![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 18, 15434-15440, May 4, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
§,
,
,
, and
**
From the
Faculty of Pharmaceutical Sciences, Kanazawa
University, Kanazawa 920-0934, Japan, ¶ Graduate School of
Pharmaceutical Sciences, Hokkaido University, Sapporo 060-0812, Japan,
and
Division of Biochemistry and Molecular Biology, University
of California, Berkeley, California 94720-3202
Received for publication, December 12, 2000, and in revised form, February 1, 2001
| |
ABSTRACT |
|---|
|
|
|---|
Human cells contain a protein that binds to
UV-irradiated DNA with high affinity. This protein, damaged DNA-binding
protein (DDB), is a heterodimer of two polypeptides, p127 and p48.
Recent in vivo studies suggested that DDB is involved in
global genome repair of cyclobutane pyrimidine dimers (CPDs), but the
mechanism remains unclear. Here, we show that in vitro DDB
directly stimulates the excision of CPDs but not (6-4)photoproducts.
The excision activity of cell-free extracts from Chinese hamster AA8
cell line that lacks DDB activity was increased 3-4-fold by
recombinant DDB heterodimer but not p127 subunit alone. Moreover, the
addition of XPA or XPA + replication protein A (RPA), which themselves enhanced excision, also enhanced the excision in the presence of DDB.
DDB was found to elevate the binding of XPA to damaged DNA and to make
a complex with damaged DNA and XPA or XPA + RPA as judged by both
electrophoretic mobility shift assays and DNase I protection assays.
These results suggest that DDB assists in the recognition of CPDs by
core NER factors, possibly through the efficient recruitment of XPA or
XPA·RPA, and thus stimulates the excision reaction of CPDs.
Nucleotide excision repair
(NER)1 is the major mechanism
for removing bulky DNA lesions including cyclobutane pyrimidine dimers (CPDs) and (6-4)photoproducts induced by sun light in humans (1-4). The basic reaction mechanism of NER is highly conserved from yeast to
human. The core reaction from DNA damage recognition to excision of the
damage is accomplished by six repair factors (XPA, RPA, XPC·HR23B,
TFIIH, XPF·ERCC1, XPG), so called excision nuclease (excinuclease) (5-8). The recent development of reconstituted systems using highly purified proteins has enabled analyses of the
detailed reaction mechanism of NER (7-10). In yeast, some accessory or
regulatory factors such as Rad7·Rad16 complex (11-13), ABF1 (14),
and MMS19 (15-16) have been reported to help mediate NER. The
existence of such factors in humans, however, has not been clearly demonstrated.
Damaged DNA-binding protein (DDB) is one of the candidates that might
play such an accessory role in human cells. DDB is composed of two
subunits, p127 and p48, and has a higher affinity for various types of
DNA lesions compared with the damage recognition subunits (XPA, RPA,
XPC·HR23B, and TFIIH) of the six core repair factors (17-19). DDB
activity has been shown to be missing in a subset of xeroderma
pigmentosum group E (XP-E) patients. XP is an autosomal recessive
disease associated with abnormal sensitivity to UV lights and a high
incidence of skin cancer, which is known to be caused by defects in
NER. XP-E is one of eight genetic complementation groups (XP-A through
XP-G and XP-V) of XP patients, and, along with XP-V, manifests the
mildest clinical features and deficiency in NER. XP-E individuals
lacking DDB activity were found to carry mutations in p48
gene (20-23). Because of its high specificity for binding to damaged
DNA and a defect in some XP-E cells, DDB has been postulated to be
involved in the NER process, presumably in a damage recognition step.
However, DDB is clearly not essential for NER in several in
vitro reconstituted systems, and its precise role in the damage
recognition process has not been demonstrated so far (24-27). However,
recent in vivo studies clearly showed that XP-E cells and
rodent cells lacking DDB activity are selectively defective in global
genome repair (GGR) of CPDs, and transfection of the p48
gene into the rodent cells complements the deficiencies (28, 29),
suggesting that DDB may be involved in GGR especially for CPDs.
For this study, we have overproduced DDB in a baculovirus/insect cell
system, purified it to near homogeneity, and tested its effect upon
in vitro excision reactions with DNA substrates containing
either a single CPD or a single (6-4)photoproduct. Indeed the
recombinant DDB stimulated the excision rate of CPDs by cell-free
extracts (CFEs) prepared from AA8 Chinese hamster ovary cell lines that
lack DDB activity, and the stimulatory effect was enhanced in the
presence of XPA or XPA + RPA. We also observed that DDB forms a complex
with XPA and RPA at the damage sites based on electrophoretic mobility
shift assays and DNase I protection assays. These results provide
direct biochemical evidence that DDB can be involved in the recognition
process of CPDs in NER.
Plasmid Constructs--
To overproduce FLAG-tagged DDB subunits
in insect cells, 5'-terminal portions of cDNAs with FLAG epitope
sequences were amplified by polymerase chain reactions using the
primers for p127
(5'-CGCGGACCATGGACTACAAGGACGACGATGACAAGATGTCGTACAACTACGTGG-3' and
5'-ATTGAATTCCTTTTCTCGG-3') or for p48 (5'-
CGCGGATCCATGGACTACAAGGACGACGATGACAAGATGGCTCCCAAGAAACGC-3' and
5'-CATGAATTCTCCCCCTTTGG-3') and digested with BamHI and
EcoRI. These fragments of 0.6 kilobases for p127 and 0.4 kilobases for p48 were individually subcloned into the pFASTBac1
expression vector (Life Technologies, Inc.), and the sequences of the
inserted portions were verified. The remaining 3'-terminal regions of
p127 or p48 cDNA were excised from the
original constructs (30) with BstEII and NotI or
BstXI and NotI, respectively, and inserted into
the pFASTBac1 constructs containing each 5'terminal portions to
give the complete cDNAs.
Protein Expression and Purification--
Recombinant
baculoviruses encoding the p127 or p48 subunit were prepared according
to the manufacturer's protocol. Sf21 insect cells were
co-infected with both viruses to jointly express p127 and p48 or with
the p127 virus alone and incubated at 27 °C for 42-48 h. After
collecting the cells by centrifugation, extracts were prepared by
method of Manley et al. (31) and dialyzed against storage
buffer (25 mM Hepes-KOH (pH 7.9), 100 mM KCl,
12 mM MgCl2, 1 mM EDTA, 2 mM dithiothreitol, 12.5% glycerol). The extracts were
first applied to SP-Sepharose (Amersham Pharmacia Biotech) equilibrated
with buffer A (25 mM Hepes-KOH (pH 7.9), 12 mM
MgCl2, 1 mM EDTA, 2 mM
dithiothreitol, 10% glycerol) containing 100 mM KCl. After
extensive washing with buffer A containing 100 mM KCl, the
recombinant proteins were eluted with a linear gradient of KCl (0.1-1
M) in buffer A and identified by Western blotting using anti-FLAG antibody. The eluted proteins were directly applied to a
column containing anti-FLAG M2 affinity gels (Sigma) and washed
extensively with buffer A containing 0.15 M KCl. The
proteins were eluted with 5 column volumes of buffer A containing 0.15 M KCl and 2 mg/ml FLAG peptides, dialyzed against the
storage buffer, and stored at
Recombinant RPA and (His)6-XPA were expressed in
Escherichia coli and purified as described (7, 32).
XPC·HR23B heterodimer was expressed in Sf21 cells and
purified as described previously (33). The recombinant virus encoding
XPC·HR23B was kindly provided by Drs. J. T. Reardon and A. Sancar (University of North Carolina). The activities of these purified
repair factors were verified by an in vitro complementation
assay or reconstitution assay.
Substrates--
Duplex DNA substrates (56 bp for binding assays
and DNase I protection assays and 136 bp for excision assays) that
contained a cis-syn-cyclobutane pyrimidine dimer
or a (6-4)photoproduct in the center were constructed from 4 and 6 blocks of oligomer, respectively. Details for sequences and
preparations of these substrates have been described (34, 35). All
substrates were internally labeled with 32P at the 4th
phosphate 5' to the photoproduct.
Excision Repair Assay--
Cell-free extracts (CFEs) were
prepared by the method of Manley et al. (31). The standard
reaction mixture contained 3-6 fmol of 136-bp substrate, the indicated
recombinant proteins, and 50 µg of CFE prepared from AA8 cells in 25 µl of reaction buffer (32 mM Hepes-KOH (pH 7.9), 64 mM KCl, 6.44 mM MgCl2, 0.16 mM dithiothreitol, 0.16 mM EDTA, 2 mM ATP, and 4% glycerol). Normally, the substrates were
first incubated with the indicated recombinant proteins at 30 °C for
10 min, CFE was added, and incubation was continued for 45 min. DNAs
were extracted with phenol/chloroform/isoamyl alcohol and separated on
8% denaturing polyacrylamide gels. Excision products were visualized
by autoradiography, or the signals were quantified by exposing gels to
Bas2000 imaging screens, and the intensities were measured with a Fuji
Bas2000 Bioimaging Analyzer.
Electrophoretic Mobility Shift Assay--
Two fmol of
32P-labeled 56-bp substrates were incubated with the
indicated amounts of recombinant proteins or CFE at 30 °C for 20 min
in 25 µl of reaction buffer. The protein·DNA complexes were
separated by electrophoresis on 5% nondenaturing polyacrylamide gels
at 25 mA for 2 h and analyzed by autoradiography. To identify the
compositions of protein·DNA complexes, specific antibodies were added
after the complex formation. Monoclonal antibodies against FLAG and
hexahistidine tags were obtained from Sigma and Amersham Pharmacia
Biotech, respectively. Polyclonal antibodies against the p34 subunit of
RPA were purchased from Oncogene Science.
DNase I Protection Assay--
The internally labeled 56-bp
substrates (2 fmol) were incubated with the indicated amounts of
proteins in 25 µl of reaction buffer at 30 °C for 20 min and then
digested with 700 units of DNase I (Life Technologies, Inc.) in the
presence of 3.8 mM CaCl2. The products were
purified, separated on 10% denaturing polyacrylamide gels, and
analyzed by autoradiography.
Overproduction and Purification of DDB Heterodimer and p127
Subunit--
To investigate the effect of DDB on in vitro
excision repair reaction, we have overproduced DDB heterodimer (p127
and p48) or p127 subunit alone in baculovirus/insect cell system. An
8-amino acid FLAG epitope fused at the N termini of both polypeptides (p127 and p48) facilitated the purification of the recombinant proteins. After a two-step separation with SP-Sepharose and an anti-FLAG M2 affinity gel, the near homogeneous proteins (Fig. 1A) were tested for DDB
activity by electrophoretic mobility shift assay (EMSA) (Fig.
1B). The heterodimeric DDB specifically bound to a 56-bp
duplex containing a (6-4)photoproduct (lanes 7 and 8), and the mobility of the complex was identical to that
with the native DDB (lanes 3 and 4) from HeLa
cell-free extracts. However, the recombinant p127 protein alone did not
bind to DNA either with or without a (6-4)photoproduct (lanes
9 and 10), consistent with previous reports (36, 37).
We also compared the binding ability of the DDB to a 56-mer duplex DNA
containing a single CPD or a (6-4)photoproduct (Fig. 1C).
As expected, DDB showed a clear preference for the DNA duplex with a
(6-4)photoproduct (lanes 10-12) over the undamaged DNA
probe (lanes 2-4), and it also showed a moderate preference
for the DNA probe containing the CPD (lanes 6-8).
Effects of DDB on in Vitro Nucleotide Excision Repair Reaction with
CHO AA8 Cell-free Extracts--
To test the effect of the recombinant
DDB on an in vitro excision reaction with a CPD-containing
DNA substrate, we prepared CFEs from CHO AA8 cells, which have been
shown to lack p48 expression and, consequently, DDB activity (29, 36).
Fig. 1B (lanes 5 and 6) confirmed that
there is no binding activity in AA8 CFEs. The 136-bp substrate with a
single CPD was preincubated with DDB heterodimer or p127 alone (as a
control) and subsequently incubated with AA8 CFE (Fig.
2A). DDB (lane 2),
but not p127 alone (lane 3), stimulated the excision
reaction by AA8 CFEs ~3-fold, in agreement with in vivo
data that when CHO V79 cells were transfected with the p48
gene DDB activity reappeared along with GGR of CPDs (29). This
stimulation was also dependent on the concentration of DDB (Fig.
2B). On the other hand, when the DNA substrate containing a
(6-4)photoproduct was used, the same amount of DDB (280 ng) greatly inhibited the excision reaction (Fig. 2A,
lanes 4 and 5). Since DDB binds to a
(6-4)photoproduct more efficiently than a CPD, as shown in Fig.
1C, a similar experiment with less DDB was carried out (Fig.
2C). Under this condition, DDB up to 13.2 ng did not affect
the excision level of (6-4)photoproducts by AA8 CFEs. It should be
noted that the excision amount of (6-4)photoproducts is much higher
than that of CPDs (3.0% versus 0.06%). Thus DDB might help
the recognition of CPDs by the core NER proteins.
Enhancement of the DDB-stimulated Excision Reaction by XPA and
RPA--
To investigate the functional interaction between DDB and the
predicted damage recognition subunits of the NER factors, DNA substrate
with a CPD was preincubated with DDB in the presence of RPA, XPA, XPA + RPA, or XPC·HR23B before the addition of AA8 CFE. As shown in Fig.
3A, the stimulatory effect
(lane 2, ~4-fold) of DDB on the excision of CPDs was
further enhanced by XPA (lane 4, to ~7-fold) or XPA + RPA
(lane 5, to ~10-fold) but not with RPA (lane 3) or
XPC·HR23B (lane 6). The individual repair factors show
some stimulatory effect in the absence of DDB (lanes 7-10), and the effects of DDB and XPA or XPA + RPA appear to be additive. Interestingly, when the DNA substrates with a (6-4)photoproduct were
used (Fig. 3B), the inhibitory effect of DDB on the excision reaction was apparently reversed by XPA (lane 4) or XPA + RPA (lane 5) but not by RPA (lane 3) or
XPC·HR23B (lane 6). These results suggest that XPA and RPA
might be directly involved in the DDB-stimulated excision reaction of
CPDs.
Complex Formation of DDB with XPA and RPA on a Damaged
Site--
To determine whether DDB forms a complex with XPA and/or RPA
on a damaged DNA, we first employed EMSA with various pairwise combinations of DDB, XPA, and RPA (Fig.
4). Since we had a special interest in
the possible ability of DDB to recruit XPA or RPA onto a damaged DNA,
we chose conditions under which XPA or RPA alone barely bound to the
DNA probes (Fig. 4, A and B, lane 2). A combination of DDB and XPA (Fig. 4A) produced a shifted
band (lane 4) that migrated more slowly than the DDB·DNA
complex (lane 3). Moreover, the addition of specific
antibodies to XPA (
Finally, we mixed all three factors with the DNA probe to test whether
a higher order complex forms. As shown in Fig. 4C, only one
retarded band was observed (lane 5), which was supershifted by all of the specific antibodies to these factors (lanes
6-8), indicating that this retarded band contains
DDB·XPA·RPA·DNA. We believe that the band in lane 5 is
different from the band in lane 4 for the following reason.
When we added
To determine whether the three factors make a complex at a damaged site
or bind independently, we conducted a DNase I protection assay (39)
using DNA probes containing a (6-4)photoproduct and internal
32P label at the 4th phosphate bond 5' to the lesion. This
fragment was chosen for these studies due to the inability of
CPD-containing substrates to show clear signals in the DNase I
protection assay (data not shown). After incubation with DDB and/or XPA + RPA, the probes were extensively digested with DNase I to determine the size of the DNA region that was protected from DNase I digestion (Fig. 5). DDB alone conferred a specific
and distinctive band of 9 nucleotides (lane 4) in addition
to nonspecific bands of 4-6 nucleotides, indicating the presence of a
DDB·DNA complex around a damaged site. On the other hand, XPA and RPA
protected a larger DNA region ranging between 11 and 17 nucleotides
(lane 8) in a damage-dependent manner.
Strikingly, the mixing of all three factors, DDB, XPA, and RPA, led to
a drastic increase in the protection levels, and the size of the
protected DNA region was smaller than with XPA and RPA (lane
6). These results are consistent with specific and tight complex
formation around a damaged site by DDB and XPA·RPA.
DDB Stimulates the Excision of CPDs in Vitro--
This paper
provides the direct evidence that DDB stimulates the excision reaction
of CPDs in vitro, consistent with the recent report that DDB
activity correlates well with the GGR activity of CPDs in intact cells
(28, 29). Previous attempts to observe the effect of DDB on in
vitro NER reactions have either shown little effect or inhibition
(24-27). One possible reason would be that the substrates used in
those studies contained non-CPD lesions: UV-irradiated plasmid DNA
containing (6-4)photoproducts as well as CPDs (24), linear duplexes
containing a (6-4)photoproduct or a cholesterol moiety (25),
covalent closed circular DNA containing a single cisplatin lesion (26),
or a mononucleosome containing a (6-4)photoproduct (27). In fact, we
also failed to observe a stimulatory effect of DDB using
(6-4)photoproduct-containing DNA substrates. Preferential binding of
excision repair factors RPA, XPA, or XPC·HR23B to non-CPD lesions has
been reported (33, 40-46). The recognition of these non-CPD lesions
might be properly achieved by these repair factors, at least in
vitro, regardless of the presence or absence of DDB. On the
contrary, cis-syn-CPD is a poor substrate for
in vitro NER reactions, as shown in Fig. 2, and there have
been no reports of preferential binding of the core NER factors to
CPDs. The preferential binding of CPD-containing DNA substrates (Fig.
1C) may assist core repair factors to recognize CPDs.
In Vitro Effect of DDB on the Excision of a
(6-4)Photoproduct--
Could DDB not be involved in the repair of
(6-4)photoproducts? In vivo repair studies (28, 47, 48)
do not support this idea. The repair of (6-4)photoproducts in XP-E
cells lacking DDB activity is significantly slower compared with normal
cells, indicating the partial involvement of DDB in the repair of
(6-4)photoproducts in vivo. In intact cells, DDB may be
required for the recognition of (6-4)photoproducts at some parts of
the genome. Alternatively, a possible role of DDB in the repair of DNA
in chromatin may be implicated, as suggested by others (26). Why DDB
inhibits the excision of (6-4)photoproducts at higher
concentrations (Fig. 2) is not known at present. A similar inhibitory
effect of DDB also has been reported in a reconstituted system under
XPA- or RPA-limiting conditions (25). DDB has an ~10-fold higher
affinity for (6-4)photoproducts compared with CPDs (18), and at high concentrations, the second band, with slower migration, increases relative to the first band in EMSA (Fig. 1C). This
form of the complex might inhibit the binding of core NER factors and
the complex formation of human excision nuclease.
Functional Interaction between DDB, XPA, and RPA--
Another
noteworthy finding in this study is that the stimulatory effect of DDB
on the excision of CPDs was further enhanced in the presence of XPA or
XPA + RPA (Fig. 3A). Interestingly, the inhibitory effect of
DDB on the excision of (6-4)photoproducts was also suppressed by the
presence of these factors (Fig. 3B). These observations have
a good correlation with the complex formation detected by EMSA (Fig.
4). XPA, which readily made a complex with DDB on a damaged DNA, could
enhance the stimulatory effect of DDB, whereas RPA, which partially
made a complex with DDB, could not. Analogously, the combination of XPA
and RPA made a complex with DDB as well as enhanced the stimulation of
DDB. Furthermore, the binding of XPA to damaged DNA was profoundly
enhanced in the presence of DDB (Fig. 4A). These results
strongly suggest a functional link between DDB and XPA in the efficient
repair of CPDs in vitro. Taken together, we propose the
following model. DDB binds to a CPD in DNA, providing the kink or
bending of DNA, as shown by others (18, 19), and facilitates the
recruitment of XPA or XPA together with RPA to the CPD site possibly
through protein-protein interaction with XPA. The complex formation at
a damaged site by these three factors may lead to the subsequent
excision reaction.
In this study, we failed to obtain an indication of a functional
interaction between DDB and XPC·HR23B based on the in
vitro excision assays (Fig. 3) and EMSA (data not shown). This
observation is consistent with the recent report (49) that DDB and
XPC·HR23B bind to UV-damaged DNA independently as judged by EMSA.
These results were rather unexpected because XPC·HR23B has been
already known to be involved in GGR of CPDs (50, 51) and was also proposed to be a primary damage recognition factor (45). Other unidentified factors suggested by others (28) or XPA·RPA might be
needed to link DDB and XPC·HR23B. The further analysis is needed to
verify this model and clarify the higher order complex formation.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
80 °C.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (26K):
[in a new window]
Fig. 1.
Damage-specific DNA binding activity of
purified recombinant DDB protein. A, purified
recombinant DDB heterodimer (lane 1) and p127 subunit
(lane 2) were analyzed by 10% SDS-polyacrylamide gel
electrophoresis followed by staining with GelCode Blue stain reagent
(Pierce). B, 32P-labeled 56-bp duplex DNA (2 fmol) either with or without a (6-4)photoproduct was incubated at
30 °C for 20 min with 10 µg of CFE prepared from HeLa (lanes
3 and 4) or AA8 (lanes 5 and 6)
cell lines or 70 ng of recombinant DDB heterodimer (lanes 7 and 8) and p127 subunit (lanes 9 and
10). It should be noted that 2 µg of
poly(dI-dC)·poly(dI-dC) was added to the reaction in this particular
experiment to reduce nonspecific binding. The reaction mixtures were
separated on a 5% nondenaturing polyacrylamide gel and analyzed by
autoradiography. C, two fmol of
32P-labeled 56-bp duplex DNA with or without a
lesion (CPD or (6-4)photoproduct) was incubated with the indicated
amount of DDB at 30 °C for 20 min. The protein-DNA complexes were
visualized by autoradiography after electrophoresis on a 5%
nondenaturing gel.

View larger version (27K):
[in a new window]
Fig. 2.
Effects of DDB on in vitro
nucleotide excision repair reaction by AA8 CFEs. A,
six or 3 fmol of internally labeled 136-bp substrates containing a CPD
(lanes 1-3) or (6-4)photoproduct (lanes 4-6)
were incubated at 30 °C for 10 min with 280 ng of DDB heterodimer or
p127 subunit, and then 50 µg of AA8 CFE was added to each mixture,
and incubation was continued for 45 min. DNAs were then extracted,
separated on a 8% sequencing gel, and detected by autoradiography.
B, three fmol of internally labeled substrates containing a
CPD were incubated at 30 °C for 10 min with the indicated amounts of
DDB, and then 50 µg of AA8 CFE was added to each mixture. After the
incubation for the indicated periods, DNAs were extracted and separated
on a 8% sequencing gel. Excision products were quantitated with an
image analyzer. Bars indicate S.D. from three independent
experiments. C, three fmol of internally labeled substrates
containing a (6-4)photoproduct and the indicated amounts of DDB were
incubated at 30 °C for 10 min, AA8 CFE was added to each mixture,
and incubation was continued for 45 min. The DNA was then extracted and
analyzed by autoradiography after electrophoresis on a 8% sequencing
gel.

View larger version (60K):
[in a new window]
Fig. 3.
Cooperative stimulation of excision reaction
of CPDs by DDB, XPA, and RPA. Six or 3 fmol of internally labeled
136-bp substrates containing a CPD (A) or a
(6-4)photoproduct (B) was preincubated at 30 °C for 10 min with DDB (210 or 70 ng) in the presence of XPA (360 ng), RPA (300 ng), XPA (360 ng) + RPA (300 ng), or XPC·HR23B (20 ng). Fifty µg of
AA8 CFE was added to the reaction mixture, and incubation was continued
for 45 min. The DNA was then extracted, separated on 8% sequencing
gels, and detected by autoradiography. The relative excision levels
were determined by an image analyzer and are shown in the bottom
panels. Bars indicate S.D. from three independent
experiments.
-His, lane 5) or DDB (
-FLAG,
lane 6) supershifted all of this band. These data indicate
that DDB enhances the binding of XPA to CPD-containing DNA and makes a
ternary complex of DDB·XPA·DNA. On the other hand, another
combination, DDB and RPA (Fig. 4B), gave a more intense band
compared with RPA alone (lane 2 versus lane
4). This band appears to contain RPA·DNA complex and
DDB·RPA·DNA complex since the band was partially supershifted by
-FLAG antibody (lane 6). These data indicate the
potential complex formation of DDB·RPA·DNA, which shows nearly the
same mobility as the RPA·DNA complex, consistent with a previous
report (38).

View larger version (43K):
[in a new window]
Fig. 4.
Ternary complex formation of DDB, XPA, and
RPA on a damaged DNA. Two fmol of 32P-labeled 56-bp
duplex DNA containing a CPD was incubated at 30 °C for 20 min with
the indicated combinations of proteins (70 ng of DDB, 300 ng of RPA,
360 ng of XPA). In supershift assays, antibodies were subsequently
added to the mixture and incubated for 10 min on ice. DNA-protein
complexes were separated on 5% nondenaturing gels and visualized by
autoradiography.
-His antibody to the reaction containing RPA and DDB,
as in lane 4, we could not observe any supershifted
band (data not shown). However,
-His antibody supershifted more than
90% of the complex as shown in lane 6.

View larger version (46K):
[in a new window]
Fig. 5.
Protection of DNase I digestion around a
damaged site by DDB and the effects of XPA and RPA. Two fmol of
internally labeled 56-bp duplex DNA with or without a
(6-4)photoproduct was incubated at 30 °C for 20 min with the
indicated combination of proteins (52 ng of DDB, 100 ng of RPA, 60 ng
of XPA). Seven hundred units of DNase I was subsequently added to the
mixtures, and reactions were incubated at room temperature for 5 min.
After purification of DNA and separation on a 10% sequencing gel, the
protected fragments were detected by autoradiography. The positions of
size markers are shown on the left.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
| |
ACKNOWLEDGEMENTS |
|---|
We thank Drs. J. T. Reardon and A. Sancar (University of North Carolina at Chapel Hill) for the baculovirus encoding XPC·HR23B heterodimer, the constructs for the expression of repair factors, and critical comments on the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported by grants from Ministry of Education, Science, and Culture of Japan.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Supported by Research Fellowships of the Japan Society for the Promotion of Science for Young Scientists.
** To whom correspondence should be addressed: Faculty of Pharmaceutical Sciences, Kanazawa University, 13-1 Takara-machi, Kanazawa 920-0934, Japan. Tel.: 81-76-234-4487; Fax: 81-76-234-4427; E-mail: matsukas@kenroku.kanazawa-u.ac.jp.
Published, JBC Papers in Press, February 2, 2001, DOI 10.1074/jbc.M011177200
| |
ABBREVIATIONS |
|---|
The abbreviations used are: NER, nucleotide excision repair; DDB, damaged DNA-binding protein; CPD, cyclobutane pyrimidine dimer; RPA, replication protein A; CFE, cell-free extract; XP-E, xeroderma pigmentosum group E; GGR, global genome repair; EMSA, electrophoretic mobility shift assay; bp, base pair(s).
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Friedberg, E. C., Walker, G. C., and Siede, W. (1995) DNA Repair and Mutagenesis , pp. 191-357, American Society for Microbiology, Washington, D. C. |
| 2. | Sancar, A. (1996) Annu. Rev. Biochem. 65, 43-81 |
| 3. | Wood, R. D. (1996) Annu. Rev. Biochem. 65, 135-167 |
| 4. | de Laat, W. L., Jaspers, N. G. J., and Hoeijmakers, J. H. J. (1999) Genes Dev. 13, 768-785 |
| 5. | Mu, D., Park, C. -H., Matsunaga, T., Hsu, D. S., Reardon, J. T., and Sancar, A. (1995) J. Biol. Chem. 270, 2415-2418 |
| 6. | Guzder, S. N., Habraken, Y., Sung, P., Prakash, L., and Prakash, S. (1995) J. Biol. Chem. 270, 12973-12976 |
| 7. | Mu, D., Hsu, D. S., and Sancar, A. (1996) J. Biol. Chem. 271, 8285-8294 |
| 8. | Araújo, S. J., Tirode, F., Coin, F., Pospiech, H., Syväoja, J. E., Stucki, M., Hübscher, U., Egly, J. -M., and Wood, R. D. (2000) Genes Dev. 14, 349-359 |
| 9. | Mu, D., Wakasugi, M., Hsu, D. S., and Sancar, A. (1997) J. Biol. Chem. 272, 28971-28979 |
| 10. | Wakasugi, M., and Sancar, A. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 6669-6674 |
| 11. | Guzder, S. N., Sung, P., Prakash, L., and Prakash, S. (1997) J. Biol. Chem. 272, 21665-21668 |
| 12. | Guzder, S. N., Sung, P., Prakash, L., and Prakash, S. (1998) J. Biol. Chem. 273, 6292-6296 |
| 13. | Reed, S. H., You, Z. Y., and Friedberg, E. C. (1998) J. Biol. Chem. 273, 29481-29488 |
| 14. | Reed, S. H., Akiyama, M., Stillman, B., and Friedberg, E. C. (1999) Genes Dev. 13, 3052-3058 |
| 15. | Lauder, S., Bankmann, M., Guzder, S. N., Sung, P., Prakash, L., and Prakash, S. (1996) Mol. Cell. Biol. 16, 6783-6793 |
| 16. | Lombaerts, M., Tijsterman, M., Verhage, R. A., and Brouwer, J. (1997) Nucleic Acids Res. 25, 3974-3979 |
| 17. | Keeney, S., Chang, G. J., and Linn, S. (1993) J. Biol. Chem. 268, 21293-21300 |
| 18. | Reardon, J. T., Nichols, A. F., Keeney, S., Smith, C. A., Taylor, J. -S., Linn, S., and Sancar, A. (1993) J. Biol. Chem. 268, 21301-21308 |
| 19. | Fujiwara, Y., Masutani, C., Mizukoshi, T., Kondo, J., Hanaoka, F., and Iwai, S. (1999) J. Biol. Chem. 274, 20027-20033 |
| 20. | Chu, G., and Chang, E. (1988) Science 242, 564-567 |
| 21. | Kataoka, H., and Fujiwara, Y. (1991) Biochem. Biophys. Res. Commun. 175, 1139-1143 |
| 22. | Keeney, S., Wein, H., and Linn, S. (1992) Mutat. Res. 273, 49-56 |
| 23. | Nichols, A. F., Ong, P., and Linn, S. (1996) J. Biol. Chem. 271, 24317-24320 |
| 24. | Aboussekhra, A., Biggerstaff, M., Shivji, M. K. K., Vilpo, J. A., Moncollin, V., Podust, V. N., Protic, M., Hübscher, U., Egly, J.-M., and Wood, R. D. (1995) Cell 80, 859-868 |
| 25. | Kazantsev, A., Mu, D., Nichols, A. F., Zhao, X., Linn, S., and Sancar, A. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 5014-5018 |
| 26. | Otrin, V. R., Kuraoka, I., Nardo, T., McLenigan, M., Eker, A. P. M., Stefanini, M., Levine, A. S., and Wood, R. D. (1998) Mol. Cell. Biol. 18, 3182-3190 |
| 27. | Hara, R., Mo, J., and Sancar, A. (2000) Mol. Cell. Biol. 20, 9173-9181 |
| 28. | Hwang, B. J., Ford, J. M., Hanawalt, P. C., and Chu, G. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 424-428 |
| 29. | Tang, J. Y., Hwang, B. J., Ford, J. M., Hanawalt, P. C., and Chu, G. (2000) Mol. Cell 205, 737-744 |
| 30. | Dualan, R., Brody, T., Keeney, S., Nichols, A. F., Admon, A., and Linn, S. (1995) Genomics 29, 62-69 |
| 31. | Manley, J. L., Fire, A., Cano, A., Sharp, P. A., and Gefter, M. L. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 3855-3859 |
| 32. | Henricksen, L. A., Umbricht, C. B., and Wold, M. S. (1994) J. Biol. Chem. 269, 11121-11132 |
| 33. | Reardon, J. T., Mu, D., and Sancar, A. (1996) J. Biol. Chem. 271, 19451-19456 |
| 34. | Zhao, X., Liu, J., Hsu, D. S., Zhao, S., Taylor, J.-S., and Sancar, A. (1997) J. Biol. Chem. 272, 32580-32590 |
| 35. | Mu, D., Tursun, M., Duckett, D. R., Drummond, J. T., Modrich, P., and Sancar, A. (1997) Mol. Cell. Biol. 17, 760-769 |
| 36. | Hwang, B. J., Toering, S., Francke, U., and Chu, G. (1998) Mol. Cell. Biol. 18, 4391-4399 |
| 37. | Nichols, A. F., Itoh, T., Graham, J. A., Liu, W., Yamaizumi, M., and Linn, S. (2000) J. Biol. Chem. 275, 21422-21428 |
| 38. | Otrin, V. R., McLenigan, M., Takao, M., Levine, A. S., and Protic, M. (1997) J. Cell Sci. 110, 1159-1168 |
| 39. | Selby, C. P., Drapkin, R., Reinberg, D., and Sancar, A. (1997) Nucleic Acids Res. 25, 787-793 |
| 40. | Jones, C. J., and Wood, R. D. (1993) Biochemistry 32, 12096-12104 |
| 41. | Asahina, H., Kuraoka, I., Shirakawa, M., Morita, E. H., Miura, N., Miyamoto, I., Ohtsuka, E., Okada, Y., and Tanaka, K. (1994) Mutat. Res. 315, 229-237 |
| 42. | Clugston, C. K., McLaughlin, K., Kenny, M. K., and Brown, R. (1992) Cancer Res. 52, 6375-6379 |
| 43. | Burns, J. L., Guzder, S. N., Sung, P., Prakash, S., and Prakash, L. (1996) J. Biol. Chem. 273, 11607-11610 |
| 44. | Patrick, S. M., and Turchi, J. J. (1998) Biochemistry 37, 8808-8815 |
| 45. | Sugasawa, K., Ng, J. M. Y., Masutani, C., Iwai, S., van der Speck, P. J., Eker, A. P. M., Hanaoka, F., Bootsma, D., and Hoeijmakers, J. H. J. (1998) Mol. Cell 2, 223-232 |
| 46. | Wakasugi, M., and Sancar, A. (1999) J. Biol. Chem. 274, 18759-18768 |
| 47. | Mitchell, D. L. (1988) Photochem. Photobiol. 48, 51-57 |
| 48. | Itoh, T., Mori, T., Ohkubo, H., and Yamaizumi, M. (1999) J. Invest. Dermatol. 113, 251-257 |
| 49. | Batty, D., Otrin, V. R., Levine, A. S., and Wood, R. D. (2000) J. Mol. Biol. 300, 275-279 |
| 50. | Venema, J., van Hoffen, A., Natarajan, A. T., van Zeeland, A. A., and Mullenders, L. H. F. (1990) Nucleic Acids Res. 18, 443-448 |
| 51. | Venema, J., van Hoffen, A., Karcagi, V., Natarajan, A. T., van Zeeland, A. A., and Mullenders, L. H. F. (1991) Mol. Cell. Biol. 11, 4128-4134 |
This article has been cited by other articles:
![]() |
M. S. Luijsterburg, J. Goedhart, J. Moser, H. Kool, B. Geverts, A. B. Houtsmuller, L. H. F. Mullenders, W. Vermeulen, and R. van Driel Dynamic in vivo interaction of DDB2 E3 ubiquitin ligase with UV-damaged DNA is independent of damage-recognition protein XPC J. Cell Sci., August 1, 2007; 120(15): 2706 - 2716. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, Q.-E. Wang, Q. Zhu, M. A. El-Mahdy, G. Wani, M. Praetorius-Ibba, and A. A. Wani DNA Damage Binding Protein Component DDB1 Participates in Nucleotide Excision Repair through DDB2 DNA-binding and Cullin 4A Ubiquitin Ligase Activity. Cancer Res., September 1, 2006; 66(17): 8590 - 8597. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. El-Mahdy, Q. Zhu, Q.-e. Wang, G. Wani, M. Praetorius-Ibba, and A. A. Wani Cullin 4A-mediated Proteolysis of DDB2 Protein at DNA Damage Sites Regulates in Vivo Lesion Recognition by XPC J. Biol. Chem., May 12, 2006; 281(19): 13404 - 13411. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Kapetanaki, J. Guerrero-Santoro, D. C. Bisi, C. L. Hsieh, V. Rapic-Otrin, and A. S. Levine The DDB1-CUL4ADDB2 ubiquitin ligase is deficient in xeroderma pigmentosum group E and targets histone H2A at UV-damaged DNA sites PNAS, February 21, 2006; 103(8): 2588 - 2593. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. O. Wittschieben, S. Iwai, and R. D. Wood DDB1-DDB2 (Xeroderma Pigmentosum Group E) Protein Complex Recognizes a Cyclobutane Pyrimidine Dimer, Mismatches, Apurinic/Apyrimidinic Sites, and Compound Lesions in DNA J. Biol. Chem., December 2, 2005; 280(48): 39982 - 39989. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Kulaksiz, J. T. Reardon, and A. Sancar Xeroderma Pigmentosum Complementation Group E Protein (XPE/DDB2): Purification of Various Complexes of XPE and Analyses of Their Damaged DNA Binding and Putative DNA Repair Properties Mol. Cell. Biol., November 15, 2005; 25(22): 9784 - 9792. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Alekseev, H. Kool, H. Rebel, M. Fousteri, J. Moser, C. Backendorf, F. R. de Gruijl, H. Vrieling, and L. H.F. Mullenders Enhanced DDB2 Expression Protects Mice from Carcinogenic Effects of Chronic UV-B Irradiation Cancer Res., November 15, 2005; 65(22): 10298 - 10306. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-i. Takata, H. Yoshida, M. Yamaguchi, and K. Sakaguchi Drosophila Damaged DNA-Binding Protein 1 Is an Essential Factor for Development Genetics, October 1, 2004; 168(2): 855 - 865. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Itoh, D. Cado, R. Kamide, and S. Linn DDB2 gene disruption leads to skin tumors and resistance to apoptosis after exposure to ultraviolet light but not a chemical carcinogen PNAS, February 17, 2004; 101(7): 2052 - 2057. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Fitch, S. Nakajima, A. Yasui, and J. M. Ford In Vivo Recruitment of XPC to UV-induced Cyclobutane Pyrimidine Dimers by the DDB2 Gene Product J. Biol. Chem., November 21, 2003; 278(47): 46906 - 46910. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T. Reardon and A. Sancar Recognition and repair of the cyclobutane thymine dimer, a major cause of skin cancers, by the human excision nuclease Genes & Dev., October 15, 2003; 17(20): 2539 - 2551. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rademakers, M. Volker, D. Hoogstraten, A. L. Nigg, M. J. Mone, A. A. van Zeeland, J. H. J. Hoeijmakers, A. B. Houtsmuller, and W. Vermeulen Xeroderma Pigmentosum Group A Protein Loads as a Separate Factor onto DNA Lesions Mol. Cell. Biol., August 15, 2003; 23(16): 5755 - 5767. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Rapic-Otrin, V. Navazza, T. Nardo, E. Botta, M. McLenigan, D. C. Bisi, A. S. Levine, and M. Stefanini True XP group E patients have a defective UV-damaged DNA binding protein complex and mutations in DDB2 which reveal the functional domains of its p48 product Hum. Mol. Genet., July 1, 2003; 12(13): 1507 - 1522. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Chen, X. S. Xu, J. Yang, and G. Wang Defining the function of XPC protein in psoralen and cisplatin-mediated DNA repair and mutagenesis Carcinogenesis, June 1, 2003; 24(6): 1111 - 1121. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. F. Nichols, T. Itoh, F. Zolezzi, S. Hutsell, and S. Linn Basal transcriptional regulation of human damage-specific DNA-binding protein genes DDB1 and DDB2 by Sp1, E2F, N-myc and NF1 elements Nucleic Acids Res., January 15, 2003; 31(2): 562 - 569. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-i. Takata, G. Ishikawa, F. Hirose, and K. Sakaguchi Drosophila damage-specific DNA-binding protein 1 (D-DDB1) is controlled by the DRE/DREF system Nucleic Acids Res., September 1, 2002; 30(17): 3795 - 3808. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Rapic-Otrin, M. P. McLenigan, D. C. Bisi, M. Gonzalez, and A. S. Levine Sequential binding of UV DNA damage binding factor and degradation of the p48 subunit as early events after UV irradiation Nucleic Acids Res., June 1, 2002; 30(11): 2588 - 2598. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Patrick and J. J. Turchi Xeroderma Pigmentosum Complementation Group A Protein (XPA) Modulates RPA-DNA Interactions via Enhanced Complex Stability and Inhibition of Strand Separation Activity J. Biol. Chem., May 3, 2002; 277(18): 16096 - 16101. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wakasugi, A. Kawashima, H. Morioka, S. Linn, A. Sancar, T. Mori, O. Nikaido, and T. Matsunaga DDB Accumulates at DNA Damage Sites Immediately after UV Irradiation and Directly Stimulates Nucleotide Excision Repair J. Biol. Chem., January 11, 2002; 277(3): 1637 - 1640. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||