![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 19, 16348-16355, May 11, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Physiology, University of Michigan Medical
School, Ann Arbor, Michigan 48109-0622
Received for publication, January 6, 2001, and in revised form, January 31, 2001
Despite the knowledge that
CCAAT/enhancer-binding protein Adipose tissue plays multiple roles in the mechanisms controlling
homeostasis. Adipocytes serve not only as an energy reservoir by
storing excess calories as triacylglycerol, but they also have endocrine and immune functions (1-4). The importance of understanding adipocyte biology is emphasized further by the complications that arise
from either too much or too little adipose tissue. Obesity and its
associated disorders, such as type 2 diabetes and cardiovascular disease, are an epidemic in the developed world today (5). Conversely,
lipoatrophy, the lack of adipose tissue, is also associated with
diabetes and a number of other metabolic abnormalities (6). Understanding the factors that govern the transcriptional control of
adipogenesis will aid in our understanding of how these disorders arise.
A number of the key factors controlling the adipocyte differentiation
cascade have been identified (for review, see Refs. 3 and 7-9),
including the transcription factors CCAAT/enhancer binding protein Consistent with C/EBP Cell Culture
Human embryonic kidney 293T cells were cultured in high glucose
Dulbecco's modified Eagle's medium (Life Technologies, Inc.) containing 10% calf serum (Life Technologies, Inc.), 1 mM
sodium pyruvate (Life Technologies, Inc.), 105 µg/ml penicillin G
(Sigma PEN-K), 65 µg/ml streptomycin sulfate (Sigma), and 8.4 µg/ml
biotin (Sigma). Cells were incubated in a 10% CO2
water-jacketed incubator. 3T3-L1 fibroblasts were cultured as described
(26).
Cloning of C/EBP To facilitate cloning of C/EBP Cloning of CR2/3/4 Vector--
pSER13 was digested with
BamHI and AatII (+307 nucleotides), and a
BamHI-AatII oligonucleotide (Table
I) was inserted (pSER13 Cloning of CR1/3/4 Vector--
pSER13 was digested with
AatII and KpnI and religated with an
AatII-KpnI oligonucleotide (Table I). The
resulting vector (pSER13 Cloning of CR1/2 Vector--
C/EBP Cloning of CR1 and CR2 Vectors--
To create expression vectors
containing CR1 or CR2 alone fused to the bZIP, the
BamHI-KpnI fragment from pSER13 Cloning of CR2/4 and CR1/4 Vectors--
A C/EBP Cloning of CR4 Vector--
The MluI-EcoRV
fragment (+698 to +2,111 nucleotides) from the C/EBP
To create retroviral expression vectors, pLXSN (34) was linearized with
HindIII, blunt ends were created using DNA polymerase I,
large (Klenow) fragment (New England Biolabs) and ligated with T4 DNA
ligase (New England Biolabs). The resulting plasmid was digested with
HpaI, and a HindIII linker (d(pCAAGCTTG), New
England Biolabs) was ligated in to form pNH2. The full-length, p30,
CR1, and CR1/3/4 isoforms of C/EBP
An expression vector encoding a chimeric protein consisting of the Gal4
DNA binding domain and the C/EBP Luciferase Reporter Gene Assays
Reporter gene assays were performed using leptin
promoter-luciferase reporter genes, pObLuc-760 and pObLuc-m760 (from
Dr. M. Daniel Lane, Johns Hopkins University (36)), a murine
PPAR Human embryonic kidney 293T cells (100-mm plates) were transiently
transfected with 20 µg of total DNA by calcium phosphate coprecipitation, including 1 µg of luciferase reporter gene, 500 ng
of CMV- Retroviral Infection and Oil Red-O Staining of 3T3-L1
Preadipocytes
293T cells were transfected as described above with the
retroviral C/EBP Immunoblot Analysis
Protein expression levels in samples used for reporter gene
assays were determined by immunoblot analysis. For detection of p300,
supernatant from cells lysed in 1 × reporter lysis buffer was
combined with 4 × SDS loading buffer (4% (v/v) SDS, 350 mM Multiple Conserved Regions Contribute to the Adipogenic Action of
C/EBP
To determine the region within the C/EBP p300 Coactivates C/EBP Functional Interaction between C/EBP Multiple Regions of the C/EBP
To determine which conserved regions of the C/EBP In this study we find that multiple conserved regions of the
C/EBP The ability of CR2 to act as a strong activation domain and induce
differentiation independent of the other conserved regions may be the
result of its ability to interact with multiple coactivators and
components of the basal transcription apparatus. The retinoblastoma protein (pRb) has been shown to coactivate C/EBP We show that p300, in addition to interacting functionally with CR2, is
able to interact with CR3 (p30). This interaction of p300 with multiple
regions has been shown for a number of transcription (53, 54). Attempts
to identify regions of physical interaction between C/EBP We thank Drs. G. Hammer and J. Schwartz for a
critical review of this manuscript and members of the MacDougald
laboratory for comments. We also acknowledge Drs. F. Schaufele and M. Lazar for advice on protein-protein interaction studies.
*
This work was supported by Natural Sciences and Engineering
Research Council of Canada predoctoral fellowships (to R. L. E. and
S. E. R.) and by a grant from the American Diabetes Association and
National Institutes of Health Grant DK51563 (to O. A. M.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Published, JBC Papers in Press, February 8, 2001, DOI 10.1074/jbc.M1001282200
2
F. Schaufele, personal communication.
3
F. Schaufele, J. F. Enwright III, X. Wang,
C. Teoh, R. L. Erickson, O. A. MacDougald, and R.N. Day,
manuscript in preparation.
The abbreviations used are:
C/EBP, CCAAT/enhancer binding protein;
PPAR, peroxisome proliferator-activated
receptor;
bZIP, basis region/leucine zipper;
CR, conserved region(s);
CMV, cytomegalovirus;
p300 Coactivates the Adipogenic Transcription Factor
CCAAT/Enhancer-binding Protein
*
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
(C/EBP
) plays an important role
in preadipocyte differentiation, our understanding of how C/EBP
interacts with nuclear proteins to regulate transcription is limited.
Based on the hypothesis that evolutionarily conserved regions are
functionally important and likely to interact with coactivators, we
compared the amino acid sequence of C/EBP
from different species
(frog to human) and identified four highly conserved regions (CR1-CR4)
within the transactivation domain. A series of amino-terminal
truncations and internal deletion constructs were made creating forms
of C/EBP
which lack single or multiple conserved regions. To
determine which regions of the C/EBP
transactivation domain are
important in its ability to induce spontaneous differentiation of
3T3-L1 preadipocytes, we infected preadipocytes with expression vectors encoding the C/EBP
conserved region mutants and observed their ability to induce differentiation. We found that CR2 fused to the DNA
binding domain is able to induce spontaneous differentiation independent of the other conserved regions. However, CR2 was not necessary for the adipogenic action of C/EBP
because a combination of CR1 and CR3 can also induce adipogenesis. Because the
transcriptional coactivator p300 participates in the signaling of many
transcription factors to the basal transcriptional apparatus, we
examined whether functional interaction exists between C/EBP
and
p300. Cotransfection of p300 with p42C/EBP
results in a synergistic
increase in leptin promoter activity, indicating that p300 acts as a
transcriptional coactivator of C/EBP
. Analyses using C/EBP
conserved region mutants suggest that multiple regions (CR2 and CR3) of
the C/EBP
transactivation domain functionally interact with p300.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
(C/EBP
)1 and peroxisome
proliferator-activated receptor
(PPAR
). Although the structure,
function, and regulation of PPAR
have been studied extensively
(10-13), similar analyses have yet to be performed upon C/EBP
.
being a key component in the adipogenic
cascade, mice with the c/ebp
gene deleted have
a deficiency in lipid accumulation in both white and brown adipose
tissue (14). Likewise, 3T3-L1 preadipocytes (15-17) are unable to
differentiate after hormonal induction if C/EBP
antisense RNA is
expressed in the cells (18). Moreover, the enforced expression of
C/EBP
in 3T3-L1 fibroblasts is sufficient to induce spontaneous
adipogenesis (19, 20) and overcome the effects of repressors of
adipogenesis such as Wnt-1 (21). C/EBP
is a prototypical basic
region/leucine zipper (bZIP) transcription factor consisting of a well
characterized carboxyl-terminal leucine zipper that confers
dimerization ability and a neighboring DNA binding domain and nuclear
localization signal, which are rich in basic residues (22-24). The
remaining amino-terminal 273 amino acids, termed the transactivation
domain, contains insulin-responsive sites of phosphorylation (25-27)
and regions that affect the transcriptional activity of C/EBP
(28-30). Previous studies have arbitrarily divided the transactivation domain and identified regulatory regions within it by examining the
ability of these C/EBP
constructs to transactivate reporter genes
under the control of the liver serum albumin promoter (29, 30) or an
artificial Gal4-responsive promoter (28). In contrast, the current
study approaches the functional analyses of the C/EBP
transactivation domain by targeting regions of C/EBP
which are highly conserved across several species (31). We examined the role of
these conserved regions (CR) in the ability of C/EBP
to activate the
genes necessary to induce spontaneous preadipocyte differentiation.
Furthermore, we demonstrate that the nuclear coactivator p300 is able
to potentiate C/EBP
-mediated transcription of the leptin
(ob) promoter through multiple conserved regions within the
C/EBP
transactivation domain.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
Constructs
deletion mutants, a
+5-nucleotide to +2,111-nucleotide clone of mouse C/EBP
in
pBluescript KS+ (Stratagene) containing an ideal Kozak translational
start site (32) and silent mutations was used. These silent mutations, as described previously (27), introduce unique KpnI (+534
nucleotides), SphI (+823 nucleotides), and XhoI
(+1,072 nucleotides) restriction sites. BamHI to
KpnI (pSER13) and KpnI to XhoI
(pSER23) fragments of C/EBP
were each subcloned into pBluescript
KS+.
CR1). The
BamHI-KpnI fragment of pSER13
CR1 was excised
and subcloned into pcDNA3.1(
) (Invitrogen) containing full-length
p42C/EBP
(pSER28) and resulted in a C/EBP
clone lacking CR1
(pSER28
CR1).
Synthetic oligonucleotides and PCR primers used to create C/EBP
transactivation domain mutants
CR2) was then digested with BamHI
plus KpnI, and the excised fragment was subcloned into
pSER28. The resulting clone lacks CR2 (pSER28
CR2).
containing CR1 and CR2 was
created by digesting pSER23 with KpnI and SphI
and ligating in a KpnI-SphI oligonucleotide (Table I; pSER23
CR3/4). The KpnI-XhoI fragment
of pSER23
CR3/4 was then excised and inserted into the
KpnI-XhoI site of pSER28, generating CR1/2
(SER28
CR3/4).
CR2 or
pSER13
CR1, respectively, was subcloned into the
BamHI-KpnI site of pSER28
CR3/4.
fragment
lacking CR3 was synthesized by polymerase chain reaction using
CR3
primers (Table I) with pSER28 as a template. TOPO TA cloning
(Invitrogen) was used to subclone the product into pCR2.1-TOPO
(Invitrogen). A KpnI-XhoI fragment was then
excised and subcloned into pSER28
CR1 or pSER28
CR2, yielding CR2/4
or CR1/4, respectively.
gene (33) was
cloned into pEBVHis A (Invitrogen), as described previously
(His-p18C/EBP
(27)). To create a non-His-tagged form of CR4,
His-p18C/EBP
was linearized with HindIII, and a fill-in
reaction was performed to blunt end the vector. The linearized vector
was then digested with BglII, and the resulting fragment was
subcloned into the BamHI-EcoRV site of
pcDNA3.1(+) (Invitrogen) containing an ideal Kozak consensus
sequence oligonucleotide (AGCTTGCGGCCGCCACCATGGG) 5' to the
BamHI site. The expression vectors encoding p30C/EBP
(CR3/4) and p12C/EBP
(bZIP) were described previously (27).
were each excised from
pcDNA3.1(
) with EcoRI and HindIII and
subcloned into the EcoRI-HindIII sites of pNH2.
CR2/3/4 and CR2 in pcDNA3.1(+) were first digested with BamHI. The resulting fragment was filled in with DNA
polymerase I, large (Klenow) fragment and ligated with an
EcoRI linker (d(pCGGAATTCCG), New England Biolabs). This
vector was subsequently digested with EcoRI plus
HindIII, and the resulting insert was subcloned into pNH2.
transactivation domain was
constructed by subcloning a KpnI-SacI fragment of
pSER23 into pSG424 (35). This construct was subsequently digested with BamHI and KpnI, and the
BamHI-KpnI fragment from pSER28 was inserted.
2 promoter-luciferase reporter gene (from Dr.
Jeffrey Gimble, Artecel Sciences, Inc. (37)), and a
(Gal4)5-SV40-luciferase reporter gene (from Dr. Mitchell A. Lazar, University of Pennsylvania). The human p300 expression vector,
pVR1012-p300, was donated by Dr. Gary Nabel (National Institutes of
Health). pCMV-12S E1A-WT and pCMV-12S E1A-RG2 were created by
subcloning the HindIII-NotI fragment of
pRc/RSV-12S E1A and pRc/RSV-12S E1A RG2 (from Dr. Roland Kwok,
University of Michigan, 38) into the HindIII-NotI site of pcDNA3.1(+).
-galactosidase (
Gal), and 10 µg of sheared herring sperm
DNA. Additional plasmid DNA amounts varied based upon experimental conditions and are documented in the figure legends. A constant amount
of CMV promoter was maintained in all conditions to control for the
potential squelching of the transcriptional machinery. After
precipitation for 4-5 h, cells were shocked with 12.5% glycerol in
phosphate-buffered saline (157 mM NaCl, 2.7 mM
KCl, 1.5 mM KH2PO4, 5.5 mM Na2HPO4-H2O, pH 7.3)
for 3 min. Cells were incubated for 24-48 h in 10% calf serum and
Dulbecco's modified Eagle's medium before they were lysed in 1 × reporter lysis buffer (100 mM
KH2PO4, 0.2% (v/v) Triton X-100, 1 mM dithiothreitol). Samples were vortexed and subsequently
centrifuged in a microcentrifuge for 30 s at 16,000 × g. To assay the samples for luciferase activity, 100 µl of
the supernatant was mixed with 360 µl of luciferase buffer 2 (25 mM glycylglycine (Fisher Biotech), pH 7.8, 30 mM MgSO4, 4 mM EGTA, pH 8.0, 0.0027% (v/v) Triton X-100, 15 mM KH2 PO4, 2 mM ATP, 1 mM dithiothreitol)
in glass test tubes. The tubes were then placed in an Optocomp II
luminometer (MGM Instruments, Hamden, CT) and injected with 100 µl of
luciferase buffer 3 (25 mM glycylglycine, 30 mM
MgSO4, 4 mM EGTA, pH 8.0, 200 nM
luciferin (Promega), 2 mM dithiothreitol), and the relative
light units emitted were measured and normalized against the relative
light units obtained from a chemiluminescent
-galactosidase assay.
-galactosidase activity was measured by taking 10 µl of cell lysate and inoculating 100 µl of
-galactosidase reaction buffer (100 mM KH2PO4, 1 mM
MgCl2, 1% (v/v) Galacton (Tropix)) and incubating for 45 min to 1 h at room temperature. Chemiluminescence was measured after the injection of 100 µl of light emission accelerator (10% (v/v) Emerald enhancer (Tropix) in 0.2 N NaOH (39)).
expression vectors and the viral packaging vectors SV-E-MLV-env and SV
-E-MLV (7.5 µg of each) (21, 34).
Virus-containing medium was collected at three 12-h intervals
post-transfection and at each interval passed through a 0.45-µm
syringe filter. 8 µg/ml filter-sterilized polybrene (hexadimethrine
bromide; Sigma) was added to the virus-loaded medium. This medium was
then applied to preconfluent (~40%) 3T3-L1 preadipocytes. The
infection protocol was repeated two additional times. After the third
round of infection, 3T3-L1 preadipocytes were trypsin treated and
replated, on multiple plates, in Dulbecco's modified Eagle's medium
supplemented with 10% calf serum and 400 µg/ml Geneticin (Life
Technologies, Inc.). Cells were then allowed to proliferate to
confluence, at which point the cells were fed with Dulbecco's modified
Eagle's medium containing only 10% calf serum. For 14 days
postconfluence the cells were observed for evidence of spontaneous
differentiation. To detect cytoplasmic lipid accumulation,
retrovirus-infected 3T3-L1 cells were stained by Oil Red-O, essentially
as outlined previously (40).
-mercaptoethanol, 240 mM Tris, pH 6.8, 40% (v/v) glycerol, 0.01% (w/v) bromphenol blue) and electrophoresed
on an SDS-polyacrylamide gel (5%). Proteins were transferred to a
polyvinylidene difluoride (Osmonics) membrane, and immunoblotting was
performed with mouse monoclonal p300 antibody (BD PharMingen). To
determine the expression of C/EBP
, pellets from reporter gene
samples were transferred to new tubes, resuspended in Western lysis
buffer (1% SDS, 60 mM Tris, pH 6.8), and sonicated. Lysate
was mixed with 4 × SDS loading buffer and separated on an
SDS-polyacrylamide gel (11.5%), transferred to polyvinylidene
difluoride, and immunoblotted with an affinity-purified polyclonal
C/EBP
antibody generated against a synthetic polypeptide
corresponding to amino acids 253-265 (32). Immunoblot analyses of
proteins from infected 3T3-L1 preadipocytes and adipocytes were
performed as described previously (18, 26). The adipocyte marker
422/aP2 was detected using a polyclonal antibody received from Dr.
David Bernlohr (University of Minnesota).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
--
Conserved regions of the C/EBP
transactivation domain
were identified by aligning the primary amino acid sequences of human, bovine, mouse, chicken, and frog C/EBP
(31). Analysis of the alignment revealed four regions within the transactivation domain with
a high degree of sequence homology (Fig.
1A). Homology among CR1, 2, 3, and 4 from the mouse and chicken isoforms of C/EBP
is 66, 87, 87, and 94%, respectively.

View larger version (31K):
[in a new window]
Fig. 1.
Adipogenic potential of
C/EBP
transactivation domain mutants.
A, schematic representation of various C/EBP
isoforms and
their ability to induce spontaneous differentiation of 3T3-L1
fibroblasts relative to full-length C/EBP
(p42; ++). B,
3T3-L1 fibroblasts infected with retroviral expression vectors encoding
vector alone, p42, CR2/3/4, p30 (CR3/4), CR1/3/4, CR1, or CR2, lysed 15 days postconfluence as described under "Experimental Procedures."
Whole cell lysates were separated by SDS-polyacrylamide gel
electrophoresis (15% polyacrylamide gel) and immunoblotted for the
adipocyte fatty acid-binding protein 422/aP2. C,
phase-contrast micrograph of Oil Red-O-stained 3T3-L1 fibroblasts
infected with retroviral vectors encoding the indicated C/EBP
isoform. Micrographs were taken 15 days postconfluence. Bar,
20 µm.
transactivation domain
capable of inducing differentiation, retroviral expression vectors
encoding the C/EBP
isoforms depicted in Fig. 1A were infected into 3T3-L1 preadipocytes. The adipogenic activity of the
various isoforms was measured by the expression of the adipocyte marker
422/aP2 (Fig. 1B) and Oil Red-O staining of cytoplasmic lipid accumulation (Fig. 1C). Consistent with the findings
of other investigators (19, 20), p42C/EBP
induces spontaneous differentiation, but the p30C/EBP
isoform that contains only CR3 and
CR4 does not (Fig. 1). Based upon these results and our previous
results that a C/EBP
deletion mutant containing only CR1 and CR2 is
able to induce differentiation at a level comparable to p42C/EBP
(31), we examined the contribution of CR1 and CR2 to the adipogenic
action of C/EBP
. The C/EBP
construct CR2/3/4, which lacks CR1,
was able to induce 422/aP2 expression (Fig. 1B) and lipid
accumulation (data not shown) comparable to p42C/EBP
, suggesting
that CR1 is not required for C/EBP
-induced adipogenesis and that CR2
is the adipogenic region. CR1 alone was not sufficient to induce
422/aP2 expression (Fig. 1B) nor promote cytoplasmic lipid
accumulation (Fig. 1C), whereas CR2 alone was able to induce spontaneous differentiation. This was consistent with CR2 being sufficient to mediate C/EBP
-induced adipogenesis. However, despite lacking CR2, CR1/3/4 is also able to induce adipogenesis (Fig. 1B). Thus it appears that multiple conserved regions within
C/EBP
are involved in the adipogenic effect. CR2 is able to
contribute independently of the other regions, whereas CR1 and CR3 work
in combination.
-mediated Transcription of the Leptin
Promoter--
p300 is a nuclear coactivator that has been shown to
interact with transcription factors that are important for a number of differentiation paradigms (for review, see Ref. 41). We performed a
series of experiments to investigate whether p300 coactivates C/EBP
through the adipogenic domains. To determine if p300 is a limiting
component and functions as a coactivator of C/EBP
transcription from
an adipocyte-specific promoter, reporter gene assays were performed
using a C/EBP
-responsive, leptin-luciferase reporter gene
(ob-luc). 293T cells, which do not contain endogenous C/EBP
, were transfected with a constant amount of expression vector
encoding C/EBP
and an increasing amount of p300 expression vector.
The ob-luc activity showed a p300-dependent
increase (Fig. 2, top) in the
presence of a constant level of C/EBP
, as seen by immunoblotting
(Fig. 2, bottom). p300 had no effect on ob-luc activity in the absence of C/EBP
. Similar results were seen in assays using the PPAR
2 promoter (data not shown). To
ensure that the coactivational effects observed were the result of
C/EBP
binding the ob promoter and not nonspecific or
non-DNA binding events, we performed the reporter gene assay with an
ob-luciferase reporter gene with a mutation in the C/EBP
binding site (mob-luc). This mutation prevents C/EBP
from
binding to the promoter (36) and abrogates
C/EBP
-dependent transactivation. Consistent with p300
coactivation being mediated through the C/EBP
binding site, coactivation was disrupted in reporter assays utilizing
mob-luc (Fig. 3, solid
bars). The ability of p300 alone to activate both ob-luc and mob-luc is the result of utilizing
high amounts of p300 expression vector (5 µg) in this experiment and
is not seen at lower plasmid concentrations (Figs. 2, 4, and 6). These
data strongly suggest that p300 is a rate-limiting component in the C/EBP
transcriptional machinery.

View larger version (23K):
[in a new window]
Fig. 2.
p300 potentiates
C/EBP
-mediated transcription. 293T cells
were transfected with ob-luc and CMV-
Gal as described
under "Experimental Procedures." An increasing amount (0, 0.05, 0.1, 0.5, and 1 µg) of pVR1012-p300 was cotransfected with the
reporter genes in the presence (+) or in the absence (
) of an
expression vector encoding full-length p42 C/EBP
(50 ng). Results
are displayed as the mean luciferase activity ± S.D.
(n = 3) relative to the activity of the
ob-luc transfected alone and are representative of results
obtained in at least three independent experiments. Results were
normalized to the expression of CMV-
Gal (top). For
C/EBP
immunoblot analyses, the amount of cell lysate separated by
SDS-polyacrylamide gel electrophoresis (11.5% polyacrylamide) was
normalized to
Gal expression (bottom).

View larger version (22K):
[in a new window]
Fig. 3.
Mutation of the C/EBP binding site in the
leptin promoter prevents coactivation by p300.
Luciferase reporter gene activity under the control of the wild-type
leptin promoter (ob-luc; hatched) or a leptin
promoter with the C/EBP binding site mutated (mob-luc;
solid) was assayed in 293T cells. Reporter genes were
transfected with (+) or without (
) expression vectors encoding
p42C/EBP
(50 ng) and p300 (5 µg). Results are displayed as the
mean luciferase activity ± S.D. (n = 3)
relative to the activity of the reporter genes transfected alone and
are representative of results obtained in at least three independent
experiments. Results were normalized to the expression of
CMV-
Gal.
and p300 Is Inhibited by
Adenovirus E1A--
p300 was first cloned as an adenovirus
E1A-associated protein (42). It was subsequently shown that E1A
prevents the association of p300 with a number of transcription factors
(38, 43, 44) and inhibits the interaction required for coactivation. We
examined whether E1A could inhibit coactivation of C/EBP
transactivation by p300. Cotransfection of an expression vector
encoding wild-type 12S E1A repressed C/EBP
-mediated
ob-luc activity in both the basal and the p300-coactivated
states (Fig. 4). The E1A-RG2 mutant (45),
which has a decreased affinity for p300, fails to repress (Fig. 4).
Expression of C/EBP
remained constant as shown by immunoblotting. These results confirm that p300 acts as a coactivator of C/EBP
. Furthermore, the inhibition of basal C/EBP
activity by E1A is consistent with endogenous p300 coactivating C/EBP
transcription.

View larger version (20K):
[in a new window]
Fig. 4.
E1A inhibits p300 coactivation of
C/EBP
transactivation of the leptin
promoter. 293T cells cotransfected with the ob-luc
reporter gene in combination with expression vectors for p42C/EBP
(50 ng), p300 (500 ng), 12S-E1A-WT (500 ng), or 12S-E1A-RG2 (500 ng).
Results are representative of at least three independent experiments
and are reported as the mean luciferase activity ± S.D.
(n = 3; top) relative to ob-luc
alone. Values are normalized to C/EBP
expression
(bottom). The asterisk (*) indicates a
significant difference versus p42 alone and
versus p42 plus E1A-RG2, p
0.05).
Transactivation Domain
Functionally Interact with p300--
Having firmly established that
p300 functions as a coactivator of C/EBP
transcription, we then
investigated the region of the C/EBP
transactivation domain which
interacts with p300. To determine if coactivation of C/EBP
by p300
is independent of the bZIP domain we created a chimeric protein
consisting of the Gal4 DNA binding domain and the C/EBP
transactivation domain (Gal4-C/EBP
). We then performed a luciferase
reporter gene assay using a Gal4-responsive reporter construct and
tested the ability of p300 to coactivate the chimeric protein (Fig.
5). Cotransfecting p300 with the reporter
gene alone or with the Gal4 DNA binding domain generated minimal
reporter gene activity. Cotransfection of Gal4-C/EBP
resulted in a
robust induction in reporter gene activity, whereas cotransfection with
p300 potentiates the basal Gal4-C/EBP
transactivation by ~36-fold.
This response confirmed our hypothesis that p300 functionally interacts
with the transactivation domain of C/EBP
.

View larger version (15K):
[in a new window]
Fig. 5.
p300 functionally interacts with the
C/EBP
transactivation domain. A
Gal4-responsive luciferase reporter gene was transfected into 293T
cells alone or with expression vectors encoding the Gal4 DNA binding
domain (50 ng) or the Gal4-C/EBP
chimera (50 ng) in the absence (
)
or presence (+) of a p300 expression vector (500 ng). Results are
normalized to the expression of CMV-
Gal and are the mean luciferase
activity ± S.D. (n = 3) relative to the activity
of the Gal4-responsive reporter gene transfected alone. These results
are representative of at least three independent experiments. A
schematic diagram of the Gal4DBD-C/EBP
protein is shown
(top).
transactivation
domain mediate the interaction with p300, we created C/EBP
transactivation domain truncations (Fig.
6A, top) and
conserved region deletion mutants (Fig. 6B, top).
We then tested the ability of p300 to coactivate transcription of
ob-luc by the deletion mutants. Immunoblot analysis was used
to ensure that expression levels of the C/EBP
mutants were similar
(data not shown). Truncation of the transactivation domain revealed
that the removal of CR1 did not have an effect on basal transcription
or on coactivation by p300 (Fig. 6A, CR2/3/4). Further
truncation of the amino terminus showed that upon the loss of CR2 there
was a substantial decrease in the basal activation, but there was no
change in the potentiation by p300 (~2.6-fold in both CR2/3/4 and
p30). Removal of CR3 resulted in a further decrease in basal
transcription and the loss of coactivation by p300 (Fig. 6A,
p30 versus CR4). These results suggest that CR3 is a region
within the C/EBP
transactivation domain which interacts with p300.
However, when a construct containing only CR1 and CR2 (Fig.
6B, CR1/2) was assayed, p300 cotransfection potentiated the
transcriptional activity, indicating that CR3 is able to interact
functionally with p300 but is not required for p300 interaction with
C/EBP
. Based upon the observation that the deletion of CR1 had a
minimal effect on coactivation by p300 (Fig. 6A, CR2/3/4),
we suspected that CR2 was also able to interact functionally with p300.
Consistent with this hypothesis, a C/EBP
construct lacking both CR2
and CR3 (Fig. 6B, CR1/4) was not coactivated by p300.
Furthermore, deletion of all of the conserved regions in the C/EBP
transactivation domain except CR2 (Fig. 6B, CR2) revealed
that like CR3 (data not shown), CR2 alone can be coactivated by p300.
Thus it appears that multiple regions of the C/EBP
transactivation domain interact functionally with p300.

View larger version (25K):
[in a new window]
Fig. 6.
p300 functionally interacts with multiple
regions of the C/EBP
transactivation
domain. A, amino-terminal truncations of C/EBP
and
the conserved regions of the transactivation domain are
shaded (top). 293T cells were transfected with
ob-luc and 50 ng of expression vector encoding p42, CR2/3/4,
p30, CR4, or bZIP with (+) or without (
) p300 expression vector (500 ng). Results are normalized to the expression of CMV-
Gal and are the
mean luciferase activity ± S.D. (n = 3) relative
to ob-luc transfected alone (bottom). Expression
levels of the various mutants were similar to that of p42 and were not
altered with p300 cotransfection (data not shown). Data for control,
p42, p30, and bZIP isoforms were obtained in parallel, whereas data
used for CR2/3/4 and CR4 were from separate experiments where a
p42-positive control was assayed in parallel, and the basal
transactivation and p300 potentiation were similar to that displayed.
B, schematic diagram of C/EBP
conserved region deletion
mutants (top). An experiment similar to that in panel
A was performed using expression vectors for p42, CR1/2, CR1/4,
CR2/4, CR2, and CR1/3/4 isoforms of C/EBP
(bottom). Data
for control, p42, CR1/4, and CR2/4 were obtained from assays performed
in parallel. Data for CR1/2, CR2, and CR1/3/4 are from independent
experiments where a p42-positive control was assayed in parallel, and
the basal transactivation and p300 potentiation were similar to that
displayed. All reporter gene results are representative of at least
three independent experiments.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
transactivation domain are able to stimulate adipogenesis and
interact functionally with p300. C/EBP
,
, and
are related transcription factors in the C/EBP family of genes which play a role in
adipogenesis (for review, see Ref. 7). These proteins display a high
degree of homology between their bZIP domains (93% homology between
C/EBP
and C/EBP
) and recognize the same consensus DNA binding
site (46). However, their sequences diverge markedly within the
transactivation domain. Work by Elberg et al. (47) demonstrated the important role of the transactivation domain by
showing that despite the similarities in the DNA binding domains, C/EBP
homodimers are unable to bind to and activate the
PPAR
2 promoter. C/EBP
is able both to bind and
transactivate the PPAR
2 promoter. These investigators
found that fusing the C/EBP
transactivation domain to the C/EBP
bZIP allows transactivation, whereas fusing the C/EBP
transactivation domain to the C/EBP
bZIP blocks transactivation (47). Furthermore, because of the use of alternative translation start
sites (32, 48), C/EBP
(p42/p30) and C/EBP
(LAP/LIP) have isoforms
that vary in the composition of their transactivation domain. The ratio
of expression between these isoforms is critical for normal 3T3-L1
differentiation (49), again implicating the C/EBP
transactivation
domain as a key component in understanding the control of adipogenesis.
In our study, we have identified highly conserved regions of the
C/EBP
transactivation domain which mediate C/EBP
-induced
differentiation of 3T3-L1 preadipocytes. Of the four conserved regions
in the transactivation domain, CR2 is the only region capable of
inducing spontaneous differentiation alone when fused to the C/EBP
bZIP (Fig. 1). Although CR1 and CR3 are incapable of inducing
spontaneous differentiation when placed individually next to the bZIP,
a construct containing both regions but lacking CR2 (CR1/3/4) promotes
cytoplasmic lipid accumulation and the expression of adipocyte markers.
transcription (50)
and is thought to interact with a site within CR2 (51). Furthermore,
TBP and transcription factor IIB (TFIIB) have been shown to
interact within the CR2 region of C/EBP
(52) to promote C/EBP
-mediated transcription. The coactivator p300 is also able to
potentiate C/EBP
transactivation (Fig. 2 and Ref. 43); and based
upon our results, this is mediated, in part, by functional interaction
with CR2 (Fig. 6B). Spontaneous adipogenesis induced by
CR1/3/4 (Fig. 1), which lacks the putative pRb interaction site (51),
suggests that C/EBP
can induce differentiation in 3T3-L1
preadipocytes independent of pRb. This is in contrast with the
observation that C/EBP
fails to induce differentiation of pRb
/
3T3 fibroblasts (50). The
conflicting observations may be the result of differences in the cell
models or the presence of a previously unpredicted pRb-interacting
region within the C/EBP
transactivation domain.
and p300,
utilizing a variety of techniques (glutathione S-transferase
affinity precipitation, coimmunoprecipitation and electrophoretic
mobility shift assays), by ourselves and
others2 have been
unsuccessful. It may be that p300 does not interact directly with
C/EBP
but is a limiting component in a higher order complex that
must form to allow C/EBP
transactivation. An alternative hypothesis
is that interactions between C/EBP
and nuclear factors, like p300,
are very low affinity interactions and are disrupted using standard
techniques to demonstrate physical interactions. This is consistent
with the measures taken to demonstrate C/EBP
interaction with TBP
and TFIIB (52). Interaction between C/EBP
and both of these proteins
was demonstrated in vitro using glutathione S-transferase affinity precipitation, but TFIIB could not be
coimmunoprecipitated with C/EBP
, whereas TBP could only be
coimmunoprecipitated under very low stringency conditions (52). We
report in a separate manuscript3 that a blue
fluorescent protein (BFP)-C/EBP
fusion protein localizes to punctate
regions within the nucleus when transfected into GHFT1-5 pituitary
progenitor cells or 3T3-L1 preadipocytes. This is similar to the
pattern exhibited by endogenous C/EBP
when localized using immunofluorescence (55). In contrast, green fluorescent protein (GFP)-CREB-binding protein (CBP), a functional homolog of p300, is
expressed diffusely within the nucleus. When BFP-C/EBP
and GFP-CBP
are cotransfected, GFP-CBP is recruited to discreet regions of the
nucleus occupied by BFP-C/EBP
. This study suggests that p300 and
C/EBP
interact with one another within the cell. This observation in
combination with those presented in our study indicates that p300 is
acting as a component of the C/EBP
transcriptional machinery and
suggests that p300 plays a role in mediating the effects of C/EBP
on adipogenesis.
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES
To whom correspondence should be addressed: Dept. of Physiology,
7744 Medical Science Bldg. II, 1301 E. Catherine, Ann Arbor, MI
48109-0622. Tel.: 734-647-7721; Fax: 734-936-8813; E-mail: macdouga@umich.edu.
![]()
ABBREVIATIONS
Gal,
-galactosidase;
pRb, retinoblastoma
protein;
BFP, blue fluorescent protein;
GFP, green fluorescent protein;
CREB, cAMP response element-binding protein;
CBP, CREB-binding protein;
TBP, TATA-binding protein.
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Lin, Y.,
Lee, H.,
Berg, A. H.,
Lisanti, M. P.,
Shapiro, L.,
and Scherer, P. E.
(2000)
J. Biol. Chem.
275,
24255-24263
2.
MacDougald, O. A.,
Hwang, C.-S.,
Fan, H.,
and Lane, M. D.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
9034-9037
3.
Morrison, R. F.,
and Farmer, S. R.
(1999)
J. Cell. Biochem.
32-33,
59-67
4.
Pond, C. M.,
and Mattacks, C. A.
(1998)
Immunol. Lett.
63,
159-167
5.
Wickelgren, I.
(1998)
Science
280,
1364-1367
6.
Reitman, M. L.,
Arioglu, E.,
Gavrilova, O.,
and Taylor, S. I.
(2000)
Trends Endocrinol. Metab.
11,
410-416
7.
Darlington, G. J.,
Ross, S. E.,
and MacDougald, O. A.
(1998)
J. Biol. Chem.
273,
30057-30060
8.
Rangwala, S. M.,
and Lazar, M. A.
(2000)
Annu. Rev. Nutr.
20,
535-559
9.
Rosen, E. D.,
Walkey, C. J.,
Puigserver, P.,
and Spiegelman, B. M.
(2000)
Genes Dev.
14,
1293-1307
10.
Hu, E.,
Kim, J. B.,
Sarraf, P.,
and Spiegelman, B. M.
(1996)
Science
274,
2100-2103
11.
Reginato, M. J.,
Krakow, S. L.,
Bailey, S. T.,
and Lazar, M. A.
(1998)
J. Biol. Chem.
273,
1855-1858
12.
Shao, D.,
Rangwala, S. M.,
Bailey, S. T.,
Krakow, S. L.,
Reginato, M. J.,
and Lazar, M. A.
(1998)
Nature
396,
377-380
13.
Zhang, B.,
Berger, J.,
Zhou, G.,
Elbrecht, A.,
Biswas, S.,
White-Carrington, S.,
Szalkowski, D.,
and Moller, D. E.
(1996)
J. Biol. Chem.
271,
31771-31774
14.
Wang, N. D.,
Finegold, M. J.,
Bradley, A.,
Ou, C. N.,
Abdelsayed, S. V.,
Wilde, M. D.,
Taylor, L. R.,
Wilson, D. R.,
and Darlington, G. J.
(1995)
Science
269,
1108-1112
15.
Green, H.,
and Kehinde, O.
(1979)
J. Cell Physiol.
101,
169-172
16.
Green, H.,
and Kehinde, O.
(1975)
Cell
5,
19-27
17.
Green, H.,
and Meuth, M.
(1974)
Cell
3,
127-133
18.
Lin, F.-T.,
and Lane, M. D.
(1992)
Genes Dev.
6,
533-544
19.
Freytag, S. O.,
Paielli, D. L.,
and Gilbert, J. D.
(1994)
Genes Dev.
8,
1654-1663
20.
Lin, F.-T.,
and Lane, M. D.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
8757-8761
21.
Ross, S. E.,
Hemati, N.,
Longo, K. A.,
Bennett, C. N.,
Lucas, P. C.,
Erickson, R. L.,
and MacDougald, O. A.
(2000)
Science
289,
950-953
22.
Landschulz, W. H.,
Johnson, P. F.,
and McKnight, S. L.
(1989)
Science
243,
1681-1688
23.
Landschulz, W. H.,
Johnson, P. F.,
and McKnight, S. L.
(1988)
Science
240,
1759-1764
24.
Williams, S. C.,
Angerer, N. D.,
and Johnson, P. F.
(1997)
Gene Expr.
6,
371-385
25.
MacDougald, O. A.,
Cornelius, P.,
Liu, R.,
and Lane, M. D.
(1995)
J. Biol. Chem.
270,
647-654
26.
Hemati, N.,
Ross, S. E.,
Erickson, R. L.,
Groblewski, G. E.,
and MacDougald, O. A.
(1997)
J. Biol. Chem.
272,
25913-25919
27.
Ross, S. E.,
Erickson, R. L.,
Hemati, N.,
and MacDougald, O. A.
(1999)
Mol. Cell. Biol.
19,
8433-8441
28.
Pei, D.,
and Shih, C.
(1991)
Mol. Cell. Biol.
11,
1480-1487
29.
Friedman, A. D.,
and McKnight, S. L.
(1990)
Genes Dev.
4,
1416-1426
30.
Nerlov, C.,
and Ziff, E. B.
(1994)
Genes Dev.
8,
350-362
31.
Erickson, R. L.,
Longo, K. A.,
Ross, S. E.,
Hemati, N.,
and MacDougald, O. A.
(1999)
in
Adipocyte Biology and Hormone Signaling
(Ntambi, J., ed)
, pp. 79-90, IOS Press, Amsterdam
32.
Lin, F.-T.,
MacDougald, O. A.,
Diehl, A. M.,
and Lane, M. D.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
9606-9610
33.
Christy, R. J.,
Kaestner, K. H.,
Geiman, D. E.,
and Lane, M. D.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
2593-2597
34.
Miller, A. D.,
and Rosman, G. J.
(1989)
BioTechniques
7,
980-990
35.
Sadowski, I.,
and Ptashne, M.
(1989)
Nucleic Acids Res.
17,
7539
36.
Hwang, C.-S.,
Mandrup, S.,
MacDougald, O. A.,
Geiman, D. E.,
and Lane, M. D.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
873-877
37.
Clarke, S. L.,
Robinson, C. E.,
and Gimble, J. M.
(1997)
Biochem. Biophys. Res. Commun.
240,
99-103
38.
Lundblad, J. R.,
Kwok, R. P. S.,
Laurance, M. E.,
Harter, M. L.,
and Goodman, R. H.
(1995)
Nature
374,
85-88
39.
Brasier, A. R.,
and Fortin, J. J.
(1995)
in
Current Protocols in Molecular Biology
(Ausubel, F. M.
, Brent, R.
, Kingston, R. E.
, Moore, D. D.
, Seidman, J. G.
, Smith, J. A.
, and Struhl, K., eds), Vol. 1
, pp. 9.7.12-9.7.21, John Wiley & Sons, New York
40.
Preece, A.
(1972)
A Manual for Histogic Technicians
, Little Brown, Boston
41.
Goodman, R. H.,
and Smolik, S.
(2000)
Genes Dev.
14,
1553-1577
42.
Eckner, R.,
Ewen, M. E.,
Newsome, D.,
Gerdes, M.,
DeCaprio, J. A.,
Lawrence, J. B.,
and Livingston, D. M.
(1994)
Genes Dev.
8,
869-884
43.
Mink, S.,
Haenig, B.,
and Klempnauer, K.-H.
(1997)
Mol. Cell. Biol.
17,
6609-6617
44.
Puri, P. L.,
Avantaggiati, M. L.,
Balsano, C.,
Sang, N.,
Graessmann, A.,
Giordano, A.,
and Levrero, M.
(1997)
EMBO J.
16,
369-383
45.
Wang, H. G.,
Rikitake, Y.,
Carter, M. C.,
Yaciuk, P.,
Abraham, S. E.,
Zerler, B.,
and Moran, E.
(1993)
J. Virol.
67,
476-488
46.
Osada, S.,
Yamamoto, H.,
Nishihara, T.,
and Imagawa, M.
(1996)
J. Biol. Chem.
271,
3891-3896
47.
Elberg, G.,
Gimble, J. M.,
and Tsai, S. Y.
(2000)
J. Biol. Chem.
275,
27815-27822
48.
Descombes, P.,
and Schibler, U.
(1991)
Cell
67,
569-579
49.
Calkhoven, C. F.,
Muller, C.,
and Leutz, A.
(2000)
Genes Dev.
14,
1920-1932
50.
Classon, M.,
Kennedy, B. K.,
Mulloy, R.,
and Harlow, E.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
10826-10831
51.
Chen, P.-L.,
Riley, D. J.,
Chen, Y.,
and Lee, W.-H.
(1996)
Genes Dev.
10,
2794-2804
52.
Nerlov, C.,
and Ziff, E. B.
(1995)
EMBO J.
14,
4318-4328
53.
Zhang, J. J.,
Vinkemeier, U.,
Gu, W.,
Chakravarti, D.,
Horvath, C. M.,
and Darnell, J. E., Jr.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
15092-15096
54.
Zhong, H.,
Voll, R. E.,
and Ghosh, S.
(1998)
Mol. Cell
1,
661-671
55.
Tang, Q. Q.,
and Lane, M. D.
(1999)
Genes Dev.
13,
2231-2241
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
K. R. Badri, Y. Zhou, U. Dhru, S. Aramgam, and L. Schuger Effects of the SANT Domain of Tension-Induced/Inhibited Proteins (TIPs), Novel Partners of the Histone Acetyltransferase p300, on p300 Activity and TIP-6-Induced Adipogenesis Mol. Cell. Biol., October 15, 2008; 28(20): 6358 - 6372. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Jin, N. J. Lanning, and C. Carter-Su JAK2, But Not Src Family Kinases, Is Required for STAT, ERK, and Akt Signaling in Response to Growth Hormone in Preadipocytes and Hepatoma Cells Mol. Endocrinol., August 1, 2008; 22(8): 1825 - 1841. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. C. Cha, N. R. Oak, S. Kang, T.-A. Tran, S. Kobayashi, S.-H. Chiang, D. G. Tenen, and O. A. MacDougald Phosphorylation of CCAAT/Enhancer-binding Protein {alpha} Regulates GLUT4 Expression and Glucose Transport in Adipocytes J. Biol. Chem., June 27, 2008; 283(26): 18002 - 18011. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Iida, R. Watanabe-Fukunaga, S. Nagata, and R. Fukunaga Essential role of C/EBPalpha in G-CSF-induced transcriptional activation and chromatin modification of myeloid-specific genes. Genes Cells, April 1, 2008; 13(4): 313 - 327. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yamakawa, R. H. Whitson, S.-L. Li, and K. Itakura Modulator Recognition Factor-2 Is Required for Adipogenesis in Mouse Embryo Fibroblasts and 3T3-L1 Cells Mol. Endocrinol., February 1, 2008; 22(2): 441 - 453. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Geletu, M. Y. Balkhi, A. A. Peer Zada, M. Christopeit, J. A. Pulikkan, A. K. Trivedi, D. G. Tenen, and G. Behre Target proteins of C/EBP{alpha}p30 in AML: C/EBP{alpha}p30 enhances sumoylation of C/EBP{alpha}p42 via up-regulation of Ubc9 Blood, November 1, 2007; 110(9): 3301 - 3309. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kang, C. N. Bennett, I. Gerin, L. A. Rapp, K. D. Hankenson, and O. A. MacDougald Wnt Signaling Stimulates Osteoblastogenesis of Mesenchymal Precursors by Suppressing CCAAT/Enhancer-binding Protein {alpha} and Peroxisome Proliferator-activated Receptor {gamma} J. Biol. Chem., May 11, 2007; 282(19): 14515 - 14524. [Abstract] [Full Text] [PDF] |