![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 19, 15953-15960, May 11, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Biochemistry, LaTrobe University,
Victoria 3086, Australia
Received for publication, October 10, 2000, and in revised form, February 5, 2001
Recently, we have shown that mitoxantrone can be
activated by formaldehyde in vitro to form DNA adducts that
are specific for CpG and CpA sites in DNA. The CpG specificity of
adduct formation prompted investigations into the effect of cytosine
methylation (CpG) on adduct formation, since the majority of CpG
dinucleotides in the mammalian genome are methylated and
hypermethylation in subsets of genes is associated with various
neoplasms. Upon methylation of a 512-base pair DNA fragment
(containing the lac UV5 promoter) using HpaII
methylase, three CCGG sites downstream of the promoter were methylated
at C5 of the internal cytosine residue. In vitro transcription studies of mitoxantrone-reacted DNA revealed a 3-fold enhancement in transcriptional blockage (and hence adduct formation) exclusively at these methylated sites. In vitro
cross-linking assays also revealed that methylation enhanced
mitoxantrone adduct formation by 2-3-fold, and methylation of cytosine
at a single potential drug binding site on a duplex oligonucleotide
also enhanced adduct levels by 3-fold. Collectively, these results
indicate preferential adduct formation at methylated CpG sites.
However, adducts at these methylated sites exhibited the same stability as nonmethylated sites, suggesting that cytosine methylation increases drug accessibility to DNA rather than being involved in kinetic stabilization of the adduct.
Mitoxantrone is a synthetic anticancer agent that is a member of
the anthracenedione class of compounds and was originally designed as a
simplified analogue of the anthraquinone-containing anthracyclines (1,
2). Because of the similar cytotoxicity to the anthracyclines yet lack
of associated cardiotoxicity (3, 4), mitoxantrone is an
important anticancer agent and has good activity against solid tumors
and myeloid cancers (5).
Recently, we have found that formaldehyde facilitates the formation of
mitoxantrone-DNA adducts and that these adducts stabilize duplex DNA
sufficiently to prevent strand separation in in vitro cross-linking assays (6). This structure was unstable and heat-labile, therefore not representing a classical covalent cross-link, and like
Adriamycin adducts these structures have been termed "virtual cross-links" (6). The possible potentiation of mitoxantrone cytotoxicity in the presence of formaldehyde may provide an explanation as to why mitoxantrone is most effective against myeloid cancers, since
they are known to have higher levels of formaldehyde (7). We have also shown that these formaldehyde-activated
mitoxantrone-DNA adducts form predominantly at CpG and CpA sequences
(8).
The CpG specificity of adduct formation in vitro suggested
that methylation may modulate adduct formation in cells. It is known
that CpG dinucleotides are underrepresented in the genome with
significant depletion of the doublet in ~99% of the genome in higher
eukaryotes, whereas the remaining 1% contains CpG at the expected
frequency (9, 10). In mammalian species, these CpG dinucleotides are
known to be highly methylated with 60-90% methylation at the
5-position of cytosine, whereas only 3-5% of isolated cytosine
residues occur as 5-methylcytosine (9, 10). Control of the methylation
status of cytosines plays a central role in regulating expression of
genes during mammalian development (11). In contrast, tumor cells often
have aberrant DNA methylation, and it has been hypothesized that
altered methylation is an important component of neoplastic
transformation (10). Past studies have reported hypomethylation of the
genome and of specific genes in human tumors when compared with
noncancerous cells (12-14). The demethylation appears to be random,
because specific genes that presumably would not contribute to tumor
progression (not involved in cell proliferation and suppression) have
been found to be hypomethylated (10).
However, it has also been reported that there is an increase in
methyltransferase activity and regions of hypermethylation in some
cancer cell lines. These findings are surprising considering the
widespread hypomethylation of DNA in tumors. In some cell lines, DNA
methylase activity has been found to be abnormally high, with a
30-50-fold increase in virally transformed cells and a several
hundred-fold increase in human cancer cells (15). However, this is not
accompanied by increased global methylation (16). Baylin et
al. (12) have examined methylation of the calcitonin gene in human
lymphoid and acute myeloid malignancies in both cultured and uncultured
tumors and detected increased methylation at CCGG sites in the 5'
region of the gene. An increase in methylation was found in 90% of
patients with non-Hodgkin's lymphoid neoplasms and in 95% of tumor
cell DNA extracted from patients with acute nonlymphocytic leukemia.
These unusual methylation patterns in the calcitonin gene were found
much less frequently in other tumor types (12, 13). More recently,
Clark and colleagues (17) analyzed the methylation pattern of a number
of tumor-related genes in leukemia and found that 90% of acute myeloid
leukemia patients exhibited an abnormal methylation pattern with
hypermethylation in at least one gene, and 75% exhibited an increase
in methylation in two or more of the target genes. This was in contrast
to the normal control samples, which were essentially unmethylated.
Hypermethylation in leukemia is therefore not limited to single genes
(17). In contrast, a recent global analysis of the methylation status
of 1200 CpG islands in 98 primary human tumors found that some tumors (including breast and testicular tumors) displayed relatively decreased
levels of methylation; however, others (including myeloid leukemias)
displayed a higher frequency of methylation (18).
Since mitoxantrone-induced DNA adducts have been found to occur
preferentially at CG sites, which are the dinucleotide substrates of
methylation, and because significant change in methylation status
accompanies neoplasia, we aimed to establish whether methylation modulates the ability of mitoxantrone to form adducts with CpG sequences. The ultimate objective is to provide insight into the mechanism of adduct formation at methylated DNA sites in tumor cells
and to establish how the extent of methylation of DNA contributes to
the sensitivity of cells to mitoxantrone.
Materials--
Mitoxantrone was kindly provided by Lederle
Laboratories (Pearl River, NY). The methylases (HpaII,
MspI, and SssI) and T4 polynucleotide kinase were
obtained from New England Biolabs. NTPs, 3'-O-MeG, 3'-O-MeC,
[ DNA Isolation and Methylation--
The plasmid pCC1 (19) was
isolated using a Qiagen Plasmid Maxi Kit. For transcription
assays, the plasmid was restriction-digested with PvuII and
HindIII to isolate a 512-bp fragment (containing the
lac UV5 promoter), which was purified by electroelution. A portion of this DNA was reacted with HpaII methylase in the
presence of 80 µM S-adenosylmethionine at
37 °C for 1 h. This specifically methylated the CG cytosine
(5-C) of 5'-CCGG sequences. To specifically methylate the first
cytosine of the CCGG site, the 512-bp fragment was reacted in the same
way with MspI methylase. It should be noted that the use of
SssI methylase (which methylates all CG sites) resulted in
the total loss of initiation of transcription and hence could not be
used for the transcription assay.
For in vitro cross-linking assays, the pCC1 plasmid was
linearized by restriction digestion with SalI to yield a
3496-bp DNA fragment. The DNA was 3'-end-labeled as described
previously (6) and treated with SssI methylase and 80 µM S-adenosylmethionine at 37 °C for 1 h to specifically methylate the 5-C of cytosine at CG sites.
To confirm methylation status, DNA samples were restriction-digested
with HpaII, which recognizes the CCGG site in DNA. Upon methylation of either cytosine, this sequence is not cleaved, and hence
DNA remains uncut. In all experiments, methylation levels were >90%.
Transcription Assay--
The 512-bp DNA fragment was reacted
with mitoxantrone and formaldehyde prior to removal of unreacted
formaldehyde by ethanol precipitation. The transcription assay was then
performed as described previously (8, 20). The RNA transcripts were
resolved on a 12% denaturing acrylamide gel preheated to 50 °C, and
subjected to electrophoresis at 2000 V in TBE buffer.
Cross-linking Assay--
Renatured DNA (due to formation of
mitoxantrone-DNA adducts) was separated from unreacted, denatured DNA
as previously described (6), using a 0.8% agarose gel in TAE buffer
overnight at 40 V. The gel was vacuum-dried on a Bio-Rad model 583 gel
drier prior to exposure to a phosphor screen overnight and then
analyzed using a model 400B PhosphorImager and ImageQuant software
(Molecular Dynamics, CA).
Oligonucleotide Stabilization Studies--
Both unmethylated
20-mer (ATTTTAAAACGTTTTAAAAT) and cytosine-methylated 20-mer
(ATTTTAAAAC*GTTTTAAAAT; where an asterisk represents methylation) oligonucleotides were purified electrophoretically using a 19% denaturing acrylamide gel preheated to 50 °C for 2 h at 2100 V. The DNA was visualized by UV shadowing on a TLC plate and
retrieved from the acrylamide by incubation in water at 37 °C
overnight. Samples were subsequently concentrated using Centricon 3 columns.
DNA (100 pmol of oligonucleotide) was subsequently end-labeled using T4
polynucleotide kinase and [
For studies of the effect of cytosine methylation on stabilized
oligonucleotide duplex formation, 25 µM bp DNA
(with or without methylation) was incubated with 40 µM
mitoxantrone and 0-50 mM formaldehyde for 7 h at room
temperature. The samples were run at 4 °C on a 19% denaturing gel
(7 M urea) at 600 V overnight and then exposed to a
PhosphorImager screen for 2 h.
To examine the influence of cytosine methylation on the stability of
adducts, DNA (25 µM bp) was reacted with 50 or 30 mM formaldehyde (for unmethylated and methylated
oligonucleotides, respectively) and 40 µM mitoxantrone at
room temperature for 7 h. Samples were then purified on a gel
exclusion column and incubated at 37 °C for times up to 180 min
prior to electrophoresis overnight at 4 °C on a 19% denaturing
polyacrylamide gel. The DNA was visualized, and results were
quantitated using a model 400B PhosphorImager and ImageQuant software
(Molecular Dynamics, Sunnyvale, CA).
[14C]Mitoxantrone Experiments--
The linearized
PCRII-H1 plasmid was methylated using SssI (CpG) methylase
and 80 µM S-adenosylmethionine at 37 °C for
3 h. Both methylated and nonmethylated DNA (25 µM
bp) samples were treated with 20 µM
14C-labeled mitoxantrone and 3 mM formaldehyde
for times up to 180 min at 37 °C. Samples were extracted twice with
phenol and once with chloroform prior to ethanol precipitation and
resuspension in 50 µl of TE buffer. Scintillation fluid (1 ml) was
added to 50-µl samples, and 14C counts were determined
using a Wallac 1410 liquid scintillation counter.
Effect of CG Methylation on Transcriptional Blockage--
When
E. coli RNA polymerase encounters a mitoxantrone-DNA adduct,
elongation of the RNA chain is blocked, producing truncated transcripts
rather than the 379-base full-length transcript that would be produced
if no blocks were encountered. The dependence of this blockage on
formaldehyde concentration is illustrated in Fig.
1A. Blockages were dependent
on the presence of both formaldehyde and mitoxantrone (control lanes,
which lack either of these compounds, yield only full-length
transcripts). When DNA was methylated with HpaII methylase,
the CG cytosines of CCGG sequences were specifically methylated
(CC*GG), and these sites (indicated by the arrows in Fig.
1B) revealed a greater intensity of transcriptional
blockages compared with the corresponding unmethylated sites. When
methylated DNA was incubated with mitoxantrone alone, there were no
transcriptional blockages, indicating that formaldehyde is required for
adduct formation and also that methylation itself does not cause
stalling of RNA polymerase.
The extent of blockages at all methylated sites was quantitated as a
percentage of the total amount of transcripts in each lane
(Fig. 2). Fig. 2, A-C,
illustrates the increase of adduct formation when the cytosine residue
of CG sites was methylated. There is at least a 2-fold increase in
block intensity at methylated sites, indicating that methylation
enhances mitoxantrone-DNA adduct formation. Fig. 2, D-F,
shows controls that represent increasing block intensity with
formaldehyde concentrations at sites that have not been methylated.
These images show that there was no significant difference of adduct
formation at unmethylated sites on the two DNA templates, thus
confirming that the enhanced adduct levels at methylated CG sites is a
specific consequence of methylation of cytosine residues.
Effect of C*CGG Methylation on Adduct Formation--
Since it was
known that mitoxantrone was CG-specific and methylation of these sites
led to enhanced adduct formation, it was of interest to determine the
effect of methylation of adjacent cytosine residues. DNA was treated
with MspI methylase to specifically methylate the first
cytosine of the CCGG DNA sequence (denoted as C*CGG). The dependence of
formaldehyde on transcriptional blockage with unmethylated (Fig.
3A) and methylated DNA (Fig.
3B) was compared. All CCGG sites are indicated by
arrows, and in contrast to HpaII methylation,
there was no enhancement of block frequency at the methylated sites.
The extent of blockages at these sites and other non-CCGG sites (that
do not become methylated) was quantitated as a percentage of the total
amount of transcripts in each lane. Fig. 3C shows
a comparison of the block frequency at CCGG and C*CGG sites. There was
no significant difference between CG blocks at these methylated sites,
indicating that cytosine methylation at sites adjacent to CG sequences
does not enhance adduct formation. Fig. 3D is a control
illustrating the difference in block frequency at sites that are not
methylated. Again, there was no significant difference between adducts
formed, as expected at this nonmethylated site.
Stability of Adducts at Methylated Sites--
The pronounced
enhancement of adduct formation at DNA sequences treated with
HpaII methylase prompted an investigation of the stability
of these adducts. DNA was reacted with mitoxantrone and formaldehyde to
yield a high level of adducts at each CG site. Adduct stability was
assessed at 37 °C for elongation times up to 180 min for both
unmethylated and methylated DNA (Fig. 4,
A and B, respectively). First-order kinetic
analysis of the loss of blockages at individual sites revealed that
there was no significant difference between the loss of transcriptional
blockages at CG and C*G sequences. The half-lives for the loss of
adducts at a number of blockage sites are summarized in Table
I.
Although it was found that methylation using MspI methylase
did not enhance adduct formation, studies were undertaken to determine whether methylation of the first cytosine in the CCGG sequence altered
the stability of transcriptional blockages. The stability at these
sites was assessed as described above, and there was no significant
difference in stability between CCG and C*CG sites.
Effect of Methylation on Mitoxantrone Adduct Formation Using a
Cross-linking Assay--
When DNA is treated with mitoxantrone and
formaldehyde, it has been shown using in vitro cross-linking
assays that the resulting adducts stabilize DNA sufficiently to resist
strand separation. Cross-link formation was shown to be dependent on
formaldehyde concentration for both unmethylated DNA (Fig.
5A) and DNA that was
methylated at the C-5 cytosine of CG sequences using SssI methylase (Fig. 5B). Quantitation of renatured DNA (Fig.
5C) revealed a significant increase in adduct formation upon
methylation of CG sites, with at least a 3-fold increase in adduct
levels at concentrations below 2 mM formaldehyde.
Although there was no change in the stability of adducts detected as
transcriptional blockages, it was of interest to determine whether
methylation enhanced the stabilization of DNA with respect to strand
separation. Fig. 6, A and
B, reveals the loss of "virtual cross-links" over time
at 37 °C. These results were quantitated (Fig. 6C) and
reveal that, as with transcriptional block stability, there was a
slight, but not significant, difference in adduct stability following
cytosine methylation (20 and 27 min for unmethylated and methylated
DNA, respectively).
CpG Oligonucleotide Methylation Enhances Drug Binding--
To
determine the effect of methylation of the cytosine residue of a 20-mer
oligonucleotide, two identical oligonucleotides were utilized, one of
which contained the C-5 cytosine modification. The formation of
oligonucleotide-mitoxantrone adducts stabilizes the DNA duplex such
that it migrates essentially as the duplex form following denaturing
conditions. The formation of these duplexes was dependent on
formaldehyde (Fig. 7), and there was an
obvious increase in adduct formation when the 20-mer was methylated
(Fig. 7B) compared with the unmethylated control (Fig.
7A). The results were quantitated (Fig. 7C) and
reveal that there was a 3-fold increase in the number of stabilized
duplex oligonucleotides when the cytosine residue of CpG dinucleotides
was methylated.
Although methylation enhanced the formation of mitoxantrone-DNA
adducts, it was not expected to alter the stability of the adduct at
37 °C, since this was not observed by either transcription nor
in vitro cross-linking assays. Both unmethylated (Fig.
8B) and methylated (Fig.
8A) oligonucleotides were reacted with mitoxantrone and
formaldehyde, and the stability of the resulting drug-oligonucleotide adducts was assessed at 37 °C for up to 3 h. The loss of
adducts was described by a first-order exponential decay, and the
half-lives for both the unmethylated and methylated oligonucleotides
were similar (20 and 26 min, respectively).
Methylation Leads to Faster Reaction Rates--
Since it was found
that adduct formation was enhanced ~3-fold at methylated CG sites, it
was of interest to determine whether this was due to faster reaction
rates compared with nonmethylated DNA. Methylated and nonmethylated
plasmid DNA samples were treated with [14C]mitoxantrone
and formaldehyde at 37 °C for times up to 180 min. The
14C-drug-DNA adducts were quantitated (Fig.
9) and revealed a faster reaction rate,
leading to a large increase in adducts with methylated DNA. Regardless
of the methylation status, the maximum amount of DNA-drug adducts was
formed within 60 min and resulted in approximately twice as many
adducts with the methylated CpG dinucleotides.
Enhanced Adducts at Methylated CG Sites--
Our recent studies
demonstrated that mitoxantrone-DNA adducts blocked transcription at
specific sites in DNA (8). These sites included CpA and CpG sequences,
with the latter showing a slightly enhanced stability at 37 °C. The
specificity of binding to CpG sites prompted an investigation into the
effect of cytosine methylation on adduct formation at these sites. The
underrepresentation of this doublet in the genome, but known high
frequency of cytosine methylation in CpG sequences, suggested that
methylation of CpG may modulate drug-DNA adducts at these sites.
Upon methylation of the 512-bp DNA fragment using HpaII
methylase, three CCGG sites within the sequence were methylated at C5
of the internal cytosine residue. The transcriptional block frequency
at these sites was found to be significantly enhanced (~3-fold),
indicating an increase of adduct formation at these methylated sites.
This finding was potentially important, since there is a high frequency
of methylation at these sites in biological systems, and this is
associated with differential localized hypo- and hypermethylation in
cancer cell lines (12, 14, 17). Cross-linking assays also revealed that
methylation enhanced duplex stabilization due to adduct formation by at
least 3-fold at low formaldehyde concentrations and 2-fold at higher
concentrations. In order to further analyze adduct formation at a
single potential drug binding site and the effect of methylation at
this site, an oligonucleotide with a single CpG central site was
examined. The 3-fold increase in adduct formation accompanying
methylation of the 20-mer confirmed the 2-3-fold increase detected by
in vitro transcription and cross-linking assays.
[14C]Mitoxantrone experiments revealed faster reaction
rates, leading to a 2-fold increase in adduct formation. A 3-fold
increase was not expected, since CpA adducts are detected using this
technique and these adducts are not influenced by methylation.
Stabilization of Adducts at Methylated Cytosines--
The dramatic
increase in adduct formation at CC*GG sites (>200%) prompted studies
to determine whether these adducts were preferentially stabilized at
methylated sites, compared with nonmethylated sites. Although more
adducts were being formed at methylated sites, no significant
difference in adduct stability was detected (either at individual
transcription block sites or in the single adduct-oligonucleotide complexes); nor was there any detectable increase of half-life of the
"virtual cross-link."
The enhanced adduct formation but lack of increased stability raised
the question as to whether the methyl group on cytosine participates in
the chemical composition of the drug-DNA adduct or whether it serves to
increase the accessibility of mitoxantrone to DNA. Control studies
indicated that the methylated C5 of cytosine does not replace the
methylene group, which appears to derive from formaldehyde, and
is thought to be involved in the covalent linking of the amino group on
the side chain of mitoxantrone to the N2 of guanine (6), but other
structures cannot be ruled out until chemical analysis of the adduct is
possible (currently being investigated). Methylated DNA and
mitoxantrone alone did not block the progression of RNA polymerase
along the drug-treated DNA template, and this provides evidence that
mitoxantrone does not react with this methyl group to form an adduct.
The cytosine methylation therefore may facilitate a local structural
change to DNA that enhances adduct formation at these methylated sites. It has previously been documented that cytosine methylation alters the
local structure of duplex DNA, resulting in a conformational change (9,
21) leading to what has recently been termed E-DNA (22), and it
therefore appears that it is this structural change that may enhance
the accessibility of mitoxantrone to methylated CpG sites. The
structural change may serve to enhance the initial intercalation of
mitoxantrone into DNA, causing an increased likelihood of covalent reaction.
A previous study that compared sequence preference of the CG-specific
drug mitomycin C for DNA containing either 5-methylcytosine or
unmethylated cytosine in random sequence DNA oligomers found that
methylation enhanced cross-linking efficiency by up to 2-fold. This
difference was attributed to either a local charge effect, rendering
the N2 of the reactive guanine more nucleophilic, or to a local
conformational change rendering it more accessible (9). A later study
by Tomasz and co-workers (23) discovered that CpG methylation of the
plasmid pBR322 enhanced mitomycin C cross-linking by 3-fold at low
concentrations (5 µM), 2-fold at 10 µM, and
less thereafter. This increase was also attributed to a conformational
change to the DNA helix or an electronic effect that increases the
nucleophilicity of guanine-N2. The enhanced reactivity was also shown
to be associated with the CpG methylated cytosine, rather than the C5
methylation of cytosine residues flanking this dinucleotide, and these
effects are consistent with our observations of mitoxantrone adduct
formation at methylated sites. Additional reactivity at methylated CpG
sequences has also been detected with benzo[a]pyrene
derivatives (24). It would therefore be of interest to clarify if there
is a common reaction mechanism for the binding of these compounds
(mitoxantrone, mitomycin C, benzo[a]pyrene) to methylated
CpG sequences.
Biological/Medical Implications--
There is a considerable body
of evidence to show that tumor cells display hypomethylation over a
majority of the genome. In contrast, there is concurrent DNA
hypermethylation of multiple genes in particular neoplasms, including
acute myeloid leukemia (17), associated with a general deregulation of
the methylation status in CpG islands that are usually unmethylated
apart from the inactive X chromosome (13). The hypermethylation of
genes in leukemia has been shown to be cancer type-specific, with a wide number of other cancer types showing decreased methylation of
these same genes (13, 17, 18). The present results provide evidence
that CpG methylation may enhance the activity of mitoxantrone. This is
of significance, since tumor cells have aberrant CpG methylation patterns that are tumor type-specific. However, since tumor cells generally undergo a global decrease in genomic methylation, this may
decrease the cytotoxic effectiveness of mitoxantrone against some
tumors. It is important to establish the effect of mitoxantrone on
cells with differentially methylated genomic regions, since this
knowledge should lead to strategies to increase the effectiveness of
mitoxantrone. Alternatively, it is possible that the qualitative shift
of methylation toward specific CpG islands in certain tumor cells may
serve to enhance the activity of mitoxantrone. This would be possible
if there was an increase in local levels of mitoxantrone adducts due to
gene-specific hypermethylated regions leading to an increase in adduct
stability and/or a greater effect on adduct detection, which could lead
to apoptotic destruction of the cell. Given the importance of CpG
island methylation on gene transcription, it would be interesting to
establish the ultimate effect of adducts at these sites in terms of
altered gene expression. Studies are currently being undertaken to
determine if there is differential cell sensitivity to mitoxantrone
with varying methylation status. It is also of interest to analyze
adduct and methylation levels in specific genes to determine if there
is a correlation between methylation and drug activity in
vivo. A positive correlation between cytotoxicity and methylation
patterns could lead to the development of biological markers for
potential sensitivity of individual patients to mitoxantrone treatment.
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Published, JBC Papers in Press, February 13, 2001, DOI 10.1074/jbc.M009216200
The abbreviations used are:
TEMED, N,N,N',N'-tetramethylethylenediamine;
bp, base pair(s).
Cytosine Methylation Enhances Mitoxantrone-DNA Adduct
Formation at CpG Dinucleotides*
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-32P]ATP, [
-32P]dCTP,
[
-32P]UTP (3000 Ci/mmol), ribonuclease inhibitor (RNA
guard, human placenta), Escherichia coli RNA polymerase, and
ProbeQuant G-50 microcolumns were purchased from Amersham Pharmacia
Biotech. The nonmethylated and methylated 20-mer oligonucleotides were
obtained from GeneWorks and Sigma Genosys, respectively.
Acrylamide and molecular biology grade urea were obtained from ICN
Biomedicals Inc. Bisacrylamide, ammonium persulfate, and micro Bio-spin
6 chromatography columns were purchased from Bio-Rad, and
TEMED1 and nuclease-free
bovine serum albumin were purchased from Promega. Tris-saturated phenol
was from Life Technologies, Inc., and formaldehyde was purchased from
BDH. DNA polymerase I (Klenow fragment) and all restriction enzymes
were obtained from New England Biolabs. Glycogen was from Roche
Molecular Biochemicals, and Centricon TM-3 columns were from Millipore
Corp. (Amicon Bioseparations). Plasmid purification kits were purchased
from Qiagen, and formamide was from Sigma. Calf thymus DNA was from
Worthington, and Ready Safe scintillation mixture was purchased from
Beckman. All other chemicals and reagents were of analytical grade, and
all solutions were prepared using water from a Milli-Q (Millipore
Corp.) four-stage purification system.
-32P]ATP. Unincorporated
label was removed by passing the sample through a micro Bio-spin 6 chromatography column. The self-complementary oligonucleotides were
reannealed by heating at 70 °C for 5 min followed by gradual cooling
to room temperature and then stored at
20 °C.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (103K):
[in a new window]
Fig. 1.
Effect of HpaII cytosine
methylation on mitoxantrone-formaldehyde-induced transcriptional
blockages. A, DNA (90 µM bp) was
incubated with 20 µM mitoxantrone and formaldehyde (0-20
mM as indicated) in transcription buffer for 2 h at
37 °C. The samples were ethanol-precipitated and resuspended in
transcription reaction mix. Transcription was initiated at the
lac UV5 promoter of the 512-bp fragment prior to
transcription elongation for 5 min and denaturation in transcription
termination buffer at 90 °C for 5 min. The samples were then
subjected to electrophoresis at 2000 V for 1.5 h on a 12%
acrylamide gel. Lane I, an initiation control
that has not been elongated; lane F, an elongated
control (full-length transcript) lacking mitoxantrone; lane
E, an elongated control representing undamaged DNA lacking
both mitoxantrone and formaldehyde. Lanes C and
G, sequencing lanes that were obtained using methylated
nucleotides (MeC and MeG, respectively) during elongation.
B, DNA (~200 ng/µl) was reacted with HpaII
methylase in the presence of 80 µM
S-adenosylmethionine at 37 °C for 1 h. This
specifically methylated the CG cytosine of 5'-CCGG sequences that are
indicated by arrows at blockage sites 12, 16, and 19. The
DNA was then reacted with mitoxantrone and formaldehyde and subjected
to transcriptional analysis as for A. Blockage site 10 is
representative of a nonmethylated site.

View larger version (25K):
[in a new window]
Fig. 2.
Differential adduct formation at methylated
CCGG sites in DNA. A-C, comparison of block frequency
at CCGG sites from Fig. 1, A and B. The
mole fraction of methylated (
) and nonmethylated (
) block
sites 12, 16, and 19 were calculated and plotted (expressed as a
percentage) at each formaldehyde concentration. D-F,
comparison of block frequency at block sites 5, 10, and 11. These are
not CCGG sites and were therefore not methylated.

View larger version (81K):
[in a new window]
Fig. 3.
Effect of MspI methylation
on mitoxantrone-DNA adduct formation. A, DNA was
incubated with 20 µM mitoxantrone and 0-15
mM formaldehyde and treated as described previously in Fig.
1A. B, DNA (~200 ng/µl) was reacted with
MspI methylase in the presence of 80 µM
S-adenosylmethionine at 37 °C for 1 h. This
specifically methylated the first cytosine on 5'-CCGG sequence, and
these sites are indicated by an arrow. The DNA was then
treated as outlined in the legend to Fig. 1A. C,
comparison of block frequency at methylated (
) and unmethylated
(
) CCGG sites. The mole fraction of block 16 was calculated
and plotted as a percentage of transcripts in the entire lane at the
varying formaldehyde concentrations. D, comparison of block
frequency at a non-CCGG site (block 7) that has not been
methylated.

View larger version (70K):
[in a new window]
Fig. 4.
Stability of adducts at methylated
sites. A, the 512-bp fragment was reacted with 20 µM mitoxantrone and 10 mM formaldehyde for
2 h at 37 °C. Following ethanol precipitation, transcription
was initiated and elongation was allowed for 5-180 min at 37 °C.
B, the 512-bp fragment, which was methylated using
HpaII methylase, was treated as outlined in A.
The arrows indicate methylated sites.
Stability of adducts at methylated and nonmethylated block sites

View larger version (37K):
[in a new window]
Fig. 5.
Dependence of cross-link formation on
methylation of CpG sites. A, end-labeled DNA (25 µM bp) was incubated with 20 µM
mitoxantrone and 0-3 mM formaldehyde (as shown) in PBS at
37 °C for 2 h. The samples were extracted once with phenol and
chloroform and then ethanol-precipitated. The DNA was resuspended in TE
buffer and denatured at 60 °C for 5 min in 45% formamide loading
buffer. The samples were then subjected to electrophoresis on a 0.8%
agarose gel at 45 V overnight. Lane C, a control
lacking mitoxantrone but containing 3 mM formaldehyde.
B, end-labeled DNA was treated with SssI
methylase to specifically methylate CG sites in DNA. The DNA was
extracted once with phenol and chloroform and precipitated with ethanol
prior to reaction as in A. C, quantitation of the
gels shown in A and B. The percentage of total
DNA containing interstrand cross-links was calculated and expressed as
a function of formaldehyde concentration for methylated (
) and
unmethylated (
) DNA.

View larger version (41K):
[in a new window]
Fig. 6.
Effect of methylation on cross-link
stability. A, end-labeled DNA was incubated with 20 µM mitoxantrone and 3 mM formaldehyde for
2 h at 37 °C. The reaction was terminated by phenol and
chloroform extraction followed by ethanol precipitation. Samples were
then incubated for times up to 160 min at 37 °C and denatured in
45% formamide loading buffer at 60 °C for 5 min prior to
electrophoresis on a 0.8% agarose gel. B, end-labeled DNA
was methylated at CpG sites using SssI methylase. Samples
were then reacted as in A. C, quantitation of
gels shown in A and B. The percentage of
cross-links for both methylated (
) and unmethylated (
) DNA
samples was quantitated and expressed as a function of time.

View larger version (30K):
[in a new window]
Fig. 7.
Reaction of mitoxantrone with methylated
oligonucleotides. A, the unmethylated 20-mer
oligonucleotide (25 µM bp) was incubated for 7 h
with 40 µM mitoxantrone and 0-50 mM
formaldehyde at room temperature. The samples were loaded onto a 19%
denaturing acrylamide gel with 45% formamide loading dye and run
overnight at 4 °C and 600 V prior to exposure to a phosphor screen
for PhosphorImager analysis. C1 and C2, control
reactions containing the oligonucleotide and only mitoxantrone or
formaldehyde, respectively. B, the methylated 20-mer
oligonucleotide was treated as outlined for A. C,
quantitation of gels in A and B. The percentage
of duplex DNA was quantitated and expressed as a function of
formaldehyde concentration for both methylated (
) and unmethylated
(
) oligonucleotides.

View larger version (38K):
[in a new window]
Fig. 8.
Effect of methylation on
oligonucleotide adduct stability. A, unmethylated DNA
(25 µM bp) was reacted with 40 µM
mitoxantrone and 50 mM formaldehyde for 7 h at room
temperature. Samples were subjected to gel exclusion (micro Bio-spin
P6) and incubated at 37 °C for times up to 3 h and then run at
4 °C overnight on a 19% acrylamide gel at 600 V. B,
methylated DNA was reacted with 40 µM mitoxantrone and 30 mM formaldehyde at room temperature for 7 h. Samples
were then treated as outlined for A. C,
quantitation of the time-dependent loss of cross-links with
unmodified oligonucleotides at 37 °C. D, quantitation of
percentage cross-links for cytosine-methylated oligonucleotides as a
function of time at 37 °C.

View larger version (12K):
[in a new window]
Fig. 9.
Time dependence of adduct
formation. Both methylated and unmethylated plasmid DNA were
reacted with 20 µM mitoxantrone and 3 mM
formaldehyde at 37 °C for up to 180 min. The reaction was terminated
by two phenol extractions and one chloroform extraction prior to
ethanol precipitation and resuspension in TE buffer.
14C-drug-DNA adducts were quantitated by scintillation
analysis. The formation of [14C]mitoxantrone-DNA adducts
is shown as a function of reaction time at 37 °C.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
FOOTNOTES
To whom all correspondence should be addressed. Tel.: 61 3 94792182; Fax: 61 3 94792467; E-mail: d.phillips@latrobe.edu.au.
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
De Vita, V. T.,
Hellman, S.,
and Rosenberg, S. A.
(1993)
in
Cancer: Principles and Practice of Oncology
(De Vita, V. T., ed)
, J. B. Lippincott Co., Philadelphia
2.
Feofanov, A.,
Sharonov, S.,
Fleury, F.,
Kudelina, I.,
and Nabiev, I.
(1997)
Biophys. J.
73,
3328-3336
3.
Myers, C. E.,
Mimnaugh, E. G.,
Yeh, G. C.,
and Sinha, B. K.
(1988)
in
Anthracycline and Anthracenedione-based Anti-cancer Agents
(Lown, J. W., ed)
, pp. 527-569, Elsevier, Amsterdam
4.
Pratt, W. B.,
Ruddon, R. W.,
Ensminger, W. D.,
and Maybaum, S.
(1994)
The Anticancer Drugs
, 2nd Ed.
, Oxford University Press, New York
5.
Cornbleet, M. A.,
Stuart-Harris, R. C.,
Smith, I. E.,
Coleman, R. E.,
Rubens, R. D.,
McDonald, M.,
Mouridsen, H. T.,
Rainer, H.,
Van Oosterom, A. T.,
and Smyth, J. F.
(1984)
Eur. J. Cancer Oncol.
20,
1141-1146
6.
Parker, B. S.,
Cullinane, C.,
and Phillips, D. R.
(1999)
Nucleic Acids Res.
27,
2918-2923
7.
Thorndike, J.,
and Beck, W. S.
(1977)
Cancer Res.
37,
1125-1132
8.
Parker, B. S.,
Cutts, S. M.,
Cullinane, C.,
and Phillips, D. R.
(2000)
Nucleic Acids Res.
28,
982-990
9.
Millard, J. T.,
and Beachy, T. M.
(1993)
Biochemistry
32,
12850-12856
10.
Holliday, R.,
and Grigg, G. W.
(1993)
Mutat. Res.
285,
61-67
11.
Clark, S.
(1999)
Proc. Aust. Soc. Biochem. Mol. Biol.
30,
9-11
12.
Baylin, S. B.,
Hoppener, J. W. M.,
Bustros, A. D.,
Steenbergh, P. H.,
Lips, C. J. M.,
and Nelkin, B. D.
(1986)
Cancer Res.
46,
2917-2922
13.
Jones, P. A.,
and Buckley, J. D.
(1990)
Adv. Cancer Res.
54,
1-23
14.
Villain, A.,
Vogt, N.,
Dutrillaux, B.,
and Malfoy, B.
(1999)
FEBS Lett.
460,
231-234
15.
El-Deiry, W. S.,
Nelkin, B. D.,
Celano, P.,
Yen, R.-W. C.,
Falco, J. P.,
Hamilton, S. R.,
and Baylin, S. B.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
3470-3474
16.
Szyf, M.,
Knox, D. J.,
Milutinovic, S.,
Slack, A. D.,
and Araujo, F. D.
(2000)
Ann. N. Y. Acad. Sci.
910,
156-174
17.
Melki, J. R.,
Vincent, P. C.,
and Clark, S. J.
(1999)
Cancer Res.
59,
3730-3740
18.
Costello, J. F.,
Fruhwald, M. C.,
Smiraglia, D. J.,
Rush, L. J.,
Robertson, G. P.,
Gao, X.,
Wright, F. A.,
Feramisco, J. D.,
Peltomaki, P.,
Lang, J. C.,
Schuller, D. E., Yu, L.,
Bloomfield, C. D.,
Caligiuri, M. A.,
Yates, A.,
Nishikawa, R.,
Huang, H.-J. S.,
Petrelli, N. J.,
Zhang, X.,
O'Dorisio, M. S.,
Held, W. A.,
Cavenee, W. K.,
and Plass, C.
(2000)
Nat. Genet.
25,
132-138
19.
Cullinane, C.,
and Phillips, D. R.
(1993)
Nucleic Acids Res.
21,
1857-1862
20.
Phillips, D. R.,
and Cullinane, C.
(1997)
in
Drug-DNA Interaction Protocols
(Fox, K., ed)
, pp. 127-146, Humana Press, Totowa, NJ
21.
Hodges-Garcia, Y.,
and Hagerman, P. J.
(1992)
Biochemistry
31,
7595-7599
22.
Vargason, J. M.,
Eichman, B. F.,
and Ho, P. S.
(2000)
Nat. Struct. Biol.
7,
758-761
23.
Johnson, W. S.,
He, Q-Y.,
and Tomasz, M.
(1995)
Bioorg. Med. Chem.
3,
851-860
24.
Denissenko, M. F.,
Chen, J. X.,
Tang, M. S.,
and Pfeifer, G. P.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
3893-3898
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
B. J. Evison, F. Chiu, G. Pezzoni, D. R. Phillips, and S. M. Cutts Formaldehyde-Activated Pixantrone Is a Monofunctional DNA Alkylator That Binds Selectively to CpG and CpA Doublets Mol. Pharmacol., July 1, 2008; 74(1): 184 - 194. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Evison, O. C. Mansour, E. Menta, D. R. Phillips, and S. M. Cutts Pixantrone can be activated by formaldehyde to generate a potent DNA adduct forming agent Nucleic Acids Res., June 28, 2007; 35(11): 3581 - 3589. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. S. Parker, T. Buley, B. J. Evison, S. M. Cutts, G. M. Neumann, M. N. Iskander, and D. R. Phillips A Molecular Understanding of Mitoxantrone-DNA Adduct Formation: EFFECT OF CYTOSINE METHYLATION AND FLANKING SEQUENCES J. Biol. Chem., April 30, 2004; 279(18): 18814 - 18823. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Malins, K. M. Anderson, N. L. Polissar, G. K. Ostrander, E. T. Knobbe, V. M. Green, N. K. Gilman, and J. L. Spivak Models of granulocyte DNA structure are highly predictive of myelodysplastic syndrome PNAS, April 6, 2004; 101(14): 5008 - 5011. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Cutts, L. P. Swift, A. Rephaeli, A. Nudelman, and D. R. Phillips Sequence Specificity of Adriamycin-DNA Adducts in Human Tumor Cells Mol. Cancer Ther., July 1, 2003; 2(7): 661 - 670. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |