![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 18, 15423-15433, May 4, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,From the Gene Regulation Program, Institute of Molecular Medicine and Genetics, Medical College of Georgia, Augusta, Georgia 30912
Received for publication, November 29, 2000, and in revised form, January 23, 2001
| |
ABSTRACT |
|---|
|
|
|---|
Transcriptional reinitiation is a distinct phase
of the RNA polymerase II transcription cycle. Prior work has shown that
reinitiation is deficient in nuclear extracts from Chinese hamster
ovary cells lacking the 80-kDa subunit of Ku, a double-strand
break repair protein, and that activity is rescued by expression of the
corresponding cDNA. We now show that Ku increases the amount or
availability of a soluble factor that is limiting for reinitiation,
that the factor increases the number of elongation complexes associated with the template at all times during the reaction, and that the factor
itself does not form a tight complex with DNA. The factor may consist
of a preformed complex of transcription proteins that is stabilized by
Ku. A Ku mutant, lacking residues 687-728 in the 80-kDa subunit,
preferentially suppresses transcription in Ku-containing extracts,
suggesting that Ku interacts directly with proteins required for
reinitiation. The Ku mutant functions normally in a DNA end-joining
system, indicating that the functions of Ku in transcription and repair
are genetically separable. Based on our results, we present a model in
which Ku is capable of undergoing a switch between a transcription
factor-associated and a repair-active state.
The ability of a cell to produce multiple copies of a particular
mRNA requires the recycling of template, general transcription factors, and RNAP II.1 This
process, termed reinitiation, is a key determinant of the overall
transcription rate. Reinitiation at a given promoter occurs in
vivo as frequently as every few seconds (1, 2). The ability to
maintain such high, sustained transcription rates suggests the
existence of a facilitated reinitiation pathway in which many sequential events are coordinated so that the transcription cycle can
proceed at a rapid overall rate (reviewed in Ref. 3).
Mechanisms that promote rapid reinitiation can be divided broadly into
those that operate at the template level, influencing the availability
of a particular DNA for reinitiation, and those that operate at the
protein level, influencing the availability of RNAP II and
transcription factors. A number of examples of mechanisms that promote
reinitiation have been characterized. One of the mechanisms that
operates at the template level is the persistent binding of
transcription factors to the promoter. The binding of TFIID and TFIIA
is commonly the rate-limiting step in de novo transcription
complex formation (4-6). After the first round of initiation is
complete, TFIID and TFIIA remain bound to the DNA and nucleate the
assembly of another transcription complex (7). Because this bypasses a
potentially rate-limiting step, the overall rate of reinitiation is
increased. Consistent with this interpretation, mutations that
destabilize the TFIID-TFIIA-DNA complex selectively decrease the
reinitiation rate in vitro (8, 9). Another example of a
mechanism that promotes the availability of templates for reinitiation
is the suppression of pausing during elongation. The presence of a
stable, paused elongation complex limits the ability of successive RNAP
II molecules to transit the template. The elongation factor TFIIS (also
known as SII), which suppresses pausing, stimulates reinitiation
in vitro (10).
Although template availability is important, it is not sufficient, in
itself, to assure a high reinitiation rate, because reinitiation also
requires that certain events occur at the protein level. For example,
the C-terminal domain of the largest RNAP II subunit is phosphorylated
at the time of initiation and must be dephosphorylated to allow
re-entry of RNAP II into the transcription cycle (reviewed in Ref. 11).
This dephosphorylation is mediated by a specific phosphatase, FCP-1
(12, 13), which is in turn regulated by an interaction with the
C-terminal region of the 74-kDa subunit of TFIIF (12). Mutations in
TFIIF decrease reinitiation efficiency in vitro (14).
Several other examples of proteins that affect reinitiation have been
reported, although their mechanisms of action have not been
characterized in detail. These include estrogen receptor (15) and the
TATA-binding protein-associated factors, also known as TAFs
(16).
In addition to specific protein-protein interactions, overall spatial
organization of the transcription apparatus is likely to be important
in determining reinitiation rate. Cytological studies reveal that the
mRNA synthesis apparatus is not distributed evenly throughout the
nucleus but rather occurs in hundreds or thousands of discrete clusters
termed "transcription factories" (Refs. 17 and 18; reviewed in Ref.
19). Complementary biochemical studies show that a portion of the RNAP
II in the mammalian cell is associated with discrete sets of
transcription factors in so-called "holoenzyme" complexes (Refs. 20
and 21; reviewed in Refs. 22 and 23). Proteins that preserve the
spatial organization of the transcription apparatus in a cell-free
system or that promote the formation of stable holoenzyme complexes
could exert a major influence on reinitiation by increasing the local
concentration of transcription proteins in the vicinity of the promoter.
In previous work, we made an unexpected observation that expression of
the Ku protein, a double-strand DNA break repair factor, affects
transcription efficiency in vitro (24). Extracts from mutant
CHO cells that lack the 80-kDa Ku subunit (25, 26) show a transcription
deficit of up to 5-fold, compared with extracts from isogenic control
cells rescued by expression of the corresponding cDNA (24). The
effect is seen with several unrelated promoters, indicating that it
involves the general transcription machinery and is seen only in a
multiple-round transcription assay, that is, when reinitiation is
permitted. Activity in extracts from the mutant cells can be rescued by
addition of small amounts of extract from Ku-expressing cells but not
by the addition of purified Ku protein, RNAP II, or general
transcription factors. The inability to rescue activity with purified
Ku suggests either that the role of Ku is indirect or that the
endogenous Ku differs in some way from the exogenous protein.
Interestingly, a different CHO cell mutant that lacks the
DNA-dependent protein kinase catalytic subunit, a protein
in the same repair pathway as Ku, also exhibits a decrease in
transcription activity (24).
Why a DNA double-strand break repair protein should influence the
apparently unrelated process of transcriptional reinitiation is not
known. Ku is a heterodimer, composed of 70- and 80-kDa subunits,
referred to as Ku70 and Ku80, respectively. Ku binds avidly to DNA ends
and recruits DNA-PKcs to form a complex with protein kinase activity.
The assembly of this complex initiates a repair pathway (reviewed in
Refs. 27 and 28). The effect of Ku on transcription does not require
free ends in the template, and it is not dependent on the catalytic
activity of DNA-PKcs. This suggests that the effect may involve
protein-protein interactions rather than DNA binding per se.
Consistent with this, Ku and DNA-PKcs have been found to
physically associate with an RNAP II-containing complex in
vivo (20).
There is a precedent for functional interaction between DNA repair
proteins and the transcription apparatus. The general transcription factor TFIIH has several subunits in common with a multiprotein complex
required for nucleotide excision repair. Mutations in at least two of
these proteins, the XPB and XPD helicases, have pleiotropic effects on
transcription and repair processes (Refs. 29-31; reviewed in Ref. 32).
Mutations in two other repair proteins, the Cockayne Syndrome A and B
proteins, also affect general transcription capacity, although the
mechanism is not fully understood (33, 34).
The studies described here address two major questions. First, what is
the underlying reason for the greater reinitiation activity in extracts
from Ku-expressing cells? Second, and more generally, what insights can
we obtain into the physiological interaction between double-strand
break repair proteins and the RNA polymerase II transcription
apparatus? In the course of this work, we identified a dominant mutant
form of Ku that preferentially suppresses transcription activity in
extracts from Ku-expressing cells. The mutation lies outside the
DNA-binding domain of Ku and has no apparent effect on the function of
Ku in a cell-free DNA end joining assay. Our data suggest that Ku
interacts directly with a set of proteins required for transcriptional
reinitiation and that this function is genetically separable from the
role of Ku protein in DNA double-strand break repair.
Templates, Nuclear Extracts, and Transcription
Reactions--
The xrs-6 cell line lacks detectable Ku80 protein and
has a stable, radiation-sensitive phenotype. One allele of the Ku80 gene contains a 13-base pair insertion that results in a frameshift; the other allele is silent (26). The xrs-6cKu80 and xrs-6cvec cell
lines were derived by transfection of xrs-6c cells with a human Ku80
cDNA expression vector and with an empty vector, respectively (35).
We reconfirmed the presence of a Ku80 cDNA in the xrs-6cKu80 line
by polymerase chain reaction amplification (data not shown). Nuclear
extracts were prepared from each cell line and in vitro transcription was performed using supercoiled DNA templates as described (24). In some experiments, immobilized templates were used.
The template for these experiments consisted of an hsp70 promoter fused
to a 190-base pair G-less cassette (24). This DNA was linearized by
digestion with XbaI, and the DNA ends were biotinylated in a
fill-in reaction containing 1 unit/µg Klenow fragment of
Escherichia coli DNA polymerase I and 0.025 mM
each of dATP, dCTP, dGTP, and biotin-21-dUTP
(CLONTECH). The reaction was allowed to proceed for
30 min at 30 °C. The product was digested with SphI to
remove the biotinylated end upstream of the hsp70 promoter and
subjected to spin column chromatography to remove the released fragment
and unincorporated nucleotides. The biotinylated DNA was then allowed
to bind to streptavidin-coated paramagnetic beads (Dynal, Dynabeads
M-280). Template and beads were incubated at a ratio of 5 pmol DNA/mg
beads for 1 h at 43 °C in the presence of 5 mM
Tris-HCl, pH 7.5, 0.5 mM EDTA, 2 M NaCl.
Following incubation, the supernatant was removed, and its DNA content
was quantitated to provide an estimate of the fraction of DNA that
bound to the beads. The beads were washed twice in 5 mM
Tris-HCl, pH 7.5, 0.5 mM EDTA, 2 M NaCl,
followed by extensive water washes. The beads were resuspended in a
final volume of water to a concentration of 40 µg DNA/ml.
Expression and Purification of Ku Protein--
Recombinant wild
type Ku protein was produced by coinfection of Sf 9 cells
with VBB2-86Ku and VBB2-70Ku and was purified by sequential
Superdex-200, single-stranded DNA-agarose, and heparin-agarose chromatography as described (36, 37).
To produce the Ku80 Cell-free End Joining Assay--
Whole cell extracts were
prepared as described (38) using 4 × 109 human
lymphoblasts (GM00558 cell line, Coriell Cell Repositories). Cells were
harvested by centrifugation, resuspended, and lysed by homogenization
in 10 ml of hypotonic lysis buffer (10 mM Tris-HCl, pH 8.0, 0.1 mM EDTA, 5 mM dithiothreitol) using 20 strokes of an A pestle. Phenylmethylsulfonyl fluoride (0.17 mg/ml),
pepstatin A (1 µg/ml), leupeptin (1 µg/ml), and soybean trypsin
inhibitor (1 µg/ml) were added to inhibit proteases. After 20 min of
incubation on ice, 3.33 ml of high salt buffer (50 mM
Tris-HCl, pH 7.5, 1 M KCl, 2 mM EDTA, 2 mM dithiothreitol) was added. Cell lysate was centrifuged
for 3 h at 200,000 × g. The supernatant was
dialyzed against 20 mM Tris-HCl, pH 8.0, 0.1 M
KOAc, 20% glycerol, 0.5 mM EDTA, 1 mM
dithiothreitol. Aliquots were prepared and stored at
DNA substrate for the end joining assay was prepared by digestion of
pBluescript II KS(+) vector (Stratagene) with BamHI. DNA
substrate was labeled using T4 polynucleotide kinase and
[ Immunodepletion of Ku and DNA-PKcs from End Joining
Extracts--
500 µl of IPP buffer (0.5 M NaCl, 10 mM Tris-HCl, pH 7.5, 0.1% Nonidet P-40) was added to 5 mg
of protein A-Sepharose beads and incubated for 30 min at 4 °C.
Following incubation, 5 µl of a normal human serum or a human serum
(TT) containing autoantibodies directed against Ku and DNA-PKcs was
added to the beads and incubated overnight at 4 °C. The beads were
washed 3 times in IPP buffer and twice in DB buffer (20 mM
Tris-HCl, pH 7.5, 0.1 mM KOAc, 1 mM
dithiothreitol, 0.5 mM EDTA, 20% glycerol). 12-15 µl of
GM00558 cell extract was added to the washed beads and incubated for
2 h at 4 °C. The supernatant was removed and set aside for use
in end joining assays and for analysis by SDS-PAGE and immunoblotting. The beads were washed four times with IPP buffer and analyzed by
SDS-PAGE and immunoblotting.
Expression of the Ku80 cDNA in xrs-6 Cells Increases the Amount
or Availability of a Limiting Reinitiation Factor--
We have defined
a system for studying transcription that is based on nuclear extracts
prepared from two isogenic CHO cell lines (24). As described under
"Materials and Methods," the xrs-6cvec cell line lacks Ku80
expression, whereas the xrs-6cKu80 cell line has been rescued with a
human Ku80 cDNA (35). Extracts from the latter cell line exhibit a
much higher level of in vitro transcription under
multiple-round conditions (24).
Many different mechanisms can influence reinitiation rate, and in an
initial attempt to understand the mechanism used by the Ku-dependent reinitiation activity, we performed an
experiment in which the amount of template was varied while the amount
of nuclear extract was held constant. Transcription was performed using
supercoiled templates containing the hsp70 promoter fused to a
G-less cassette. At each concentration of template, transcription was
measured under conditions that permit either single or multiple-round transcription (Fig. 1A).
When transcription was restricted to a single round by the addition of
10 µg/ml heparin, 2 min after the NTPs, the amount of RNA synthesis
was similar with both extracts. Moreover, the amount of transcription
remained constant as the amount of template increased (Fig. 1,
B and C, + heparin lanes). In all
cases, two closely spaced RNA bands were seen, corresponding
approximately to the expected size of the full-length RNA (Fig.
1B). Shorter RNAs were not present in significant amounts
(Ref. 24 and data not shown). The observation that the amount of first
round transcription remained constant as the amount of template was
varied indicates that overall RNA synthesis is limited by a component
in the extract, presumably a protein, and not by the amount of DNA.
Because the levels of RNA synthesis were similar with both extracts, we
infer that they are well matched with respect to the amount of this limiting component.
When transcription was allowed to proceed for multiple rounds, the
xrs-6cKu80 extract was much more active than the xrs-6cvec extract
(Fig. 1, B and C,
We use the term "reinitiation" for convenience and because the
process presumably reflects facilitated recycling or reuse of some
component that was limiting for the first round. It should be
understood, however, that our use of the term embraces any form of
initiation that occurs after the first 2 min, regardless of the
underlying mechanism.
The results of the template titration experiment help to discriminate
between different possible mechanisms of action for the reinitiation
factor. The finding that an increase in the amount of template leads to
an increase in multiple-round transcription, whereas the amount of
first-round transcription remains constant, strongly suggests that the
factor promotes the utilization of individual template molecules that
were not used for productive initiation in the first round. It appears
that the reinitiation factor facilitates the redistribution of some
limiting transcription component between templates rather than the
reuse of templates per se. This is consistent with the
results of a colliding polymerase assay performed previously (24),
which showed that few, if any, templates are reused in the course of
the reaction.
The Reinitiation Factor Increases the Number of Transcription
Complexes Associated with the Template at All Times after Addition of
NTPs--
It was important to confirm the results of the preceding
experiment using an independent experimental design. Heparin is a polyanion that interrupts the transcription cycle by binding to free
RNAP II and transcription factors and blocking their incorporation into
transcription complexes. We have assumed that the addition of heparin
affects only reinitiation and does not substantially interfere with the
rate or efficiency of elongation. This assumption is supported by
previous observations that heparin does not affect RNAP II elongation
in a purified system (42). However, it is possible that heparin may
affect elongation in a crude extract, where additional components are
present. It would be of particular concern if there were a special
class of heparin-sensitive elongation complexes formed in the
xrs-6cKu80 extract, because if so, the difference in transcription in
the presence and absence of heparin would not reflect reinitiation, but
rather some other property of the system.
To address this concern, we measured reinitiation in a more direct way.
We carried out two sets of transcription reactions in parallel, using
different protocols, as diagrammed in Fig. 2A. In pathway 1, transcription was allowed to proceed for a variable length of time,
heparin was added, and incubation was continued for an additional 30 min to complete previously initiated chains. Pathway 1 measures
accumulated RNA chains as a function of time. In pathway 2, transcription was allowed to proceed for the same amounts of time as in
pathway 1, but EDTA was then added to chelate divalent cations, halting
RNA synthesis immediately. The difference in the amount of RNA
synthesized in pathway 1 versus pathway 2 allows the
estimation of the relative number of transcription complexes that are
associated with the template at a given time.
Results are shown in Fig. 2B, with quantitation in Fig. 2
(C and D). Under the conditions where chain
elongation was allowed to proceed to completion in the presence of
heparin (pathway 1), there was an approximately linear increase in the
number of RNA chains with time, consistent with a constant reinitiation
rate throughout the course of the reaction. Although this linear
increase was observed with both extracts, the slope of the line, which is proportional to the reinitiation rate, was 4-fold greater with xrs-6cKu80 than with the xrs-6cvec extracts (Fig. 2C). By
plotting the differences between the amount of synthesis in the two
pathways (Fig. 2D), it becomes apparent that more
transcription complexes are associated with the template at all times
in the presence of the xrs-6cKu80 extract. The number of transcription
complexes actually appears to increase as the reaction proceeds,
perhaps reflecting the fact that NTPases in the crude extract reduce
the substrate concentration at later times, decreasing the rate of elongation, and thus prolonging the lifetime of individual elongation complexes. These results provide independent support for the conclusion that xrs-6cKu80 extracts have a higher reinitiation rate. They appear
to exclude the possibility that the original results were attributable
to the existence of a special class of heparin-sensitive elongation
complexes in the xrs-6cKu80 extracts.
The Reinitiation Factor Is Diffusible Rather Than
Template-associated--
To further investigate the mechanism of
action of the Ku-dependent reinitiation factor, we tested
whether the reinitiation activity became stably associated with the
template during the course of the reaction. The design of these
experiments is shown in Fig.
3A. A promoter-containing DNA
fragment was prepared with a single biotin group downstream of the
transcription unit, the DNA was allowed to bind to streptavidin-coated
paramagnetic beads, and the beads were incubated with nuclear extracts
to allow preinitiation complex formation. In some reactions, NTPs were
added, and RNA synthesis was measured directly, and in others, the
supernatant was removed, the beads were washed, and the same or a
different supernatant was added back. NTPs were then added, and RNA
synthesis was measured.
In reactions where RNA synthesis was measured directly, without washing
or otherwise manipulating the DNA beads, there was a substantial,
4.2-fold difference between xrs-6cKu80 and xrs-6cvec extracts (Fig.
3B, lanes 1-4). These results are comparable
with those obtained with soluble, supercoiled template (Fig. 1). In contrast, when the supernatant was removed, and beads were gently washed in transcription buffer, the overall level of transcription was
greatly reduced and the difference between extracts was virtually eliminated (lanes 5-8). The present results clearly
demonstrate that the components remaining on the template following the
wash are not, in themselves, sufficient to support the greater level of
transcription characteristic of xrs-6cKu80 extracts. This was a
surprising result, given that prior work in our laboratory and elsewhere has shown that RNAP II preinitiation complexes are stable to
washing (43). However, the initial studies validating the immobilized
template method focused on single-round transcription (43) and are thus
not directly comparable with the experiment presented here.
When supernatant fractions were added back to the washed beads, the
xrs-6cKu80 supernatant was able to partially restore activity (lanes 11 and 12), and, interestingly, the same
level of transcription was obtained regardless of the source of
preinitiation complex (compare lanes 13 and 14 with lanes 11 and 12). By contrast, the xrs-6cvec
supernatant restored very little activity to either type of
preinitiation complex (lanes 9, 10,
15, and 16). Thus, in these add-back experiments,
the washed preinitiation complexes showed a level of transcription
characteristic of the supernatant rather than the extract used for the
initial complex formation. Qualitatively similar results were
obtained when the wash step was omitted and supernatant was added
back directly to unwashed preinitiation complexes (lanes 17-24). The
results of these experiments are quantitated in Fig. 3C.
These experiments appear to rule out the possibility that the
difference in activity between the two extracts can be explained by
differential binding of transcription factors to the DNA at the time of
preinitiation complex formation. It seems very unlikely that the
template is "marked" as reinitiation-competent during the
preincubation period, for example, through differential formation of
TFIID-TFIIA-DNA complexes or through stable binding of Ku
protein to a region of DNA melting at the promoter. The finding that
the Ku-dependent reinitiation factor is diffusible rather
than template-associated provides additional evidence that the factor
works by influencing the availability of limiting transcription
proteins rather than template.
Addition of Purified Ku Protein Preferentially Suppresses Activity
of the xrs-6cKu80 Extract--
The preceding experiments leave open
the question of whether the effect of Ku on transcription is direct or
indirect. We have previously reported an inability to correct the
defect in xrs-6cvec extracts by addition of exogenous Ku protein, but
this negative result does not rule out a direct role for Ku, because it
could reflect a difficulty in assembling exogenous Ku into an active multiprotein complex. To address whether Ku is directly involved in
reinitiation, we turned to an alternative approach, which was to
investigate whether addition of excess wild type or mutant Ku protein
could suppress reinitiation activity in vitro.
Several recent reports have focused on potential functions of sequences
in the C-terminal region of the Ku80 subunit (44-46). Partial
proteolysis suggests that this region forms a distinct structural
domain that increases in protease sensitivity upon DNA binding (47).
This region is not required for DNA binding but may be involved in
contacts with DNA-PKcs (44-46). Interestingly, expression of a natural
variant of Ku80, which lacks the C terminus, correlates with a
phenotype where cells are competent for repair but are
radiation-sensitive because of an inability to pass a G2/M
cell cycle checkpoint (44, 48). Because the C-terminal region of Ku80
appears to be involved in signaling rather than repair per
se, it was a plausible target for our initial mutagenesis. A
mutant, Ku80
Purified wild type and mutant Ku proteins were added to in
vitro transcription assays containing DNA template immobilized on
streptavidin-coated paramagnetic beads (Fig. 4B). Both the wild type and mutant Ku proteins inhibited transcription in a multiple-round reaction. The mutant had a greater effect, however, and
showed more selectivity for the xrs-6cKu80 extract. The Ku80
Similar results were also obtained in transcription assays using a
circular template in solution, although the effect was not as dramatic
as when the template was immobilized (data not shown). The
dominant-negative effect of the exogenous, purified Ku protein strongly
suggests that Ku is directly involved in the reinitiation pathway,
either as a component of the reinitiation factor or as a protein that
interacts with the reinitiation factor.
Preincubation with Exogenous Ku Causes Loss of Template
Activity--
To further investigate the ability of exogenous Ku to
suppress transcription activity, we performed an experiment in which exogenous Ku was preincubated with DNA bead template. This
preincubation was performed in the presence of xrs-6cKu80 extract.
Beads were then washed, and fresh xrs-6cKu80 supernatant was added from
a parallel incubation containing no exogenous Ku protein. NTPs were added, and RNA synthesis was measured in a multiple-round assay (Fig.
5A). The results (Fig.
5B) show that exposure to exogenous Ku during the
preincubation inactivates the template such that it can no longer
support multiple rounds of transcription. As in the preceding
experiment, the effect is more pronounced with the Ku80
The results point to the existence of a key functional difference
between endogenous and exogenous Ku protein. Endogenous Ku stimulates
transcription through a mechanism that does not involve tight binding
to the template. Exogenous Ku inhibits transcription and at the same
time exhibits the expected ability to bind to DNA. One hypothesis to
reconcile these observations is that Ku is capable of undergoing a
switch between a latent form, which is sequestered in a complex with
transcription factors, and a repair-active form, which binds DNA ends,
recruits DNA-PKcs, and initiates the repair pathway. This model will be
explored in more detail under "Discussion." We suggest that
endogenous Ku exists in the latent form, whereas biochemically purified
Ku, which has been dissociated from other proteins, exists
predominantly in the repair-active form. The balance may be further
shifted toward the repair-active form by the Ku80 Sequestration of DNA-PKcs in a Non-DNA Binding Form in the
xrs-6cKu80 Extracts--
To investigate this model further, it was of
interest to investigate the status of the double-strand break repair
apparatus in the xrs-6cKu80 extracts. For these experiments, we sought
to compare the DNA binding properties of the endogenous and exogenous Ku, as well as the endogenous DNA-PKcs. DNA binding was measured under
the same conditions used for transcription. Nuclear extract was
incubated with DNA beads in the presence or absence of exogenous Ku,
and the bound and unbound fractions were collected and analyzed by
SDS-PAGE and immunoblotting.
The available anti-Ku80 antibodies were not sensitive enough to allow
direct detection of the endogenous Ku, which is typically present at
very low levels in rodent cells (Fig.
6A, lanes 1-4, 13, and 14). We were able to draw inferences
about its behavior based on the DNA binding properties of endogenous
DNA-PKcs (see below). The larger amounts of exogenous Ku were readily
detected (lanes 5-12), and, as expected, a substantial
proportion of the exogenous Ku was in the DNA-bound fraction. The wild
type and Ku80
Fig. 6B shows an analysis of the distribution of DNA-PKcs in
the same experiment. Endogenous DNA-PKcs is readily detected using a
sensitive, cross-species reactive monoclonal antibody, 18-2 (49). A
substantial fraction of the DNA-PKcs in the xrs-6cvec extract
associates with the DNA beads, whether or not exogenous Ku is present
(lanes 1 and 2). This is consistent with recent findings that DNA-PKcs has some intrinsic in vitro DNA
binding activity, independent of Ku (50, 51). By contrast, the DNA-PKcs in the xrs-6cKu80 extract appears to be sequestered in a non-DNA binding form (lanes 3 and 4) and is recruited to
the DNA beads only when the reinitiation factor is disrupted by
addition of exogenous Ku. In some lanes, the non-DNA bound form of
DNA-PKcs appears as a doublet; whether this relates to functional
properties of the protein is unknown. These results establish a
correlation between the behavior of endogenous DNA-PKcs and
reinitiation factor activity. When reinitiation activity is present, in
the xrs-6cKu80 extract, the DNA-PKcs is sequestered in a non-DNA
binding form. When activity is absent in the xrs-6cvec extract or when
it is suppressed by exogenous Ku, the DNA-PKcs associates with the DNA.
Ku80
For the purpose of this experiment, it was necessary to have a way to
quantitatively remove endogenous Ku and DNA-PKcs without unduly
diluting the extract or introducing interfering components. To
accomplish this, we used a human autoimmune serum (serum TT) that
contains a very high titer of autoantibodies against both Ku and
DNA-PKcs. An immunoblot, shown in Fig.
7A, indicates that the TT
serum depleted essentially all of the endogenous Ku and DNA-PKcs from
the lymphoblast extract. By contrast, normal human serum (NS) did not
deplete significant amounts of either protein.
Results of a functional end joining assay are shown in Fig.
7B, with quantitation in Fig. 7C.
Mock-immunodepleted cell extract showed readily detectable end joining
activity (lane 2). The activity was dependent on
as-yet-unidentified extract components, because activity was not seen
with a mixture of recombinant and purified repair proteins alone
(lane 1). To make the in vitro system dependent on exogenous Ku- and DNA-PKcs, we depleted the extract with serum TT.
This greatly reduced end joining activity (lane 3). Addition of wild type Ku protein and DNA-PKcs together, but not separately, restored activity to the depleted extract (lanes 6-8).
Addition of Ku80
These results demonstrate that both the wild type and mutant Ku
proteins are capable of directing DNA end joining and that the mutant
retains the ability for functional interaction with DNA-PKcs in the
context of a repair complex. The finding that Ku80 In the present work, we have compared RNAP II transcription in
extracts from Ku-deficient CHO cells with transcription in extracts
from genetically matched cells that have been rescued by transfection
of a human Ku80 cDNA. We found that expression of Ku increased the
amount or availability of a soluble reinitiation factor. The factor
appears to work by facilitating the recycling or redistribution of
limiting transcription factors to new template molecules subsequent to
the first round of initiation. We have shown that it increases the
number of elongation complexes loaded on the template at all times
after addition of NTPs. The factor itself does not form a tight complex
with DNA, ruling out various models based on the DNA binding properties
of Ku or the differential binding of transcription factors to DNA
during the first round of transcription.
Addition of a mutant form of Ku lacking the C-terminal region of Ku80
preferentially suppresses transcription in the extract from
Ku-expressing cells. Addition of wild type Ku also suppresses transcription, but to a lesser extent. The finding that mutant and wild
type Ku differ in their effect on transcription, although they have
similar DNA binding properties, provides evidence that Ku influences
reinitiation through protein-protein rather than protein-DNA interactions.
We used a recently developed cell-free double-stranded break repair
system (38, 39) to further investigate the functional behavior of the
mutant Ku. The system is based on lymphoblast whole cell extracts and
mimics the in vivo double-strand break repair pathway, in
that its activity is dependent on Ku, DNA-PKcs, and the DNA ligase
IV-XRCC4 complex (39). In vitro cooperation between Ku and
DNA ligase IV-XRCC4 has also been reported by others in recent studies
(52, 53). We used a high titer human autoantiserum to deplete the cell
extracts of endogenous Ku and DNA-PKcs and reconstituted end joining
activity with recombinant or highly purified preparations of these
proteins. The results indicate that the mutant Ku is functional in
repair and capable of interaction with DNA-PKcs. Thus, the C-terminal
region of Ku80, although phylogenetically conserved, is not directly
required to promote DNA end joining. We suggest that this region of
Ku80 may serve to interact with other nuclear proteins, including
components of the transcription apparatus, to coordinate repair with
other cellular processes.
It is of interest that certain hematopoietic cells contain a natural
variant of Ku80 that lacks the C-terminal region, and the presence of
this form is correlated with a phenotype where cells are capable of
repairing DNA damage but defective in their ability to recover and
resume normal growth (44, 48). This observation appears to be analogous
to our in vitro findings, where mutant Ku is able to
participate in repair but not in other functions. It is also of
interest that threonine 715 of Ku80, which falls within the putative
C-terminal regulatory region, is a site of phosphorylation by DNA-PKcs
in vitro (54). Phosphorylation at this site in
vivo could help mediate the switch between alternative functions
of Ku.
To exert its effect on reinitiation, the Ku-dependent
reinitiation factor must be capable of at least transient interaction with promoter DNA or promoter-bound proteins, but these interactions do
not lead to creation of a stable, bound complex that can be recovered
in association with immobilized template. It seems paradoxical that
endogenous Ku protein would not bind to the template, given the avid
DNA binding properties of isolated Ku protein, and our findings have
led us to hypothesize that the endogenous Ku in the xrs-6cKu80 extracts
may be sequestered in a form that is incapable of assembling into high
affinity complexes at DNA ends. Although the level of Ku expression was
too low to confirm this directly, the anomalous behavior of DNA-PKcs in
the xrs-6cKu80 extracts strongly suggests that this might be the case.
The mechanism by which Ku is sequestered is unknown but could reflect
protein-protein interaction or stable occupancy of the DNA binding site
by a high affinity endogenous DNA sequence (55) or RNA sequence (56, 57).
The model that components of the DNA double-strand break repair
apparatus are capable of switching between two stable states, one of
which relates to transcription and the other to repair, is attractive
a priori because it provides a mechanism for tight, all-or-none regulation of function. The illustration in Fig.
8 illustrates how such a switch might
function in the context of a Ku-dependent reinitiation
complex. Under normal growth conditions (Fig. 8A), Ku and
DNA-PKcs are are sequestered via a network of interactions with
transcription proteins. This has a dual effect in that it stabilizes
the higher order organization of the transcription apparatus, while at
the same time it precludes the adventitious activation of the repair
pathway by Ku-binding structures, such as DNA replication
intermediates, that are formed as products of normal cellular
metabolism. In the presence of DNA damage signals, Ku and DNA-PKcs are
released from their interactions with transcription proteins and become
free to bind DNA ends and initiate repair, as shown in Fig.
8B. RNAP II remains active, but the rate of reinitiation is
decreased because factors essential for reinitiation are no longer held
within an organized complex.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
681-728 mutant, polymerase chain reaction-based
mutagenesis was used to replace codons 681-728 of the human Ku80
cDNA with an XhoI linker. Two divergent primers with sequences d(CCCGCTCGAGCTGGACAACAATTTCCCAGAA) and
d(CCCGCTCGAGTTGGACATGATATAAGTCGAC) were annealed to a human Ku80
cDNA subcloned in pGEM3zf(+) (Promega). Polymerase chain reaction
was performed, and the resulting fragment was digested with
XhoI and allowed to recircularize. The resulting clone was
digested with BamHI and SalI to release a
Ku-encoding fragment, which was inserted into the pCITE4(+)a vector
(Novagen) to provide additional flanking restriction sites. This
plasmid was digested with BamHI and NotI, and a
fragment containing the Ku gene was inserted into the pVL1393
baculovirus transfer vector (PharMingen). This plasmid was
cotransfected into Sf9 cells with linearized AcNPV baculovirus
DNA (PharMingen), and viral stocks were produced. Recombinant
Ku80
681-728 protein was produced by coinfection of Sf9 cells
with the Ku80
681-728 baculovirus and VBB2-70Ku. Mutant protein was
purified by the same method as wild type (37).
70 °C.
-32P]ATP (6000 Ci/mmol). End-joining reactions were
performed essentially as described (39). Briefly, reaction mixtures
contained 10 mM Tris-HCl, pH 7.9, 65 mM KOAc,
0.25 mM EDTA, 0.5 mM dithiothreitol, 10%
glycerol, 50 mM triethanolamine, pH 7.5, 0.7 mM
MgOAc, 100 µg/ml bovine serum albumin, 2 mM ATP, 100 ng
of purified, recombinant DNA Ligase IV/XRCC4 (39), 4 µl of
immunodepleted lymphoblast extract (see below), and purified
recombinant human Ku protein (40) or DNA-PKcs protein (41). The
reaction mixture was incubated for 10 min at 37 °C. DNA (10 ng) was
added, bringing the final volume to 20 µl. Incubation was continued
for 1 h at 37 °C. The reaction was stopped by adding 150 µl
of a solution containing 0.2 M NaCl, 0.02 M
EDTA, 1% SDS, 4 µg/ml tRNA, and 100 µl of a solution containing 10 mM Tris-HCl, pH 7.9, 1 mM EDTA, 0.1 M NaCl. Reactions were extracted with 300 µl of
phenol:chloroform:isoamyl alcohol (50:49:1 v/v/v). A solution of 0.5 M NH4OAc in ethanol was added (500 µl), the
nucleic acid precipitate was collected by centrifugation, and reaction
products were analyzed by 0.6% agarose gel electrophoresis. Ligated
products were detected by PhosphorImager analysis.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (28K):
[in a new window]
Fig. 1.
Expression of the Ku80 cDNA in xrs-6
cells increases the amount or availability of a limiting reinitiation
factor. A, experimental time course schematic. Extracts
were preincubated with the indicated amounts of circular hsp70 G-less
cassette template for 30 min at 30 °C. Transcription was initiated
by the addition of ribonucleoside triphosphates. One reaction in each
set was limited to a single round of transcription by the addition of
10 µg/ml heparin. B, transcription reactions, performed
using 50 µg of nuclear extract prepared from xrs-6cvec or xrs-6cKu80
cell lines and in the presence or absence of heparin as indicated. RNA
was isolated, subjected to urea-PAGE, and visualized by PhosphorImager
analysis. C, quantitation of data in B.
heparin lanes).
Moreover, the amount of RNA synthesis with the xrs-6cKu80 extract
increased as the amount of template increased. By contrast, the amount
of RNA synthesis with the xrs-6cvec extract showed little change as the
amount of template increased. We conclude that the introduction of a functional Ku80 gene in the xrs-6cKu80 cell line increases the amount
or availability of a component in the extract that is specifically required for multiple-round transcription. This component is evidently different than the component that limits single-round transcription, and we provisionally refer to it as the "reinitiation factor."

View larger version (38K):
[in a new window]
Fig. 2.
The Ku-dependent reinitiation
factor causes an increase in the number of transcription complexes
loaded onto the template. A, experimental time course
schematic. Two sets of transcription reactions were performed in
parallel. Extracts were preincubated with 1 µg of circular hsp70
G-less cassette template for 30 min at 30 °C. Transcription was
initiated by the addition of ribonucleoside triphosphates and was
allowed to proceed for a variable length of time. At the indicated
time, in one set of assays (Pathway 1), heparin was added to
a final concentration of 10 µg/ml. RNA chain elongation was then
allowed to proceed for an additional 30 min prior to termination of the
reaction by addition of RNase T1 and EDTA. In the other set of assays
(Pathway 2), the reaction was terminated without allowing
the additional time to complete chain elongation. B,
transcription reactions performed using pathway 1 or pathway 2 as
indicated. Transcription reaction time is shown in minutes. Reactions
contained 50 µg of either xrs-6cvec or xrs-6cKu80 nuclear extract as
indicated. RNA was isolated, analyzed, and visualized as in Fig. 1.
C, quantitation of data in B. Symbols denote
xrs-6cvec (vec) and xrs-6cKu80 (Ku80), assayed
according to pathway 1 ((1)) or pathway 2 ((2))
as indicated. Transcription is plotted in arbitrary units.
D, subtraction of the transcription levels observed in
reactions terminated with EDTA (pathway 2) from those levels observed
in reactions containing heparin (pathway 1). The difference reflects
the relative number of active elongation complexes present at each time
point.

View larger version (40K):
[in a new window]
Fig. 3.
The reinitiation factor is diffusible rather
than template-associated. A, experimental time course
schematic. The hsp70 G-less cassette DNA template was linearized,
biotinylated at one end, and bound to streptavidin-coated paramagnetic
beads as described under "Materials and Methods." 50 µg of
xrs-6cvec or xrs-6cKu80 nuclear extract was then incubated with DNA
beads containing ~1 µg of template, to allow for preinitiation
complex (PIC) formation. Following this incubation period,
extract supernatants were removed from the beads and reserved for
future use. In some cases, immobilized templates and their associated
PICs were washed in transcription buffer. Reserved supernatants were
then either added back to the same immobilized templates from which
they were derived, or they were switched and added back to the opposite
templates. Transcription was initiated by the addition of
ribonucleoside triphosphates, and the reactions were allowed to go to
completion. B, transcription reactions, performed using the
indicated sources of PICs and supernatants, with or without a wash
step. Assays were performed in duplicate. RNA was isolated, analyzed,
and visualized as in Fig. 1. C, quantitation of data in
B. Graph shows means and standard deviation.
681-728, was constructed that removes 45 amino acids
near the C terminus of Ku80. This disrupts the C-terminal domain
without impinging on the DNA binding and dimerization domains. We
coexpressed this mutant with Ku70 using baculovirus vectors in
Sf9 cells and purified the resulting heterodimeric Ku
protein as described under "Materials and Methods." SDS-PAGE
analysis with silver staining showed that the mutant protein was
homogeneous and that the concentrations of mutant and wild type Ku
protein were accurately matched (Fig.
4A).

View larger version (29K):
[in a new window]
Fig. 4.
Addition of purified Ku protein
preferentially suppresses activity of the xrs-6cKu80 extract.
A, analysis of 300 ng of purified wild type Ku (lane
1), 300 ng of purified Ku80
681-728 mutant (lane 2),
and molecular mass standards (lane 3). Proteins were
resolved by 12% SDS-PAGE and visualized by silver staining. The
positions of wild type (WT) Ku80, mutant Ku80, and Ku70 are
indicated. B, experimental time course schematic. Reactions
were performed using 50 µg of nuclear extract and ~1 µg of the
immobilized hsp70 template. When present, purified wild type human Ku80
or Ku80
681-728 protein (450 ng) was added prior to preinitiation
complex formation. C, transcription reactions (inset),
performed using extracts from xrs-6cvec (vec) or xrs-6cKu80
(Ku80) cells with or without exogenous purified Ku as
indicated. Assays were performed in duplicate. RNA was isolated,
analyzed, and visualized as in Fig. 1. Graph represents quantitation of
transcription data. Error bars denote standard
deviation.
681-728 mutant, unlike wild type Ku, nearly abolished the difference in transcription between the two extracts (Fig. 4C).
Qualitatively similar inhibition was obtained using different amounts
of wild type and mutant Ku, ranging from 150 to 450 ng/reaction (data not shown). These are relatively modest amounts of Ku, representing only a 2-6-fold molar excess of Ku over DNA ends. Although greater than the amount of Ku typically found in rodent cell extracts, they are
comparable with the levels of endogenous Ku present in human cell
extracts (see immunoblot in Fig. 7A).
681-728
mutant than with the wild type Ku protein. Because the inhibitory
activity becomes associated with the template, the results suggest that
both the exogenous mutant and the exogenous wild type Ku are capable of
DNA binding, as expected, because the mutation lies outside the
DNA-binding domain. The DNA binding activity of the mutant Ku was
confirmed directly in a subsequent experiment (see below).

View larger version (26K):
[in a new window]
Fig. 5.
Preincubation with exogenous Ku causes
loss of template activity. A, experimental time course
schematic. 50 µg of either xrs-6cvec or xrs-6cKu80 nuclear
extract was incubated with ~1 µg of the hsp70 immobilized template.
300 ng of either wild type (wt) human Ku80 or the
Ku80
681-728 mutant protein was also added as indicated prior to
preinitiation complex formation. Following this incubation
period, extract supernatants were removed from the beads,
immobilized templates and their associated preinitiation complexes were
washed in transcription buffer, and fresh extract supernatant derived
from xrs-6cKu80 bead transcription experiments was added back to the
washed beads. Transcription was then initiated by the addition of NTPs.
B, PhosphorImager analysis (inset) and
quantitation of transcription data. Assays were performed in duplicate.
Bars represent the means with standard deviations as
indicated.
687-728 mutation.
681-728 mutant bound to the DNA beads equivalently,
consistent with the fact that the mutation lies outside the DNA-binding
domain.

View larger version (39K):
[in a new window]
Fig. 6.
Sequestration of DNA-PKcs in a non-DNA
binding form in the xrs-6cKu80 extracts. Nonradioactive
transcription reactions were performed using 50 µg of either
xrs-6cvec or xrs-6cKu80 nuclear extract and ~1 µg of the
immobilized hsp70 template. 450 ng of either wild type human Ku or the
Ku80
681-728 mutant protein, purified as described under
"Materials and Methods," was added as indicated prior to
preinitiation complex formation. Transcription was initiated by
addition of NTPs. After 20 min, supernatants were removed, and the
immobilized templates were washed with transcription buffer. Samples
were then analyzed by SDS-PAGE and immunoblotting. A,
proteins were resolved by 10% SDS-PAGE and immunoblot was developed
with anti-Ku80 (monoclonal antibody S10B1). B, proteins were
resolved by 5% SDS-PAGE and immunoblot was developed with
anti-DNA-PKcs (monoclonal antibody 18-2).
687-728 Supports DNA End Joining in an in Vitro
Assay--
We have proposed that the Ku80
687-728 mutation favors a
repair-active conformation of Ku and that the presence of an excess amount of this repair-active form disrupts interactions between endogenous Ku and other proteins, including DNA-PKcs, transcription factors, or both. One of the predictions of the model is that the
mutant form of Ku should be active in DNA end joining and be capable of
productive interaction with DNA-PKcs in a repair complex. To test this
prediction, we measured repair activity in a Ku-dependent
cell-free DNA end-joining system. The system is based on human whole
cell lymphoblast extracts (38) and has been supplemented with
recombinant DNA ligase IV-XRCC4 complex. This increases ligation
efficiency and makes the system less sensitive to small changes in
buffer composition, which was important for the immunodepletion
experiments described below. Purification of DNA ligase IV-XRCC4 and
characterization of its ability to function synergistically with
endogenous repair factors has been described in detail elsewhere
(39).

View larger version (39K):
[in a new window]
Fig. 7.
Ku80
681-728
supports DNA end-joining in an in vitro assay.
12-15 µl of the GM00558 lymphoblast extract was immunodepleted with
5 µl of normal human serum (NS) or of TT serum containing
autoantibodies directed against the Ku and DNA-PKcs. 4 µl of
immunodepleted extract, 10 ng of 32P-labeled DNA substrate
and the indicated quantities of purified Ku or DNA-PKcs protein were
incubated for 1 h at 37 °C to allow for end joining.
A, immunoblot showing purified protein markers (100 ng of
Ku, 150 ng of DNA-PKcs), undepleted cell extract (15 µg of total
protein), and a similar amount of cell extract depleted with the
indicated serum. For depleted extracts, both the extract
(Sup) and the proteins precipitated in the immune complex
(Bead) are shown. B, substrate and products of
end joining reaction, resolved by 0.6% agarose gel electrophoresis,
and visualized by PhosphorImager analysis. Positions of unligated
monomer and dimer and trimer ligation products are indicated.
C, quantitation of results in B. Ratio of product
(dimer plus trimer) to total DNA was determined. All values were then
normalized to the result obtained with normal serum-depleted extract
(lane 2).
681-728 mutant protein, together with DNA-PKcs,
also restored activity, to a level comparable to that seen with wild
type (lanes 9-12). The restoration of activity by wild type
and mutant Ku showed a similar dose dependence.
687-728 behaves
differently than wild type Ku in an in vitro transcription
inhibition assay but identically in an in vitro end joining
assay demonstrates that the functions of Ku protein in transcriptional
reinitiation and in double-strand break repair are genetically separable.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (18K):
[in a new window]
Fig. 8.
Model for the regulation of Ku and DNA-PKcs
activity. A, Ku and DNA-PKcs are sequestered in a a
complex with transcription factors. The presence of Ku and DNA-PKcs
stabilizes the higher order structure of the transcription machinery,
which promotes efficient recycling of limiting protein components in
the reinitiation phase of the transcription reaction. When sequestered
in this form, Ku and DNA-PKcs are not capable of forming a high
affinity complex at DNA ends. B, in the presence of DNA
damage signals, Ku and DNA-PKcs are released and become active for DNA
end binding and repair. Simultaneously, the transcription factor
complex is disrupted, limiting its ability to facilitate rapid
reinitiation. Upon recovery, the system returns to its original
state.
One question is whether the present findings concerning the role of Ku in transcription can be generalized or whether they are unique to the CHO cells and to the in vitro systems used in our experiments. The CHO system is favorable for reinitiation studies, because the two cell lines are isogenic except for the presence of Ku, and the xrs-6cKu80 line shows an exceptionally high level of reinitiation in the presence of Ku. We note, however, that a similar but less dramatic affect on transcription has been observed in comparisons of independent CHO cell lines with and without DNA-PKcs (24). Preliminary observations also suggest a similar effect in comparisons of DNA-PKcs-deficient murine scid fibroblasts, with their isogenic, rescued sc (8)-10 cell line counterpart.2
It may be that the conditions of in vitro transcription accentuate the effect of Ku on reinitiation, particularly if a major role of Ku is to stabilize and protect a pre-existing complex of transcription factors during the preparation of nuclear extracts. We note, however, that both the Ku- and DNA-PKcs-deficient cell lines show substantially increased sensitivity to heat-induced apoptosis, consistent with destabilization of an essential cell component in the mutant cell lines (58). DNA-PKcs-deficient cells show a defect in the ability to carry out sustained high levels of hsp70 mRNA transcription, consistent with a reinitiation defect (58). Interestingly, Ku-deficient mice are smaller than their wild type littermates (59), which is consistent with the existence of a mild but general transcription defect. Similar dwarfism has been observed in mice with a small deletion in the C-terminal domain of RNA polymerase II (60).
We have not yet been able to identify the Ku-dependent reinitiation factor at the molecular level. Although this remains an important goal, activity appears to be labile to column chromatography, and we have been unsuccessful in reconstituting the activity from fractionated extracts. One possibility is that the complex between Ku and transcription factors, if it exists, is based on low affinity interactions, because we have not been able to demonstrate specific high affinity interactions between Ku and general transcription factors by biochemical methods. It may not be accurate to characterize such a complex as a "holoenzyme," comparable with the well-defined E. coli RNA polymerase holoenzyme, but even if it is short-lived, heterogeneous, or easily disrupted, it could have profound effects on reaction kinetics.
Since the initial molecular characterization of Ku protein in 1986, there have been a number of reports that Ku and its partner, DNA-PKcs,
are involved in some way in transcription, either through binding to
DNA, through phosphorylation of RNA polymerase II and transcription
factors, or through participation in multiprotein complexes. Although
these observations are suggestive, it has been difficult to demonstrate
a direct functional role for Ku or DNA-PKcs in transcription. In the
present study, we have investigated this role through an assessment of
the phenotype of Ku80 mutant cells, making no prior assumptions based
on biochemical studies. We conclude that expression of Ku80 has
dramatic effects on in vitro reinitiation rate and that this
is genetically separable from its role in end joining. We put forward a
testable model that the enhanced rate of reinitiation is a consequence
of sequestration of double-strand break repair proteins in a network of
low affinity molecular interactions with transcription proteins in the
living cell.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Yoshihiko Takeda for the generous gift of TT serum and Dr. Scott Peterson and Dr. David Chen for the gift of the xrs-6cvec and xrs-6cKu80 cell lines. We thank Rhea-Beth Markowitz, Michele Sawadogo, and Diane Hawley for helpful comments on the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported by Public Health Service Grant GM 35866 and by National Science Foundation Grant MCB-9906440.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Present address: University of Virginia's College at Wise, 1 College Avenue, Wise, VA 24293-4412.
§ Eminent Scholar of the Georgia Research Alliance. To whom correspondence should be addressed: Inst. of Molecular Medicine and Genetics, Rm. CB-2803, Medical College of Georgia, 1120 15th St., Augusta, GA 30912. Tel.: 706-721-8756; Fax: 706-721-8752; E-mail: wdynan@mail.mcg.edu.
Published, JBC Papers in Press, February 2, 2001, DOI 10.1074/jbc.M010752200
2 S. Jesch and W. S. Dynan, unpublished observations.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: RNAP II, RNA polymerase II; CHO, Chinese hamster ovary; DNA-PKcs, DNA-dependent kinase catalytic subunit; PAGE, polyacrylamide gel electrophoresis.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | O'Brien, T., and Lis, J. T. (1993) Mol. Cell. Biol. 13, 3456-3463 |
| 2. | Iyer, V., and Struhl, K. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 5208-5212 |
| 3. | Hahn, S. (1998) Cold Spring Harb. Symp. Quant. Biol. 63, 181-188 |
| 4. | Reinberg, D., Horikoshi, M., and Roeder, R. G. (1987) J. Biol. Chem. 262, 3322-3330 |
| 5. | Buratowski, S., Hahn, S., Guarente, L., and Sharp, P. A. (1989) Cell 56, 549-561 |
| 6. | Chi, T., and Carey, M. (1996) Genes Dev. 10, 2540-2550 |
| 7. | Zawel, L., Kumar, K. P., and Reinberg, D. (1995) Genes Dev. 9, 1479-1490 |
| 8. | Yean, D., and Gralla, J. (1997) Mol. Cell. Biol. 17, 3809-3816 |
| 9. | Yean, D., and Gralla, J. D. (1999) Nucleic Acids Res. 27, 831-838 |
| 10. | Szentirmay, M. N., and Sawadogo, M. (1993) EMBO J. 12, 4677-4684 |
| 11. | Dahmus, M. E. (1996) J. Biol. Chem. 271, 19009-19012 |
| 12. | Archambault, J., Pan, G., Dahmus, G. K., Cartier, M., Marshall, N., Zhang, S., Dahmus, M. E., and Greenblatt, J. (1998) J. Biol. Chem. 273, 27593-27601 |
| 13. | Cho, H., Kim, T. K., Mancebo, H., Lane, W. S., Flores, O., and Reinberg, D. (1999) Genes Dev. 13, 1540-1552 |
| 14. | Lei, L., Ren, D., Finkelstein, A., and Burton, Z. F. (1998) Mol. Cell. Biol. 18, 2130-2142 |
| 15. | Kraus, W. L., and Kadonaga, J. T. (1998) Genes Dev. 12, 331-342 |
| 16. | Oelgeschlager, T., Tao, Y., Kang, Y. K., and Roeder, R. G. (1998) Mol. Cell 1, 925-931 |
| 17. | Grande, M. A., van der Kraan, I., de Jong, L., and van Driel, R. (1997) J. Cell Sci. 110, 1781-1791 |
| 18. | Zeng, C., Kim, E., Warren, S. L., and Berget, S. M. (1997) EMBO J. 16, 1401-1412 |
| 19. | Szentirmay, M. N., and Sawadogo, M. (2000) Nucleic Acids Res. 28, 2019-2025 |
| 20. | Maldonado, E., Shiekhatter, R., Sheldon, M., Cho, H., Drapkin, R., Rickert, P., Lees, E., Anderson, C. W., Linn, S., and Reinberg, D. (1996) Nature 381, 86-89 |
| 21. | Chao, D. M., Gadbois, E. L., Murray, P. J., Anderson, S. F., Sonu, M. S., Parvin, J. D., and Young, R. A. (1996) Nature 380, 82-85 |
| 22. | Hampsey, M., and Reinberg, D. (1999) Curr. Opin. Genet. Dev. 9, 132-139 |
| 23. | Myer, V. E., and Young, R. A. (1998) J. Biol. Chem. 273, 27757-27760 |
| 24. | Woodard, R. L., Anderson, M. G., and Dynan, W. S. (1999) J. Biol. Chem. 274, 478-485 |
| 25. | Jeggo, P. A., and Kemp, L. M. (1983) Mutation Res. 112, 313-327 |
| 26. | Singleton, B. K., Priestley, A., Steingrimsdottir, H., Gell, D., Blunt, T., Jackson, S. P., Lehmann, A. R., and Jeggo, P. A. (1997) Mol. Cell. Biol. 17, 1264-1273 |
| 27. | Dynan, W. S., and Yoo, S. (1998) Nucleic Acids Res. 26, 1551-1559 |
| 28. | Smith, G. C., and Jackson, S. P. (1999) Genes Dev. 13, 916-934 |
| 29. | Schaeffer, L., Roy, R., Humbert, S., Moncollin, V., Vermeulen, W., Hoeijmakers, J. H., Chambon, P., and Egly, J. M. (1993) Science 260, 58-63 |
| 30. | Svejstrup, J. Q., Wang, Z., Feaver, W. J., Wu, X., Bushnell, D. A., Donahue, T. F., Friedberg, E. C., and Kornberg, R. D. (1995) Cell 80, 21-28 |
| 31. | Coin, F., Bergmann, E., Tremeau-Bravard, A., and Egly, J. M. (1999) EMBO J. 18, 1357-1366 |
| 32. | Coin, F., and Egly, J. M. (1998) Cold Spring Harb. Symp. Quant. Biol. 63, 105-110 |
| 33. | Balajee, A. S., May, A., Dianov, G. L., Friedberg, E. C., and Bohr, V. A. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 4306-4311 |
| 34. | Dianov, G. L., Houle, J. F., Iyer, N., Bohr, V. A., and Friedberg, E. C. (1997) Nucleic Acids Res. 25, 3636-3642 |
| 35. | Chen, F., Peterson, S. R., Story, M. D., and Chen, D. J. (1996) Mutat. Res. 362, 9-19 |
| 36. | Ono, M., Tucker, P. W., and Capra, J. D. (1994) Nucleic Acids Res. 22, 3918-3924 |
| 37. | Yoo, S., Kimzey, A., and Dynan, W. S. (1999) J. Biol. Chem. 274, 20034-20039 |
| 38. | Baumann, P., and West, S. C. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 14066-14070 |
| 39. | Lee, K. J., Huang, J., Takeda, Y., and Dynan, W. S. (2000) J. Biol. Chem. 275, 34787-34796 |
| 40. | Huang, J., Nueda, A., Yoo, S., and Dynan, W. S. (1997) J. Biol. Chem. 272, 26009-26016 |
| 41. | Dvir, A., Stein, L. Y., Calore, B. L., and Dynan, W. S. (1993) J. Biol. Chem. 268, 10440-10447 |
| 42. | Dynan, W. S., and Burgess, R. R. (1979) Biochemistry 18, 4581-4588 |
| 43. | Arias, J. A., and Dynan, W. S. (1989) J. Biol. Chem. 264, 3223-3229 |
| 44. | Han, Z., Johnston, C., Reeves, W. H., Carter, T., Wyche, J. H., and Hendrickson, E. A. (1996) J. Biol. Chem. 271, 14098-14104 |
| 45. | Gell, D., and Jackson, S. P. (1999) Nucleic Acids Res. 27, 3494-3502 |
| 46. | Singleton, B. K., Torres-Arzayus, M. I., Rottinghaus, S. T., Taccioli, G. E., and Jeggo, P. A. (1999) Mol. Cell. Biol. 19, 3267-3277 |
| 47. | Paillard, S., and Strauss, F. (1993) Proteins 15, 330-337 |
| 48. | Han, Z., Chatterjee, D., He, D. M., Early, J., Pantazis, P., Wyche, J. H., and Hendrickson, E. A. (1995) Mol. Cell. Biol. 15, 5849-5857 |
| 49. | Carter, T., Vancurova, I., Sun, I., Lou, W., and DeLeon, S. (1990) Mol. Cell. Biol. 10, 6460-6471 |
| 50. | West, R. B., Yaneva, M., and Lieber, M. R. (1998) Mol. Cell. Biol. 18, 5908-5920 |
| 51. | Hammarsten, O., and Chu, G. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 525-530 |
| 52. | Chen, L., Trujillo, K., Sung, P., and Tomkinson, A. E. (2000) J. Biol. Chem. 275, 26196-26205 |
| 53. | Nick McElhinny, S. A., Snowden, C. M., McCarville, J., and Ramsden, D. A. (2000) Mol. Cell. Biol. 20, 2996-3003 |
| 54. | Chan, D. W., Ye, R., Veillette, C. J., and Lees-Miller, S. P. (1999) Biochemistry 38, 1819-1828 |
| 55. | Giffin, W., Torrance, H., Rodda, D. J., Prefontaine, G. G., Pope, L., and Hache, R. J. G. (1996) Nature 380, 265-268 |
| 56. | Yoo, S., and Dynan, W. S. (1998) Biochemistry 37, 1336-1343 |
| 57. | Peterson, S. E., Stellwagen, A. E., Diede, S. J., Singer, M. S., Haimberger, Z. W., Johnson, C. O., Tzoneva, M., and Gottschling, D. E. (2001) Nat. Genet. 27, 64-67 |
| 58. | Nueda, A., Hudson, F., Mivechi, N. F., and Dynan, W. S. (1999) J. Biol. Chem. 274, 14988-14996 |
| 59. | Nussenzweig, A., Chen, C., da Costa Soares, V., Sanchez, M., Sokol, K., Nussenzweig, M. C., and Li, G. C. (1996) Nature 382, 551-555 |
| 60. | Litingtung, Y., Lawler, A. M., Sebald, S. M., Lee, E., Gearhart, J. D., Westphal, H., and Corden, J. L. (1999) Mol. Gen. Genet. 261, 100-105 |
This article has been cited by other articles:
![]() |
L. Shi, D. Qiu, G. Zhao, B. Corthesy, S. Lees-Miller, W. H. Reeves, and P. N. Kao Dynamic binding of Ku80, Ku70 and NF90 to the IL-2 promoter in vivo in activated T-cells Nucleic Acids Res., April 1, 2007; 35(7): 2302 - 2310. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Bladen, W. K. Lam, W. S. Dynan, and D. J. Kozlowski DNA damage response and Ku80 function in the vertebrate embryo Nucleic Acids Res., May 24, 2005; 33(9): 3002 - 3010. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Mayeur, W.-J. Kung, A. Martinez, C. Izumiya, D. J. Chen, and H.-J. Kung Ku Is a Novel Transcriptional Recycling Coactivator of the Androgen Receptor in Prostate Cancer Cells J. Biol. Chem., March 18, 2005; 280(11): 10827 - 10833. [Abstract] [Full Text] [PDF] |