|
Originally published In Press as doi:10.1074/jbc.M011525200 on February 2, 2001
J. Biol. Chem., Vol. 276, Issue 18, 15275-15283, May 4, 2001
Overlapping Destinations for Two Dual Targeted Glycyl-tRNA
Synthetases in Arabidopsis thaliana and Phaseolus
vulgaris*
Anne-Marie
Duchêne §,
Nemo
Peeters¶,
André
Dietrich ,
Anne
Cosset ,
Ian D.
Small¶, and
Henri
Wintz
From the Institut de Biologie Moléculaire des
Plantes du CNRS, Université, CNRS Université Louis
Pasteur, 12 Rue du Général Zimmer,
F-67084 Strasbourg Cedex, France and the ¶ Station de
Génétique et d'Amélioration des Plantes, Institut
National de la Recherche Agronomique, Route de St.-Cyr,
F-78026 Versailles Cedex, France
Received for publication, December 20, 2000, and in revised form, February 1, 2001
 |
ABSTRACT |
In plant mitochondria, some of the tRNAs are
encoded by the mitochondrial genome and resemble their prokaryotic
counterparts, whereas the remaining tRNAs are encoded by the nuclear
genome and imported from the cytosol. Generally, mitochondrial
isoacceptor tRNAs all have the same genetic origin. One known exception
to this rule is the group of tRNAGly isoacceptors in
dicotyledonous plants. A mitochondrion-encoded tRNAGly and at least one nucleus-encoded
tRNAGly coexist in the mitochondria of these plants, and
both are required to allow translation of all four GGN glycine
codons. We have taken advantage of this atypical situation to address
the problem of tRNA/aminoacyl-tRNA synthetase coevolution in plants. In
this work, we show that two different nucleus-encoded glycyl-tRNA
synthetases (GlyRSs) are imported into Arabidopsis thaliana
and Phaseolus vulgaris mitochondria. The first one,
GlyRS-1, is similar to human or yeast glycyl-tRNA synthetase, whereas
the second, GlyRS-2, is similar to Escherichia coli
glycyl-tRNA synthetase. Both enzymes are dual targeted, GlyRS-1 to
mitochondria and to the cytosol and GlyRS-2 to mitochondria and
chloroplasts. Unexpectedly, GlyRS-1 seems to be active in the cytosol
but inactive in mitochondrial fractions, whereas GlyRS-2 is likely to
glycylate both the organelle-encoded tRNAGly and the
imported tRNAGly present in mitochondria.
 |
INTRODUCTION |
Aminoacyl-tRNA synthetases
(aaRSs)1 play a crucial role
in protein synthesis by catalyzing the addition of amino acids to their cognate tRNAs. In plants, protein synthesis occurs in three cellular compartments: the cytosol, the mitochondria, and the chloroplasts. All
tRNAs and aaRSs necessary for mRNA translation have to be present in
these three compartments. In photosynthetic plants, cytosolic tRNAs are
all nucleus-encoded, and chloroplastic tRNAs are all
chloroplast-encoded (1). By contrast, plant mitochondrial tRNAs have
several genetic origins. Some are nucleus-encoded and imported from the
cytosol. The others are mitochondrion-encoded and show 70-75%
identity with their prokaryotic counterparts and less than 60%
identity with their cytosolic counterparts. These mitochondrion-encoded
tRNAs are of two types: the "native" tRNAs derived from authentic
mitochondrial tRNA genes and the "chloroplast-like" tRNAs that are
97-100% identical to their chloroplast counterparts. The genes
corresponding to the latter originated from the chloroplast and were
inserted into the mitochondrial genome during evolution. The number of
tRNAs in each category (imported, native, or chloroplast-like) and their identity can vary from one plant species to another (2,
3).
Higher plant aaRSs are all encoded by the nuclear genome and
post-translationally addressed to the different subcellular
compartments. The fidelity of translation relies in part on the
specificity of the aminoacylation reaction catalyzed by the aaRSs.
Thus, strong coevolution is expected between the aaRSs and their
cognate tRNAs (4, 5). A few plant genes coding for mitochondrial aaRSs have been characterized, and it appears that the aaRSs used in mitochondrial translation have, in general, the same genetic origin as
their substrate tRNAs. This is the case for tRNAsAla,
tRNAsThr, and tRNAsVal and their cognate aaRSs
in Arabidopsis thaliana. These tRNAs are most likely to be
imported from the cytosol into mitochondria in A. thaliana,
because the corresponding genes are absent from the mitochondrial
genome (6), and they were shown to be imported into mitochondria in
other plants such as potato (3). Similarly, cytosolic alanyl-tRNA
synthetase (7), threonyl-tRNA synthetase, and valyl-tRNA synthetase (8)
are also imported into mitochondria. In all three cases, the
mitochondrial form and the cytosolic form of the enzyme are encoded by
the same gene. Similarly, dual targeting to mitochondria and
chloroplasts was observed for methionyl- (9), histidyl- (10),
cysteinyl-, and asparaginyl-tRNA synthetase (11), whereas the
corresponding mitochondrial tRNAs were shown to be encoded by native
(initiator tRNAMet, tRNACys) or
chloroplast-like (elongator tRNAMet, tRNAHis,
tRNAAsn) genes present in the mitochondrial genome (6).
An organelle-encoded native tRNAGly(GCC) is present
in mitochondria of the dicotyledonous plants A. thaliana (6,
12), potato (Solanum tuberosum) (13), and common bean
(Phaseolus vulgaris) (14). Because this tRNA cannot read all
four GGN glycine codons, at least one other tRNAGly
is required in mitochondria for translation to occur, and a
tRNAGly(UCC) was shown to be imported from the
cytosol into S. tuberosum and P. vulgaris
mitochondria (14). Coexistence of imported and organelle-encoded
isoacceptor tRNAs in mitochondria has been reported only in a very few
cases, i.e. tRNAsIle in higher plants (2) and
tRNAsIle, tRNAsThr, and tRNAsVal in
Marchantia polymorpha (15). The presence of isoacceptor tRNAs with different genetic origins in plant mitochondria raises the
problem of the coevolution between tRNAs and aaRSs. In this work, we
show that, along with the coexistence in the organelles of a cytosolic
and a native mitochondrial tRNAGly, two different
glycyl-tRNA synthetases are imported into mitochondria in
dicotyledonous plants. Both are dual targeted proteins, one to the
cytosol and mitochondria (called glycyl-tRNA synthetase-1 (GlyRS-1))
and the other to chloroplasts and mitochondria (called GlyRS-2).
Unexpectedly, GlyRS-1 was shown to be active in the bean cytosol but
not in mitochondria, whereas GlyRS-2 was able to aminoacylate either
nuclearly or mitochondrially encoded tRNAsGly.
 |
EXPERIMENTAL PROCEDURES |
Inverse PCR--
A. thaliana total DNA was extracted
from whole plants according to Dellaporta et al. (16),
digested with BglII, self-ligated, and used as a template
for PCR amplification (17) with divergent oligonucleotides AM10
(5'-GCGGGATCCGGATCGGAGCGATGGAGATTGGG-3'; the
BamHI site for cloning is underlined) and AM12
(5'-CGCTCTAGAGGCTTCCCGTGCAGCTAAACCAG-3'; the
XbaI site for cloning is underlined) (see Fig.
1A).
Primer Extension--
Total RNA was extracted from 3-week-old
A. thaliana plants (18), and poly(A+) RNA was
prepared using a PolyATtract mRNA isolation system IV kit
(Promega, Madison, WI). Primer extensions were performed with oligonucleotide AM16 (5'-GGATCGGAGCGATGGAGATTGGG-3') (see Fig. 1A) and with 1 µg of poly(A+) RNA or 12 µg
of total RNA (17). Sequencing reactions were primed with
oligonucleotide AM16 (17).
Computer Predictions of Subcellular Targeting--
Predictions
of intracellular targeting of proteins were made using ChloroP,
MITOPROT, Predotar, PSORT, or TargetP.
Isolation of Mitochondria and Chloroplasts--
Isolation of
organelles from A. thaliana plants gave a very poor yield,
and extensive cytosolic contamination was observed. Organelles were
therefore mainly isolated from bean, and to a lesser extent from wheat
and potato. Mitochondria were extracted from 3-week-old A. thaliana plants, from 5-day-old etiolated bean hypocotyls or wheat
plantlets, or from potato tubers in extraction buffers containing 0.6 M mannitol, 0.3 M sucrose, or 0.3 M
mannitol, respectively, as an osmoticum (19) and were purified on
continuous polyvinylpyrrolidone/Percoll gradients (20). For
A. thaliana mitochondria, a second, discontinuous
polyvinylpyrrolidone/Percoll gradient was necessary to reduce cytosolic
contamination (14). Chloroplasts were extracted from leaves of
6-day-old bean plants (21).
For protease treatment, mitochondria were incubated in the presence of
100 µg/ml proteinase K for 5 min at room temperature and 10 min on
ice. Upon addition of 2 mM phenylmethylsulfonyl fluoride,
organelles were recovered by centrifugation through a cushion of 27%
(w/v) sucrose, 20 mM Hepes-KOH, pH 7.5, 1 mM phenylmethylsulfonyl fluoride. For subfractionation, mitochondria were
resuspended in 5 mM potassium phosphate buffer, pH 7.5, and incubated on ice for 20 min to disrupt the outer membrane. Gentle homogenizing with a plunger was applied several times during incubation to help release of the outer membrane. The suspension was subsequently loaded on a 15/32/45/52% sucrose step gradient in a 10 mM
potassium phosphate buffer, pH 7.5, containing 2 mM EDTA
and 0.2% (w/v) bovine serum albumin and centrifuged for 20 min at
125,000 × g. The outer membrane fraction and the
mitoplasts were recovered at the 15/32% interface and the 45/52%
interface, respectively. Both were washed in 10 mM
potassium phosphate, pH 7.5, 0.3 M sucrose, 1 mM EDTA, 0.1% (w/v) bovine serum albumin, 5 mM
glycine and pelleted for 10 min at 175,000 × g.
Mitoplasts were resuspended in the same buffer and disrupted by three
freeze/thaw cycles and two sonication cycles of 10 s. The
suspension was successively centrifuged for 5 min at 2500 × g, to eliminate the remaining undisrupted material, and for
30 min at 175,000 × g, to separate the inner membrane
fraction from the matrix.
Protein Extracts--
Denatured protein extracts for
SDS-polyacrylamide gel electrophoresis were prepared in 10 mM Tris-HCl, pH 7.5, 5 mM EDTA, 0.3% (w/v)
SDS, 5% (v/v) -mercaptoethanol. Enzymatic extracts for
aminoacylation and chromatography were prepared according to
Maréchal-Drouard et al. (22).
Aminoacylation Assays--
Aminoacylations (19) were performed
in the presence of 10 4 M
[3H]glycine and 3 µg/µl yeast or Escherichia
coli total tRNA, 0.15 µg/µl bean total leaf, mitochondrial, or
chloroplastic tRNA (22), or 0.04 µg/µl in vitro
transcribed tRNAGly.
Green Fluorescent Protein (GFP) Targeting
Analysis--
The sequence corresponding to the N terminus of GlyRS-1
(nucleotides 616-810 in Fig. 1A) was amplified by PCR using
the A. thaliana cDNA as a template and oligonucleotides
SIGM.5 (5'-GATCTCTAGAAAAATGCGCATCTTCTCTACA-3'; the
XbaI site is underlined) and SIGM.3
(5'-CATGCTCGAGAGTTACCCTGAGCTTCGAC-3'; the XhoI
site is underlined). To fuse this sequence with the GFP gene, the PCR
products were cloned into the SpeI/SalI sites of pOL-GFP-S65C (11), generating pSYGM in which the first AUG of the
GlyRS-1 sequence was in a favorable context for initiation of
translation. The sequence corresponding to the N terminus of GlyRS-2
(GenBankTM accession number AJ003069, nucleotides
32-275) was amplified by PCR using A. thaliana total DNA as
a template and oligonucleotides SIGO.5
(5'-GATCTCTAGAAAAATGGCCATCCTCCATT-3'; the XbaI
site is underlined) and SIGO.3
(5'-CATGCTCGAGCCTGGAGGCGTTGAA-3'; the XhoI site
is underlined). The PCR products were cloned into the
SpeI/SalI sites of pOL-GFP-S65C, generating
pSYGO. The complete expression cassette containing the cauliflower
mosaic virus 35S promoter, the GFP fusion, and the cauliflower mosaic
virus 35S terminator was cut out of pSYGM and pSYGO with
HindIII and cloned into the binary vector pGPTV-kan (23).
The resulting plasmids, pNP7 and pNP8, respectively, were used to
transform the Agrobacterium tumefaciens LBA4404 strain (Life
Technologies, Inc.).
Transformation was performed by infiltration of Nicotiana
benthamiana leaves (24) with a suspension of A. tumefaciens carrying pNP7 or pNP8. After 25-30 h, protoplats were
prepared (25) from the infiltrated leaves. Protoplasts were stained
with a mitochondria-specific dye (MitoTrackerTM, CMTMRos,
Molecular Probes, Eugene, OR) and analyzed using an epifluorescence
microscope (9).
In Vitro Import into Isolated Mitochondria--
The sequence
corresponding to the N terminus of GlyRS-1 (nucleotides 616-742 in
Fig. 1A) was first amplified by PCR using the A. thaliana cDNA clone as a template and oligonucleotides AM26
(5'-CGCGCCATGGGCATCTTCTCTACATTCGTCTTTCATCGC-3'; the
NcoI site is underlined) and AM36
(5'-CGCGGATCCTCGGCGTCAATCGGAATCTGGATC-3'; the
BamHI site is underlined). This introduced a point
mutation at position 735, replacing the second AUG codon with an AUU
isoleucine codon. The PCR products were cloned into the
NcoI/BamHI sites of pCK-GFP3 (9), yielding a GFP
fusion. The obtained plasmid was named pAM160. The
EcoRI/HindIII fragments from pAM160 and pSYGO
(see above), which contained the tobacco etch virus translation leader,
the GlyRS-1 or GlyRS-2 N terminus, the GFP gene, and the cauliflower
mosaic virus 35S terminator, were cloned into pBlueScript-KS (Stratagene, La Jolla, CA). These constructs were used as templates for
in vitro transcription/translation carried out with a
TNTTM coupled reticulocyte lysate system (Promega)
in the presence of [35S]methionine. Import of
35S-labeled fusion proteins into purified potato
mitochondria was performed according to Wischmann and Schuster (26) and
analyzed by SDS-polyacrylamide gel electrophoresis.
Overexpression of GlyRS-1 in E. coli--
The sequence of the
cytosolic form (690 amino acids) of GlyRS-1 was amplified by PCR using
the A. thaliana cDNA as a template and oligonucleotides
AM19 (5'-CGCGCCATGGACGCCACCGAGCAGTCTCTC-3'; the
NcoI site is underlined) and AM20
(5'-GGCGGATCCGTCTGCAGCAGCAGAAGAATG-3'; the BamHI
site is underlined) and cloned into pQE60 (Qiagen, Hilden, Germany). The resulting plasmid, pAM147, was used to transform the
E. coli TG2 strain (17). Overexpression in E. coli was induced with 2 mM
isopropyl-1-thio- -D-galactopyranoside. Protein
extraction under denaturing conditions was performed according to the
manufacturer's instructions. Extracts were fractionated by
SDS-polyacrylamide gel electrophoresis. The polypeptide corresponding
to GlyRS-1 was electroeluted from the gels (27) and injected into
rabbits to raise antibodies. Alternately, native enzymatic extracts
(22) were prepared from the E. coli strain overexpressing
GlyRS-1 and used for liquid chromatography fractionation.
Western Blot Analysis--
Proteins were separated by
SDS-polyacrylamide gel electrophoresis, electrotransferred onto
ImmobilonTM-P membranes (Millipore, Bedford, MA), and
submitted to immunological detection following classical protocols
(17). Antisera were used at a 1/5000 dilution. Antibodies against
mitochondrial superoxide dismutase were a gift from Dirk Inzé
(Gent, Belgium), and antibodies against -tubulin were from Amersham
Pharmacia Biotech. Antisera against bean chloroplastic leucyl-tRNA
synthetase were obtained previously (28). Binding of the primary
antibodies was revealed by chemiluminescence using
peroxidase-conjugated secondary antibodies and ECL reagents (Amersham
Pharmacia Biotech).
Liquid Chromatography--
Enzymatic extracts were fractionated
by medium pressure chromatography on a 1-ml POROS 20 PE hydrophobic
column (PerSeptive Biosystems, Framingham, MA) driven by a BioLogic
integrated system (Bio-Rad). The samples (1 mg of proteins) adjusted to
1.5 M ammonium sulfate were loaded at 1 ml/min on the
column equilibrated with a 20 mM Tris-HCl buffer, pH 7.5, containing 1.5 M ammonium sulfate, 1 mM
MgCl2, 5% (v/v) 1,2-propanediol, 0.1 mM EDTA,
5 mM -mercaptoethanol, 0.5 mM
phenylmethylsulfonyl fluoride, 0.5 mM
diisopropylfluorophosphate. After washing with the same buffer (5 ml),
elution was performed at 1 ml/min with a linear ammonium sulfate
gradient (10 ml, 1.5 to 0 M). Fractions of 0.33 ml were
collected, and aliquots were submitted to aminoacylation assays and
Western blot analyses.
Enzymatic extracts were also fractionated on a 1.3-ml
UNOTM-Q1 anion exchange column (Bio-Rad). The samples were
loaded at 0.5 ml/min on the column equilibrated with a 20 mM Tris-HCl buffer, pH 7.5, containing 10 mM
NaCl, 1 mM MgCl2, 5% (v/v) 1,2-propanediol, 0.1 mM EDTA, 5 mM -mercaptoethanol, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM
diisopropylfluorophosphate. Elution was performed at 0.7 ml/min with a
15-ml linear gradient from 10 to 500 mM NaCl, followed by a
5-ml linear gradient from 500 to 1000 mM NaCl. Fractions of
0.5 ml were collected.
Preparation of tRNA Transcripts--
Constructs encoding
tRNAsGly were amplified by PCR with the relevant primers
(see below) so that the tRNA gene sequence was directly fused to
the T7 RNA polymerase promoter at the 5' terminus and to a
BstNI site at the 3' terminus. PCR products were cloned into the EcoRI or EcoRI/BamHI sites of
pUC19. After BstNI digestion, in vitro
transcription of these constructs with T7 RNA polymerase yielded mature
sized, unmodified tRNA transcripts with a 3' CCA end (29). The
following oligonucleotides were used as primers (EcoRI and
BamHI sites are underlined; the T7 RNA polymerase promoter or BstNI site is in italics): for mitochondrial native
tRNAGly(GCC), 5'
AGCAAGAATTCGAATTGTAATACGACTCACTATAGCGGAAATAGCTTAATGGTAG 3' and 5'
GTACAGAATTCCCTGGAGCGGAAGGAGGGACTTGAAC
3'; for cytosolic tRNAGly(GCC), 5'
AGCAAGAATTCGAATTGTAATACGACTCACTATAGCACCAGTGGTCTAGTGGTAG 3' and 5' GTACAGAATTCCCTGGTGCACCAGCCGGGAATCGAAC
3'; for cytosolic tRNAGly(UCC), 5'
GCAAGAATTCGAATTGTAATACGACTCACTATAGCGTCTGTAGTCCAACGGTTAG 3' and 5' CGCGGATCCTGGTGCGTCTGCCGGGAGTCGAAC 3'.
 |
RESULTS |
Characterization of an A. thaliana Eukaryotic-type GlyRS,
GlyRS-1--
By analysis of cDNAs and inverse PCR products, we
characterized a eukaryotic-type GlyRS gene in A. thaliana
(GenBankTM accession number AJ002062) (30), and we
termed this gene GlyRS-1. For this, an A. thaliana cDNA library (Strasbourg, France) was screened using
as a probe an A. thaliana expressed sequence tag
clone (GenBankTM accession number 117F7T7) (31)
showing similarity with known GlyRS genes. Several incomplete
cDNAs, lacking the 5' end, were recovered from this screening. The
5' region of the gene (Fig. 1A) was cloned from A. thaliana genomic DNA by using inverse PCR. Southern blot analysis
(17) of total A. thaliana DNA digested with PstI,
BglII, or EcoRI suggested that the
GlyRS-1 gene is a single copy gene (data not shown), which
was confirmed with the availability of the complete A. thaliana genomic sequence ((32); see the Arabidopsis
Genome Initiative web site). A second gene showing similarities
with GlyRS-1 and other eukaryotic GlyRS sequences was
previously identified in the A. thaliana genome (GenBankTM accession number AC002534). However, this
second gene was considered to be a pseudogene, because the sequence is
partial, it contains a number of frameshifts, and no corresponding
expressed sequence tags could be detected.

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 1.
Structure and expression of the A. thaliana GlyRS-1 gene. The 5' end and upstream region
of the GlyRS-1 gene are presented in A. Mapped 5'
ends of transcripts (+1) and positions of initiation codons
(ATG) are underlined. The sequences corresponding to
oligonucleotides AM12 and AM10/AM16 are also underlined.
Primer extension analysis of the GlyRS-1 mRNA
(B) was performed with AM16 and with 12 µg of total
(lane 1) or 1 µg of poly(A+)
(lane 2) A. thaliana RNA. Arrows
indicate the major products synthesized. A sequencing ladder is shown
on the right.
|
|
The full GlyRS-1 coding sequence is 729 amino acids
long. It is similar to other known eukaryotic GlyRS sequences (more
than 45% amino acid identity and 60% similarity with Homo
sapiens, Bombyx mori, and Caenorhabditis
elegans GlyRS sequences) and presents no obvious similarity with
prokaryotic GlyRS sequences such as the E. coli GlyRS,
suggesting a cytosolic localization. A multiple alignment of GlyRS
sequences is available on our web site devoted to A. thaliana tRNAs and aminoacyl-tRNA synthetases (web site address
available from the corresponding author). The high level of similarity
between GlyRS-1 and eukaryotic GlyRSs suggests that the native enzyme
probably has an 2 quaternary structure, like other
eukaryotic GlyRSs. The presence of a mitochondrial targeting peptide at
the N-terminal end of the coding sequence was predicted by computer
analysis. MITOPROT, Predotar, PSORT, and TargetP gave a score of 0.88, 0.90, 0.76, and 0.91, respectively, for a mitochondrial localization.
Alignment of the GlyRS-1 amino acid sequence with that of the other
GlyRS sequences starts around the end of the potential targeting
sequence. It should also be noticed that a dual localization in the
cytosol and in mitochondria was proposed for two homologs of GlyRS-1,
in humans (33, 34) and in Saccharomyces cerevisiae (35).
Expression of the GlyRS-1 gene was investigated by primer
extension. The results shown in Fig. 1B indicate that there
are two major transcripts with different 5' ends that map 22 nucleotides upstream and 15 nucleotides downstream, respectively, of
the first putative AUG initiation codon. The sequence shows a second
in-frame AUG, 40 codons downstream of the first initiator AUG. This
second AUG maps near the position corresponding to the C-terminal end of the predicted mitochondrial targeting peptide. The 5' end of the
shortest mRNA is located upstream of the second in-frame AUG codon,
which could thus be used to initiate translation on this transcript,
leading to the synthesis of a short, cytosolic form of GlyRS-1 (690 amino acids, 76 kDa). Translation of the long transcript could generate
a long protein (729 amino acids, 80 kDa) with a putative mitochondrial
targeting peptide.
Reexamination of a Second A. thaliana GlyRS Gene (GlyRS-2)--
An
expressed GlyRS gene of prokaryotic-type (GenBankTM
accession number AJ003069) was characterized by Uwer et al.
(36) upon analysis of an A. thaliana embryo development
mutant due to a unique insertion of a DsA transposable
element. The corresponding protein, which is 1068 amino acids long, has
no significant similarity with GlyRS-1 but presents regions similar to
the and subunits of E. coli GlyRS (59% identity
with the subunit and 36% identity with the subunit), so that a
dimeric structure of GlyRS-2 would reflect the tetrameric
2 2 structure of E. coli GlyRS.
An alignment of the GlyRS-2 sequence with other GlyRS sequences is also
available on our web site. Prediction of the subcellular localization
run with ChloroP, Predotar, and TargetP gave a score of 0.57, 0.98, and
0.82, respectively, for a chloroplastic localization of GlyRS-2, and
this enzyme was indeed shown to be imported into chloroplasts (36).
However, the corresponding GlyRS mutant has an embryo lethal phenotype.
Embryo growth was stopped between the globular and heart stages of
embryonic development, and germination of mutant seeds was never
observed. Such a phenotype was not expected for a plastid enzyme, and
the function of this GlyRS during plastidic translation does not
provide a direct hint to its role during embryogenesis (36). Indeed,
Uwer et al. (36) did not exclude another
localization, and further prediction analyses with MITOPROT gave a
score of 0.95 for a mitochondrial localization of GlyRS-2. With PSORT,
no clear prediction for mitochondrial or chloroplastic targeting was obtained.
Subcellular Localization of GlyRS-1 and GlyRS-2 as Implied by
Targeting of GFP Fusions--
As an in vivo approach to
analyze the intracellular localization of GlyRS-1, the sequence
encoding the first 65 amino acids of this enzyme was fused upstream to,
and in frame with, an enhanced jellyfish (Aequorea
victoria) GFP reporter gene. When transiently expressed in
N. benthamiana cells, this construct yielded fluorescence associated with mitochondria (Fig. 2,
panels 2a and 2b), demonstrating that the N
terminus of GlyRS-1 is an active mitochondrial targeting peptide
in vivo.

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 2.
Expression of GFP fusions in N. benthamiana cells. Fluorescence was observed at × 100 magnification with a Nikon Eclipse E800 epifluorescence microscope.
In panels 1, 2a, and 3a, GFP
fluorescence was observed using a GFP band pass filter set (excitation,
460-500 nm; band pass emission, 510-560 nm). In panel
3c, red chlorophyll autofluorescence was observed using a long
pass filter set (excitation, 460-500 nm; long pass emission,
510 nm). In panels 2b and 3b, fluorescence of the
mitochondria-specific dye (MitoTrackerTM) was observed
using a TRITC filter set (excitation, 540/25 nm; emission,
605/55 nm). Panel 1 corresponds to unfused GFP. Panels
2a and 2b correspond to the GlyRS-1 N
terminus-GFP fusion. Panels 3a, 3b, and
3c correspond to the GlyRS-2 N terminus-GFP fusion.
|
|
Because potential dual targeting of GlyRS-2 to mitochondria and
chloroplasts was predicted by computer analyses, a similar approach was
developed for this enzyme. The sequence encoding the first 81 amino
acids of the GlyRS-2 polypeptide was fused in frame to the 5' end of
the GFP gene. When this construct was expressed in N. benthamiana cells, fluorescence was associated with both
chloroplasts and mitochondria (Fig. 2, panels 3a,
3b, and 3c), indicating that the GlyRS-2
presequence is able to promote dual targeting to both organelles
in vivo.
Mitochondrial Localization of GlyRS-1 and GlyRS-2 as Implied by in
Vitro Import into Isolated Mitochondria--
The large size of the
GlyRS-1 (80 kDa) and GlyRS-2 (117 kDa) polypeptides was expected to be
unfavorable both for coupled in vitro
transcription/translation and for in vitro import into mitochondria. Thus, these experiments were carried out with constructs corresponding to fusions between the GlyRS N-terminal sequences and
GFP. In vitro transcription/translation of the chimeric
genes yielded a 32-kDa fusion protein for the GlyRS-1 construct (Fig. 3A, lane 1) and a
35-kDa product for the GlyRS-2 construct (Fig. 3B,
lane 1). In the presence of mitochondria, these products
were partially processed into polypeptides of 27 and 30 kDa,
respectively (Fig. 3, A and B, lane
2), which corresponded to the Mr of
the fusion proteins upon cleavage of the predicted GlyRS targeting sequence. The addition of proteinase K to the import medium reduced the
signals corresponding to the preproteins but did not affect the signals
corresponding to the processed proteins that were protected (Fig. 3,
A and B, lane 3). The addition of
valinomycin, which is known to inhibit mitochondrial protein import,
prevented the formation of the processed proteins (Fig. 3, A
and B, lanes 4 and 5). When the same
experiment was performed with unfused GFP, no interaction with
mitochondria was observed, because no labeled protein was associated
with mitochondria after incubation and centrifugation through a sucrose
cushion (data not shown). These results showed that the GlyRS-1 and
GlyRS-2 presequences can promote in vitro protein import
into isolated mitochondria.

View larger version (68K):
[in this window]
[in a new window]
|
Fig. 3.
In vitro protein import into isolated
mitochondria. The GlyRS-1 N terminus-GFP fusion (A) and
the GlyRS-2 N terminus-GFP fusion (B) were in
vitro translated (lane 1) and incubated for 30 min at
25 °C with mitochondria (lanes 2-5). Mitochondria were
treated with valinomycin prior to import (lanes 4 and
5) and/or submitted to proteinase K digestion after import
(lanes 3 and 5). Migration of the chimeric
preproteins (pre) and of the processed polypeptides
(m) is indicated.
|
|
Subcellullar Localization of GlyRS-1 as Deduced from Western Blot
Analysis--
The cytosolic form of GlyRS-1 was overexpressed in
E. coli and purified to raise polyclonal antibodies. Western
blots were performed with A. thaliana total and
mitochondrial proteins. Cross-contaminations were checked with antisera
against mitochondrial superoxide dismutase (Fig.
4IB) for mitochondrial
contamination or -tubulin (Fig. 4IC) for cytosolic
contamination. An immunoreactive protein of about 76 kDa was detected
both in total and in mitochondrial protein extracts when using the
antiserum against GlyRS-1 (Fig. 4IA). The size of the
detected protein was in accordance with the calculated Mr of the cytosolic form and the processed
mitochondrial form of the enzyme. Faster migrating polypeptides
revealed with the GlyRS-1 antiserum in mitochondrial extracts (Fig.
4IA) might reflect some degradation.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 4.
Western blot analyses. Immunodetection
of GlyRS-1 (A), mitochondrial superoxide dismutase
(B), -tubulin (C), and chloroplastic
leucyl-tRNA synthetase (D) was performed with total
(pt) and mitochondrial (mt) protein extracts from
A. thaliana plantlets (panel I), with bean total
leaf (lt), total hypocotyl (ht), chloroplastic
(cp), and mitochondrial protein extracts (panel
II), with protein extracts from untreated ( K) and
proteinase K-treated (+K) bean mitochondria (panel
III), and with total (t), soluble (s),
membrane (m), inner membrane (im), or outer
membrane (om) protein extracts from bean mitochondria or
mitoplasts (panel IV). The chemiluminescence reaction in
panel IIIC was developed for a much longer time to visualize
residual contamination of mitochondrial proteins with
-tubulin.
|
|
An immunoreactive protein of the same size was also found in the
cytosol and in mitochondria when using bean total and mitochondrial enzymatic extracts in Western blot analyses with the GlyRS-1 antiserum (Fig. 4IIA). This observation implies that a homolog of
A. thaliana GlyRS-1 is present in bean and is dual targeted
to the cytosol and to mitochondria, although it does not completely
exclude the possibility that the cytosolic form and the
mitochondrial form derive from two highly similar genes in bean.
Cross-contaminations between cytosolic and mitochondrial extracts were
checked as before (Fig. 4, IIB and IIC), whereas
chloroplastic contamination was checked with an antiserum against
chloroplast leucyl-tRNA synthetase (Fig. 4IID). Based on
these observations, further experiments were developed with protein
extracts from bean, because isolation of clean A. thaliana
mitochondria was quite inefficient. Isolated bean mitochondria were
treated with proteinase K before protein extraction. Such a treatment
strongly reduced residual cytosolic contamination, as checked by
immunodetection with the -tubulin antiserum (Fig. 4IIIC),
but did not affect the signal obtained with the antibodies against
GlyRS-1 (Fig. 4IIIA), confirming that GlyRS-1 was present
inside mitochondria. Submitochondrial localization of GlyRS-1 was then
analyzed. Isolated bean mitochondria were lysed, and total membranes
were separated from the soluble fraction by centrifugation. GlyRS-1 was
essentially detected in the soluble fraction by Western blot analysis
(Fig. 4IV). Finally, mitochondria were submitted to an
osmotic shock to release the outer membrane, which was separated from
the remaining mitoplasts on a step gradient. Lysis of the mitoplasts
and centrifugation allowed us to recover the matrix and the inner
membrane fraction. GlyRS-1 was found only in the matrix fraction and
was not significantly associated with the outer membrane or the inner
membrane (Fig. 4IV).
Subcellular Localization of GlyRS-1 and GlyRS-2 as Assessed by
Chromatographic Fractionation--
Following Western blot analysis
(Fig. 4II), the enzymatic extracts from bean leaves,
mitochondria and chloroplasts, as well as an enzymatic extract from an
E. coli strain overexpressing the cytosolic form of A. thaliana GlyRS-1, were fractionated by chromatography on a
hydrophobic column (POROS 20 PE) in standardized conditions. Proteins
were eluted with a decreasing ammonium sulfate gradient. Collected
fractions were tested for GlyRS activity using E. coli or
yeast tRNAs and [3H]glycine as substrates and submitted
to immunodetection with the antiserum against GlyRS-1. The activity of
the overexpressed GlyRS-1 reached its maximum in fractions 12-14 of
the elution profile and was followed by a second peak corresponding to
E. coli GlyRS (Fig.
5A). GlyRS-1 efficiently
glycylated yeast tRNAs but very poorly glycylated E. coli
tRNAs. Two peaks of GlyRS activity were also obtained with enzymatic
extracts from bean leaves (Fig. 5B). The first peak matched
the elution of the overexpressed GlyRS-1 (Fig. 5A), reaching
its maximum with fractions 13/14 and showing efficient glycylation of
yeast tRNAs versus E. coli tRNAs. The presence of
the bean GlyRS-1 in these fractions was confirmed by Western blot
analysis using anti-GlyRS-1 antibodies (Fig. 5C). It should
be noted that the high ammonium sulfate concentrations present in the
fractions at that point of the gradient were inhibitory for
aminoacylation, and desalting of fractions 12-15 resulted in a 7-fold
higher activity. The second peak of GlyRS activity, which reached its
maximum with fractions 29/30, corresponded to glycylation of either
yeast or E. coli tRNAs, with a more efficient recognition of
the latter (Fig. 5B). Similar results were obtained with an
enzymatic extract from green A. thaliana plantlets (data not
shown), thus validating the use of bean for these analyses. Chromatographic fractionation of bean chloroplast enzymatic extracts, which were supposed to contain GlyRS-2 (36), on the hydrophobic column
yielded only one peak of GlyRS activity (Fig. 5D),
corresponding to the second peak in the elution profile obtained with
enzymatic extracts from bean leaves. This peak, with a maximum GlyRS
activity in fractions 28-30 and a better recognition of E. coli tRNAs versus yeast tRNAs, was therefore likely to
be representative of GlyRS-2. Finally, the elution profile obtained
upon fractionation of bean mitochondrial enzymatic extracts (Fig.
5E) was the same as for chloroplast extracts, showing only
one peak of GlyRS activity, which matched the presumed GlyRS-2 elution.
Together with the in vivo targeting analyses (Fig. 2) and
the in vitro import experiments (Fig. 3), these results
imply that GlyRS-2 is dual targeted to both chloroplasts and
mitochondria. Unexpectedly, the peak of GlyRS-1 activity detected upon
fractionation of enzymatic extracts from bean leaves or A. thaliana plantlets could not be recovered upon hydrophobic
chromatography of bean mitochondrial extracts, although in
vivo targeting studies (Fig. 2), in vitro import
experiments (Fig. 3), and Western blot analyses (Fig. 4) had
unambiguously shown the import of GlyRS-1 into mitochondria. Moreover,
the GlyRS-1 protein was clearly detected in the bean mitochondrial
enzymatic extracts prior to chromatographic fractionation (Fig.
4IIA). Probing with the anti-GlyRS-1 antiserum revealed
that, during hydrophobic chromatography of mitochondrial extracts,
elution of the GlyRS-1 polypeptide occurred at the very end of the
fractionation (around fraction 32; Fig. 5F), while washing
the column with buffer devoid of ammonium sulfate, and not in fractions
13/14 as expected (see Fig. 5, B and C). Elution
from this type of column occurs according to the hydrophobic
characteristics of the proteins. From these experiments, it seems that
GlyRS-1 is active and quite hydrophilic in cytosolic extracts but
becomes inactive and hydrophobic in mitochondrial extracts.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 5.
Hydrophobic column chromatography of
GlyRS activities. Fractionation is presented for enzymatic
extracts from an E. coli strain overexpressing GlyRS-1
(A), bean leaves (B and C), bean
chloroplasts (D), and bean mitochondria (E and
F). Column fractions were analyzed for GlyRS activity
(A, B, D, and E) in the
presence of [3H]glycine and yeast total tRNAs
(dotted lines) or E. coli total tRNAs (full
lines) and for reactivity with the antibodies against GlyRS-1 on
Western blots (C and F). T corresponds
to an unfractionated bean total leaf protein extract run as a
control.
|
|
To determine to what extent the above behavior of GlyRS-1 was an effect
due to the hydrophobic column, enzymatic extracts from bean leaves and
mitochondria were fractionated by chromatography on an anion exchange
column (UNO-Q1). As done previously, an enzymatic extract from an
E. coli strain overexpressing the cytosolic form of A. thaliana GlyRS-1 was used as a control. The overexpressed GlyRS-1
was eluted in fractions 9-13 (Fig.
6A). With the bean leaf
extract, two peaks of GlyRS activity were again obtained (Fig.
6B). One peak reached its maximum with fraction 10, matching the elution of GlyRS-1 (Fig. 6A) and showing an efficient
glycylation of yeast tRNAs. The second peak reached its maximum with
fraction 16, with a more efficient glycylation of E. coli
versus yeast tRNAs. Anti-GlyRS-1 antibodies gave a signal
with fractions 10-12 on Western blots (Fig. 6C). This
suggested that the first peak corresponded to GlyRS-1 and the second to
GlyRS-2. With the bean mitochondrial extract, still only one peak of
activity, corresponding to GlyRS-2, was obtained (Fig. 6D).
In this case, the GlyRS-1 polypeptide was detected by Western blotting
in the fractions around fraction 12 (Fig. 6E), as expected
from the profile obtained with the total leaf extract, but no
detectable activity was associated with these fractions even in the
presence of bean total or mitochondrial tRNAs.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 6.
Anion exchanger column chromatography
of GlyRS activities. Fractionation is presented for enzymatic
extracts from an E. coli strain overexpressing GlyRS-1
(A), bean leaves (B and C), bean
mitochondria (D and E), and wheat mitochondria
(F and G). Column fractions were analyzed for
GlyRS activity (A, B, D, and
F) in the presence of [3H]glycine and yeast total tRNAs
(dotted lines) or E. coli total tRNAs (full
lines) and for reactivity with the antibodies against GlyRS-1 on
Western blots (C, E, and G).
T corresponds to an unfractionated bean leaf protein extract
run as a control. For graphical convenience, GlyRS activity values
obtained in the presence of yeast total tRNAs were divided by 3 in
A and 10 in B.
|
|
Based on quantitative analysis of the signals on Western blots, the
absence of GlyRS-1 activity in the chromatographic profiles of
mitochondrial extracts was unlikely to reflect a too weak concentration of the enzyme in the column fractions. The absence of GlyRS-1 activity
could not be explained by an effect of the chromatography, because
similar results were obtained with two different types of column. As a
further step toward understanding these unexpected observations made
with dicotyledons, we switched the analyses to another class of plants.
According to the data available for wheat (Triticum
aestivum) and maize (Zea mays), all mitochondrial tRNAsGly seem to be imported from the cytosol in
monocotyledonous angiosperms (3, 37). An active GlyRS of cytosolic
type, like GlyRS-1, was therefore expected to be present in
mitochondria of monocotyledons, considering substrate specificity and
tRNA/aaRS coevolution. Wheat total (data not shown) and mitochondrial
(Fig. 6, F and G) enzymatic extracts were
prepared and fractionated on the anion exchange column. The same
elution profiles were obtained for both extracts, showing two peaks of
GlyRS activity. The first peak reached its maximum in fraction 12 (Fig.
6F), and the anti-GlyRS-1 antibodies recognized in these
fractions a polypeptide of the expected size (Fig. 6G),
suggesting the existence of an active equivalent of the bean and
A. thaliana GlyRS-1 in wheat, both in the cytosol and in
mitochondria. The inactivation of GlyRS-1 in mitochondrial extracts
therefore appeared not to be a systematic behavior of the enzyme or an
artifact produced by our experimental procedures. However, it was
obvious from the column elution profiles (Fig. 6F) that,
even in wheat, GlyRS-1 makes a very minor contribution to the
total GlyRS activity present in mitochondria. The main activity showed
up as a second peak having its maximum in fractions 15-17. The
shouldered shape of this second peak, the aminoacylation ratio of yeast
versus E. coli tRNAs along the different
fractions, and the fact that recognition of a wheat-specific
polypeptide smaller than GlyRS-1 by the anti-GlyRS-1 antibodies
preferentially matched the second half of the peak (Fig. 6G)
raised the possibility that at least two other forms of GlyRS are
present in wheat mitochondria.
Substrate Specificity of GlyRS-1 and GlyRS-2--
Fractions
containing only GlyRS-1 activity obtained upon chromatography of a bean
total enzymatic extract on either the hydrophobic or the anion exchange
column were used to characterize the tRNA recognition specificity of
GlyRS-1. A bean chloroplast enzymatic extract, which contained only
GlyRS-2, was used to characterize the tRNA recognition specificity of
GlyRS-2. Despite its prokaryotic features revealed by a strong
similarity to the bacterial GlyRS, GlyRS-2 was able to glycylate bean
total (mainly cytosolic), chloroplastic, and mitochondrial tRNAs with
little difference in efficiency (Fig. 7A). Moreover, the
aminoacylation efficiency in the presence of GlyRS-2 was the same for
in vitro transcripts of a mitochondrial tRNAGly(GCC), a cytosolic tRNAGly(UCC), and a
cytosolic tRNAGly(GCC) (Fig. 7C). GlyRS-2 would
therefore be sufficient to charge both the native, organelle-encoded
tRNAGly(GCC) and the imported tRNAGly(UCC) in
mitochondria of dicotyledonous plants, unless post-transcriptional modifications not present in our in vitro transcripts alter
tRNA recognition in vivo (e.g. Ref. 38). By
contrast, aminoacylation of bean chloroplastic or mitochondrial tRNAs
in the presence of GlyRS-1 appeared to be five times less efficient, as
compared with bean total tRNAs (Fig. 7A). GlyRS-1 was also
three times less efficient in glycylating the in vitro
mitochondrial tRNAGly(GCC) transcript versus the
two cytosolic tRNAGly transcripts.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 7.
Aminoacylation assays with partially purified
bean GlyRS fractions. A, relative initial charging rate
of different total tRNA samples (chloro., chloroplasts; mito.,
mitochondria) in the presence of an enzymatic extract containing either
GlyRS-1 or GlyRS-2. Values are expressed relative to the rate obtained
with total bean leaf tRNAs (1 = 1.7 pmol of
[3H]glycyl-tRNA/min) for the tests with GlyRS-1 and to
the rate obtained with total bean chloroplast tRNAs (1 = 4.9 pmol
of [3H]glycyl-tRNA/min) for the tests with GlyRS-2.
Because both enzymatic extracts were only enrichment intermediates, no
conclusion could be drawn as to the relative specific activity of
GlyRS-1 and GlyRS-2. B and C, the activity of
GlyRS-1 (B) or GlyRS-2 (C) was tested in the
presence of [3H]glycine and cytosolic
tRNAGly(UCC) transcript (Cyto(UCC)), cytosolic
tRNAGly(GCC) transcript (Cyto(GCC)), or
mitochondrial tRNAGly(GCC) transcript
(Mito(GCC)).
|
|
 |
DISCUSSION |
In this work, we show that two different GlyRSs are imported into
A. thaliana and P. vulgaris mitochondria.
Moreover, these enzymes are both dual targeted, the first one, GlyRS-1,
to the cytosol and to mitochondria and the second, GlyRS-2, to
chloroplasts and mitochondria, underlining the complexity of the
relations between cell compartments. GlyRS-1 is similar to eukaryotic
enzymes, whereas GlyRS-2 presents similarities with E. coli
GlyRS. This situation is original and puzzling, especially because
GlyRS-1 is imported but inactive in bean mitochondria, and GlyRS-2
appears to be sufficient to charge all tRNAsGly in
mitochondria of dicotyledonous plants. The latter results were
unexpected, considering the identity elements previously defined for
tRNAGly, i.e. position N73, the first three base
pairs of the acceptor stem (1:72, 2:71, 3:70), as well as positions C35
and C36 in the anticodon (39). The most striking difference between
prokaryotic and eukaryotic tRNAsGly is the discriminator
base at position 73, which is phylogenetically conserved as U in
prokaryotes and as A in eukaryotes. In A. thaliana, N73 is a
U in the native mitochondrial tRNAGly and an A in the three
cytosolic tRNAsGly. Because GlyRS-2 is similar to
E. coli GlyRS, the same specificity was expected for these
two enzymes. E. coli GlyRS was shown to aminoacylate
E. coli tRNAGly 18-fold more efficiently than
yeast tRNAGly (40), whereas both tRNAs were good substrates
for plant GlyRS-2. A 73U A mutation in the E. coli
tRNAGly transcript was responsible for an 11-fold loss in
the charging efficiency by E. coli GlyRS (40), but GlyRS-2
does not seem to be sensitive to the nucleotide at position 73. Plant
GlyRS-2 therefore appears to be a prokaryotic-like enzyme with new
specificities. So far, in plant mitochondria, the genetic origin of
aaRSs seemed to coincide with that of their cognate tRNAs, and
cytosolic-like mitochondrial aaRSs were associated with imported
cytosolic tRNAs (7, 8). The prokaryotic-type GlyRS-2 potentially
charges a mitochondrion-encoded tRNAGly and a
nucleus-encoded tRNAGly, and the presence of this somehow
atypical enzyme in mitochondria of dicotyledonous plants reveals new
and complex aspects of tRNA/aaRS coevolution.
Several tentative explanations can be considered to account for the
absence of GlyRS-1 activity in mitochondrial extracts. Among these,
misfolding, or post-translational modification, of the protein during
or after mitochondrial import is a possible cause. Phosphorylation
(e.g. Refs. 41 and 42), acetylation (e.g. Refs.
43 and 44), isoprenylation (45), disulfide bond formation (46), and
unidentified covalent modifications (47) have been shown to be
associated with higher plant mitochondria. Changes in phosphorylation
or acetylation should lead to the addition or lack of charges and to a
shift in the elution from the anion exchanger, as compared with that of
the cytosolic GlyRS-1 detected in total extracts. Significant
glycosylation would affect the electrophoretic behavior, whereas
addition of lipid derivatives would tend to promote anchoring into the
membrane fraction, which is clearly not the case. Intersubunit
disulfide bond formation looks plausible but has no obvious reason to
increase the hydrophobicity of the protein versus the
putative cytosolic GlyRS-1 2 dimer. Alternatively, it is
possible that the lack of significant GlyRS-1 activity observed in bean
hypocotyl mitochondria is specific for this plant tissue or this plant
species or that GlyRS-1 is only active in mitochondria upon certain
developmental conditions. However, the fact that wheat mitochondrial
extracts contain significant but limited GlyRS-1 activity strengthens
the idea that, whatever the reasons are for its lack of activity in the
organelles of some species, the role of GlyRS-1 is not to make
a major contribution to the aminoacylation of mitochondrial
tRNAsGly. Therefore, one wonders why GlyRS-1 is imported
into the organelles. An attractive hypothesis would be that this enzyme
is required for import of cytosolic tRNAsGly into
mitochondria. Two different mechanisms have been proposed for
mitochondrial tRNA import. The first one, which seems to apply for
trypanosomatids, is a direct import of the tRNAs through the mitochondrial membranes via receptor(s) and a specific channel (48). The second mechanism, which has been proposed to account for the
mitochondrial import of the single cytosolic tRNALys(CUU)
in yeast, is a co-import of the tRNA with protein factors, and in
particular the corresponding aminoacyl-tRNA synthetase (49). In plants,
it was shown that a point mutation in a normally imported tRNA,
tRNAAla(UGC), blocked both the aminoacylation of this tRNA
by alanyl-tRNA synthetase and its import into mitochondria in
vivo (29). Although recent studies in Xenopus laevis
and in yeast imply that proofreading might prevent or impair nuclear
export of inactive tRNAs (50, 51), these observations suggest a role of
alanyl-tRNA synthetase, and more generally of aaRSs, in plant
mitochondrial tRNA import. One can speculate that mitochondrial import
of tRNAGly isoacceptors is perhaps mediated by GlyRS-1.
Considering that unfolding steps are implicated in mitochondrial
protein import (e.g. Refs. 52-54), the conformation of
GlyRS-1 might be modified during these processes, so that tRNA import
would rely on tRNA/aaRS interactions that differ from those occurring
during aminoacylation. Such a mechanism has already been proposed for
the lysyl-tRNA synthetase-mediated mitochondrial import of
tRNALys(CUU) in yeast (49). Conservation of this
alternative conformation would also be a possibility to explain the
lack of GlyRS-1 aminoacylation activity in the mitochondria of some
plant species. Finally, the possibility also remains open that GlyRS-1
has another role than recognition of tRNAs during import or inside
mitochondria. Indeed, there is growing evidence that aaRSs are involved
in cellular processes other than tRNA aminoacylation, for example in
transcription (55), intron splicing (56), and mRNA 3' end
processing (57).
 |
ACKNOWLEDGEMENTS |
We thank Laurence Maréchal-Drouard,
Jean-Luc Evrard, and Regina Kraüter for fruitful discussions,
Sabine Brubacher-Kauffmann and Vincent Mirabet for help in experiments,
and Dirk Inzé for providing us with an antiserum against plant
mitochondrial superoxide dismutase.
 |
FOOTNOTES |
*
This work was supported by the CNRS, the Université
Louis Pasteur (Strasbourg), and the Institut National de la Recherche Agronomique and by a grant from the Groupement de Recherche et d'Etude
des Génomes.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed. Fax: 33 3 88 61 44 42;
E-mail: anne-marie.duchene@ibmp-ulp.u-strasbg.fr.
Current address: Nutrition and Toxicology, 119 Koshland Hall,
University of California, Berkeley, CA 94720.
Published, JBC Papers in Press, February 2, 2001, DOI 10.1074/jbc.M011525200
 |
ABBREVIATIONS |
The abbreviations used are:
aaRS, aminoacyl-tRNA
synthetase;
GlyRS, glycyl-tRNA synthetase;
PCR, polymerase chain
reaction;
GFP, green fluorescent protein.
 |
REFERENCES |
| 1.
|
Maréchal-Drouard, L.,
Weil, J. H.,
and Dietrich, A.
(1993)
Annu. Rev. Plant Physiol. Plant Mol. Biol.
44,
13-32
|
| 2.
|
Dietrich, A.,
Small, I.,
Cosset, A.,
Weil, J. H.,
and Maréchal-Drouard, L.
(1996)
Biochimie (Paris)
78,
518-529
|
| 3.
|
Kumar, R.,
Maréchal-Drouard, L.,
Akama, K.,
and Small, I.
(1996)
Mol. Gen. Genet.
252,
404-411
|
| 4.
|
Ribas de Pouplana, L.,
Frugier, M.,
Quinn, C.,
and Schimmel, P.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
166-170
|
| 5.
|
Doolittle, R.,
and Handy, J.
(1998)
Curr. Opin. Genet. Dev.
8,
630-636
|
| 6.
|
Unseld, M.,
Marienfeld, J. R.,
Brandt, P.,
and Brennicke, A.
(1997)
Nat. Genet.
15,
57-61
|
| 7.
|
Mireau, H.,
Lancelin, D.,
and Small, I.
(1996)
Plant Cell
8,
1027-1039
|
| 8.
|
Souciet, G.,
Menand, B.,
Ovesna, J.,
Cosset, A.,
Dietrich, A.,
and Wintz, H.
(1999)
Eur. J. Biochem.
266,
1-8
|
| 9.
|
Menand, B.,
Maréchal-Drouard, L.,
Sakamoto, W.,
Dietrich, A.,
and Wintz, H.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
11014-11019
|
| 10.
|
Akashi, K.,
Grandjean, O.,
and Small, I.
(1998)
FEBS Lett.
431,
39-44
|
| 11.
|
Peeters, N. M.,
Chapron, A.,
Giritch, A.,
Grandjean, O.,
Lancelin, D.,
Lhomme, T.,
Vivrel, A.,
and Small, I.
(2000)
J. Mol. Evol.
50,
413-423
|
| 12.
|
Duchêne, A. M.,
Brubacher, S.,
Cosset, A.,
Maréchal-Drouard, L.,
and Dietrich, A.
(1998)
in
Plant Mitochondria: From Gene to Function
(Moller, I. M.
, Gardeström, P.
, and Glaser, E., eds)
, pp. 121-125, Backuys Publishers, Leiden, The Netherlands
|
| 13.
|
Schock, I.,
Maréchal-Drouard, L.,
and Marchfelder, A.
(1998)
Mol. Gen. Genet.
257,
554-560
|
| 14.
|
Brubacher-Kauffmann, S.,
Maréchal-Drouard, L.,
Cosset, A.,
Dietrich, A.,
and Duchêne, A. M.
(1999)
Nucleic Acids Res.
27,
2037-2042
|
| 15.
|
Akashi, K.,
Tazkenaka, M.,
Yamaoka, S.,
Suyama, Y.,
Fukuzama, H.,
and Ohyama, K.
(1998)
Nucleic Acids Res.
26,
2168-2172
|
| 16.
|
Dellaporta, S. L.,
Wood, J.,
and Hicks, J. B.
(1983)
Plant Mol. Biol. Rep.
1,
19-21
|
| 17.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd Ed.
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 18.
|
Goodall, G. J.,
Wiebauer, K.,
and Filipowicz, W.
(1990)
Methods Enzymol.
181,
148-161
|
| 19.
|
Maréchal-Drouard, L.,
Guillemaut, P.,
Cosset, A.,
Arbogast, M.,
Weber, F.,
Weil, J. H.,
and Dietrich, A.
(1990)
Nucleic Acids Res.
18,
3689-3696
|
| 20.
|
Neuburger, M.,
Journet, E. P.,
Bligny, R.,
Carde, J. P.,
and Douce, R.
(1982)
Arch. Biochem. Biophys.
217,
312-323
|
| 21.
|
Robinson, C.,
and Barnet, L. K.
(1988)
in
Plant Molecular Biology: A Practical Approach
(Shaw, C. H., ed)
, pp. 67-78, IRL Press at Oxford University Press, Oxford
|
| 22.
|
Maréchal-Drouard, L.,
Small, I.,
Weil, J. H.,
and Dietrich, A.
(1995)
Methods Enzymol.
260,
310-327
|
| 23.
|
Becker, D.,
Kemper, E.,
Schell, J.,
and Masterson, R.
(1992)
Plant Mol. Biol.
20,
1195-1197
|
| 24.
|
Rubino, L.,
Weber-Lotfi, F.,
Dietrich, A.,
Stussi-Garaud, C.,
and Russo, M.
(2001)
J. Gen. Virol.
82,
29-34
|
| 25.
|
Nagy, J. I.,
and Maliga, P.
(1976)
Z. Pflanzenphysiol.
78,
453-455
|
| 26.
|
Wischmann, C.,
and Schuster, W.
(1995)
FEBS Lett.
374,
152-156
|
| 27.
|
Nguyen, N. Y.,
and Chrambach, A.
(1981)
in
Gel Electrophoresis of Proteins
(Hames, B. D.
, and Rickwood, D., eds)
, pp. 150-151, IRL Press at Oxford University Press, Oxford
|
| 28.
|
Souciet, G.,
Dietrich, A.,
Colas, B.,
Razafimahatratra, P.,
and Weil, J. H.
(1982)
J. Biol. Chem.
257,
9598-9604
|
| 29.
|
Dietrich, A.,
Maréchal-Drouard, L.,
Carneiro, V.,
Cosset, A.,
and Small, I.
(1996)
Plant J.
10,
913-918
|
| 30.
|
Duchêne, A. M.,
and Dietrich, A.
(1997)
Plant Physiol.
115,
1730
|
| 31.
|
Newman, T.,
de Bruijn, F.,
Keegstra, K.,
Kende, H.,
McIntosh, L.,
Ohlrogge, J.,
Raikhel, N.,
Somerville, S.,
Thomashow, M.,
Retzel, E.,
and Somerville, C.
(1994)
Plant Physiol.
106,
1241-1255
|
| 32.
|
The Arabidopsis Genome Initiative.
(2000)
Nature
408,
796-815
|
| 33.
|
Mudge, S. J.,
Williams, J. H.,
Eyre, H. J.,
Suthereland, G. R.,
Cowan, P. J.,
and Power, D. A.
(1998)
Gene
209,
45-50
|
| 34.
|
Shiba, K.,
Schimmel, P.,
Motegi, H.,
and Noda, T.
(1994)
J. Biol. Chem.
269,
30049-30055
|
| 35.
|
Turner, R. J.,
Lovato, M.,
and Schimmel, P.
(2000)
J. Biol. Chem.
275,
27681-27688
|
| 36.
|
Uwer, U.,
Willmitzer, L.,
and Altmann, T.
(1998)
Plant Cell
10,
1277-1294
|
| 37.
|
Joyce, P.,
and Gray, M.
(1989)
Nucleic Acids Res.
17,
5461-5476
|
| 38.
|
Björk, G. R.
(1995)
in
tRNA: Structure, Biosynthesis, and Function
(Söll, D.
, and RajBhandary, U., eds)
, pp. 165-205, American Society for Microbiology (ASM), Washington, D. C.
|
| 39.
|
Giegé, R.,
Sissler, M.,
and Florentz, C.
(1998)
Nucleic Acids Res.
26,
5017-5035
|
| 40.
|
Nameki, N.,
Tamura, K.,
Asahara, H.,
and Hasegawa, T.
(1997)
J. Mol. Biol.
268,
640-647
|
| 41.
|
Struglics, A.,
and Hakansson, G.
(1999)
Eur. J. Biochem.
262,
765-773
|
| 42.
|
Struglics, A.,
Fredlund, K. M.,
Konstantinov, Y. M.,
Allen, J. F.,
and Moller, I. M.
(2000)
FEBS Lett.
475,
213-217
|
| 43.
|
Millar, A. H.,
Knorpp, C.,
Leaver, C. J.,
and Hill, S. A.
(1998)
Biochem. J.
334,
571-576
|
| 44.
|
Millar, A. H.,
Leaver, C. J.,
and Hill, S. A.
(1999)
Eur. J. Biochem.
264,
973-981
|
| 45.
|
Shipton, C. A.,
Parmryd, I.,
Swiezewska, E.,
Andersson, B.,
and Dallner, G.
(1995)
J. Biol. Chem.
270,
566-572
|
| 46.
|
Rhoads, D. M.,
Umbach, A. L.,
Sweet, C. R.,
Lennon, A. M.,
Rauch, G. S.,
and Siedow, J. N.
(1998)
J. Biol. Chem.
273,
30750-30756
|
| 47.
|
von Stedingk, E.,
Pavlov, P. F.,
Grinkevich, V. A.,
and Glaser, E.
(1999)
Plant. Mol. Biol.
41,
505-515
|
| 48.
|
Mahapatra, S.,
Ghosh, S.,
Kanti Bera, S.,
Ghosh, T.,
Das, A.,
and Adhya, S.
(1998)
Nucleic Acids Res.
26,
2037-2041
|
| 49.
|
Tarassov, I.,
and Martin, R.
(1996)
Biochimie (Paris)
78,
502-510
|
| 50.
|
Lund, E.,
and Dahlberg, J. E.
(1998)
Science
282,
2082-2085
|
| 51.
|
Sarkar, S.,
Azad, A. K.,
and Hopper, A. K.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
14366-14371
|
| 52.
|
Gaume, B.,
Klaus, C.,
Ungermann, C.,
Guiard, B.,
Neupert, W.,
and Brunner, M.
(1998)
EMBO J.
17,
6497-6507
|
| 53.
|
Huang, S.,
Ratliff, K. S.,
Schwartz, M. P.,
Spenner, J. M.,
and Matouschek, A.
(1999)
Nat. Struct. Biol.
6,
1132-1138
|
| 54.
|
Voisine, C.,
Craig, E. A.,
Zufall, N.,
von Ahsen, O.,
Pfanner, N.,
and Voos, W.
(1999)
Cell
97,
565-574
|
| 55.
|
Yanovfsky, C.,
Konan, K. V.,
and Sarsero, J. P.
(1996)
Biochimie (Paris)
78,
1017-1024
|
| 56.
|
Lambowitz, A. M.,
and Perlman, P. S.
(1990)
Trends Biochem. Sci.
15,
440-444
|
| 57.
|
Magrath, C.,
and Hyman, L. E.
(1999)
Genetics
152,
129-141
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. Fender, C. Sauter, M. Messmer, J. Putz, R. Giege, C. Florentz, and M. Sissler
Loss of a Primordial Identity Element for a Mammalian Mitochondrial Aminoacylation System
J. Biol. Chem.,
June 9, 2006;
281(23):
15980 - 15986.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Pesaresi, S. Masiero, H. Eubel, H.-P. Braun, S. Bhushan, E. Glaser, F. Salamini, and D. Leister
Nuclear Photosynthetic Gene Expression Is Synergistically Modulated by Rates of Protein Synthesis in Chloroplasts and Mitochondria
PLANT CELL,
April 1, 2006;
18(4):
970 - 991.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A.-M. Duchene, A. Giritch, B. Hoffmann, V. Cognat, D. Lancelin, N. M. Peeters, M. Zaepfel, L. Marechal-Drouard, and I. D. Small
Dual targeting is the rule for organellar aminoacyl-tRNA synthetases in Arabidopsis thaliana
PNAS,
November 8, 2005;
102(45):
16484 - 16489.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-K. Kim, J.-Y. Lee, H. S. Cho, S. S. Lee, H. J. Ha, S. Kim, D. Choi, and H.-S. Pai
Inactivation of Organellar Glutamyl- and Seryl-tRNA Synthetases Leads to Developmental Arrest of Chloroplasts and Mitochondria in Higher Plants
J. Biol. Chem.,
November 4, 2005;
280(44):
37098 - 37106.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Heilmann, M. S. Pidkowich, T. Girke, and J. Shanklin
From the Cover: Switching desaturase enzyme specificity by alternate subcellular targeting
PNAS,
July 13, 2004;
101(28):
10266 - 10271.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Delage, A. Dietrich, A. Cosset, and L. Marechal-Drouard
In Vitro Import of a Nuclearly Encoded tRNA into Mitochondria of Solanum tuberosum
Mol. Cell. Biol.,
June 1, 2003;
23(11):
4000 - 4012.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Shikanai, P. Muller-Moule, Y. Munekage, K. K. Niyogi, and M. Pilon
PAA1, a P-Type ATPase of Arabidopsis, Functions in Copper Transport in Chloroplasts
PLANT CELL,
June 1, 2003;
15(6):
1333 - 1346.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. M. Chabregas, D. D. Luche, M.-A. Van Sluys, C. F. M. Menck, and M. C. Silva-Filho
Differential usage of two in-frame translational start codons regulates subcellular localization of Arabidopsis thaliana THI1
J. Cell Sci.,
January 15, 2003;
116(2):
285 - 291.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Laloi, N. Rayapuram, Y. Chartier, J.-M. Grienenberger, G. Bonnard, and Y. Meyer
Identification and characterization of a mitochondrial thioredoxin system in plants
PNAS,
November 20, 2001;
98(24):
14144 - 14149.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|