![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 18, 15547-15553, May 4, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, September 6, 2000, and in revised form, January 16, 2001
CEACAM1 is a cell-cell adhesion molecule that
mediates homophilic cell adhesion. In addition, CEACAM1 was also shown
to suppress the growth of prostate, breast, and colon tumors.
Structural and functional analyses showed that the adhesion activity of
CEACAM1 is mediated by its extracellular domain while its cytoplasmic domain is necessary and sufficient for growth-inhibitory activity. The
signal pathways leading to CEACAM1-mediated growth suppression are not
known. We studied the importance of phosphorylation of serine 503 in
this growth-inhibitory signaling pathway. Full-length CEACAM1 was found
to be phosphorylated in vivo in both tyrosine and serine
residues. Mutation of tyrosine 488 to phenylalanine did not abolish the
tumor-suppressive activity of CEACAM1, suggesting that phosphorylation
at tyrosine 488 is not critical for CEACAM1's tumor-suppressive
activity. Although expression of CEACAM1's cytoplasmic domain
inhibited the growth of DU145 prostate cancer cells in vivo, mutation of serine 503 to alanine abolished the
growth-inhibitory activity. In addition, the change of serine 503 to
aspartic acid produced tumor-suppressive activity similar to that of
the wild-type CEACAM1. These results suggested that phosphorylation at
serine 503 is essential for CEACAM1's growth-inhibitory function
in vivo.
CEACAM11 (previously
known as C-CAM1) is a cell-cell adhesion molecule of the immunoglobulin
supergene family that has been shown to mediate homotypic cell adhesion
(1, 2). The involvement of CEACAM1 in growth regulation was suggested
by observations that CEACAM1 protein was down-regulated in cancers of
prostate (3, 4), breast (5, 6), colon (7, 8), and endometrium (9), thus
indicating that CEACAM1 may have a role in tumorigenesis. The
restoration of CEACAM1 expression in prostate (10-12), breast (13),
and colon (14) cancer cells dramatically reduced these cells' ability
to form tumors in vivo, which indicated that CEACAM1 functions as a growth suppressor. In addition, direct injection of
Ad-CEACAM1, an adenoviral vector that carries the human CEACAM1 gene,
into DU145 tumors in nude mice significantly suppressed the growth of
these tumors (11). These results suggested that CEACAM1 functions as a
tumor suppressor in prostate tumors and that Ad-CEACAM1 is a potential
therapeutic agent for prostate cancer.
Structure and function study of CEACAM1 revealed that the first
extracellular immunoglobulin domain is important for its adhesion function (2). We found that neither the adhesion domain of CEACAM1 (13,
15) nor its extracellular and transmembrane domains are required for
CEACAM1's tumor-suppressive activity (16). However, the cytoplasmic
domain of CEACAM1 is essential and sufficient for growth suppression of
prostate cancer cells (16), suggesting the involvement of signal
transduction through the cytoplasmic domain.
The signal pathway leading to tumor suppression by CEACAM1 is largely
unknown. The cytoplasmic domain of CEACAM1 is relatively short (71 amino acids) and does not contain strong homology to the kinase or
phosphatase domains, suggesting that the cytoplasmic domain may not
possess kinase or phosphatase activity typical of growth factor
receptors. However, several tyrosine kinases, including Lyn (17), Hck
(17), and Src (18), were reported to associate with the human homologue
of CEACAM1, CD66a. Similarly, Najjar et al. (19) reported
that rat CEACAM1 is a substrate of the insulin receptor kinase. Binding
of SH2-containing phosphatase (SHP-1) to mouse CEACAM1 in a tyrosine
phosphorylation-dependent fashion was also reported (20).
The binding of tyrosine kinases and phosphatases to CEACAM1 may be
caused by the presence of a partial immunoreceptor tyrosine-based
activation and inhibition motif in the CEACAM1 cytoplasmic
domain (20). These observations suggested that tyrosine phosphorylation
of the CEACAM1 cytoplasmic domain may be critical for CEACAM1's function.
In addition to tyrosine phosphorylation, CEACAM1 was shown to be
phosphorylated at serine by an in vivo labeling study (21). Whether phosphorylation at serine is required for CEACAM1's
growth-suppressive activity is a critical issue that has not been
addressed. Here we present results obtained with use of a site-specific
phosphorylation-negative CEACAM1 mutant and a putative
phosphorylation-equivalent mutant to test the biological significance
of serine 503 phosphorylation in CEACAM1-mediated tumor-suppressive activity.
Construction of Expression Vectors and Generation of Recombinant
Adenovirus--
Generation of adenovirus containing the full-length
wild-type CEACAM1 cDNA in the sense (Ad-CEACAM1) and antisense
(Ad-AS) orientations has been described previously (22). The
Ad-CAM1-Y488F virus, in which Tyr-488 was mutated to Phe, was
generated as follows. The CAM1-Y488F fragment with flanking
HindIII-NotI sites was generated by
polymerase chain reaction (PCR) with oligonucleotides
5'-GTCGACAAGCTTATGGAGCTAGCCTCGGCTCGTCTC-3' and
5'- GCGGCCGCGTCGACGGTATCGATAAGGTTGATATC-3' as
primers (the HindIII and NotI sites are
underlined) and using pSK-F488 (23) as template. The 1.6-kb
product was subcloned into pCRII to yield pCRII-Adeno-Y488F. The DNA
fragment coding for CAM1-Y488F was isolated from pCRII-Adeno-Y488F by
digestion with HindIII and NotI, and the fragment
was inserted into the adenoviral shuttle vector pXCMV at the
HindIII-NotI site to generate pXCMV-CAM1-Y488F. The Ad-CAM1-G454 virus, with six amino acids in its cytoplasmic domain,
was generated in the same manner as for Ad-CAM1-Y488F, except for the
use of template pSK-CAM3 (24). The Ad-CAM1-S503A virus, which contains
a Ser-503 to Ala mutation, was generated in the same manner as for
Ad-CAM1-Y488F, except that oligo 200, which contains nucleotides
CEACAM1 mutants containing only the cytoplasmic domain (CAM1-cyto),
cytoplasmic domain with a serine 503 to alanine mutation (CAM1-cyto-S503A), or cytoplasmic domain with a serine to aspartic acid
mutation (CAM1-cyto-S503D), were constructed as follows. A translation
initiation codon (ATG) was inserted at the N terminus of the
cytoplasmic domain by PCR. An oligonucleotide (oligo 55, AAGCTTATGGGATCCAGGAAGACTGGCGGGGGA) that contained the
HindIII restriction site, a sequence encoding methionine and
glycine, and nucleotides 1345-1365 of CEACAM1 (25), was synthesized
and used as the 5'-primer. For the CAM1-cyto, the 3'-oligonucleotide primer (oligo 54) contained a sequence complementary to nucleotides 1540-1560 of CEACAM1 and a NotI restriction site. For the
CAM1-cyto-S503A mutant, the 3'-oligonucleotide primer (oligo 201)
contained nucleotides 1504-1560 with a TCA to GCA mutation at the
serine 503 and a NotI restriction site. For the
CAM1-cyto-S503D mutant, the 3'-oligonucleotide primer (oligo 205)
contained nucleotides 1504-1560 with a TCA to GAT mutation at the
serine 503 and a NotI restriction site. Using oligo 55 as
the 5'-primer and corresponding 3'-primer and the full-length CEACAM1
cDNA as the template for PCR, 236-bp (CAM1-cyto, CAM1-cyto-S503A,
and CAM1-cyto-S503D) products were obtained. The PCR products were
subcloned into a pCRII plasmid, and the nucleotide sequence of the
double-stranded DNA was determined to confirm that no nucleotide
substitution had occurred. The fragments were digested with
HindIII and NotI and inserted into the adenoviral shuttle vector pXCMV at HindIII-NotI sites to
generate pXCMV-CAM1-cyto, pXCMV-CAM1-cyto-S503A, and
pXCMV-CAM1-cyto-S503D. Recombinant adenoviruses containing cDNAs
coding for mutant CEACAM1 sequences were generated in 293 embryonic
kidney cells by cotransfection of plasmid pJM17, which contained the
adenovirus genome with the E1 region deleted and CEACAM1 mutant
cDNAs in adenoviral shuttle vectors according to the published
procedures (26). PCR using a pair of primers (XCMV1 and XCMV2) (26),
which flank the cDNA insert, showed a predicted size of
corresponding DNA fragments (data not shown), suggesting that no DNA
rearrangement or deletion had occurred during recombination.
Phosphorylation Analysis of CEACAM1 Mutant Proteins Expressed in
DU145 Cells--
DU145 cells were infected with recombinant adenovirus
at a multiplicity of infection (m.o.i.) of 10 for 24 h. Cells were
washed with phosphate-free minimal essential medium (MEM) (Life
Technologies, Inc., Rockville, MD) three times to remove the phosphate
in the medium. Cells were further incubated in phosphate-free MEM
containing 0.5 mCi of [32P]phosphoric acid (Amersham
Pharmacia Biotech, Arlington Height, IL) and 10% fetal bovine serum,
which had been dialyzed against Tris-buffered saline (50 mM
Tris-HCl, 150 mM NaCl, pH 7.4). After overnight incubation,
the 32P-containing medium was removed and the cells were
washed three times with Tris-buffered saline (50 mM
Tris-HCl, pH 7.4, 150 mM NaCl). The 32P-labeled
cells were solubilized from the plates with 2 ml of 1× lysis buffer
(0.5% Triton X-100, protease inhibitor mixture (antipain
dihydrochloride, bestatin, chymostatin, E64, leupeptin, pepstatin,
phosphoamidon, Pefabloc, EDTA disodium salt, and aprotinin; Roche
Molecular Biochemicals Corp., Indianapolis, IN), 10 mM
phenylmethylsulfonyl fluoride, 100 mM NaF, 100 mM ATP, 4 mM EDTA, and 10 mM sodium pyrophosphate) with or without 20 mM sodium orthovanadate.
After the detergent-insoluble material was removed by centrifugation, the supernatant fractions were used for immunoprecipitation. The supernatant fractions (1 ml) were incubated with 3 µl of antibody against CEACAM (Ab669) (27) and 30 µl of protein G-Sepharose (Amersham Pharmacia Biotech, Piscataway, NJ) for 16 h at 4 °C with constant mixing. The immunoprecipitates were washed twice with 0.8 ml of immunoprecipitation buffer (150 mM NaCl, 1 mM EDTA, 0.5% deoxycholate, 1% Nonidet P-40, and 25 mM Tris-HCl, pH 7.5) containing 0.1 ml of saturated NaCl,
then twice with 0.8 ml of immunoprecipitation buffer containing 0.1%
SDS. The materials bound to protein G-Sepharose were eluted by boiling
the protein G-Sepharose in SDS sample buffer then analyzed by
SDS-polyacrylamide gel electrophoresis (28). After electrophoresis, the
proteins were transferred to nitrocellulose membranes, and the
phosphorylated proteins were detected by phosphorimaging analysis. The
membrane was further exposed to antiphosphotyrosine antibody (anti-PY, clone 4G10; Upstate Biotechnology Inc., Lake Placid, NY) and secondary antibody, and detected by an enhanced chemiluminescence assay.
Western Immunoblot Analysis of CEACAM1 Cytoplasmic Domain Mutant
Proteins Expressed in DU145 Cells--
Aliquots of the cell lysate
were boiled in SDS sample buffer and analyzed by SDS-polyacrylamide gel
electrophoresis (28). After electrophoresis, proteins were transferred
to nitrocellulose membranes, exposed to rabbit anti-cytoplasmic domain
antibody anti-C2 (27) and secondary antibody, and detected by an
enhanced chemiluminescence assay.
Measurement of in Vivo Tumor Growth from Recombinant
Adenovirus-infected DU145 Cells--
DU145 cells were infected with
recombinant adenovirus at an m.o.i. of 10 for 48 h. The cells were
harvested by trypsin treatment and resuspended in MEM. Cells (2 × 106 cells in a total volume of 100 µl) were injected
subcutaneously into the flanks of nu/nu mice. The sizes of tumors that
developed from these DU145 cells were determined weekly with calipers
to measure length, width, and height of the tumor nodules. Tumor sizes
were calculated according to the formula of Rockwell et al.
(29).
Statistical Analysis--
The nonlinear regression approach (30)
with random effects was used to analyze the longitudinal growth data of
tumors in different treatment groups. The tumor growth rates were
modeled according to the exponential curve with the formula:
tumor size (mm3) = C × e(t×k) + Phosphorylation of CEACAM1--
DU145 cells, derived from human
prostatic carcinoma metastasized to brain (31), were previously shown
to be deficient in CEACAM1 expression, and re-expression of CEACAM1 by
adenoviral-mediated gene transfer was able to inhibit their
tumorigenicity, as tested in vivo in a nude-mouse xenograft
model (16). To examine whether CEACAM1 was phosphorylated when
expressed in DU145 cells, the cells were infected with control
adenovirus (Luc) or Ad-CEACAM1. Following metabolic labeling with
[32P]orthophosphoric acid, the full-length wild-type
CEACAM1 was immunoprecipitated with polyclonal antibody against CEACAM
(27). That CEACAM1 could be identified as a phosphoprotein suggested that CEACAM1 was phosphorylated in DU145 cells (Fig.
1A). In addition, no
phosphorylation was detected on the CEACAM1 mutant with deletion of the
cytoplasmic domain, i.e. CAM1-G454, suggesting that the phosphorylation sites were located within the last 65 amino acids of the cytoplasmic domain (Fig. 1A).
To further examine the amino acids that were phosphorylated,
phosphorylated CEACAM1 protein was immunoblotted with
anti-phosphotyrosine antibody. As shown in Fig. 1B,
phosphorylated CEACAM1 protein was reactive with anti-phosphotyrosine
antibody, suggesting that CEACAM1 is at least phosphorylated on
tyrosine residues. To test whether CEACAM1 is phosphorylated on
residues other than tyrosines, immunoprecipitation of CEACAM1was
carried out in a lysis buffer without the tyrosine phosphatase
inhibitor vanadate. As shown in Fig. 1A, CEACAM1 was labeled
with 32P, but at a lower level when compared with the
CEACAM1 prepared in the presence of vanadate. In addition, this
phosphorylated CEACAM1 was not reactive with antibody specific to
anti-phosphotyrosine (Fig. 1B). This observation suggested
that CEACAM1 is phosphorylated in serine/threonine residues in addition
to tyrosine residues.
The observation that CEACAM1 was phosphorylated in DU145 cells in
vivo suggested that phosphorylation modification of CEACAM1 may be
involved in the growth-suppressive function mediated by CEACAM1. A
previous study by Sippel et al. (21) showed that CEACAM1 was
phosphorylated at Tyr-488 and Ser-503 residues when expressed in COS
cells. Thus, the phosphorylation of CEACAM1 observed in DU145 cells
most likely occurred at the Tyr-488 and Ser-503 residues. To test this
possibility, we have generated recombinant adenoviruses containing the
full-length CEACAM1 with either a Tyr-488 to Phe mutation
(Ad-CAM1-Y488F) or a Ser-503 to Ala mutation (Ad-CAM1-S503A) and used
them to infect DU145 cells. Following metabolic labeling with
[32P]orthophosphoric acid, the wild-type and mutant
CEACAM1 proteins were immunoprecipitated with anti-CEACAM1 antibody
Ab669 in the absence or presence of orthovanadate, an inhibitor of
phosphotyrosine phosphatase. As shown in Fig.
2B, no tyrosine
phosphorylation was detected in the wild-type or mutant CEACAM1 when
immunoprecipitation was performed in the absence of vanadate. On the
other hand, tyrosine phosphorylation of CEACAM1 could be detected when
immunoprecipitation was performed in the presence of vanadate (Fig.
2D). Thus, the phosphorylation of CEACAM1 in the absence of
vanadate is on Ser/Thr rather than on Tyr. In the absence of vanadate,
a significant decrease in CEACAM1 phosphorylation was observed with the
CAM1-S503A mutant, whereas the CAM1-Y488F mutant exhibited only
slightly reduced phosphorylation as compared with that of the wild-type CEACAM1 (Fig. 2A). This observation suggests that Ser-503 is
a major phosphorylation site. By quantifying the radioactivities in the
wild-type CEACAM1 and CAM1-S503A, we estimate that about 85% of total
Ser/Thr phosphorylation in CEACAM1 occurred on Ser-503. Western blot
analysis using Ab669 showed that similar amounts of CEACAM1 proteins
were expressed among different mutants (data not shown).
There are two tyrosine residues in the cytoplasmic domain of CEACAM1,
i.e. Tyr-488 and Tyr-513 (25). Mutation of Tyr-488 to Phe
resulted in a significant decrease in phosphotyrosine, suggesting that
Tyr-488 is a major tyrosine phosphorylation site in CEACAM1 (Fig.
2D). However, Tyr-513 is also phosphorylated in
vivo, albeit to a lesser extent, because mutation of Tyr-488 to
Phe did not completely abolish tyrosine phosphorylation (Fig. 2D). By quantifying the intensity of CAM1-Y488F with that of
wild type CEACAM1 using a densitometer, we estimated that about 80% of
total tyrosine phosphorylation occurred on Tyr-488.
The relative extent of total Ser/Thr phosphorylation versus
total Tyr phosphorylation on CEACAM1 can be estimated from the radioactivities on the wild-type CEACAM1 proteins immunoprecipitated in
the absence and presence of vanadate (Fig. 2, A and
C). From this comparison, we find that Ser/Thr
phosphorylation accounts for about 40% and Tyr phosphorylation about
60% of total phosphorylation on CEACAM1.
Effect of Tyrosine 488 Mutation on CEACAM1's Tumor-suppressive
Activity--
To investigate the effect of tyrosine phosphorylation on
CEACAM1-mediated tumor suppression, Ad-CAM1-Y488F was used to infect DU145 cells. Expression of the full-length wild type CEACAM1 in DU145
cells, which were previously shown to be deficient in CEACAM1 protein
expression (11), effectively inhibited tumor growth in vivo
when tested in a mouse xenograft model (Fig.
3). Similarly, expression of CEACAM1 with
a Tyr-488 to Phe mutation (CAM1-Y488F) in DU145 cells, though not as
effective as that of wild-type CEACAM1, showed significant
growth-inhibitory activity in two separate experiments (Fig. 3,
A and B). Statistical analysis showed that the
growth rates of Ad-CAM1-Y488F-treated tumors differed significantly from no virus- or control virus-treated tumors (Table I, A
and B). This observation
suggests that phosphorylation at Tyr-488 is not critical for CEACAM1's
growth-suppressive activity, although it may have a role in regulating
its efficiency.
Effect of Serine 503 to Alanine Mutation on Tumor-suppressive
Activity--
We have previously shown that expression of the
cytoplasmic domain of CEACAM1 is sufficient to elicit its tumor
suppressive activity in vivo (16). To examine the role of
serine phosphorylation on CEACAM1-mediated tumor suppression, the
serine residue (S503) located in the CEACAM1 cytoplasmic domain was
mutated to alanine to generate a recombinant adenovirus
(Ad-CAM1-cyto-S503A) containing cDNA coding for the cytoplasmic
domain with the mutation (Fig. 4A). Expression of the mutant
protein was achieved by infecting DU145 prostate cancer cells with
Ad-CAM1-cyto-S503A. Western blot analysis using antipeptide antibodies
against the CEACAM1 cytoplasmic domain (anti-C2) (27) showed that the
wild-type CEACAM1 cytoplasmic domain protein (CAM1-cyto) had a
molecular mass of 7-8 kDa and was expressed with a level similar to
that of full-length CEACAM1 (Fig. 4B). Mutant
CAM1-cyto-S503A protein has a molecular mass similar to that of
CAM1-cyto (Fig. 4C).
The effect of CAM1-cyto-S503A mutant protein on the
tumorigenicity of DU145 cells in vivo was examined in a nude
mouse xenograft model. DU145 cells were infected with
Ad-CAM1-cyto-S503A with an m.o.i. of 10, and the cells were injected
subcutaneously into nude mice 2 days after viral infection. Expression
of the wild-type CEACAM1's cytoplasmic domain inhibited the growth of
DU145 prostate cancer cells in vivo, as evidenced by the
reduction in tumor incidence and size (Fig.
5A). However, mutation of
serine 503 to alanine abolished the growth-inhibitory activity (Fig.
5A). When the tumor growth rate was calculated by using an
exponential curve, Ad-CAM1-cyto-S503A-treated tumors had a growth rate
of 14.744 ± 0.491, similar to that of Ad-AS- or Ad-Luc-treated
tumors that showed growth rates of 14.209 ± 0.508 and 13.229 ± 0.547, respectively. Statistical analysis showed that the growth
rates of Ad-CAM1-cyto-S503A- and control virus-treated tumors did not
differ significantly (Table
IIA). These results suggest
that phosphorylation at S503 may be critical for CEACAM1's
growth-suppressive activity.
Effect of Serine 503 to Aspartic Acid Mutation on
Tumor-suppressive Activity--
Conversion of serine to
aspartic or glutamic acid has been shown to imitate serine
phosphorylation-induced changes in the function of several proteins,
including polymeric immunoglobulin receptor (32), myosin heavy chain
(33), and bovine prolactin (34). Therefore, serine 503 in the
CEACAM1's cytoplasmic domain was changed to aspartic acid, and the
corresponding recombinant adenovirus (Ad-CAM1-cyto-S503D) was generated
(Fig. 4A). The effect of the CAM1-cyto-S503D mutant on the
tumorigenicity of DU145 cells was compared with those of CAM1-cyto and
CAM1-cyto-S503A. In contrast to CAM1-cyto-S503A, expression of the
CAM1-cyto-S503D mutant in DU145 cells completely suppressed DU145 tumor
growth in vivo (Fig. 5B), similar to that of
wild-type CAM1-cyto. In this experiment, the Ad-CAM1-cyto-S503A-treated
tumors had a growth rate of 17.481 ± 0.764, similar to that of
Ad-AS-treated tumor, which was 17.561 ± 0.782. The growth rates
for Ad-CAM1-cyto- and Ad-CAM1-cyto-S503D-treated tumors were zero and
significantly different from those of Ad-AS- or
Ad-CAM1-cyto-S503A-treated tumors (Table IIB). These results strongly suggest that phosphorylation at serine 503 is critical for
CEACAM1-mediated tumor suppression.
By demonstrating that phosphorylation at serine 503 is required
for CEACAM1-mediated tumor-suppressive activity, this study raises the
possibility that phosphorylation at Ser-503 is directly involved in the
signal transduction pathways that lead to tumor suppression. The study
also indicates the involvement of kinase and phosphatase activities in
the regulation of CEACAM1's growth-suppressive function.
Phosphorylation of target proteins as a mechanism of recruiting
proteins into signaling complexes has become one of the paradigms for
signal transduction (35, 36). Phosphorylation at a specific amino acid
residue enables the phosphorylated protein to interact with proteins
that contain phosphoprotein-binding domains (36). SH2 and PTB domains
are known to bind to tyrosine-phosphorylated target proteins that have
functions in growth regulation (37, 38). WD40 or leucine-rich repeat
domains in F-box proteins were shown to target the
phosphoserine-containing proteins, and this resulted in degrading of
the targeted proteins (39). Association of the phosphoserine-binding
protein 14-3-3 with protein kinases c-Bcr and Bcr-Abl was postulated to
affect the mitogenic and cell-cycle control pathways (40); 14-3-3 protein homologues were also shown to be required for the DNA-damage
checkpoint in fission yeast (41) and for Raf-1 activation (42-44).
Using a panel of phosphorylated peptides based on the peptide sequences
of Raf-1, Muslin et al. (45) defined the 14-3-3 binding
motif. Interestingly, the sequences of CEACAM1 encompass Ser-503,
RPTSAX, is homologous to the 14-3-3 binding motif. However, we found no
evidence that CEACAM1 is associated with 14-3-3 protein (data not
shown). Identification of the protein that binds to the
Ser-503-phosphorylated form of CEACAM1 will be critical for unraveling
CEACAM1's downstream signaling events.
In this study we showed that phosphorylation of Tyr-488 was not
critical for CEACAM1-mediated tumor suppression. This result is
contrary to that reported by Izzi et al. (46). There are several possibilities that may explain this discrepancy. First, Izzi
et al. (46) used mutant CEACAM1 proteins expressed in mouse colonic carcinoma cell lines to study their effects in BALB/c syngeneic mice, whereas we used human prostate carcinoma cells injected in a nude-mouse xenograft model in our study. Thus, both the
cancer cell lines and the mouse models are different. In addition, they
transfected the CEACAM1 gene into the colonic carcinoma cells by
retroviral-mediated infections followed with G418 selection, whereas we
used adenovirus vector to achieve high efficiency protein expression
without gene integration. Finally, it is also possible that
phosphorylation of tyrosine 513 can functionally complement for the
loss of tyrosine 488. As shown in our study (Fig. 2), tyrosine 513 was
phosphorylated in DU145 cells although to a much lesser extent than
that of tyrosine 488. Therefore, the discrepancy between our study and
that of Izzi et al. (46) may arise from differences in the
extent of tyrosine 513 phosphorylation in the different cancer cell
lines used.
The observation that phosphorylation of serine 503 is required for
growth-inhibitory activity is important for searching the downstream
mechanisms associated with CEACAM1-mediated tumor suppression. Previous
efforts to identify CEACAM1-interacting proteins with the yeast
two-hybrid approach using wild-type CEACAM1 cytoplasmic domain and with
the protein-pull down assay using GST-CAM1-cyto fusion protein
containing the wild-type CEACAM1 cytoplasmic domain fused to GST
protein did not yield useful information (data not shown). In light of
the present study, the failure to identify molecules that interact with
the CEACAM1 cytoplasmic domain may be due to the absence of
phosphorylation at the serine residue. Because the S503D mutant, which
presumably mimics the phosphorylated state of CEACAM1, allows the
interacting protein to bind and resume CEACAM1's tumor-suppressive
activity, the S503D mutant may be used to identify CEACAM1-interacting
protein in both yeast two-hybrid and protein-pull down assays.
Taken together, the results of our study indicated that
post-translational regulation at serine 503 is critical for CEACAM1's tumor-suppressive activity. It will be interesting to identify the
kinase that phosphorylates serine 503 and the adaptor protein that
binds to the specific phosphorylated motif. Understanding the molecular
mechanism of tumor suppression by CEACAM1 will enable us to use this
molecule more effectively in the prevention and treatment of cancer.
*
This work was supported by Grant CA64856 (to S. H. L.),
Core Grant CA16672 (to M. D. Anderson Cancer Center), and
Predoctoral Training Grant T32 CA67759 (to V. T. E.) from the
National Institutes of Health.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Published, JBC Papers in Press, February 5, 2001, DOI 10.1074/jbc.M008156200
The abbreviations used are:
CEACAM, cell-cell
adhesion molecule (previously known as C-CAM);
CAM1-cyto, CAM1
cytoplasmic domain;
PCR, polymerase chain reaction;
Ad-CEACAM1, sense;
Ad-AS, antisense;
m.o.i., multiplicity of infection;
MEM, minimal
essential medium;
kb, kilobase(s);
bp, base pair(s).
Signal Transduction by the CEACAM1 Tumor Suppressor
PHOSPHORYLATION OF SERINE 503 IS REQUIRED FOR GROWTH-INHIBITORY
ACTIVITY*
,
,
Department of Molecular Pathology, The
University of Texas M. D. Anderson Cancer Center, Houston, Texas
77030, the § Department of Pediatrics and Center for
Academic and Reading Skills, The University of Texas-Houston Health
Science Center, Houston, Texas 77030, and the ¶ Department of
Medical Oncology, Rhode Island Hospital, Brown University, Providence,
Rhode Island 02906
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
63
to
40 (25) and a HindIII site, and oligo 201, which
contains nucleotides 1504-1560 with a TCA to GCA mutation at the
serine 503 and a NotI restriction site, were used as the PCR
primers, and a full-length CEACAM1 cDNA was used as the template.
, where C is
a constant, t is time, k is tumor growth rate, and
is measurement error. In this analysis, tumor growth rates are
functions of treatment effects and mouse variability, which arises from
biological or genetic factors. This mixed-effect model accounts for
both within-subject and between-subject variations.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (34K):
[in a new window]
Fig. 1.
Phosphorylation of CEACAM1 in DU145
cells. DU145 cells were infected with control virus (Ad-Luc),
Ad-CEACAM1, or Ad-CAM1-G454 virus, respectively, for 24 h. The
cells were then incubated overnight in phosphate-free MEM containing
0.5 mCi of [32P]phosphoric acid. Immunoprecipitation of
CEACAM1 protein (C-CAM1) was performed as described under
"Experimental Procedures." The immunoprecipitates were analyzed on
SDS-polyacrylamide gel electrophoresis and transferred onto a
nitrocellulose membrane. A, PhosphorImager analysis of
phosphorylated proteins; B, Western immunoblot analysis of
proteins with anti-phosphotyrosine antibody (anti-pY) in 1 to 1000 dilution. Arrow indicates the location of CEACAM1
proteins in SDS-polyacrylamide gel.

View larger version (48K):
[in a new window]
Fig. 2.
Phosphorylation of CEACAM1 mutants.
DU145 cells were infected with recombinant adenoviruses as indicated.
After 24 h of incubation, the media were removed and the cells
were then incubated overnight in phosphate-free MEM containing 0.5 mCi
of [32P]phosphoric acid. The cells were washed, lysed,
and immunoprecipitated with Ab669 in the absence (A and
B) or presence (C and D) of vanadate
as described under "Experimental Procedures." A and
C, PhosphorImager analysis of phosphorylated proteins;
B and D, Western immunoblot analysis of proteins
with anti-phosphotyrosine antibody (anti-pY).

View larger version (12K):
[in a new window]
Fig. 3.
Effect of tyrosine mutation on CEACAM1's
growth-suppressive activity. DU145 cells (no virus) or DU145 cells
infected with Ad-AS (antisense, control), Ad-CEACAM1 (sense), or
Ad-CAM1-Y488F (Tyr-488 mutated to Phe) were injected subcutaneously
into the flanks of nu/nu mice at 2 × 106 cells/site.
Eighteen sites were injected for each virus-infected cells. Tumor sizes
were measured at 20 and 30 days post-injection; average tumor
sizes ± S.E. from each group are shown. A and
B represent two independent experiments.
Tumor growth rate analysis of wild-type CEACAM1 and CAM1-F488 mutant

View larger version (25K):
[in a new window]
Fig. 4.
Analysis of CAM1-S503A and CAM1-S503D mutant
expressed in DU145 cells. A, schematic diagram of
mutant CEACAM1 (C-CAM1) molecules. Immunoglobulin-like
domains are labeled D1 to D4. Sig,
signal sequence; TM, transmembrane domain; cyto,
cytoplasmic domain, Met, methionine; Gly,
glycine; a.a., amino acids. B, immunoblot
analysis of full-length CEACAM1 and cytoplasmic domain mutant protein.
DU145 cells were infected with recombinant adenovirus at a multiplicity
of infection of 10 for 48 h. The cell lysates were prepared by
adding SDS-sample buffer to the cells. Cell lysates from cells infected
with recombinant virus are indicated at the top of each
lane. The positions of the cytoplasmic domain and the full-length
CEACAM1 protein are indicated by the arrow and
arrowhead, respectively. C, immunoblot analysis
of the cytoplasmic domain mutant proteins. Cell lysates from cells
infected with recombinant virus are indicated at the top of each
lane. Cell lysate from Ad-Luc-infected cells was used as a
control. Immunoblot shows anti-peptide antibody anti-C2 (27) in 1:500
dilution.

View larger version (13K):
[in a new window]
Fig. 5.
Effect of S503 mutation on CEACAM1's
growth-inhibitory activity. A, DU145 cells were
infected with control virus (Ad-Luc or Ad-AS), Ad-CAM1-cyto, or
Ad-CAM1-cyto-S503A; and B, DU145 cells were infected with
Ad-AS(control), Ad-CAM1-cyto, Ad-CAM1-cyto-S503A, or Ad-CAM1-cyto-S503D
as described under "Experimental Procedures." Cells were injected
subcutaneously into the flanks of nu/nu mice at 2 × 106 cells/site. A total of 12 sites were injected for each
virus-infected cell line. Tumor sizes were measured weekly, and average
tumor sizes ± S.E. from each group are shown. A and
B represent two independent experiments.
Tumor growth rate analysis of cytoplasmic domain mutants
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
FOOTNOTES
To whom correspondence should be addressed: Dept. of Molecular
Pathology, Box 89, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Blvd., Houston, TX 77030. Tel.: 713-794-1559; Fax: 713-794-4672; E-mail: slin@notes.mdacc.tmc.edu.
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Ocklind, C.,
and Obrink, B.
(1982)
J. Biol. Chem.
257,
6788-6795
2.
Cheung, P. H.,
Luo, W.,
Qiu, Y.,
Zhang, X.,
Earley, K.,
Millirons, P.,
and Lin, S. H.
(1993)
J. Biol. Chem.
268,
24303-24310
3.
Pu, Y. S.,
Luo, W.,
Lu, H.-H.,
Gingrich, J.,
Greenberg, N.,
and Lin, S.-H.
(1999)
J. Urol.
162,
892-896
4.
Kleinerman, D. I.,
Troncoso, P.,
Lin, S. H.,
Pisters, L. L.,
Sherwood, E. R.,
Brooks, T.,
von Eschenbach, A. C.,
and Hsieh, J. T.
(1995)
Cancer Res.
55,
1215-1220
5.
Riethdorf, L.,
Lisboa, B. W.,
Henkel, U.,
Naumann, M.,
Wagener, C.,
and Loning, T.
(1997)
J. Histochem. Cytochem.
45,
957-963
6.
Huang, J.,
Simpson, J. F.,
Glackin, C.,
Riethorf, L.,
Wagener, C.,
and Shively, J.
(1998)
Anticancer
18,
3203-3212
7.
Nollau, P.,
Scheller, H.,
Kona-Horstmann, M.,
Rohde, S.,
Hagenmuller, F.,
Wagener, C.,
and Neumaier, M.
(1997)
Cancer Res.
57,
2354-2357
8.
Nollau, P.,
Prall, F.,
Helmchen, U.,
Wagener, C.,
and Neumaier, M.
(1997)
Am. J. Pathol.
151,
521-530
9.
Bamberger, A. M.,
Riethdorf, L.,
Nollau, P.,
Naumann, M.,
Erdmann, I.,
Gotze, J.,
Brummer, J.,
Schulte, H. M.,
Wagener, C.,
and Loning, T.
(1998)
Am. J. Pathol.
152,
1401-1406
10.
Hsieh, J. T.,
Luo, W.,
Song, W.,
Wang, Y.,
Kleinerman, D. I.,
Van, N. T.,
and Lin, S. H.
(1995)
Cancer Res.
55,
190-197
11.
Luo, W.,
Talposky, M.,
Earley, K.,
Wood, C.,
Wilson, D.,
Logothetis, C. J.,
and Lin, S.-H.
(1999)
Cancer Gene Ther.
6,
313-321
12.
Lin, S.-H.,
Pu, Y.-S.,
Luo, W.,
Wang, Y.,
and Logothetis, C.
(1999)
Anticancer Res.
19,
337-340
13.
Luo, W.,
Wood, C.,
Earley, K.,
Hung, M.-C.,
and Lin, S.-H.
(1997)
Oncogene
14,
1697-1704
14.
Kunath, T.,
Ordonez-Garcia, C.,
Turbide, C.,
and Beauchemin, N.
(1995)
Oncogene
11,
2375-2382
15.
Hsieh, J. T.,
Earley, K.,
Pong, R.-C.,
Wang, Y.,
Van, N. T.,
and Lin, S.-H.
(1999)
Prostate
41,
31-38
16.
Estrera, V. T.,
Luo, W.,
Phan, D.,
Hixson, D.,
and Lin, S.-H.
(1999)
Biochem. Biophys. Res. Commun.
263,
797-803
17.
Skubitz, K. M.,
Campbell, K. D.,
Ahmed, K.,
and Skubitz, P. N.
(1995)
J. Immunol.
155,
5382-5390
18.
Brummer, J.,
Neumaier, M.,
Gopfert, C.,
and Wagener, C.
(1995)
Oncogene
11,
1649-1655
19.
Najjar, S. M.,
Accili, D.,
Philippe, N.,
Jernberg, J.,
Margolis, R.,
and Taylor, S. I.
(1993)
J. Biol. Chem.
268,
1201-1206
20.
Beauchemin, N.,
Kunath, T.,
Robitaille, J.,
Chow, B.,
Turbide, C.,
Daniels, E.,
and Veillette, A.
(1997)
Oncogene
14,
783-790
21.
Sippel, C. J.,
Fallon, R. J.,
and Perlmutter, D. H.
(1994)
J. Biol. Chem.
269,
19539-19545
22.
Kleinerman, D. I.,
Zhang, W. W.,
Lin, S. H.,
Nguyen, T. V.,
von Eschenbach, A. C.,
and Hsieh, J. T.
(1995)
Cancer Res.
55,
2831-2836
23.
Lin, S. H.,
Luo, W.,
Earley, K.,
Cheung, P.,
and Hixson, D. C.
(1995)
Biochem. J.
311,
239-245
24.
Cheung, P. H.,
Culic, O.,
Qiu, Y.,
Earley, K.,
Thompson, N.,
Hixson, D. C.,
and Lin, S. H.
(1993)
Biochem. J.
295,
427-435
25.
Lin, S.-H.,
and Guidotti, G.
(1989)
J. Biol. Chem.
264,
14408-14414
26.
Zhang, W.-W.,
Fang, X.,
Branch, C. D.,
Mazur, W.,
French, B. A.,
and Roth, J. A.
(1993)
BioTechniques
15,
869-872
27.
Lin, S. H.,
Culic, O.,
Flanagan, D.,
and Hixson, D. C.
(1991)
Biochem. J.
278,
155-161
28.
Laemmli, U. K.
(1970)
Nature
227,
680-685
29.
Rockwell, S. C.,
Kallman, R. F.,
and Fajardo, L. F.
(1972)
J. Natl. Cancer Inst.
49,
735-749
30.
Lindstrom, M. J.,
and Bates, D. M.
(1990)
Biometrics
46,
673-687
31.
Stone, K. R.,
Mickey, D. D.,
Wunderli, H.,
Mickey, G. H.,
and Paulson, D. F.
(1978)
Int. J. Cancer
21,
274-281
32.
Casanova, J. E.,
Breitfeld, P. P.,
Ross, S. A.,
and Mostov, K. E.
(1990)
Science
248,
742-745
33.
Egelhoff, T. T.,
Lee, R. J.,
and Spudich, J. A.
(1993)
Cell
75,
363-371
34.
Maciejewski, P. M.,
Peterson, F. C.,
Anderson, P. J.,
and Brooks, C. L.
(1995)
J. Biol. Chem.
270,
27661-27665
35.
Hunter, T.
(1995)
Cell
80,
225-236
36.
Barinaga, M.
(1999)
Science
283,
1247-1249
37.
van der Geer, P.,
and Pawson, T.
(1995)
Trends Biochem. Sci.
20,
277-280
38.
Pelicci, G.,
Lanfrancone, L.,
Grignani, F.,
McGlade, J.,
Cavallo, F.,
Forni, G.,
Nicoletti, I.,
Grignani, F.,
Pawson, T.,
and Pelicci, P. G.
(1992)
Cell
70,
93-104
39.
Lu, P.-J.,
Zhou, X. Z.,
Shen, M.,
and Lu, K. P.
(1999)
Science
283,
1325-1328
40.
Reuther, G. W.,
Fu, H.,
Cripe, L. D.,
Collier, J.,
and Pendergast, A. M.
(1994)
Science
266,
129-133
41.
Ford, J. C.,
Al-Khodairy, F.,
Fotou, E.,
Sheldrick, K. S.,
Griffiths, D. J. F.,
and Carr, A. M.
(1994)
Science
265,
533-534
42.
Freed, E.,
Symons, M.,
Macdonald, S. G.,
McCormick, F.,
and Ruggieri, R.
(1994)
Science
265,
1713-1716
43.
Irie, K.,
Gotoh, Y.,
Yashar, B. M.,
Errede, B.,
Nishida, E.,
and Matsumoto, K.
(1994)
Science
265,
1716-1719
44.
Li, S.,
Janosch, P.,
Tanji, M.,
Rosenfeld, G. C.,
Waymire, J. C.,
Mischak, H.,
Kolch, W.,
and Sedivy, J. M.
(1995)
EMBO J.
14,
685-696
45.
Muslin, A. J.,
Tanner, J. W.,
Allen, P. M.,
and Shaw, A. S.
(1996)
Cell
84,
889-897
46.
Izzi, L.,
Turbide, C.,
Houde, C.,
Kunath, T.,
and Beauchemin, N.
(1999)
Oncogene
18,
5563-5572
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
B. Albarran-Somoza, R. Franco-Topete, V. Delgado-Rizo, F. Cerda-Camacho, L. Acosta-Jimenez, M. Lopez-Botet, and A. Daneri-Navarro CEACAM1 in Cervical Cancer and Precursor Lesions: Association With Human Papillomavirus Infection J. Histochem. Cytochem., December 1, 2006; 54(12): 1393 - 1399. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Laurie, M. M. Comegys, M. P. Carreiro, J. F. Brown, D. L. Flanagan, K. E. Brilliant, and D. C. Hixson Carcinoembryonic Antigen-Related Cell Adhesion Molecule 1a-4L Suppression of Rat Hepatocellular Carcinomas Cancer Res., December 1, 2005; 65(23): 11010 - 11017. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Servin Pathogenesis of Afa/Dr Diffusely Adhering Escherichia coli Clin. Microbiol. Rev., April 1, 2005; 18(2): 264 - 292. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Comegys, S.-H. Lin, D. Rand, D. Britt, D. Flanagan, H. Callanan, K. Brilliant, and D. C. Hixson Two Variable Regions in Carcinoembryonic Antigen-related Cell Adhesion Molecule1 N-terminal Domains Located in or Next to Monoclonal Antibody and Adhesion Epitopes Show Evidence of Recombination in Rat but Not in Human J. Biol. Chem., August 13, 2004; 279(33): 35063 - 35078. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Plunkett and P. A. Ellis CEACAM1: A Marker With a Difference or More of the Same? J. Clin. Oncol., November 1, 2002; 20(21): 4273 - 4275. [Full Text] [PDF] |
||||
![]() |
B. W. M. van Balkom, P. J. M. Savelkoul, D. Markovich, E. Hofman, S. Nielsen, P. van der Sluijs, and P. M. T. Deen The Role of Putative Phosphorylation Sites in the Targeting and Shuttling of the Aquaporin-2 Water Channel J. Biol. Chem., October 25, 2002; 277(44): 41473 - 41479. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Volpert, W. Luo, T.-J. Liu, V. T. Estrera, C. Logothetis, and S.-H. Lin Inhibition of Prostate Tumor Angiogenesis by the Tumor Suppressor CEACAM1 J. Biol. Chem., September 13, 2002; 277(38): 35696 - 35702. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |