JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M100128200 on February 8, 2001

J. Biol. Chem., Vol. 276, Issue 19, 16348-16355, May 11, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/19/16348    most recent
M100128200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Erickson, R. L.
Right arrow Articles by MacDougald, O. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Erickson, R. L.
Right arrow Articles by MacDougald, O. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

p300 Coactivates the Adipogenic Transcription Factor CCAAT/Enhancer-binding Protein alpha *

Robin L. Erickson, Nahid Hemati, Sarah E. Ross, and Ormond A. MacDougaldDagger

From the Department of Physiology, University of Michigan Medical School, Ann Arbor, Michigan 48109-0622

Received for publication, January 6, 2001, and in revised form, January 31, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Despite the knowledge that CCAAT/enhancer-binding protein alpha  (C/EBPalpha ) plays an important role in preadipocyte differentiation, our understanding of how C/EBPalpha interacts with nuclear proteins to regulate transcription is limited. Based on the hypothesis that evolutionarily conserved regions are functionally important and likely to interact with coactivators, we compared the amino acid sequence of C/EBPalpha from different species (frog to human) and identified four highly conserved regions (CR1-CR4) within the transactivation domain. A series of amino-terminal truncations and internal deletion constructs were made creating forms of C/EBPalpha which lack single or multiple conserved regions. To determine which regions of the C/EBPalpha transactivation domain are important in its ability to induce spontaneous differentiation of 3T3-L1 preadipocytes, we infected preadipocytes with expression vectors encoding the C/EBPalpha conserved region mutants and observed their ability to induce differentiation. We found that CR2 fused to the DNA binding domain is able to induce spontaneous differentiation independent of the other conserved regions. However, CR2 was not necessary for the adipogenic action of C/EBPalpha because a combination of CR1 and CR3 can also induce adipogenesis. Because the transcriptional coactivator p300 participates in the signaling of many transcription factors to the basal transcriptional apparatus, we examined whether functional interaction exists between C/EBPalpha and p300. Cotransfection of p300 with p42C/EBPalpha results in a synergistic increase in leptin promoter activity, indicating that p300 acts as a transcriptional coactivator of C/EBPalpha . Analyses using C/EBPalpha conserved region mutants suggest that multiple regions (CR2 and CR3) of the C/EBPalpha transactivation domain functionally interact with p300.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Adipose tissue plays multiple roles in the mechanisms controlling homeostasis. Adipocytes serve not only as an energy reservoir by storing excess calories as triacylglycerol, but they also have endocrine and immune functions (1-4). The importance of understanding adipocyte biology is emphasized further by the complications that arise from either too much or too little adipose tissue. Obesity and its associated disorders, such as type 2 diabetes and cardiovascular disease, are an epidemic in the developed world today (5). Conversely, lipoatrophy, the lack of adipose tissue, is also associated with diabetes and a number of other metabolic abnormalities (6). Understanding the factors that govern the transcriptional control of adipogenesis will aid in our understanding of how these disorders arise.

A number of the key factors controlling the adipocyte differentiation cascade have been identified (for review, see Refs. 3 and 7-9), including the transcription factors CCAAT/enhancer binding protein alpha  (C/EBPalpha )1 and peroxisome proliferator-activated receptor gamma  (PPARgamma ). Although the structure, function, and regulation of PPARgamma have been studied extensively (10-13), similar analyses have yet to be performed upon C/EBPalpha .

Consistent with C/EBPalpha being a key component in the adipogenic cascade, mice with the c/ebpalpha gene deleted have a deficiency in lipid accumulation in both white and brown adipose tissue (14). Likewise, 3T3-L1 preadipocytes (15-17) are unable to differentiate after hormonal induction if C/EBPalpha antisense RNA is expressed in the cells (18). Moreover, the enforced expression of C/EBPalpha in 3T3-L1 fibroblasts is sufficient to induce spontaneous adipogenesis (19, 20) and overcome the effects of repressors of adipogenesis such as Wnt-1 (21). C/EBPalpha is a prototypical basic region/leucine zipper (bZIP) transcription factor consisting of a well characterized carboxyl-terminal leucine zipper that confers dimerization ability and a neighboring DNA binding domain and nuclear localization signal, which are rich in basic residues (22-24). The remaining amino-terminal 273 amino acids, termed the transactivation domain, contains insulin-responsive sites of phosphorylation (25-27) and regions that affect the transcriptional activity of C/EBPalpha (28-30). Previous studies have arbitrarily divided the transactivation domain and identified regulatory regions within it by examining the ability of these C/EBPalpha constructs to transactivate reporter genes under the control of the liver serum albumin promoter (29, 30) or an artificial Gal4-responsive promoter (28). In contrast, the current study approaches the functional analyses of the C/EBPalpha transactivation domain by targeting regions of C/EBPalpha which are highly conserved across several species (31). We examined the role of these conserved regions (CR) in the ability of C/EBPalpha to activate the genes necessary to induce spontaneous preadipocyte differentiation. Furthermore, we demonstrate that the nuclear coactivator p300 is able to potentiate C/EBPalpha -mediated transcription of the leptin (ob) promoter through multiple conserved regions within the C/EBPalpha transactivation domain.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture

Human embryonic kidney 293T cells were cultured in high glucose Dulbecco's modified Eagle's medium (Life Technologies, Inc.) containing 10% calf serum (Life Technologies, Inc.), 1 mM sodium pyruvate (Life Technologies, Inc.), 105 µg/ml penicillin G (Sigma PEN-K), 65 µg/ml streptomycin sulfate (Sigma), and 8.4 µg/ml biotin (Sigma). Cells were incubated in a 10% CO2 water-jacketed incubator. 3T3-L1 fibroblasts were cultured as described (26).

Cloning of C/EBPalpha Constructs

To facilitate cloning of C/EBPalpha deletion mutants, a +5-nucleotide to +2,111-nucleotide clone of mouse C/EBPalpha in pBluescript KS+ (Stratagene) containing an ideal Kozak translational start site (32) and silent mutations was used. These silent mutations, as described previously (27), introduce unique KpnI (+534 nucleotides), SphI (+823 nucleotides), and XhoI (+1,072 nucleotides) restriction sites. BamHI to KpnI (pSER13) and KpnI to XhoI (pSER23) fragments of C/EBPalpha were each subcloned into pBluescript KS+.

Cloning of CR2/3/4 Vector-- pSER13 was digested with BamHI and AatII (+307 nucleotides), and a BamHI-AatII oligonucleotide (Table I) was inserted (pSER13Delta CR1). The BamHI-KpnI fragment of pSER13Delta CR1 was excised and subcloned into pcDNA3.1(-) (Invitrogen) containing full-length p42C/EBPalpha (pSER28) and resulted in a C/EBPalpha clone lacking CR1 (pSER28Delta CR1).

                              
View this table:
[in this window]
[in a new window]
 
Table I
Synthetic oligonucleotides and PCR primers used to create C/EBPalpha transactivation domain mutants

Cloning of CR1/3/4 Vector-- pSER13 was digested with AatII and KpnI and religated with an AatII-KpnI oligonucleotide (Table I). The resulting vector (pSER13Delta CR2) was then digested with BamHI plus KpnI, and the excised fragment was subcloned into pSER28. The resulting clone lacks CR2 (pSER28Delta CR2).

Cloning of CR1/2 Vector-- C/EBPalpha containing CR1 and CR2 was created by digesting pSER23 with KpnI and SphI and ligating in a KpnI-SphI oligonucleotide (Table I; pSER23Delta CR3/4). The KpnI-XhoI fragment of pSER23Delta CR3/4 was then excised and inserted into the KpnI-XhoI site of pSER28, generating CR1/2 (SER28Delta CR3/4).

Cloning of CR1 and CR2 Vectors-- To create expression vectors containing CR1 or CR2 alone fused to the bZIP, the BamHI-KpnI fragment from pSER13Delta CR2 or pSER13Delta CR1, respectively, was subcloned into the BamHI-KpnI site of pSER28Delta CR3/4.

Cloning of CR2/4 and CR1/4 Vectors-- A C/EBPalpha fragment lacking CR3 was synthesized by polymerase chain reaction using Delta CR3 primers (Table I) with pSER28 as a template. TOPO TA cloning (Invitrogen) was used to subclone the product into pCR2.1-TOPO (Invitrogen). A KpnI-XhoI fragment was then excised and subcloned into pSER28Delta CR1 or pSER28Delta CR2, yielding CR2/4 or CR1/4, respectively.

Cloning of CR4 Vector-- The MluI-EcoRV fragment (+698 to +2,111 nucleotides) from the C/EBPalpha gene (33) was cloned into pEBVHis A (Invitrogen), as described previously (His-p18C/EBPalpha (27)). To create a non-His-tagged form of CR4, His-p18C/EBPalpha was linearized with HindIII, and a fill-in reaction was performed to blunt end the vector. The linearized vector was then digested with BglII, and the resulting fragment was subcloned into the BamHI-EcoRV site of pcDNA3.1(+) (Invitrogen) containing an ideal Kozak consensus sequence oligonucleotide (AGCTTGCGGCCGCCACCATGGG) 5' to the BamHI site. The expression vectors encoding p30C/EBPalpha (CR3/4) and p12C/EBPalpha (bZIP) were described previously (27).

To create retroviral expression vectors, pLXSN (34) was linearized with HindIII, blunt ends were created using DNA polymerase I, large (Klenow) fragment (New England Biolabs) and ligated with T4 DNA ligase (New England Biolabs). The resulting plasmid was digested with HpaI, and a HindIII linker (d(pCAAGCTTG), New England Biolabs) was ligated in to form pNH2. The full-length, p30, CR1, and CR1/3/4 isoforms of C/EBPalpha were each excised from pcDNA3.1(-) with EcoRI and HindIII and subcloned into the EcoRI-HindIII sites of pNH2. CR2/3/4 and CR2 in pcDNA3.1(+) were first digested with BamHI. The resulting fragment was filled in with DNA polymerase I, large (Klenow) fragment and ligated with an EcoRI linker (d(pCGGAATTCCG), New England Biolabs). This vector was subsequently digested with EcoRI plus HindIII, and the resulting insert was subcloned into pNH2.

An expression vector encoding a chimeric protein consisting of the Gal4 DNA binding domain and the C/EBPalpha transactivation domain was constructed by subcloning a KpnI-SacI fragment of pSER23 into pSG424 (35). This construct was subsequently digested with BamHI and KpnI, and the BamHI-KpnI fragment from pSER28 was inserted.

Luciferase Reporter Gene Assays

Reporter gene assays were performed using leptin promoter-luciferase reporter genes, pObLuc-760 and pObLuc-m760 (from Dr. M. Daniel Lane, Johns Hopkins University (36)), a murine PPARgamma 2 promoter-luciferase reporter gene (from Dr. Jeffrey Gimble, Artecel Sciences, Inc. (37)), and a (Gal4)5-SV40-luciferase reporter gene (from Dr. Mitchell A. Lazar, University of Pennsylvania). The human p300 expression vector, pVR1012-p300, was donated by Dr. Gary Nabel (National Institutes of Health). pCMV-12S E1A-WT and pCMV-12S E1A-RG2 were created by subcloning the HindIII-NotI fragment of pRc/RSV-12S E1A and pRc/RSV-12S E1A RG2 (from Dr. Roland Kwok, University of Michigan, 38) into the HindIII-NotI site of pcDNA3.1(+).

Human embryonic kidney 293T cells (100-mm plates) were transiently transfected with 20 µg of total DNA by calcium phosphate coprecipitation, including 1 µg of luciferase reporter gene, 500 ng of CMV-beta -galactosidase (beta Gal), and 10 µg of sheared herring sperm DNA. Additional plasmid DNA amounts varied based upon experimental conditions and are documented in the figure legends. A constant amount of CMV promoter was maintained in all conditions to control for the potential squelching of the transcriptional machinery. After precipitation for 4-5 h, cells were shocked with 12.5% glycerol in phosphate-buffered saline (157 mM NaCl, 2.7 mM KCl, 1.5 mM KH2PO4, 5.5 mM Na2HPO4-H2O, pH 7.3) for 3 min. Cells were incubated for 24-48 h in 10% calf serum and Dulbecco's modified Eagle's medium before they were lysed in 1 × reporter lysis buffer (100 mM KH2PO4, 0.2% (v/v) Triton X-100, 1 mM dithiothreitol). Samples were vortexed and subsequently centrifuged in a microcentrifuge for 30 s at 16,000 × g. To assay the samples for luciferase activity, 100 µl of the supernatant was mixed with 360 µl of luciferase buffer 2 (25 mM glycylglycine (Fisher Biotech), pH 7.8, 30 mM MgSO4, 4 mM EGTA, pH 8.0, 0.0027% (v/v) Triton X-100, 15 mM KH2 PO4, 2 mM ATP, 1 mM dithiothreitol) in glass test tubes. The tubes were then placed in an Optocomp II luminometer (MGM Instruments, Hamden, CT) and injected with 100 µl of luciferase buffer 3 (25 mM glycylglycine, 30 mM MgSO4, 4 mM EGTA, pH 8.0, 200 nM luciferin (Promega), 2 mM dithiothreitol), and the relative light units emitted were measured and normalized against the relative light units obtained from a chemiluminescent beta -galactosidase assay. beta -galactosidase activity was measured by taking 10 µl of cell lysate and inoculating 100 µl of beta -galactosidase reaction buffer (100 mM KH2PO4, 1 mM MgCl2, 1% (v/v) Galacton (Tropix)) and incubating for 45 min to 1 h at room temperature. Chemiluminescence was measured after the injection of 100 µl of light emission accelerator (10% (v/v) Emerald enhancer (Tropix) in 0.2 N NaOH (39)).

Retroviral Infection and Oil Red-O Staining of 3T3-L1 Preadipocytes

293T cells were transfected as described above with the retroviral C/EBPalpha expression vectors and the viral packaging vectors SV-E-MLV-env and SVpsi -E-MLV (7.5 µg of each) (21, 34). Virus-containing medium was collected at three 12-h intervals post-transfection and at each interval passed through a 0.45-µm syringe filter. 8 µg/ml filter-sterilized polybrene (hexadimethrine bromide; Sigma) was added to the virus-loaded medium. This medium was then applied to preconfluent (~40%) 3T3-L1 preadipocytes. The infection protocol was repeated two additional times. After the third round of infection, 3T3-L1 preadipocytes were trypsin treated and replated, on multiple plates, in Dulbecco's modified Eagle's medium supplemented with 10% calf serum and 400 µg/ml Geneticin (Life Technologies, Inc.). Cells were then allowed to proliferate to confluence, at which point the cells were fed with Dulbecco's modified Eagle's medium containing only 10% calf serum. For 14 days postconfluence the cells were observed for evidence of spontaneous differentiation. To detect cytoplasmic lipid accumulation, retrovirus-infected 3T3-L1 cells were stained by Oil Red-O, essentially as outlined previously (40).

Immunoblot Analysis

Protein expression levels in samples used for reporter gene assays were determined by immunoblot analysis. For detection of p300, supernatant from cells lysed in 1 × reporter lysis buffer was combined with 4 × SDS loading buffer (4% (v/v) SDS, 350 mM beta -mercaptoethanol, 240 mM Tris, pH 6.8, 40% (v/v) glycerol, 0.01% (w/v) bromphenol blue) and electrophoresed on an SDS-polyacrylamide gel (5%). Proteins were transferred to a polyvinylidene difluoride (Osmonics) membrane, and immunoblotting was performed with mouse monoclonal p300 antibody (BD PharMingen). To determine the expression of C/EBPalpha , pellets from reporter gene samples were transferred to new tubes, resuspended in Western lysis buffer (1% SDS, 60 mM Tris, pH 6.8), and sonicated. Lysate was mixed with 4 × SDS loading buffer and separated on an SDS-polyacrylamide gel (11.5%), transferred to polyvinylidene difluoride, and immunoblotted with an affinity-purified polyclonal C/EBPalpha antibody generated against a synthetic polypeptide corresponding to amino acids 253-265 (32). Immunoblot analyses of proteins from infected 3T3-L1 preadipocytes and adipocytes were performed as described previously (18, 26). The adipocyte marker 422/aP2 was detected using a polyclonal antibody received from Dr. David Bernlohr (University of Minnesota).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Multiple Conserved Regions Contribute to the Adipogenic Action of C/EBPalpha -- Conserved regions of the C/EBPalpha transactivation domain were identified by aligning the primary amino acid sequences of human, bovine, mouse, chicken, and frog C/EBPalpha (31). Analysis of the alignment revealed four regions within the transactivation domain with a high degree of sequence homology (Fig. 1A). Homology among CR1, 2, 3, and 4 from the mouse and chicken isoforms of C/EBPalpha is 66, 87, 87, and 94%, respectively.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 1.   Adipogenic potential of C/EBPalpha transactivation domain mutants. A, schematic representation of various C/EBPalpha isoforms and their ability to induce spontaneous differentiation of 3T3-L1 fibroblasts relative to full-length C/EBPalpha (p42; ++). B, 3T3-L1 fibroblasts infected with retroviral expression vectors encoding vector alone, p42, CR2/3/4, p30 (CR3/4), CR1/3/4, CR1, or CR2, lysed 15 days postconfluence as described under "Experimental Procedures." Whole cell lysates were separated by SDS-polyacrylamide gel electrophoresis (15% polyacrylamide gel) and immunoblotted for the adipocyte fatty acid-binding protein 422/aP2. C, phase-contrast micrograph of Oil Red-O-stained 3T3-L1 fibroblasts infected with retroviral vectors encoding the indicated C/EBPalpha isoform. Micrographs were taken 15 days postconfluence. Bar, 20 µm.

To determine the region within the C/EBPalpha transactivation domain capable of inducing differentiation, retroviral expression vectors encoding the C/EBPalpha isoforms depicted in Fig. 1A were infected into 3T3-L1 preadipocytes. The adipogenic activity of the various isoforms was measured by the expression of the adipocyte marker 422/aP2 (Fig. 1B) and Oil Red-O staining of cytoplasmic lipid accumulation (Fig. 1C). Consistent with the findings of other investigators (19, 20), p42C/EBPalpha induces spontaneous differentiation, but the p30C/EBPalpha isoform that contains only CR3 and CR4 does not (Fig. 1). Based upon these results and our previous results that a C/EBPalpha deletion mutant containing only CR1 and CR2 is able to induce differentiation at a level comparable to p42C/EBPalpha (31), we examined the contribution of CR1 and CR2 to the adipogenic action of C/EBPalpha . The C/EBPalpha construct CR2/3/4, which lacks CR1, was able to induce 422/aP2 expression (Fig. 1B) and lipid accumulation (data not shown) comparable to p42C/EBPalpha , suggesting that CR1 is not required for C/EBPalpha -induced adipogenesis and that CR2 is the adipogenic region. CR1 alone was not sufficient to induce 422/aP2 expression (Fig. 1B) nor promote cytoplasmic lipid accumulation (Fig. 1C), whereas CR2 alone was able to induce spontaneous differentiation. This was consistent with CR2 being sufficient to mediate C/EBPalpha -induced adipogenesis. However, despite lacking CR2, CR1/3/4 is also able to induce adipogenesis (Fig. 1B). Thus it appears that multiple conserved regions within C/EBPalpha are involved in the adipogenic effect. CR2 is able to contribute independently of the other regions, whereas CR1 and CR3 work in combination.

p300 Coactivates C/EBPalpha -mediated Transcription of the Leptin Promoter-- p300 is a nuclear coactivator that has been shown to interact with transcription factors that are important for a number of differentiation paradigms (for review, see Ref. 41). We performed a series of experiments to investigate whether p300 coactivates C/EBPalpha through the adipogenic domains. To determine if p300 is a limiting component and functions as a coactivator of C/EBPalpha transcription from an adipocyte-specific promoter, reporter gene assays were performed using a C/EBPalpha -responsive, leptin-luciferase reporter gene (ob-luc). 293T cells, which do not contain endogenous C/EBPalpha , were transfected with a constant amount of expression vector encoding C/EBPalpha and an increasing amount of p300 expression vector. The ob-luc activity showed a p300-dependent increase (Fig. 2, top) in the presence of a constant level of C/EBPalpha , as seen by immunoblotting (Fig. 2, bottom). p300 had no effect on ob-luc activity in the absence of C/EBPalpha . Similar results were seen in assays using the PPARgamma 2 promoter (data not shown). To ensure that the coactivational effects observed were the result of C/EBPalpha binding the ob promoter and not nonspecific or non-DNA binding events, we performed the reporter gene assay with an ob-luciferase reporter gene with a mutation in the C/EBP binding site (mob-luc). This mutation prevents C/EBPalpha from binding to the promoter (36) and abrogates C/EBPalpha -dependent transactivation. Consistent with p300 coactivation being mediated through the C/EBPalpha binding site, coactivation was disrupted in reporter assays utilizing mob-luc (Fig. 3, solid bars). The ability of p300 alone to activate both ob-luc and mob-luc is the result of utilizing high amounts of p300 expression vector (5 µg) in this experiment and is not seen at lower plasmid concentrations (Figs. 2, 4, and 6). These data strongly suggest that p300 is a rate-limiting component in the C/EBPalpha transcriptional machinery.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2.   p300 potentiates C/EBPalpha -mediated transcription. 293T cells were transfected with ob-luc and CMV-beta Gal as described under "Experimental Procedures." An increasing amount (0, 0.05, 0.1, 0.5, and 1 µg) of pVR1012-p300 was cotransfected with the reporter genes in the presence (+) or in the absence (-) of an expression vector encoding full-length p42 C/EBPalpha (50 ng). Results are displayed as the mean luciferase activity ± S.D. (n = 3) relative to the activity of the ob-luc transfected alone and are representative of results obtained in at least three independent experiments. Results were normalized to the expression of CMV-beta Gal (top). For C/EBPalpha immunoblot analyses, the amount of cell lysate separated by SDS-polyacrylamide gel electrophoresis (11.5% polyacrylamide) was normalized to beta Gal expression (bottom).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3.   Mutation of the C/EBP binding site in the leptin promoter prevents coactivation by p300. Luciferase reporter gene activity under the control of the wild-type leptin promoter (ob-luc; hatched) or a leptin promoter with the C/EBP binding site mutated (mob-luc; solid) was assayed in 293T cells. Reporter genes were transfected with (+) or without (-) expression vectors encoding p42C/EBPalpha (50 ng) and p300 (5 µg). Results are displayed as the mean luciferase activity ± S.D. (n = 3) relative to the activity of the reporter genes transfected alone and are representative of results obtained in at least three independent experiments. Results were normalized to the expression of CMV-beta Gal.

Functional Interaction between C/EBPalpha and p300 Is Inhibited by Adenovirus E1A-- p300 was first cloned as an adenovirus E1A-associated protein (42). It was subsequently shown that E1A prevents the association of p300 with a number of transcription factors (38, 43, 44) and inhibits the interaction required for coactivation. We examined whether E1A could inhibit coactivation of C/EBPalpha transactivation by p300. Cotransfection of an expression vector encoding wild-type 12S E1A repressed C/EBPalpha -mediated ob-luc activity in both the basal and the p300-coactivated states (Fig. 4). The E1A-RG2 mutant (45), which has a decreased affinity for p300, fails to repress (Fig. 4). Expression of C/EBPalpha remained constant as shown by immunoblotting. These results confirm that p300 acts as a coactivator of C/EBPalpha . Furthermore, the inhibition of basal C/EBPalpha activity by E1A is consistent with endogenous p300 coactivating C/EBPalpha transcription.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4.   E1A inhibits p300 coactivation of C/EBPalpha transactivation of the leptin promoter. 293T cells cotransfected with the ob-luc reporter gene in combination with expression vectors for p42C/EBPalpha (50 ng), p300 (500 ng), 12S-E1A-WT (500 ng), or 12S-E1A-RG2 (500 ng). Results are representative of at least three independent experiments and are reported as the mean luciferase activity ± S.D. (n = 3; top) relative to ob-luc alone. Values are normalized to C/EBPalpha expression (bottom). The asterisk (*) indicates a significant difference versus p42 alone and versus p42 plus E1A-RG2, p <=  0.05).

Multiple Regions of the C/EBPalpha Transactivation Domain Functionally Interact with p300-- Having firmly established that p300 functions as a coactivator of C/EBPalpha transcription, we then investigated the region of the C/EBPalpha transactivation domain which interacts with p300. To determine if coactivation of C/EBPalpha by p300 is independent of the bZIP domain we created a chimeric protein consisting of the Gal4 DNA binding domain and the C/EBPalpha transactivation domain (Gal4-C/EBPalpha ). We then performed a luciferase reporter gene assay using a Gal4-responsive reporter construct and tested the ability of p300 to coactivate the chimeric protein (Fig. 5). Cotransfecting p300 with the reporter gene alone or with the Gal4 DNA binding domain generated minimal reporter gene activity. Cotransfection of Gal4-C/EBPalpha resulted in a robust induction in reporter gene activity, whereas cotransfection with p300 potentiates the basal Gal4-C/EBPalpha transactivation by ~36-fold. This response confirmed our hypothesis that p300 functionally interacts with the transactivation domain of C/EBPalpha .


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5.   p300 functionally interacts with the C/EBPalpha transactivation domain. A Gal4-responsive luciferase reporter gene was transfected into 293T cells alone or with expression vectors encoding the Gal4 DNA binding domain (50 ng) or the Gal4-C/EBPalpha chimera (50 ng) in the absence (-) or presence (+) of a p300 expression vector (500 ng). Results are normalized to the expression of CMV-beta Gal and are the mean luciferase activity ± S.D. (n = 3) relative to the activity of the Gal4-responsive reporter gene transfected alone. These results are representative of at least three independent experiments. A schematic diagram of the Gal4DBD-C/EBPalpha protein is shown (top).

To determine which conserved regions of the C/EBPalpha transactivation domain mediate the interaction with p300, we created C/EBPalpha transactivation domain truncations (Fig. 6A, top) and conserved region deletion mutants (Fig. 6B, top). We then tested the ability of p300 to coactivate transcription of ob-luc by the deletion mutants. Immunoblot analysis was used to ensure that expression levels of the C/EBPalpha mutants were similar (data not shown). Truncation of the transactivation domain revealed that the removal of CR1 did not have an effect on basal transcription or on coactivation by p300 (Fig. 6A, CR2/3/4). Further truncation of the amino terminus showed that upon the loss of CR2 there was a substantial decrease in the basal activation, but there was no change in the potentiation by p300 (~2.6-fold in both CR2/3/4 and p30). Removal of CR3 resulted in a further decrease in basal transcription and the loss of coactivation by p300 (Fig. 6A, p30 versus CR4). These results suggest that CR3 is a region within the C/EBPalpha transactivation domain which interacts with p300. However, when a construct containing only CR1 and CR2 (Fig. 6B, CR1/2) was assayed, p300 cotransfection potentiated the transcriptional activity, indicating that CR3 is able to interact functionally with p300 but is not required for p300 interaction with C/EBPalpha . Based upon the observation that the deletion of CR1 had a minimal effect on coactivation by p300 (Fig. 6A, CR2/3/4), we suspected that CR2 was also able to interact functionally with p300. Consistent with this hypothesis, a C/EBPalpha construct lacking both CR2 and CR3 (Fig. 6B, CR1/4) was not coactivated by p300. Furthermore, deletion of all of the conserved regions in the C/EBPalpha transactivation domain except CR2 (Fig. 6B, CR2) revealed that like CR3 (data not shown), CR2 alone can be coactivated by p300. Thus it appears that multiple regions of the C/EBPalpha transactivation domain interact functionally with p300.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 6.   p300 functionally interacts with multiple regions of the C/EBPalpha transactivation domain. A, amino-terminal truncations of C/EBPalpha and the conserved regions of the transactivation domain are shaded (top). 293T cells were transfected with ob-luc and 50 ng of expression vector encoding p42, CR2/3/4, p30, CR4, or bZIP with (+) or without (-) p300 expression vector (500 ng). Results are normalized to the expression of CMV-beta Gal and are the mean luciferase activity ± S.D. (n = 3) relative to ob-luc transfected alone (bottom). Expression levels of the various mutants were similar to that of p42 and were not altered with p300 cotransfection (data not shown). Data for control, p42, p30, and bZIP isoforms were obtained in parallel, whereas data used for CR2/3/4 and CR4 were from separate experiments where a p42-positive control was assayed in parallel, and the basal transactivation and p300 potentiation were similar to that displayed. B, schematic diagram of C/EBPalpha conserved region deletion mutants (top). An experiment similar to that in panel A was performed using expression vectors for p42, CR1/2, CR1/4, CR2/4, CR2, and CR1/3/4 isoforms of C/EBPalpha (bottom). Data for control, p42, CR1/4, and CR2/4 were obtained from assays performed in parallel. Data for CR1/2, CR2, and CR1/3/4 are from independent experiments where a p42-positive control was assayed in parallel, and the basal transactivation and p300 potentiation were similar to that displayed. All reporter gene results are representative of at least three independent experiments.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In this study we find that multiple conserved regions of the C/EBPalpha transactivation domain are able to stimulate adipogenesis and interact functionally with p300. C/EBPalpha , beta , and delta  are related transcription factors in the C/EBP family of genes which play a role in adipogenesis (for review, see Ref. 7). These proteins display a high degree of homology between their bZIP domains (93% homology between C/EBPalpha and C/EBPbeta ) and recognize the same consensus DNA binding site (46). However, their sequences diverge markedly within the transactivation domain. Work by Elberg et al. (47) demonstrated the important role of the transactivation domain by showing that despite the similarities in the DNA binding domains, C/EBPbeta homodimers are unable to bind to and activate the PPARgamma 2 promoter. C/EBPalpha is able both to bind and transactivate the PPARgamma 2 promoter. These investigators found that fusing the C/EBPalpha transactivation domain to the C/EBPbeta bZIP allows transactivation, whereas fusing the C/EBPbeta transactivation domain to the C/EBPalpha bZIP blocks transactivation (47). Furthermore, because of the use of alternative translation start sites (32, 48), C/EBPalpha (p42/p30) and C/EBPbeta (LAP/LIP) have isoforms that vary in the composition of their transactivation domain. The ratio of expression between these isoforms is critical for normal 3T3-L1 differentiation (49), again implicating the C/EBPalpha transactivation domain as a key component in understanding the control of adipogenesis. In our study, we have identified highly conserved regions of the C/EBPalpha transactivation domain which mediate C/EBPalpha -induced differentiation of 3T3-L1 preadipocytes. Of the four conserved regions in the transactivation domain, CR2 is the only region capable of inducing spontaneous differentiation alone when fused to the C/EBPalpha bZIP (Fig. 1). Although CR1 and CR3 are incapable of inducing spontaneous differentiation when placed individually next to the bZIP, a construct containing both regions but lacking CR2 (CR1/3/4) promotes cytoplasmic lipid accumulation and the expression of adipocyte markers.

The ability of CR2 to act as a strong activation domain and induce differentiation independent of the other conserved regions may be the result of its ability to interact with multiple coactivators and components of the basal transcription apparatus. The retinoblastoma protein (pRb) has been shown to coactivate C/EBPalpha transcription (50) and is thought to interact with a site within CR2 (51). Furthermore, TBP and transcription factor IIB (TFIIB) have been shown to interact within the CR2 region of C/EBPalpha (52) to promote C/EBPalpha -mediated transcription. The coactivator p300 is also able to potentiate C/EBPalpha transactivation (Fig. 2 and Ref. 43); and based upon our results, this is mediated, in part, by functional interaction with CR2 (Fig. 6B). Spontaneous adipogenesis induced by CR1/3/4 (Fig. 1), which lacks the putative pRb interaction site (51), suggests that C/EBPalpha can induce differentiation in 3T3-L1 preadipocytes independent of pRb. This is in contrast with the observation that C/EBPalpha fails to induce differentiation of pRb-/- 3T3 fibroblasts (50). The conflicting observations may be the result of differences in the cell models or the presence of a previously unpredicted pRb-interacting region within the C/EBPalpha transactivation domain.

We show that p300, in addition to interacting functionally with CR2, is able to interact with CR3 (p30). This interaction of p300 with multiple regions has been shown for a number of transcription (53, 54). Attempts to identify regions of physical interaction between C/EBPalpha and p300, utilizing a variety of techniques (glutathione S-transferase affinity precipitation, coimmunoprecipitation and electrophoretic mobility shift assays), by ourselves and others2 have been unsuccessful. It may be that p300 does not interact directly with C/EBPalpha but is a limiting component in a higher order complex that must form to allow C/EBPalpha transactivation. An alternative hypothesis is that interactions between C/EBPalpha and nuclear factors, like p300, are very low affinity interactions and are disrupted using standard techniques to demonstrate physical interactions. This is consistent with the measures taken to demonstrate C/EBPalpha interaction with TBP and TFIIB (52). Interaction between C/EBPalpha and both of these proteins was demonstrated in vitro using glutathione S-transferase affinity precipitation, but TFIIB could not be coimmunoprecipitated with C/EBPalpha , whereas TBP could only be coimmunoprecipitated under very low stringency conditions (52). We report in a separate manuscript3 that a blue fluorescent protein (BFP)-C/EBPalpha fusion protein localizes to punctate regions within the nucleus when transfected into GHFT1-5 pituitary progenitor cells or 3T3-L1 preadipocytes. This is similar to the pattern exhibited by endogenous C/EBPalpha when localized using immunofluorescence (55). In contrast, green fluorescent protein (GFP)-CREB-binding protein (CBP), a functional homolog of p300, is expressed diffusely within the nucleus. When BFP-C/EBPalpha and GFP-CBP are cotransfected, GFP-CBP is recruited to discreet regions of the nucleus occupied by BFP-C/EBPalpha . This study suggests that p300 and C/EBPalpha interact with one another within the cell. This observation in combination with those presented in our study indicates that p300 is acting as a component of the C/EBPalpha transcriptional machinery and suggests that p300 plays a role in mediating the effects of C/EBPalpha on adipogenesis.

    ACKNOWLEDGEMENTS

We thank Drs. G. Hammer and J. Schwartz for a critical review of this manuscript and members of the MacDougald laboratory for comments. We also acknowledge Drs. F. Schaufele and M. Lazar for advice on protein-protein interaction studies.

    FOOTNOTES

* This work was supported by Natural Sciences and Engineering Research Council of Canada predoctoral fellowships (to R. L. E. and S. E. R.) and by a grant from the American Diabetes Association and National Institutes of Health Grant DK51563 (to O. A. M.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Dept. of Physiology, 7744 Medical Science Bldg. II, 1301 E. Catherine, Ann Arbor, MI 48109-0622. Tel.: 734-647-7721; Fax: 734-936-8813; E-mail: macdouga@umich.edu.

Published, JBC Papers in Press, February 8, 2001, DOI 10.1074/jbc.M1001282200

2 F. Schaufele, personal communication.

3 F. Schaufele, J. F. Enwright III, X. Wang, C. Teoh, R. L. Erickson, O. A. MacDougald, and R.N. Day, manuscript in preparation.

    ABBREVIATIONS

The abbreviations used are: C/EBP, CCAAT/enhancer binding protein; PPAR, peroxisome proliferator-activated receptor; bZIP, basis region/leucine zipper; CR, conserved region(s); CMV, cytomegalovirus; beta Gal, beta -galactosidase; pRb, retinoblastoma protein; BFP, blue fluorescent protein; GFP, green fluorescent protein; CREB, cAMP response element-binding protein; CBP, CREB-binding protein; TBP, TATA-binding protein.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Lin, Y., Lee, H., Berg, A. H., Lisanti, M. P., Shapiro, L., and Scherer, P. E. (2000) J. Biol. Chem. 275, 24255-24263
2. MacDougald, O. A., Hwang, C.-S., Fan, H., and Lane, M. D. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 9034-9037
3. Morrison, R. F., and Farmer, S. R. (1999) J. Cell. Biochem. 32-33, 59-67
4. Pond, C. M., and Mattacks, C. A. (1998) Immunol. Lett. 63, 159-167
5. Wickelgren, I. (1998) Science 280, 1364-1367
6. Reitman, M. L., Arioglu, E., Gavrilova, O., and Taylor, S. I. (2000) Trends Endocrinol. Metab. 11, 410-416
7. Darlington, G. J., Ross, S. E., and MacDougald, O. A. (1998) J. Biol. Chem. 273, 30057-30060
8. Rangwala, S. M., and Lazar, M. A. (2000) Annu. Rev. Nutr. 20, 535-559
9. Rosen, E. D., Walkey, C. J., Puigserver, P., and Spiegelman, B. M. (2000) Genes Dev. 14, 1293-1307
10. Hu, E., Kim, J. B., Sarraf, P., and Spiegelman, B. M. (1996) Science 274, 2100-2103
11. Reginato, M. J., Krakow, S. L., Bailey, S. T., and Lazar, M. A. (1998) J. Biol. Chem. 273, 1855-1858
12. Shao, D., Rangwala, S. M., Bailey, S. T., Krakow, S. L., Reginato, M. J., and Lazar, M. A. (1998) Nature 396, 377-380
13. Zhang, B., Berger, J., Zhou, G., Elbrecht, A., Biswas, S., White-Carrington, S., Szalkowski, D., and Moller, D. E. (1996) J. Biol. Chem. 271, 31771-31774
14. Wang, N. D., Finegold, M. J., Bradley, A., Ou, C. N., Abdelsayed, S. V., Wilde, M. D., Taylor, L. R., Wilson, D. R., and Darlington, G. J. (1995) Science 269, 1108-1112
15. Green, H., and Kehinde, O. (1979) J. Cell Physiol. 101, 169-172
16. Green, H., and Kehinde, O. (1975) Cell 5, 19-27
17. Green, H., and Meuth, M. (1974) Cell 3, 127-133
18. Lin, F.-T., and Lane, M. D. (1992) Genes Dev. 6, 533-544
19. Freytag, S. O., Paielli, D. L., and Gilbert, J. D. (1994) Genes Dev. 8, 1654-1663
20. Lin, F.-T., and Lane, M. D. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 8757-8761
21. Ross, S. E., Hemati, N., Longo, K. A., Bennett, C. N., Lucas, P. C., Erickson, R. L., and MacDougald, O. A. (2000) Science 289, 950-953
22. Landschulz, W. H., Johnson, P. F., and McKnight, S. L. (1989) Science 243, 1681-1688
23. Landschulz, W. H., Johnson, P. F., and McKnight, S. L. (1988) Science 240, 1759-1764
24. Williams, S. C., Angerer, N. D., and Johnson, P. F. (1997) Gene Expr. 6, 371-385
25. MacDougald, O. A., Cornelius, P., Liu, R., and Lane, M. D. (1995) J. Biol. Chem. 270, 647-654
26. Hemati, N., Ross, S. E., Erickson, R. L., Groblewski, G. E., and MacDougald, O. A. (1997) J. Biol. Chem. 272, 25913-25919
27. Ross, S. E., Erickson, R. L., Hemati, N., and MacDougald, O. A. (1999) Mol. Cell. Biol. 19, 8433-8441
28. Pei, D., and Shih, C. (1991) Mol. Cell. Biol. 11, 1480-1487
29. Friedman, A. D., and McKnight, S. L. (1990) Genes Dev. 4, 1416-1426
30. Nerlov, C., and Ziff, E. B. (1994) Genes Dev. 8, 350-362
31. Erickson, R. L., Longo, K. A., Ross, S. E., Hemati, N., and MacDougald, O. A. (1999) in Adipocyte Biology and Hormone Signaling (Ntambi, J., ed) , pp. 79-90, IOS Press, Amsterdam
32. Lin, F.-T., MacDougald, O. A., Diehl, A. M., and Lane, M. D. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 9606-9610
33. Christy, R. J., Kaestner, K. H., Geiman, D. E., and Lane, M. D. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 2593-2597
34. Miller, A. D., and Rosman, G. J. (1989) BioTechniques 7, 980-990
35. Sadowski, I., and Ptashne, M. (1989) Nucleic Acids Res. 17, 7539
36. Hwang, C.-S., Mandrup, S., MacDougald, O. A., Geiman, D. E., and Lane, M. D. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 873-877
37. Clarke, S. L., Robinson, C. E., and Gimble, J. M. (1997) Biochem. Biophys. Res. Commun. 240, 99-103
38. Lundblad, J. R., Kwok, R. P. S., Laurance, M. E., Harter, M. L., and Goodman, R. H. (1995) Nature 374, 85-88
39. Brasier, A. R., and Fortin, J. J. (1995) in Current Protocols in Molecular Biology (Ausubel, F. M. , Brent, R. , Kingston, R. E. , Moore, D. D. , Seidman, J. G. , Smith, J. A. , and Struhl, K., eds), Vol. 1 , pp. 9.7.12-9.7.21, John Wiley & Sons, New York
40. Preece, A. (1972) A Manual for Histogic Technicians , Little Brown, Boston
41. Goodman, R. H., and Smolik, S. (2000) Genes Dev. 14, 1553-1577
42. Eckner, R., Ewen, M. E., Newsome, D., Gerdes, M., DeCaprio, J. A., Lawrence, J. B., and Livingston, D. M. (1994) Genes Dev. 8, 869-884
43. Mink, S., Haenig, B., and Klempnauer, K.-H. (1997) Mol. Cell. Biol. 17, 6609-6617
44. Puri, P. L., Avantaggiati, M. L., Balsano, C., Sang, N., Graessmann, A., Giordano, A., and Levrero, M. (1997) EMBO J. 16, 369-383
45. Wang, H. G., Rikitake, Y., Carter, M. C., Yaciuk, P., Abraham, S. E., Zerler, B., and Moran, E. (1993) J. Virol. 67, 476-488
46. Osada, S., Yamamoto, H., Nishihara, T., and Imagawa, M. (1996) J. Biol. Chem. 271, 3891-3896
47. Elberg, G., Gimble, J. M., and Tsai, S. Y. (2000) J. Biol. Chem. 275, 27815-27822
48. Descombes, P., and Schibler, U. (1991) Cell 67, 569-579
49. Calkhoven, C. F., Muller, C., and Leutz, A. (2000) Genes Dev. 14, 1920-1932
50. Classon, M., Kennedy, B. K., Mulloy, R., and Harlow, E. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 10826-10831
51. Chen, P.-L., Riley, D. J., Chen, Y., and Lee, W.-H. (1996) Genes Dev. 10, 2794-2804
52. Nerlov, C., and Ziff, E. B. (1995) EMBO J. 14, 4318-4328
53. Zhang, J. J., Vinkemeier, U., Gu, W., Chakravarti, D., Horvath, C. M., and Darnell, J. E., Jr. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 15092-15096
54. Zhong, H., Voll, R. E., and Ghosh, S. (1998) Mol. Cell 1, 661-671
55. Tang, Q. Q., and Lane, M. D. (1999) Genes Dev. 13, 2231-2241


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
K. R. Badri, Y. Zhou, U. Dhru, S. Aramgam, and L. Schuger
Effects of the SANT Domain of Tension-Induced/Inhibited Proteins (TIPs), Novel Partners of the Histone Acetyltransferase p300, on p300 Activity and TIP-6-Induced Adipogenesis
Mol. Cell. Biol., October 15, 2008; 28(20): 6358 - 6372.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Jin, N. J. Lanning, and C. Carter-Su
JAK2, But Not Src Family Kinases, Is Required for STAT, ERK, and Akt Signaling in Response to Growth Hormone in Preadipocytes and Hepatoma Cells
Mol. Endocrinol., August 1, 2008; 22(8): 1825 - 1841.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. C. Cha, N. R. Oak, S. Kang, T.-A. Tran, S. Kobayashi, S.-H. Chiang, D. G. Tenen, and O. A. MacDougald
Phosphorylation of CCAAT/Enhancer-binding Protein {alpha} Regulates GLUT4 Expression and Glucose Transport in Adipocytes
J. Biol. Chem., June 27, 2008; 283(26): 18002 - 18011.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
S. Iida, R. Watanabe-Fukunaga, S. Nagata, and R. Fukunaga
Essential role of C/EBPalpha in G-CSF-induced transcriptional activation and chromatin modification of myeloid-specific genes.
Genes Cells, April 1, 2008; 13(4): 313 - 327.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. Yamakawa, R. H. Whitson, S.-L. Li, and K. Itakura
Modulator Recognition Factor-2 Is Required for Adipogenesis in Mouse Embryo Fibroblasts and 3T3-L1 Cells
Mol. Endocrinol., February 1, 2008; 22(2): 441 - 453.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Geletu, M. Y. Balkhi, A. A. Peer Zada, M. Christopeit, J. A. Pulikkan, A. K. Trivedi, D. G. Tenen, and G. Behre
Target proteins of C/EBP{alpha}p30 in AML: C/EBP{alpha}p30 enhances sumoylation of C/EBP{alpha}p42 via up-regulation of Ubc9
Blood, November 1, 2007; 110(9): 3301 - 3309.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kang, C. N. Bennett, I. Gerin, L. A. Rapp, K. D. Hankenson, and O. A. MacDougald
Wnt Signaling Stimulates Osteoblastogenesis of Mesenchymal Precursors by Suppressing CCAAT/Enhancer-binding Protein {alpha} and Peroxisome Proliferator-activated Receptor {gamma}
J. Biol. Chem., May 11, 2007; 282(19): 14515 - 14524.
[Abstract] [Full Text] [PDF]