA import would rely on tRNA/aaRS interactions that differ from those occurring during aminoacylation. Such a mechanism has already been proposed for the lysyl-tRNA synthetase-mediated mitochondrial import of tRNALys(CUU) in yeast (49). Conservation of this alternative conformation would also be a possibility to explain the lack of GlyRS-1 aminoacylation activity in the mitochondria of some plant species. Finally, the possibility also remains open that GlyRS-1 has another role than recognition of tRNAs during import or inside mitochondria. Indeed, there is growing evidence that aaRSs are involved in cellular processes other than tRNA aminoacylation, for example in transcription (55), intron splicing (56), and mRNA 3' end processing (57).

    ACKNOWLEDGEMENTS

We thank Laurence Maréchal-Drouard, Jean-Luc Evrard, and Regina Kraüter for fruitful discussions, Sabine Brubacher-Kauffmann and Vincent Mirabet for help in experiments, and Dirk Inzé for providing us with an antiserum against plant mitochondrial superoxide dismutase.

    FOOTNOTES

* This work was supported by the CNRS, the Université Louis Pasteur (Strasbourg), and the Institut National de la Recherche Agronomique and by a grant from the Groupement de Recherche et d'Etude des Génomes.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ To whom correspondence should be addressed. Fax: 33 3 88 61 44 42; E-mail: anne-marie.duchene@ibmp-ulp.u-strasbg.fr.

|| Current address: Nutrition and Toxicology, 119 Koshland Hall, University of California, Berkeley, CA 94720.

Published, JBC Papers in Press, February 2, 2001, DOI 10.1074/jbc.M011525200

    ABBREVIATIONS

The abbreviations used are: aaRS, aminoacyl-tRNA synthetase; GlyRS, glycyl-tRNA synthetase; PCR, polymerase chain reaction; GFP, green fluorescent protein.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Maréchal-Drouard, L., Weil, J. H., and Dietrich, A. (1993) Annu. Rev. Plant Physiol. Plant Mol. Biol. 44, 13-32
2. Dietrich, A., Small, I., Cosset, A., Weil, J. H., and Maréchal-Drouard, L. (1996) Biochimie (Paris) 78, 518-529
3. Kumar, R., Maréchal-Drouard, L., Akama, K., and Small, I. (1996) Mol. Gen. Genet. 252, 404-411
4. Ribas de Pouplana, L., Frugier, M., Quinn, C., and Schimmel, P. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 166-170
5. Doolittle, R., and Handy, J. (1998) Curr. Opin. Genet. Dev. 8, 630-636
6. Unseld, M., Marienfeld, J. R., Brandt, P., and Brennicke, A. (1997) Nat. Genet. 15, 57-61
7. Mireau, H., Lancelin, D., and Small, I. (1996) Plant Cell 8, 1027-1039
8. Souciet, G., Menand, B., Ovesna, J., Cosset, A., Dietrich, A., and Wintz, H. (1999) Eur. J. Biochem. 266, 1-8
9. Menand, B., Maréchal-Drouard, L., Sakamoto, W., Dietrich, A., and Wintz, H. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 11014-11019
10. Akashi, K., Grandjean, O., and Small, I. (1998) FEBS Lett. 431, 39-44
11. Peeters, N. M., Chapron, A., Giritch, A., Grandjean, O., Lancelin, D., Lhomme, T., Vivrel, A., and Small, I. (2000) J. Mol. Evol. 50, 413-423
12. Duchêne, A. M., Brubacher, S., Cosset, A., Maréchal-Drouard, L., and Dietrich, A. (1998) in Plant Mitochondria: From Gene to Function (Moller, I. M. , Gardeström, P. , and Glaser, E., eds) , pp. 121-125, Backuys Publishers, Leiden, The Netherlands
13. Schock, I., Maréchal-Drouard, L., and Marchfelder, A. (1998) Mol. Gen. Genet. 257, 554-560
14. Brubacher-Kauffmann, S., Maréchal-Drouard, L., Cosset, A., Dietrich, A., and Duchêne, A. M. (1999) Nucleic Acids Res. 27, 2037-2042
15. Akashi, K., Tazkenaka, M., Yamaoka, S., Suyama, Y., Fukuzama, H., and Ohyama, K. (1998) Nucleic Acids Res. 26, 2168-2172
16. Dellaporta, S. L., Wood, J., and Hicks, J. B. (1983) Plant Mol. Biol. Rep. 1, 19-21
17. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
18. Goodall, G. J., Wiebauer, K., and Filipowicz, W. (1990) Methods Enzymol. 181, 148-161
19. Maréchal-Drouard, L., Guillemaut, P., Cosset, A., Arbogast, M., Weber, F., Weil, J. H., and Dietrich, A. (1990) Nucleic Acids Res. 18, 3689-3696
20. Neuburger, M., Journet, E. P., Bligny, R., Carde, J. P., and Douce, R. (1982) Arch. Biochem. Biophys. 217, 312-323
21. Robinson, C., and Barnet, L. K. (1988) in Plant Molecular Biology: A Practical Approach (Shaw, C. H., ed) , pp. 67-78, IRL Press at Oxford University Press, Oxford
22. Maréchal-Drouard, L., Small, I., Weil, J. H., and Dietrich, A. (1995) Methods Enzymol. 260, 310-327
23. Becker, D., Kemper, E., Schell, J., and Masterson, R. (1992) Plant Mol. Biol. 20, 1195-1197
24. Rubino, L., Weber-Lotfi, F., Dietrich, A., Stussi-Garaud, C., and Russo, M. (2001) J. Gen. Virol. 82, 29-34
25. Nagy, J. I., and Maliga, P. (1976) Z. Pflanzenphysiol. 78, 453-455
26. Wischmann, C., and Schuster, W. (1995) FEBS Lett. 374, 152-156
27. Nguyen, N. Y., and Chrambach, A. (1981) in Gel Electrophoresis of Proteins (Hames, B. D. , and Rickwood, D., eds) , pp. 150-151, IRL Press at Oxford University Press, Oxford
28. Souciet, G., Dietrich, A., Colas, B., Razafimahatratra, P., and Weil, J. H. (1982) J. Biol. Chem. 257, 9598-9604
29. Dietrich, A., Maréchal-Drouard, L., Carneiro, V., Cosset, A., and Small, I. (1996) Plant J. 10, 913-918
30. Duchêne, A. M., and Dietrich, A. (1997) Plant Physiol. 115, 1730
31. Newman, T., de Bruijn, F., Keegstra, K., Kende, H., McIntosh, L., Ohlrogge, J., Raikhel, N., Somerville, S., Thomashow, M., Retzel, E., and Somerville, C. (1994) Plant Physiol. 106, 1241-1255
32. The Arabidopsis Genome Initiative. (2000) Nature 408, 796-815
33. Mudge, S. J., Williams, J. H., Eyre, H. J., Suthereland, G. R., Cowan, P. J., and Power, D. A. (1998) Gene 209, 45-50
34. Shiba, K., Schimmel, P., Motegi, H., and Noda, T. (1994) J. Biol. Chem. 269, 30049-30055
35. Turner, R. J., Lovato, M., and Schimmel, P. (2000) J. Biol. Chem. 275, 27681-27688
36. Uwer, U., Willmitzer, L., and Altmann, T. (1998) Plant Cell 10, 1277-1294
37. Joyce, P., and Gray, M. (1989) Nucleic Acids Res. 17, 5461-5476
38. Björk, G. R. (1995) in tRNA: Structure, Biosynthesis, and Function (Söll, D. , and RajBhandary, U., eds) , pp. 165-205, American Society for Microbiology (ASM), Washington, D. C.
39. Giegé, R., Sissler, M., and Florentz, C. (1998) Nucleic Acids Res. 26, 5017-5035
40. Nameki, N., Tamura, K., Asahara, H., and Hasegawa, T. (1997) J. Mol. Biol. 268, 640-647
41. Struglics, A., and Hakansson, G. (1999) Eur. J. Biochem. 262, 765-773
42. Struglics, A., Fredlund, K. M., Konstantinov, Y. M., Allen, J. F., and Moller, I. M. (2000) FEBS Lett. 475, 213-217
43. Millar, A. H., Knorpp, C., Leaver, C. J., and Hill, S. A. (1998) Biochem. J. 334, 571-576
44. Millar, A. H., Leaver, C. J., and Hill, S. A. (1999) Eur. J. Biochem. 264, 973-981
45. Shipton, C. A., Parmryd, I., Swiezewska, E., Andersson, B., and Dallner, G. (1995) J. Biol. Chem. 270, 566-572
46. Rhoads, D. M., Umbach, A. L., Sweet, C. R., Lennon, A. M., Rauch, G. S., and Siedow, J. N. (1998) J. Biol. Chem. 273, 30750-30756
47. von Stedingk, E., Pavlov, P. F., Grinkevich, V. A., and Glaser, E. (1999) Plant. Mol. Biol. 41, 505-515
48. Mahapatra, S., Ghosh, S., Kanti Bera, S., Ghosh, T., Das, A., and Adhya, S. (1998) Nucleic Acids Res. 26, 2037-2041
49. Tarassov, I., and Martin, R. (1996) Biochimie (Paris) 78, 502-510
50. Lund, E., and Dahlberg, J. E. (1998) Science 282, 2082-2085
51. Sarkar, S., Azad, A. K., and Hopper, A. K. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 14366-14371
52. Gaume, B., Klaus, C., Ungermann, C., Guiard, B., Neupert, W., and Brunner, M. (1998) EMBO J. 17, 6497-6507
53. Huang, S., Ratliff, K. S., Schwartz, M. P., Spenner, J. M., and Matouschek, A. (1999) Nat. Struct. Biol. 6, 1132-1138
54. Voisine, C., Craig, E. A., Zufall, N., von Ahsen, O., Pfanner, N., and Voos, W. (1999) Cell 97, 565-574
55. Yanovfsky, C., Konan, K. V., and Sarsero, J. P. (1996) Biochimie (Paris) 78, 1017-1024
56. Lambowitz, A. M., and Perlman, P. S. (1990) Trends Biochem. Sci. 15, 440-444
57. Magrath, C., and Hyman, L. E. (1999) Genetics 152, 129-141


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. Fender, C. Sauter, M. Messmer, J. Putz, R. Giege, C. Florentz, and M. Sissler
Loss of a Primordial Identity Element for a Mammalian Mitochondrial Aminoacylation System
J. Biol. Chem., June 9, 2006; 281(23): 15980 - 15986.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
P. Pesaresi, S. Masiero, H. Eubel, H.-P. Braun, S. Bhushan, E. Glaser, F. Salamini, and D. Leister
Nuclear Photosynthetic Gene Expression Is Synergistically Modulated by Rates of Protein Synthesis in Chloroplasts and Mitochondria
PLANT CELL, April 1, 2006; 18(4): 970 - 991.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A.-M. Duchene, A. Giritch, B. Hoffmann, V. Cognat, D. Lancelin, N. M. Peeters, M. Zaepfel, L. Marechal-Drouard, and I. D. Small
Dual targeting is the rule for organellar aminoacyl-tRNA synthetases in Arabidopsis thaliana
PNAS, November 8, 2005; 102(45): 16484 - 16489.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-K. Kim, J.-Y. Lee, H. S. Cho, S. S. Lee, H. J. Ha, S. Kim, D. Choi, and H.-S. Pai
Inactivation of Organellar Glutamyl- and Seryl-tRNA Synthetases Leads to Developmental Arrest of Chloroplasts and Mitochondria in Higher Plants
J. Biol. Chem., November 4, 2005; 280(44): 37098 - 37106.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
I. Heilmann, M. S. Pidkowich, T. Girke, and J. Shanklin
From the Cover: Switching desaturase enzyme specificity by alternate subcellular targeting
PNAS, July 13, 2004; 101(28): 10266 - 10271.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
L. Delage, A. Dietrich, A. Cosset, and L. Marechal-Drouard
In Vitro Import of a Nuclearly Encoded tRNA into Mitochondria of Solanum tuberosum
Mol. Cell. Biol., June 1, 2003; 23(11): 4000 - 4012.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
T. Shikanai, P. Muller-Moule, Y. Munekage, K. K. Niyogi, and M. Pilon
PAA1, a P-Type ATPase of Arabidopsis, Functions in Copper Transport in Chloroplasts
PLANT CELL, June 1, 2003; 15(6): 1333 - 1346.
[Abstract] [Full Text]


Home page
J. Cell Sci.Home page
S. M. Chabregas, D. D. Luche, M.-A. Van Sluys, C. F. M. Menck, and M. C. Silva-Filho
Differential usage of two in-frame translational start codons regulates subcellular localization of Arabidopsis thaliana THI1
J. Cell Sci., January 15, 2003; 116(2): 285 - 291.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. Laloi, N. Rayapuram, Y. Chartier, J.-M. Grienenberger, G. Bonnard, and Y. Meyer
Identification and characterization of a mitochondrial thioredoxin system in plants
PNAS, November 20, 2001; 98(24): 14144 - 14149.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/18/15275    most recent
M011525200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Duchêne, A.-M.
Right arrow Articles by Wintz, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Duchêne, A.-M.
Right arrow Articles by Wintz, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement