JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M011177200 on February 2, 2001

J. Biol. Chem., Vol. 276, Issue 18, 15434-15440, May 4, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/18/15434    most recent
M011177200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wakasugi, M.
Right arrow Articles by Matsunaga, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wakasugi, M.
Right arrow Articles by Matsunaga, T.

Damaged DNA-binding Protein DDB Stimulates the Excision of Cyclobutane Pyrimidine Dimers in Vitro in Concert with XPA and Replication Protein A*

Mitsuo WakasugiDagger §, Mayuko ShimizuDagger , Hiroshi Morioka, Stuart Linn||, Osamu NikaidoDagger , and Tsukasa MatsunagaDagger **

From the Dagger  Faculty of Pharmaceutical Sciences, Kanazawa University, Kanazawa 920-0934, Japan,  Graduate School of Pharmaceutical Sciences, Hokkaido University, Sapporo 060-0812, Japan, and || Division of Biochemistry and Molecular Biology, University of California, Berkeley, California 94720-3202

Received for publication, December 12, 2000, and in revised form, February 1, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Human cells contain a protein that binds to UV-irradiated DNA with high affinity. This protein, damaged DNA-binding protein (DDB), is a heterodimer of two polypeptides, p127 and p48. Recent in vivo studies suggested that DDB is involved in global genome repair of cyclobutane pyrimidine dimers (CPDs), but the mechanism remains unclear. Here, we show that in vitro DDB directly stimulates the excision of CPDs but not (6-4)photoproducts. The excision activity of cell-free extracts from Chinese hamster AA8 cell line that lacks DDB activity was increased 3-4-fold by recombinant DDB heterodimer but not p127 subunit alone. Moreover, the addition of XPA or XPA + replication protein A (RPA), which themselves enhanced excision, also enhanced the excision in the presence of DDB. DDB was found to elevate the binding of XPA to damaged DNA and to make a complex with damaged DNA and XPA or XPA + RPA as judged by both electrophoretic mobility shift assays and DNase I protection assays. These results suggest that DDB assists in the recognition of CPDs by core NER factors, possibly through the efficient recruitment of XPA or XPA·RPA, and thus stimulates the excision reaction of CPDs.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Nucleotide excision repair (NER)1 is the major mechanism for removing bulky DNA lesions including cyclobutane pyrimidine dimers (CPDs) and (6-4)photoproducts induced by sun light in humans (1-4). The basic reaction mechanism of NER is highly conserved from yeast to human. The core reaction from DNA damage recognition to excision of the damage is accomplished by six repair factors (XPA, RPA, XPC·HR23B, TFIIH, XPF·ERCC1, XPG), so called excision nuclease (excinuclease) (5-8). The recent development of reconstituted systems using highly purified proteins has enabled analyses of the detailed reaction mechanism of NER (7-10). In yeast, some accessory or regulatory factors such as Rad7·Rad16 complex (11-13), ABF1 (14), and MMS19 (15-16) have been reported to help mediate NER. The existence of such factors in humans, however, has not been clearly demonstrated.

Damaged DNA-binding protein (DDB) is one of the candidates that might play such an accessory role in human cells. DDB is composed of two subunits, p127 and p48, and has a higher affinity for various types of DNA lesions compared with the damage recognition subunits (XPA, RPA, XPC·HR23B, and TFIIH) of the six core repair factors (17-19). DDB activity has been shown to be missing in a subset of xeroderma pigmentosum group E (XP-E) patients. XP is an autosomal recessive disease associated with abnormal sensitivity to UV lights and a high incidence of skin cancer, which is known to be caused by defects in NER. XP-E is one of eight genetic complementation groups (XP-A through XP-G and XP-V) of XP patients, and, along with XP-V, manifests the mildest clinical features and deficiency in NER. XP-E individuals lacking DDB activity were found to carry mutations in p48 gene (20-23). Because of its high specificity for binding to damaged DNA and a defect in some XP-E cells, DDB has been postulated to be involved in the NER process, presumably in a damage recognition step. However, DDB is clearly not essential for NER in several in vitro reconstituted systems, and its precise role in the damage recognition process has not been demonstrated so far (24-27). However, recent in vivo studies clearly showed that XP-E cells and rodent cells lacking DDB activity are selectively defective in global genome repair (GGR) of CPDs, and transfection of the p48 gene into the rodent cells complements the deficiencies (28, 29), suggesting that DDB may be involved in GGR especially for CPDs.

For this study, we have overproduced DDB in a baculovirus/insect cell system, purified it to near homogeneity, and tested its effect upon in vitro excision reactions with DNA substrates containing either a single CPD or a single (6-4)photoproduct. Indeed the recombinant DDB stimulated the excision rate of CPDs by cell-free extracts (CFEs) prepared from AA8 Chinese hamster ovary cell lines that lack DDB activity, and the stimulatory effect was enhanced in the presence of XPA or XPA + RPA. We also observed that DDB forms a complex with XPA and RPA at the damage sites based on electrophoretic mobility shift assays and DNase I protection assays. These results provide direct biochemical evidence that DDB can be involved in the recognition process of CPDs in NER.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Plasmid Constructs-- To overproduce FLAG-tagged DDB subunits in insect cells, 5'-terminal portions of cDNAs with FLAG epitope sequences were amplified by polymerase chain reactions using the primers for p127 (5'-CGCGGACCATGGACTACAAGGACGACGATGACAAGATGTCGTACAACTACGTGG-3' and 5'-ATTGAATTCCTTTTCTCGG-3') or for p48 (5'- CGCGGATCCATGGACTACAAGGACGACGATGACAAGATGGCTCCCAAGAAACGC-3' and 5'-CATGAATTCTCCCCCTTTGG-3') and digested with BamHI and EcoRI. These fragments of 0.6 kilobases for p127 and 0.4 kilobases for p48 were individually subcloned into the pFASTBac1 expression vector (Life Technologies, Inc.), and the sequences of the inserted portions were verified. The remaining 3'-terminal regions of p127 or p48 cDNA were excised from the original constructs (30) with BstEII and NotI or BstXI and NotI, respectively, and inserted into the pFASTBac1 constructs containing each 5'terminal portions to give the complete cDNAs.

Protein Expression and Purification-- Recombinant baculoviruses encoding the p127 or p48 subunit were prepared according to the manufacturer's protocol. Sf21 insect cells were co-infected with both viruses to jointly express p127 and p48 or with the p127 virus alone and incubated at 27 °C for 42-48 h. After collecting the cells by centrifugation, extracts were prepared by method of Manley et al. (31) and dialyzed against storage buffer (25 mM Hepes-KOH (pH 7.9), 100 mM KCl, 12 mM MgCl2, 1 mM EDTA, 2 mM dithiothreitol, 12.5% glycerol). The extracts were first applied to SP-Sepharose (Amersham Pharmacia Biotech) equilibrated with buffer A (25 mM Hepes-KOH (pH 7.9), 12 mM MgCl2, 1 mM EDTA, 2 mM dithiothreitol, 10% glycerol) containing 100 mM KCl. After extensive washing with buffer A containing 100 mM KCl, the recombinant proteins were eluted with a linear gradient of KCl (0.1-1 M) in buffer A and identified by Western blotting using anti-FLAG antibody. The eluted proteins were directly applied to a column containing anti-FLAG M2 affinity gels (Sigma) and washed extensively with buffer A containing 0.15 M KCl. The proteins were eluted with 5 column volumes of buffer A containing 0.15 M KCl and 2 mg/ml FLAG peptides, dialyzed against the storage buffer, and stored at -80 °C.

Recombinant RPA and (His)6-XPA were expressed in Escherichia coli and purified as described (7, 32). XPC·HR23B heterodimer was expressed in Sf21 cells and purified as described previously (33). The recombinant virus encoding XPC·HR23B was kindly provided by Drs. J. T. Reardon and A. Sancar (University of North Carolina). The activities of these purified repair factors were verified by an in vitro complementation assay or reconstitution assay.

Substrates-- Duplex DNA substrates (56 bp for binding assays and DNase I protection assays and 136 bp for excision assays) that contained a cis-syn-cyclobutane pyrimidine dimer or a (6-4)photoproduct in the center were constructed from 4 and 6 blocks of oligomer, respectively. Details for sequences and preparations of these substrates have been described (34, 35). All substrates were internally labeled with 32P at the 4th phosphate 5' to the photoproduct.

Excision Repair Assay-- Cell-free extracts (CFEs) were prepared by the method of Manley et al. (31). The standard reaction mixture contained 3-6 fmol of 136-bp substrate, the indicated recombinant proteins, and 50 µg of CFE prepared from AA8 cells in 25 µl of reaction buffer (32 mM Hepes-KOH (pH 7.9), 64 mM KCl, 6.44 mM MgCl2, 0.16 mM dithiothreitol, 0.16 mM EDTA, 2 mM ATP, and 4% glycerol). Normally, the substrates were first incubated with the indicated recombinant proteins at 30 °C for 10 min, CFE was added, and incubation was continued for 45 min. DNAs were extracted with phenol/chloroform/isoamyl alcohol and separated on 8% denaturing polyacrylamide gels. Excision products were visualized by autoradiography, or the signals were quantified by exposing gels to Bas2000 imaging screens, and the intensities were measured with a Fuji Bas2000 Bioimaging Analyzer.

Electrophoretic Mobility Shift Assay-- Two fmol of 32P-labeled 56-bp substrates were incubated with the indicated amounts of recombinant proteins or CFE at 30 °C for 20 min in 25 µl of reaction buffer. The protein·DNA complexes were separated by electrophoresis on 5% nondenaturing polyacrylamide gels at 25 mA for 2 h and analyzed by autoradiography. To identify the compositions of protein·DNA complexes, specific antibodies were added after the complex formation. Monoclonal antibodies against FLAG and hexahistidine tags were obtained from Sigma and Amersham Pharmacia Biotech, respectively. Polyclonal antibodies against the p34 subunit of RPA were purchased from Oncogene Science.

DNase I Protection Assay-- The internally labeled 56-bp substrates (2 fmol) were incubated with the indicated amounts of proteins in 25 µl of reaction buffer at 30 °C for 20 min and then digested with 700 units of DNase I (Life Technologies, Inc.) in the presence of 3.8 mM CaCl2. The products were purified, separated on 10% denaturing polyacrylamide gels, and analyzed by autoradiography.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Overproduction and Purification of DDB Heterodimer and p127 Subunit-- To investigate the effect of DDB on in vitro excision repair reaction, we have overproduced DDB heterodimer (p127 and p48) or p127 subunit alone in baculovirus/insect cell system. An 8-amino acid FLAG epitope fused at the N termini of both polypeptides (p127 and p48) facilitated the purification of the recombinant proteins. After a two-step separation with SP-Sepharose and an anti-FLAG M2 affinity gel, the near homogeneous proteins (Fig. 1A) were tested for DDB activity by electrophoretic mobility shift assay (EMSA) (Fig. 1B). The heterodimeric DDB specifically bound to a 56-bp duplex containing a (6-4)photoproduct (lanes 7 and 8), and the mobility of the complex was identical to that with the native DDB (lanes 3 and 4) from HeLa cell-free extracts. However, the recombinant p127 protein alone did not bind to DNA either with or without a (6-4)photoproduct (lanes 9 and 10), consistent with previous reports (36, 37). We also compared the binding ability of the DDB to a 56-mer duplex DNA containing a single CPD or a (6-4)photoproduct (Fig. 1C). As expected, DDB showed a clear preference for the DNA duplex with a (6-4)photoproduct (lanes 10-12) over the undamaged DNA probe (lanes 2-4), and it also showed a moderate preference for the DNA probe containing the CPD (lanes 6-8).


View larger version (26K):
[in this window]
[in a new window]
  		Fig. 1.   Damage-specific DNA binding activity of purified recombinant DDB protein. A, purified recombinant DDB heterodimer (lane 1) and p127 subunit (lane 2) were analyzed by 10% SDS-polyacrylamide gel electrophoresis followed by staining with GelCode Blue stain reagent (Pierce). B, 32P-labeled 56-bp duplex DNA (2 fmol) either with or without a (6-4)photoproduct was incubated at 30 °C for 20 min with 10 µg of CFE prepared from HeLa (lanes 3 and 4) or AA8 (lanes 5 and 6) cell lines or 70 ng of recombinant DDB heterodimer (lanes 7 and 8) and p127 subunit (lanes 9 and 10). It should be noted that 2 µg of poly(dI-dC)·poly(dI-dC) was added to the reaction in this particular experiment to reduce nonspecific binding. The reaction mixtures were separated on a 5% nondenaturing polyacrylamide gel and analyzed by autoradiography. C, two fmol of 32P-labeled 56-bp duplex DNA with or without a lesion (CPD or (6-4)photoproduct) was incubated with the indicated amount of DDB at 30 °C for 20 min. The protein-DNA complexes were visualized by autoradiography after electrophoresis on a 5% nondenaturing gel.

Effects of DDB on in Vitro Nucleotide Excision Repair Reaction with CHO AA8 Cell-free Extracts-- To test the effect of the recombinant DDB on an in vitro excision reaction with a CPD-containing DNA substrate, we prepared CFEs from CHO AA8 cells, which have been shown to lack p48 expression and, consequently, DDB activity (29, 36). Fig. 1B (lanes 5 and 6) confirmed that there is no binding activity in AA8 CFEs. The 136-bp substrate with a single CPD was preincubated with DDB heterodimer or p127 alone (as a control) and subsequently incubated with AA8 CFE (Fig. 2A). DDB (lane 2), but not p127 alone (lane 3), stimulated the excision reaction by AA8 CFEs ~3-fold, in agreement with in vivo data that when CHO V79 cells were transfected with the p48 gene DDB activity reappeared along with GGR of CPDs (29). This stimulation was also dependent on the concentration of DDB (Fig. 2B). On the other hand, when the DNA substrate containing a (6-4)photoproduct was used, the same amount of DDB (280 ng) greatly inhibited the excision reaction (Fig. 2A, lanes 4 and 5). Since DDB binds to a (6-4)photoproduct more efficiently than a CPD, as shown in Fig. 1C, a similar experiment with less DDB was carried out (Fig. 2C). Under this condition, DDB up to 13.2 ng did not affect the excision level of (6-4)photoproducts by AA8 CFEs. It should be noted that the excision amount of (6-4)photoproducts is much higher than that of CPDs (3.0% versus 0.06%). Thus DDB might help the recognition of CPDs by the core NER proteins.


View larger version (27K):
[in this window]
[in a new window]
  		Fig. 2.   Effects of DDB on in vitro nucleotide excision repair reaction by AA8 CFEs. A, six or 3 fmol of internally labeled 136-bp substrates containing a CPD (lanes 1-3) or (6-4)photoproduct (lanes 4-6) were incubated at 30 °C for 10 min with 280 ng of DDB heterodimer or p127 subunit, and then 50 µg of AA8 CFE was added to each mixture, and incubation was continued for 45 min. DNAs were then extracted, separated on a 8% sequencing gel, and detected by autoradiography. B, three fmol of internally labeled substrates containing a CPD were incubated at 30 °C for 10 min with the indicated amounts of DDB, and then 50 µg of AA8 CFE was added to each mixture. After the incubation for the indicated periods, DNAs were extracted and separated on a 8% sequencing gel. Excision products were quantitated with an image analyzer. Bars indicate S.D. from three independent experiments. C, three fmol of internally labeled substrates containing a (6-4)photoproduct and the indicated amounts of DDB were incubated at 30 °C for 10 min, AA8 CFE was added to each mixture, and incubation was continued for 45 min. The DNA was then extracted and analyzed by autoradiography after electrophoresis on a 8% sequencing gel.

Enhancement of the DDB-stimulated Excision Reaction by XPA and RPA-- To investigate the functional interaction between DDB and the predicted damage recognition subunits of the NER factors, DNA substrate with a CPD was preincubated with DDB in the presence of RPA, XPA, XPA + RPA, or XPC·HR23B before the addition of AA8 CFE. As shown in Fig. 3A, the stimulatory effect (lane 2, ~4-fold) of DDB on the excision of CPDs was further enhanced by XPA (lane 4, to ~7-fold) or XPA + RPA (lane 5, to ~10-fold) but not with RPA (lane 3) or XPC·HR23B (lane 6). The individual repair factors show some stimulatory effect in the absence of DDB (lanes 7-10), and the effects of DDB and XPA or XPA + RPA appear to be additive. Interestingly, when the DNA substrates with a (6-4)photoproduct were used (Fig. 3B), the inhibitory effect of DDB on the excision reaction was apparently reversed by XPA (lane 4) or XPA + RPA (lane 5) but not by RPA (lane 3) or XPC·HR23B (lane 6). These results suggest that XPA and RPA might be directly involved in the DDB-stimulated excision reaction of CPDs.


View larger version (60K):
[in this window]
[in a new window]
  		Fig. 3.   Cooperative stimulation of excision reaction of CPDs by DDB, XPA, and RPA. Six or 3 fmol of internally labeled 136-bp substrates containing a CPD (A) or a (6-4)photoproduct (B) was preincubated at 30 °C for 10 min with DDB (210 or 70 ng) in the presence of XPA (360 ng), RPA (300 ng), XPA (360 ng) + RPA (300 ng), or XPC·HR23B (20 ng). Fifty µg of AA8 CFE was added to the reaction mixture, and incubation was continued for 45 min. The DNA was then extracted, separated on 8% sequencing gels, and detected by autoradiography. The relative excision levels were determined by an image analyzer and are shown in the bottom panels. Bars indicate S.D. from three independent experiments.

Complex Formation of DDB with XPA and RPA on a Damaged Site-- To determine whether DDB forms a complex with XPA and/or RPA on a damaged DNA, we first employed EMSA with various pairwise combinations of DDB, XPA, and RPA (Fig. 4). Since we had a special interest in the possible ability of DDB to recruit XPA or RPA onto a damaged DNA, we chose conditions under which XPA or RPA alone barely bound to the DNA probes (Fig. 4, A and B, lane 2). A combination of DDB and XPA (Fig. 4A) produced a shifted band (lane 4) that migrated more slowly than the DDB·DNA complex (lane 3). Moreover, the addition of specific antibodies to XPA (alpha -His, lane 5) or DDB (alpha -FLAG, lane 6) supershifted all of this band. These data indicate that DDB enhances the binding of XPA to CPD-containing DNA and makes a ternary complex of DDB·XPA·DNA. On the other hand, another combination, DDB and RPA (Fig. 4B), gave a more intense band compared with RPA alone (lane 2 versus lane 4). This band appears to contain RPA·DNA complex and DDB·RPA·DNA complex since the band was partially supershifted by alpha -FLAG antibody (lane 6). These data indicate the potential complex formation of DDB·RPA·DNA, which shows nearly the same mobility as the RPA·DNA complex, consistent with a previous report (38).


View larger version (43K):
[in this window]
[in a new window]
  		Fig. 4.   Ternary complex formation of DDB, XPA, and RPA on a damaged DNA. Two fmol of 32P-labeled 56-bp duplex DNA containing a CPD was incubated at 30 °C for 20 min with the indicated combinations of proteins (70 ng of DDB, 300 ng of RPA, 360 ng of XPA). In supershift assays, antibodies were subsequently added to the mixture and incubated for 10 min on ice. DNA-protein complexes were separated on 5% nondenaturing gels and visualized by autoradiography.

Finally, we mixed all three factors with the DNA probe to test whether a higher order complex forms. As shown in Fig. 4C, only one retarded band was observed (lane 5), which was supershifted by all of the specific antibodies to these factors (lanes 6-8), indicating that this retarded band contains DDB·XPA·RPA·DNA. We believe that the band in lane 5 is different from the band in lane 4 for the following reason. When we added alpha -His antibody to the reaction containing RPA and DDB, as in lane 4, we could not observe any supershifted band (data not shown). However, alpha -His antibody supershifted more than 90% of the complex as shown in lane 6.

To determine whether the three factors make a complex at a damaged site or bind independently, we conducted a DNase I protection assay (39) using DNA probes containing a (6-4)photoproduct and internal 32P label at the 4th phosphate bond 5' to the lesion. This fragment was chosen for these studies due to the inability of CPD-containing substrates to show clear signals in the DNase I protection assay (data not shown). After incubation with DDB and/or XPA + RPA, the probes were extensively digested with DNase I to determine the size of the DNA region that was protected from DNase I digestion (Fig. 5). DDB alone conferred a specific and distinctive band of 9 nucleotides (lane 4) in addition to nonspecific bands of 4-6 nucleotides, indicating the presence of a DDB·DNA complex around a damaged site. On the other hand, XPA and RPA protected a larger DNA region ranging between 11 and 17 nucleotides (lane 8) in a damage-dependent manner. Strikingly, the mixing of all three factors, DDB, XPA, and RPA, led to a drastic increase in the protection levels, and the size of the protected DNA region was smaller than with XPA and RPA (lane 6). These results are consistent with specific and tight complex formation around a damaged site by DDB and XPA·RPA.


View larger version (46K):
[in this window]
[in a new window]
  		Fig. 5.   Protection of DNase I digestion around a damaged site by DDB and the effects of XPA and RPA. Two fmol of internally labeled 56-bp duplex DNA with or without a (6-4)photoproduct was incubated at 30 °C for 20 min with the indicated combination of proteins (52 ng of DDB, 100 ng of RPA, 60 ng of XPA). Seven hundred units of DNase I was subsequently added to the mixtures, and reactions were incubated at room temperature for 5 min. After purification of DNA and separation on a 10% sequencing gel, the protected fragments were detected by autoradiography. The positions of size markers are shown on the left.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

DDB Stimulates the Excision of CPDs in Vitro-- This paper provides the direct evidence that DDB stimulates the excision reaction of CPDs in vitro, consistent with the recent report that DDB activity correlates well with the GGR activity of CPDs in intact cells (28, 29). Previous attempts to observe the effect of DDB on in vitro NER reactions have either shown little effect or inhibition (24-27). One possible reason would be that the substrates used in those studies contained non-CPD lesions: UV-irradiated plasmid DNA containing (6-4)photoproducts as well as CPDs (24), linear duplexes containing a (6-4)photoproduct or a cholesterol moiety (25), covalent closed circular DNA containing a single cisplatin lesion (26), or a mononucleosome containing a (6-4)photoproduct (27). In fact, we also failed to observe a stimulatory effect of DDB using (6-4)photoproduct-containing DNA substrates. Preferential binding of excision repair factors RPA, XPA, or XPC·HR23B to non-CPD lesions has been reported (33, 40-46). The recognition of these non-CPD lesions might be properly achieved by these repair factors, at least in vitro, regardless of the presence or absence of DDB. On the contrary, cis-syn-CPD is a poor substrate for in vitro NER reactions, as shown in Fig. 2, and there have been no reports of preferential binding of the core NER factors to CPDs. The preferential binding of CPD-containing DNA substrates (Fig. 1C) may assist core repair factors to recognize CPDs.

In Vitro Effect of DDB on the Excision of a (6-4)Photoproduct-- Could DDB not be involved in the repair of (6-4)photoproducts? In vivo repair studies (28, 47, 48) do not support this idea. The repair of (6-4)photoproducts in XP-E cells lacking DDB activity is significantly slower compared with normal cells, indicating the partial involvement of DDB in the repair of (6-4)photoproducts in vivo. In intact cells, DDB may be required for the recognition of (6-4)photoproducts at some parts of the genome. Alternatively, a possible role of DDB in the repair of DNA in chromatin may be implicated, as suggested by others (26). Why DDB inhibits the excision of (6-4)photoproducts at higher concentrations (Fig. 2) is not known at present. A similar inhibitory effect of DDB also has been reported in a reconstituted system under XPA- or RPA-limiting conditions (25). DDB has an ~10-fold higher affinity for (6-4)photoproducts compared with CPDs (18), and at high concentrations, the second band, with slower migration, increases relative to the first band in EMSA (Fig. 1C). This form of the complex might inhibit the binding of core NER factors and the complex formation of human excision nuclease.

Functional Interaction between DDB, XPA, and RPA-- Another noteworthy finding in this study is that the stimulatory effect of DDB on the excision of CPDs was further enhanced in the presence of XPA or XPA + RPA (Fig. 3A). Interestingly, the inhibitory effect of DDB on the excision of (6-4)photoproducts was also suppressed by the presence of these factors (Fig. 3B). These observations have a good correlation with the complex formation detected by EMSA (Fig. 4). XPA, which readily made a complex with DDB on a damaged DNA, could enhance the stimulatory effect of DDB, whereas RPA, which partially made a complex with DDB, could not. Analogously, the combination of XPA and RPA made a complex with DDB as well as enhanced the stimulation of DDB. Furthermore, the binding of XPA to damaged DNA was profoundly enhanced in the presence of DDB (Fig. 4A). These results strongly suggest a functional link between DDB and XPA in the efficient repair of CPDs in vitro. Taken together, we propose the following model. DDB binds to a CPD in DNA, providing the kink or bending of DNA, as shown by others (18, 19), and facilitates the recruitment of XPA or XPA together with RPA to the CPD site possibly through protein-protein interaction with XPA. The complex formation at a damaged site by these three factors may lead to the subsequent excision reaction.

In this study, we failed to obtain an indication of a functional interaction between DDB and XPC·HR23B based on the in vitro excision assays (Fig. 3) and EMSA (data not shown). This observation is consistent with the recent report (49) that DDB and XPC·HR23B bind to UV-damaged DNA independently as judged by EMSA. These results were rather unexpected because XPC·HR23B has been already known to be involved in GGR of CPDs (50, 51) and was also proposed to be a primary damage recognition factor (45). Other unidentified factors suggested by others (28) or XPA·RPA might be needed to link DDB and XPC·HR23B. The further analysis is needed to verify this model and clarify the higher order complex formation.

    ACKNOWLEDGEMENTS

We thank Drs. J. T. Reardon and A. Sancar (University of North Carolina at Chapel Hill) for the baculovirus encoding XPC·HR23B heterodimer, the constructs for the expression of repair factors, and critical comments on the manuscript.

    FOOTNOTES

* This work was supported by grants from Ministry of Education, Science, and Culture of Japan.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Supported by Research Fellowships of the Japan Society for the Promotion of Science for Young Scientists.

** To whom correspondence should be addressed: Faculty of Pharmaceutical Sciences, Kanazawa University, 13-1 Takara-machi, Kanazawa 920-0934, Japan. Tel.: 81-76-234-4487; Fax: 81-76-234-4427; E-mail: matsukas@kenroku.kanazawa-u.ac.jp.

Published, JBC Papers in Press, February 2, 2001, DOI 10.1074/jbc.M011177200

    ABBREVIATIONS

The abbreviations used are: NER, nucleotide excision repair; DDB, damaged DNA-binding protein; CPD, cyclobutane pyrimidine dimer; RPA, replication protein A; CFE, cell-free extract; XP-E, xeroderma pigmentosum group E; GGR, global genome repair; EMSA, electrophoretic mobility shift assay; bp, base pair(s).

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Friedberg, E. C., Walker, G. C., and Siede, W. (1995) DNA Repair and Mutagenesis , pp. 191-357, American Society for Microbiology, Washington, D. C.
2. Sancar, A. (1996) Annu. Rev. Biochem. 65, 43-81
3. Wood, R. D. (1996) Annu. Rev. Biochem. 65, 135-167
4. de Laat, W. L., Jaspers, N. G. J., and Hoeijmakers, J. H. J. (1999) Genes Dev. 13, 768-785
5. Mu, D., Park, C. -H., Matsunaga, T., Hsu, D. S., Reardon, J. T., and Sancar, A. (1995) J. Biol. Chem. 270, 2415-2418
6. Guzder, S. N., Habraken, Y., Sung, P., Prakash, L., and Prakash, S. (1995) J. Biol. Chem. 270, 12973-12976
7. Mu, D., Hsu, D. S., and Sancar, A. (1996) J. Biol. Chem. 271, 8285-8294
8. Araújo, S. J., Tirode, F., Coin, F., Pospiech, H., Syväoja, J. E., Stucki, M., Hübscher, U., Egly, J. -M., and Wood, R. D. (2000) Genes Dev. 14, 349-359
9. Mu, D., Wakasugi, M., Hsu, D. S., and Sancar, A. (1997) J. Biol. Chem. 272, 28971-28979
10. Wakasugi, M., and Sancar, A. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 6669-6674
11. Guzder, S. N., Sung, P., Prakash, L., and Prakash, S. (1997) J. Biol. Chem. 272, 21665-21668
12. Guzder, S. N., Sung, P., Prakash, L., and Prakash, S. (1998) J. Biol. Chem. 273, 6292-6296
13. Reed, S. H., You, Z. Y., and Friedberg, E. C. (1998) J. Biol. Chem. 273, 29481-29488
14. Reed, S. H., Akiyama, M., Stillman, B., and Friedberg, E. C. (1999) Genes Dev. 13, 3052-3058
15. Lauder, S., Bankmann, M., Guzder, S. N., Sung, P., Prakash, L., and Prakash, S. (1996) Mol. Cell. Biol. 16, 6783-6793
16. Lombaerts, M., Tijsterman, M., Verhage, R. A., and Brouwer, J. (1997) Nucleic Acids Res. 25, 3974-3979
17. Keeney, S., Chang, G. J., and Linn, S. (1993) J. Biol. Chem. 268, 21293-21300
18. Reardon, J. T., Nichols, A. F., Keeney, S., Smith, C. A., Taylor, J. -S., Linn, S., and Sancar, A. (1993) J. Biol. Chem. 268, 21301-21308
19. Fujiwara, Y., Masutani, C., Mizukoshi, T., Kondo, J., Hanaoka, F., and Iwai, S. (1999) J. Biol. Chem. 274, 20027-20033
20. Chu, G., and Chang, E. (1988) Science 242, 564-567
21. Kataoka, H., and Fujiwara, Y. (1991) Biochem. Biophys. Res. Commun. 175, 1139-1143
22. Keeney, S., Wein, H., and Linn, S. (1992) Mutat. Res. 273, 49-56
23. Nichols, A. F., Ong, P., and Linn, S. (1996) J. Biol. Chem. 271, 24317-24320
24. Aboussekhra, A., Biggerstaff, M., Shivji, M. K. K., Vilpo, J. A., Moncollin, V., Podust, V. N., Protic, M., Hübscher, U., Egly, J.-M., and Wood, R. D. (1995) Cell 80, 859-868
25. Kazantsev, A., Mu, D., Nichols, A. F., Zhao, X., Linn, S., and Sancar, A. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 5014-5018
26. Otrin, V. R., Kuraoka, I., Nardo, T., McLenigan, M., Eker, A. P. M., Stefanini, M., Levine, A. S., and Wood, R. D. (1998) Mol. Cell. Biol. 18, 3182-3190
27. Hara, R., Mo, J., and Sancar, A. (2000) Mol. Cell. Biol. 20, 9173-9181
28. Hwang, B. J., Ford, J. M., Hanawalt, P. C., and Chu, G. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 424-428
29. Tang, J. Y., Hwang, B. J., Ford, J. M., Hanawalt, P. C., and Chu, G. (2000) Mol. Cell 205, 737-744
30. Dualan, R., Brody, T., Keeney, S., Nichols, A. F., Admon, A., and Linn, S. (1995) Genomics 29, 62-69
31. Manley, J. L., Fire, A., Cano, A., Sharp, P. A., and Gefter, M. L. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 3855-3859
32. Henricksen, L. A., Umbricht, C. B., and Wold, M. S. (1994) J. Biol. Chem. 269, 11121-11132
33. Reardon, J. T., Mu, D., and Sancar, A. (1996) J. Biol. Chem. 271, 19451-19456
34. Zhao, X., Liu, J., Hsu, D. S., Zhao, S., Taylor, J.-S., and Sancar, A. (1997) J. Biol. Chem. 272, 32580-32590
35. Mu, D., Tursun, M., Duckett, D. R., Drummond, J. T., Modrich, P., and Sancar, A. (1997) Mol. Cell. Biol. 17, 760-769
36. Hwang, B. J., Toering, S., Francke, U., and Chu, G. (1998) Mol. Cell. Biol. 18, 4391-4399
37. Nichols, A. F., Itoh, T., Graham, J. A., Liu, W., Yamaizumi, M., and Linn, S. (2000) J. Biol. Chem. 275, 21422-21428
38. Otrin, V. R., McLenigan, M., Takao, M., Levine, A. S., and Protic, M. (1997) J. Cell Sci. 110, 1159-1168
39. Selby, C. P., Drapkin, R., Reinberg, D., and Sancar, A. (1997) Nucleic Acids Res. 25, 787-793
40. Jones, C. J., and Wood, R. D. (1993) Biochemistry 32, 12096-12104
41. Asahina, H., Kuraoka, I., Shirakawa, M., Morita, E. H., Miura, N., Miyamoto, I., Ohtsuka, E., Okada, Y., and Tanaka, K. (1994) Mutat. Res. 315, 229-237
42. Clugston, C. K., McLaughlin, K., Kenny, M. K., and Brown, R. (1992) Cancer Res. 52, 6375-6379
43. Burns, J. L., Guzder, S. N., Sung, P., Prakash, S., and Prakash, L. (1996) J. Biol. Chem. 273, 11607-11610
44. Patrick, S. M., and Turchi, J. J. (1998) Biochemistry 37, 8808-8815
45. Sugasawa, K., Ng, J. M. Y., Masutani, C., Iwai, S., van der Speck, P. J., Eker, A. P. M., Hanaoka, F., Bootsma, D., and Hoeijmakers, J. H. J. (1998) Mol. Cell 2, 223-232
46. Wakasugi, M., and Sancar, A. (1999) J. Biol. Chem. 274, 18759-18768
47. Mitchell, D. L. (1988) Photochem. Photobiol. 48, 51-57
48. Itoh, T., Mori, T., Ohkubo, H., and Yamaizumi, M. (1999) J. Invest. Dermatol. 113, 251-257
49. Batty, D., Otrin, V. R., Levine, A. S., and Wood, R. D. (2000) J. Mol. Biol. 300, 275-279
50. Venema, J., van Hoffen, A., Natarajan, A. T., van Zeeland, A. A., and Mullenders, L. H. F. (1990) Nucleic Acids Res. 18, 443-448
51. Venema, J., van Hoffen, A., Karcagi, V., Natarajan, A. T., van Zeeland, A. A., and Mullenders, L. H. F. (1991) Mol. Cell. Biol. 11, 4128-4134

Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.


This article has been cited by other articles:


Home page
 J. Cell Sci.Home page
M. S. Luijsterburg, J. Goedhart, J. Moser, H. Kool, B. Geverts, A. B. Houtsmuller, L. H. F. Mullenders, W. Vermeulen, and R. van Driel
Dynamic in vivo interaction of DDB2 E3 ubiquitin ligase with UV-damaged DNA is independent of damage-recognition protein XPC
J. Cell Sci., August 1, 2007; 120(15): 2706 - 2716.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J. Li, Q.-E. Wang, Q. Zhu, M. A. El-Mahdy, G. Wani, M. Praetorius-Ibba, and A. A. Wani
DNA Damage Binding Protein Component DDB1 Participates in Nucleotide Excision Repair through DDB2 DNA-binding and Cullin 4A Ubiquitin Ligase Activity.
Cancer Res., September 1, 2006; 66(17): 8590 - 8597.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. A. El-Mahdy, Q. Zhu, Q.-e. Wang, G. Wani, M. Praetorius-Ibba, and A. A. Wani
Cullin 4A-mediated Proteolysis of DDB2 Protein at DNA Damage Sites Regulates in Vivo Lesion Recognition by XPC
J. Biol. Chem., May 12, 2006; 281(19): 13404 - 13411.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. G. Kapetanaki, J. Guerrero-Santoro, D. C. Bisi, C. L. Hsieh, V. Rapic-Otrin, and A. S. Levine
The DDB1-CUL4ADDB2 ubiquitin ligase is deficient in xeroderma pigmentosum group E and targets histone H2A at UV-damaged DNA sites
PNAS, February 21, 2006; 103(8): 2588 - 2593.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B. O. Wittschieben, S. Iwai, and R. D. Wood
DDB1-DDB2 (Xeroderma Pigmentosum Group E) Protein Complex Recognizes a Cyclobutane Pyrimidine Dimer, Mismatches, Apurinic/Apyrimidinic Sites, and Compound Lesions in DNA
J. Biol. Chem., December 2, 2005; 280(48): 39982 - 39989.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
G. Kulaksiz, J. T. Reardon, and A. Sancar
Xeroderma Pigmentosum Complementation Group E Protein (XPE/DDB2): Purification of Various Complexes of XPE and Analyses of Their Damaged DNA Binding and Putative DNA Repair Properties
Mol. Cell. Biol., November 15, 2005; 25(22): 9784 - 9792.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. Alekseev, H. Kool, H. Rebel, M. Fousteri, J. Moser, C. Backendorf, F. R. de Gruijl, H. Vrieling, and L. H.F. Mullenders
Enhanced DDB2 Expression Protects Mice from Carcinogenic Effects of Chronic UV-B Irradiation
Cancer Res., November 15, 2005; 65(22): 10298 - 10306.
[Abstract] [Full Text] [PDF]

Home page
 GeneticsHome page
K.-i. Takata, H. Yoshida, M. Yamaguchi, and K. Sakaguchi
Drosophila Damaged DNA-Binding Protein 1 Is an Essential Factor for Development
Genetics, October 1, 2004; 168(2): 855 - 865.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
T. Itoh, D. Cado, R. Kamide, and S. Linn
DDB2 gene disruption leads to skin tumors and resistance to apoptosis after exposure to ultraviolet light but not a chemical carcinogen
PNAS, February 17, 2004; 101(7): 2052 - 2057.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. E. Fitch, S. Nakajima, A. Yasui, and J. M. Ford
In Vivo Recruitment of XPC to UV-induced Cyclobutane Pyrimidine Dimers by the DDB2 Gene Product
J. Biol. Chem., November 21, 2003; 278(47): 46906 - 46910.
[Abstract] [Full Text] [PDF]

Home page
 Genes Dev.Home page
J. T. Reardon and A. Sancar
Recognition and repair of the cyclobutane thymine dimer, a major cause of skin cancers, by the human excision nuclease
Genes & Dev., October 15, 2003; 17(20): 2539 - 2551.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
S. Rademakers, M. Volker, D. Hoogstraten, A. L. Nigg, M. J. Mone, A. A. van Zeeland, J. H. J. Hoeijmakers, A. B. Houtsmuller, and W. Vermeulen
Xeroderma Pigmentosum Group A Protein Loads as a Separate Factor onto DNA Lesions
Mol. Cell. Biol., August 15, 2003; 23(16): 5755 - 5767.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
V. Rapic-Otrin, V. Navazza, T. Nardo, E. Botta, M. McLenigan, D. C. Bisi, A. S. Levine, and M. Stefanini
True XP group E patients have a defective UV-damaged DNA binding protein complex and mutations in DDB2 which reveal the functional domains of its p48 product
Hum. Mol. Genet., July 1, 2003; 12(13): 1507 - 1522.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
Z. Chen, X. S. Xu, J. Yang, and G. Wang
Defining the function of XPC protein in psoralen and cisplatin-mediated DNA repair and mutagenesis
Carcinogenesis, June 1, 2003; 24(6): 1111 - 1121.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
A. F. Nichols, T. Itoh, F. Zolezzi, S. Hutsell, and S. Linn
Basal transcriptional regulation of human damage-specific DNA-binding protein genes DDB1 and DDB2 by Sp1, E2F, N-myc and NF1 elements
Nucleic Acids Res., January 15, 2003; 31(2): 562 - 569.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
K.-i. Takata, G. Ishikawa, F. Hirose, and K. Sakaguchi
Drosophila damage-specific DNA-binding protein 1 (D-DDB1) is controlled by the DRE/DREF system
Nucleic Acids Res., September 1, 2002; 30(17): 3795 - 3808.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
V. Rapic-Otrin, M. P. McLenigan, D. C. Bisi, M. Gonzalez, and A. S. Levine
Sequential binding of UV DNA damage binding factor and degradation of the p48 subunit as early events after UV irradiation
Nucleic Acids Res., June 1, 2002; 30(11): 2588 - 2598.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. M. Patrick and J. J. Turchi
Xeroderma Pigmentosum Complementation Group A Protein (XPA) Modulates RPA-DNA Interactions via Enhanced Complex Stability and Inhibition of Strand Separation Activity
J. Biol. Chem., May 3, 2002; 277(18): 16096 - 16101.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Wakasugi, A. Kawashima, H. Morioka, S. Linn, A. Sancar, T. Mori, O. Nikaido, and T. Matsunaga
DDB Accumulates at DNA Damage Sites Immediately after UV Irradiation and Directly Stimulates Nucleotide Excision Repair
J. Biol. Chem., January 11, 2002; 277(3): 1637 - 1640.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/18/15434    most recent
M011177200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wakasugi, M.
Right arrow Articles by Matsunaga, T.
Right arrow Search for Related Content
PubMed
Right arrow