![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 19, 16411-16417, May 11, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, October 11, 2000, and in revised form, February 6, 2001
There is ample evidence that deregulation of
apoptosis results in the development, progression, and/or maintenance
of cancer. Since many apoptotic regulatory genes (e.g.
bcl-x) code for alternatively spliced protein variants with
opposing functions, the manipulation of alternative splicing presents a
unique way of regulating the apoptotic response. Here we have targeted
oligonucleotides antisense to the 5'-splice site of
bcl-xL, an anti-apoptotic gene that is
overexpressed in various cancers, and shifted the splicing pattern of
Bcl-x pre-mRNA from Bcl-xL to Bcl-xS, a
pro-apoptotic splice variant. This approach induced significant
apoptosis in PC-3 prostate cancer cells. In contrast, the same
oligonucleotide treatment elicited a much weaker apoptotic response in
MCF-7 breast cancer cells. Moreover, although the shift in Bcl-x
pre-mRNA splicing inhibited colony formation in both cell lines,
this effect was much less pronounced in MCF-7 cells. These differences
in responses to oligonucleotide treatment were analyzed in the context
of expression of Bcl-xL, Bcl-xS, and Bcl-2
proteins. The results indicate that despite the presence of Bcl-x
pre-mRNA in a number of cell types, the effects of modification of
its splicing by antisense oligonucleotides vary depending on the
expression profile of the treated cells.
Apoptosis, or programmed cell death, is a highly regulated process
controlled by numerous genes that determine a proper response to death
signals (1-4); the relative levels of expression of pro- and
anti-apoptotic genes appear to be particularly important (5-9).
Deregulation of apoptosis, which contributes to the development, progression, and/or maintenance of cancer (3, 4, 10), is frequently
caused by mechanisms that alter splicing of regulatory genes (11, 12).
Therefore, this work focused on the modification of alternative
splicing of bcl-x, a member of the bcl-2 family of apoptotic genes that play crucial roles in both inhibiting and
activating the apoptotic response to cellular insults (1, 2). Bcl-x is
alternatively spliced to produce two distinct mRNAs and two variant
proteins, Bcl-xL and Bcl-xS, that have
antagonistic functions; the longer, 241-amino acid protein
(Bcl-xL) inhibits apoptosis, whereas the shorter,
178-amino acid protein (Bcl-xS) activates it (13).
Bcl-xL is highly expressed in many types of cancers,
including multiple myeloma (14), small cell lung carcinoma (15), and
breast cancer (16). High Bcl-xL expression levels have been associated with an increased risk of metastasis in breast cancer (16)
as well as with an increased resistance to apoptosis induced by
methotrexate and 5-fluorouracil (17) and etoposide and cisplatin (18). Additionally, an immunohistochemical study (19) showed that
Bcl-x, presumably Bcl-xL, was expressed in 100% of
prostate tumors and that its immunointensity was stronger in higher
grade metastases.
Bcl-xS antagonizes the pro-survival properties of
Bcl-xL (13, 20) and appears to induce apoptosis. For
example, high levels of Bcl-xS induced apoptosis in cancer
cells from patients with colon and stomach cancers (21) as well as in
human mammary tumors in nude mice (22). However, overexpression of
Bcl-xS did not cause apoptosis in an established breast
cancer cell line; the latter cells became apoptotic only after
additional treatment with the chemotherapeutic agents Taxol and
etoposide (23).
Work from this laboratory showed that antisense oligonucleotides could
be used to modify the splicing patterns of various genes in cell
culture (24-27). We therefore hypothesized that blocking the
alternative 5'-splice site in intron 2 of Bcl-x with an antisense oligonucleotide should shift splicing from Bcl-xL to
Bcl-xS mRNA, thereby increasing the level of
pro-apoptotic Bcl-xS protein and decreasing the level of
its anti-apoptotic isoform, Bcl-xL. We show here that this
shift in splicing could indeed be accomplished and that it induced
apoptotic markers in the prostate cancer cell line PC-3. However, in
the breast cancer cell line MCF-7, shifting splicing from
Bcl-xL to Bcl-xS and induction of apoptosis
were much less efficient. Differences in the responses to
oligonucleotide treatment were also evident in the inhibition of cell
growth of the two cell lines.
Cells--
PC-3 cells were cultured in Dulbecco's modified
Eagle's medium/nutrient mixture F-12 supplemented with 10% fetal calf
serum. MCF-7 cells were cultured in modified essential medium
supplemented with 10% fetal calf serum, 1× sodium pyruvate (Life
Technologies, Inc.), 1× nonessential amino acids (Sigma), and 10 µg/ml insulin. Twenty-four hours prior to oligonucleotide treatment,
the cells were plated in 2 ml of medium in 6-well plates at a density
of 2 × 105 cells/well. For experiments requiring
estrogen-free medium, MCF-7 cells were cultured in phenol red-free
medium containing 10% (4 days) and then 3% (3 days) charcoal-stripped
fetal calf serum (Hyclone Laboratories, Logan, UT) (28, 29).
Oligonucleotide Treatment--
2'-O-Methyl-modified
oligoribonucleoside phosphorothioate 18-mers antisense to the 5'-splice
site of Bcl-xL (5'-Bcl-x AS, ACCCAGCCGCCGUUCUCC) and to the
3'-splice site of exon III in Bcl-x pre-mRNA (3'-Bcl-x AS,
GUUCCACAAAAGUAUCCU) were used. Oligonucleotides with randomized and
anti- RNA Isolation and Reverse Transcription-Polymerase Chain
Reaction
(RT-PCR)1--
Oligonucleotide-treated
cells were lysed in 1 ml of TRI-reagent (Molecular Research Center,
Inc., Cincinnati, OH), and total RNA was isolated. RNA (200 ng)
was used in RT-PCR with rTth enzyme (PerkinElmer Life Sciences) in the
presence of 0.2 µCi of [ Protein Analysis--
Transfected cells were harvested at the
indicated time points in radioimmune precipitation assay buffer (50 mM Tris-HCl, 150 mM NaCl, 5 mM
EDTA, 1% Triton X-100, 0.1% SDS, and 1% sodium deoxycholate) and a
mixture of protease inhibitors (Sigma). Total protein (100 µg for
Bcl-xS, 10 µg for Bcl-xL and Bcl-2, and 75 µg for PARP) from the cells was electrophoresed on a 15% (for Bcl-2,
Bcl-xL, and Bcl-xS) or 8% (for PARP)
SDS-polyacrylamide gel and electrotransferred to polyvinylidene
difluoride membranes. Equal gel loading and transfer of protein were
confirmed by staining the membranes with Ponceau S. Membranes were
blocked for 1 h with BLOTTO (5% nonfat powdered milk in
Tris-buffered saline/Tween) and incubated for 1 h at room
temperature with rabbit anti-Bcl-xL polyclonal antibody (1:1000 dilution; Transduction Laboratories, Lexington, KY),
mouse anti-Bcl-2 monoclonal antibody (1:250 dilution; Transduction
Laboratories), or rabbit anti-PARP polyclonal antibody (1:1000
dilution; Cell Signaling Technology, Beverly, MA), followed by 1 h
of incubation with horseradish peroxidase-conjugated anti-rabbit
(1:5000 dilution; Bio-Rad) or anti-mouse (1:1000 dilution; Amersham
Pharmacia Biotech) secondary antibodies. Blots were developed with ECL
Plus reagents (Amersham Pharmacia Biotech) and exposed to Kodak film.
Bcl-xL, Bcl-xS, Bcl-2, and cleaved PARP
proteins migrated at ~30, 21, 26, and 89 kDa, respectively. The
densities of the resulting bands were quantified using NIH IMAGE
Version 1.61 software.
Fluorescence-activated Cell Sorting (FACS) Analysis--
At the
indicated times after oligonucleotide treatment, cells were resuspended
by trypsinization, and aliquots were removed for RT-PCR analysis (see
above) and for colony formation assays (see below). The remaining cells
were washed twice with cold 1× phosphate-buffered saline, fixed in
cold 70% ethanol, and stored at Colony Formation Assay--
Aliquots of trypsinized cell
suspensions were seeded on 100-mm plates at 5 × 102
for PC-3 cells and 1 × 103 for MCF-7 cells. After 10 days under normal culture conditions, cells were stained with 5%
methylene blue (Sigma) in 50% ethanol for 10 min. Colonies of >50
cells were counted.
Statistical Analysis--
Numerical data were analyzed by
one-way analysis of variance and post hoc
Student-Neuman-Keuls tests using the statistical software
program STATVIEW. The significance level for all analyses was 5%.
Shift in Splicing from Bcl-xL to Bcl-xS in
Oligonucleotide-treated PC-3 Cells--
PC-3 cells were treated with
increasing amounts of 5'-Bcl-x AS, a 2'-O-methyl-modified
oligoribonucleoside phosphorothioate 18-mer targeted to the downstream
alternative 5'-splice site in Bcl-x pre-mRNA. Splicing at this site
led to Bcl-xL mRNA and protein; alternative splicing at
the upstream site resulted in the Bcl-xS splice variant
(Fig. 1). The
2'-O-methyl-modified oligonucleotide was chosen because it
is resistant to nucleases, does not induce degradation of RNA in the
RNA-oligonucleotide hybrid by RNase H (33), and binds to the target
sequence with high Tm (34). These properties predict
that the oligonucleotide should block the targeted splice site and
induce a shift in the splicing pathways from Bcl-xL to
Bcl-xS mRNA.
RT-PCR analysis (see "Experimental Procedures") of total cell RNA
24 h post-treatment showed that 5'-Bcl-x AS treatment led to a
dose-dependent shift in splicing from the
Bcl-xL to Bcl-xS pathway as indicated by a
shift in the ratios of the respective mRNAs (Fig.
2A, upper panel,
lanes 2-7). At the highest concentrations of the 5'-Bcl-x
AS oligonucleotide, the level of Bcl-xS reached ~65% of
the total amount of Bcl-xS and Bcl-xL isoforms
(Fig. 2A, lower panel, lane 7).
There was no shift in Bcl-x pre-mRNA splicing in cells treated with
an oligonucleotide with a randomized sequence (Fig. 2A,
lanes 8-11). After a single treatment of PC-3 cells with
0.08 µM 5'-Bcl-x AS oligonucleotide, a maximal shift in
splicing occurred at 12 h post-treatment and persisted, with a
slight decrease, for at least 72 h (Fig. 2B,
lanes 3-6). This decrease was presumably due to dilution of
the oligonucleotide and/or instability of the oligonucleotide and
Bcl-xS mRNA in dividing cells. As expected, despite
prolonged culture of the cells, the randomized oligonucleotide had no
effect on the Bcl-xL/Bcl-xS mRNA ratio
(Fig. 2B, lanes 7-11).
Since a shift in the splicing pattern of Bcl-x pre-mRNA from
Bcl-xL to Bcl-xS should change the
Bcl-xL/Bcl-xS protein ratio, we analyzed total
protein from the PC-3 cell line by immunoblotting and probing with an
antibody expected to detect both splice variants of the Bcl-x protein.
This analysis showed a time-dependent decrease in
Bcl-xL protein (Fig. 3,
upper panel, lanes 2-5) and an increase in
Bcl-xS protein (lower panel, lanes
2-5) in cells treated with 0.08 µM 5'-Bcl-x AS
oligonucleotide, but not in cells treated with the randomized
oligonucleotide (lower panel, lanes 6-9).
Apoptosis and Death of PC-3 Cells Caused by a Shift in Splicing
from Bcl-xL to Bcl-xS--
To determine
whether increasing the levels of Bcl-xS protein increased
apoptosis of 5'-Bcl-x AS oligonucleotide-treated PC-3 cells, the cells
were analyzed by FACS for two measures of apoptosis: subdiploid DNA and
loss of cell volume. As illustrated in Fig. 4A, the population of cells
that had degraded their DNA (shown in green in the
left panels and to the left of the bars in the right panels) also exhibited a decreased cell size
(lower left corners in the left panels).
Quantitation of the results of multiple experiments showed that
treatment with 0.01, 0.03, and 0.08 µM 5'-Bcl-x AS
oligonucleotide resulted in 6.4, 11.2, and 19.8% of the PC-3 cells,
respectively, exhibiting subdiploid DNA (Fig. 4B); the
latter result was statistically significant (p < 0.0001, analysis of variance and Student-Neuman-Keuls tests) in
comparison with mock-treated cells (4.4%) or with cells transfected
with 0.8 µM randomized oligonucleotide (5.0%).
Similarly, treatment with the 5'-Bcl-x AS oligonucleotide resulted in a
dose-dependent loss of cell volume; at 0.08 µM 5'-Bcl-x AS, the effect (20.3%) was statistically
significant (p < 0.0001) relative to either mock-treated (5.2%) or randomized oligonucleotide-treated (6.0%) cells (data not shown). Thus, by two different criteria and
consistent with the RT-PCR and immunoblot results, the shift in
splicing of Bcl-x pre-mRNA from Bcl-xL to
Bcl-xS led to a dose-dependent increase in
apoptosis of PC-3 cells.
The ultimate goal of shifting splicing from the Bcl-xL to
Bcl-xS isoform is to induce cell death. Since it has been
argued that apoptotic markers, especially in cells with mutated p53, underestimate the killing potential of cytotoxic drugs (35), we have
analyzed the effects of 5'-Bcl-x AS treatment of PC-3 cells on cell
survival. The colony formation assay showed statistically significant
cell death at 0.01, 0.03, and 0.08 µM 5'-Bcl-x AS oligonucleotide compared with mock- or randomized
oligonucleotide-transfected cells (Fig. 4C). At these
oligonucleotide concentrations, the number of surviving cells was
reduced 2.0-, 2.6-, and 4.4-fold, respectively, relative to mock
treatment and 1.7-, 1.8-, and 3.8-fold relative to randomized
oligonucleotide treatment. Thus, the long-term effects of the treatment
were even more pronounced than those detected by the short-term assays
of apoptotic markers.
Inefficient Induction of Apoptosis by Down-regulation of
Bcl-xL Pre-mRNA in PC-3 Cells--
Shifting splicing
of Bcl-x pre-mRNA should presumably lead to a more efficient
induction of apoptosis than down-regulation of Bcl-xL
because the former approach leads to simultaneous down-regulation of
anti-apoptotic Bcl-xL and up-regulation of pro-apoptotic
Bcl-xS. To test this hypothesis, PC-3 cells were treated
with an oligonucleotide targeted to the 3'-splice site of exon III in
Bcl-x pre-mRNA (3'-Bcl-x AS; see Fig. 1). In contrast to 5'-Bcl-x
AS, this oligonucleotide should simultaneously decrease the level of
Bcl-xL and Bcl-xS proteins because the
3'-splice site is common to both Bcl-xL and Bcl-xS splice variants.
As predicted, at 0.08 µM, the 3'-Bcl-x AS oligonucleotide
led to a decrease in the levels of Bcl-xL protein (Fig.
5A, upper panel,
lane 2). The levels of Bcl-xS protein appeared
unaffected (Fig. 5A, lower panel, lane
2) and equal to that in mock-treated or control cells (lanes
1 and 4, respectively). In agreement with the results
shown in Fig. 3, 5'-Bcl-x AS decreased Bcl-xL levels (Fig.
5A, upper panel, lane 3), but
increased Bcl-xS protein levels (lower panel,
lane 3). FACS analysis of the oligonucleotide-treated cells showed that 3'-Bcl-x AS was approximately half as efficient as
5'-Bcl-x AS in inducing apoptosis (Fig. 5B). These results confirm that apoptosis of PC-3 cells is more efficiently induced by an
increase in Bcl-xS than by a decrease in
Bcl-xL, validating the approach of modification of splicing
of Bcl-x pre-mRNA.
Shift in Splicing from Bcl-xL to Bcl-xS in
MCF-7 Cells Leads to Cell Death with Minimal Induction of
Apoptosis--
Since Bcl-xL is overexpressed in
~40-60% of breast cancers (16), we also tested the 5'-Bcl-x AS
oligonucleotide against a breast cancer cell line, MCF-7. Similar to
PC-3 cells, treatment of MCF-7 cells with the oligonucleotide·DMRIE-C
Reagent complex resulted in a dose-dependent (Fig.
6, lanes 2-6) and
sequence-dependent (lanes 7-11) shift in
Bcl-x pre-mRNA splicing from the Bcl-xL to
Bcl-xS pathway; however, the effects were much less
pronounced. At 0.1 µM oligonucleotide, only 18% of
Bcl-xS was generated (compared with 62% in PC-3 cells),
and the maximal Bcl-xS level (54%) was reached at 1.0 µM oligonucleotide, i.e. at a concentration
almost 10 times higher than that needed for PC-3 cells. As a
consequence of the shift in splicing, the level of Bcl-xL
protein decreased, and that of Bcl-xS protein increased
(see Fig. 10, A and B, respectively, lane
5). The effects of the 5'-Bcl-x AS oligonucleotide persisted for
up to 72 h (data not shown).
In contrast to PC-3 cells, 5'-Bcl-x AS oligonucleotide-treated MCF-7
cells did not appear to undergo significant apoptosis. Approximately
3.6, 5.2, and 5.2% of the cells exhibited subdiploid DNA (Fig.
7, left three bars) and loss
of cell volume (data not shown) when mock-transfected or transfected
with the randomized oligonucleotide or with the 5'-Bcl-x AS
oligonucleotide, respectively. Interestingly, despite the lack of
apoptotic markers, the colony formation assay showed that the cells
transfected with the 5'-Bcl-x AS oligonucleotide formed ~2.7-fold
fewer colonies than the negative control cells (Fig.
8, left three bars).
Since the MCF-7 cells treated with 5'-Bcl-x AS alone did not exhibit
subdiploid DNA or loss of cell volume, we sought to determine if the
increased Bcl-xL/Bcl-xS isoform ratio generated
by the oligonucleotide treatment of the cells sensitized them to
apoptotic inducers such as thapsigargin. Thapsigargin is known to
induce apoptosis by depleting the intracellular calcium stores without increasing the influx of extracellular calcium (36). This mechanism was
shown to be inhibited by anti-apoptotic proteins such as Bcl-2 (37) and
Bcl-xL (38) and should be restored if the ratio of Bcl-xS to Bcl-xL and Bcl-2 were significantly increased.
Twenty-four hours after transfection with the oligonucleotide, the
cells were treated with 0.5 µM thapsigargin for 48 h. Relative to mock-transfected cells, 5'-Bcl-x AS combined with
thapsigargin treatment resulted in a statistically significant increase
in the percentage of cells with subdiploid DNA (p = 0.04) (Fig. 7, middle three bars) and loss of cell volume
(data not shown). There was no statistically significant difference
between cells treated with a randomized oligonucleotide plus
thapsigargin and with the 5'-Bcl-x AS oligonucleotide plus thapsigargin.
Despite the lack of induction of apoptotic markers in 5'-Bcl-x AS
oligonucleotide-treated cells, the survival of the MCF-7 cells treated
with the 5'-Bcl-x AS oligonucleotide alone was consistently reduced
(Fig. 8, left three bars). Interestingly, the additional treatment with thapsigargin had only a minor effect, if any, on cell
survival (Fig. 8, three right bars). The difference in cell death after treatment with Bcl-x AS alone or in combination with thapsigargin was not statistically significant.
The oligonucleotide-induced cell death without evidence of cell
apoptosis was intriguing, raising a possibility that the apoptosis assay based on DNA fragmentation may be inadequate in detecting apoptosis in the MCF-7 cell line. Therefore, we tested 5'-Bcl-x AS
oligonucleotide-treated PC-3 and MCF-7 cells for PARP cleavage (Fig.
9), another indicator of apoptosis.
Twenty-four hours after a single treatment with the 5'-Bcl-x AS
oligonucleotide (0.08 µM for PC-3 cells and 0.4 µM for MCF-7 cells), this assay detected maximal
apoptotic response of PC-3 cells, but virtually no apoptosis of MCF-7
cells. PARP cleavage did appear in MCF-7 cells at 48 h and reached
maximum levels at 72 h post-treatment. However, even at the
optimal time points, apoptosis of PC-3 cells was 3.5-fold higher than
that of MCF-7 cells.
Factors Affecting Apoptosis of MCF-7 Cells--
To gain some
insight into the mechanisms responsible for the differences in the
5'-Bcl-x AS effects on PC-3 and MCF-7 cells, we compared the two cell
lines for the levels of expression of Bcl-xL,
Bcl-xS, and Bcl-2 proteins. Fig.
10A shows that the level of
Bcl-xL in MCF-7 cells (lanes 4-6) was markedly
lower than that in PC-3 cells (lanes 1-3). This suggests
that even if the same Bcl-xL/Bcl-xS mRNA
ratio is induced by the oligonucleotide in the two cell lines, the
absolute amount of generated Bcl-xS protein will be lower
in MCF-7 cells. Fig. 10B (lane 5 versus
2) illustrates this for treatment of PC-3 and MCF-7 cells
with 0.08 and 0.4 µM 5'-Bcl-x AS, respectively. This
treatment resulted in similar ratios of the splice variant mRNAs
(data not shown). Note that the low level of Bcl-xS protein
in oligonucleotide-treated MCF-7 cells will also result in a low ratio
of this protein to other anti-apoptotic gene products.
Since a wide variety of human cancers express not only
Bcl-xL, but also Bcl-2, a potent anti-apoptotic protein
whose function is antagonized by Bcl-xS (13), the
expression of Bcl-2 was assayed in the two cell lines by immunoblotting
of total protein. Densitometry of the immunoblot shown in Fig.
10C and quantitation of the results indicated that, in MCF-7
cells, the concentration of Bcl-2 was ~1.7 times higher than that in
PC-3 cells (compare lanes 1-3 versus 4-6). As
expected, the level of Bcl-2 was not affected by treatment of the cells
with the 5'-Bcl-x AS or randomized oligonucleotide (Fig.
10C, lanes 2 and 5 and lanes
3 and 6, respectively).
We have cultured MCF-7 cells in charcoal-stripped medium, a procedure
shown to remove estrogen from the medium and, as a consequence, to
inhibit expression of Bcl-2 in these cells (28). Under these conditions, the cellular level of Bcl-2 in MCF-7 cells was reduced below the level detected in PC-3 cells (data not shown). However, the
treatment had no effect on apoptosis of 5'-Bcl-x AS
oligonucleotide-treated MCF-7 cells (Fig. 7, right three
bars). Thus, the contribution of Bcl-2 to the induction or the
lack of apoptosis in 5'-Bcl-x AS oligonucleotide-treated cells
remains unclear.
We have taken advantage of the fact that alternative splicing of
Bcl-x pre-mRNA yields two products with antagonistic functions and
used an oligonucleotide antisense to the 5'-splice site of Bcl-xL to shift splicing from the anti-apoptotic splice
variant, Bcl-xL, to the pro-apoptotic splice variant,
Bcl-xS. This approach should be superior to antisense
down-regulation of Bcl-xL mRNA (39, 40) since, by
definition, a decrease in Bcl-xL leads to a concomitant
increase in the concentration of the antagonistic Bcl-xS,
amplifying the biological effects of the treatment. In fact, an
oligonucleotide targeted to the 5'-splice site of Bcl-x pre-mRNA,
which led to an increase in the Bcl-xS splice variant and a
decrease in the Bcl-xL splice variant, was a better inducer of apoptosis in PC-3 cells than an oligonucleotide targeted to the
3'-splice site, which decreased the expression of the
Bcl-xL protein.
Treatment of PC-3 and MCF-7 cells with the 5'-Bcl-x AS oligonucleotide
led to a dose- and time-dependent shift in splicing of
Bcl-x pre-mRNA from the Bcl-xL to Bcl-xS
pathway and to a concomitant increase in the level of
Bcl-xS protein. However, even though most of the
Bcl-xL mRNA disappeared, the Bcl-xL protein
remained in the cells in apparent excess over the Bcl-xS
variant. There may be two reasons for this unexpected observation.
First, the anti-Bcl-x antibodies may preferentially recognize the
longer Bcl-xL polypeptide and under-represent the
Bcl-xS splice variant. This possibility seems likely since
several anti-Bcl-x antibodies from different manufacturers failed to
detect the Bcl-xS polypeptide altogether. Second, the
Bcl-xL protein may be very stable, persisting in the cells
at high concentrations even though its de novo translation was markedly reduced. The latter interpretation suggests that, especially in PC-3 cells, Bcl-xS has
trans-dominant properties, promoting apoptosis and/or cell
death despite the existing excess of anti-apoptotic Bcl-xL.
Since Bcl-xS binds to Bcl-xL and inhibits its
anti-apoptotic action (20), one has to conclude either that the binding
is not stoichiometric or that this is not the only mechanism
responsible for the pro-apoptotic properties of Bcl-xS (20).
It appears that the minimal apoptotic response of MCF-7 cells to
oligonucleotide treatment is mostly due to the low level of
Bcl-xS protein generated by the shift in the
Bcl-xL/Bcl-xS mRNA ratio. It follows that
the ratio of Bcl-xS protein to other apoptotic regulatory
proteins that may impact its function may also be lower. However, the
identity and nature of the genes that may be responsible for the
apoptotic resistance of MCF-7 cells are not clear and require
additional studies.
For instance, a shift in alternative splicing of Bcl-x pre-mRNA was
also observed in another breast cancer cell line,
HS578T,2 and, while this work
was in progress, in a lung adenocarcinoma cell line, A549, treated with
2'-O-methoxyethoxy-modified oligoribonucleotides (41). Among
these cell lines, as well as the ones investigated here, the
p53 gene is mutated in PC-3 (42, 43) and HS578T (44) cells,
but not in A549 (41) or MCF-7 (44) cells, and Bcl-2 is low in PC-3
(Fig. 10C) (8), HS578T (44), and A549 (41) cells and high in
MCF-7 cells (Fig. 10C) (44). Yet treatment with 5'-Bcl-x AS
alone led to significant apoptosis only in PC-3 cells, whereas a
decrease in Bcl-2 in MCF-7 cells to levels below those in PC-3 cells
did not promote oligonucleotide-induced apoptosis. It appears that if
the p53 and bcl-2 genes do play a role in
modulating the function of the 5'-Bcl-x AS oligonucleotide, their
effects may depend on additional cellular background. In this regard, it is notable that Bcl-xL was found in 100% of prostate
adenocarcinomas, but Bcl-2 was found in only 25% (19). However, in
some breast carcinomas, as well as in some breast cancer cell lines,
the levels of Bcl-2 were higher than those of Bcl-xL
(45).
The different responses of PC-3 and MCF-7 cells to the shift in Bcl-x
pre-mRNA splicing are not limited to generation of subdiploid DNA,
but also to cleavage of PARP, a different apoptotic marker, and to cell
death assayed by colony formation. In this regard, 5'-Bcl-x AS promoted
cell death in both PC-3 and MCF-7 cell lines, further complicating the
interpretation of the results. Approximately 39% of MCF-7 cells and
24% of PC-3 cells survived the treatment with 5'-Bcl-x AS (0.4 µM oligonucleotide for MCF-7 cells and 0.08 µM for PC-3 cells) that resulted in a similar ratio of
Bcl-xL to Bcl-xS mRNA. Recalculation of the
data in terms of the effective concentration (EC50) of the
oligonucleotide yielded EC50 values of 0.32 and 0.05 µM for MCF-7 and PC-3 cells, respectively, a 6.5-fold
ratio. This difference is partly explained by reduced nuclear uptake of
the oligonucleotide in MCF-7 cells. In contrast to PC-3 cells, in which
fluorescent labeled oligonucleotide accumulated predominantly in the
nucleus, in MCF-7 cells, the large fraction of the compound remained
concentrated in cytoplasmic endosomal vesicles (data not shown), where
it was unable to affect splicing, a nuclear process (46).
The fact that cells differ in their response to a shift in the
Bcl-xL/Bcl-xS ratio may impart beneficial
specificity to the in vivo applications of the 5'-Bcl-x AS
oligonucleotide. That is, although Bcl-xL is expressed in a
number of cell types, including several hematopoietic cell lineages
(47), the apoptotic stimulus of the oligonucleotide may be effective
only in certain susceptible cells with a gene expression profile akin
to the prostate cancer PC-3 cell line. In addition, a combination of
the oligonucleotide with chemotherapeutic agents exemplified by
cisplatin in A549 cells (41) may sensitize only certain types of cells
to undergo apoptosis. An additional benefit of cellular sensitization
by the oligonucleotide may be a reduction in the dosage of
chemotherapeutic agents and hence in the overall toxicity of cancer treatment.
We thank Elizabeth Smith for excellent
technical assistance.
*
This work was supported in part by Grants PO1-59299 and
HL-51940-05 from the National Institutes of Health (to R. K.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence and reprint requests should be
addressed: Lineberger Comprehensive Cancer Center, CB 7295, University of North Carolina, Chapel Hill, NC 27599-7295. Tel.: 919-966-1143; Fax:
919-966-3015; E-mail: kole@med.unc.edu.
Published, JBC Papers in Press, February 7, 2001, DOI 10.1074/jbc.M009256200
2
D. R. Mercatante and R. Kole, unpublished data.
The abbreviations used are:
RT-PCR, reverse
transcription-polymerase chain reaction;
bp, base pair(s);
PARP, poly(ADP-ribose) polymerase;
FACS, fluorescence-activated
cell sorting.
Modification of Alternative Splicing of Bcl-x
Pre-mRNA in Prostate and Breast Cancer Cells
ANALYSIS OF APOPTOSIS AND CELL DEATH*
,
¶
Lineberger Comprehensive Cancer Center and
the Department of Pharmacology, University of North Carolina, Chapel
Hill, North Carolina 27599-7295 and the § Laboratory of
Signal Transduction, NIEHS, National Institutes of Health,
Research Triangle Park, North Carolina 27709
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-globin sequences (24) were used as negative controls. All
oligonucleotides were synthesized and purified by Hybridon, Inc.
(Milford, MA) and Trilink Biotechnologies, Inc. (San Diego, CA). The
cells were treated with oligonucleotide·DMRIE-C Reagent (8 µg/ml; Life Technologies, Inc.) cationic lipid complexes according to
the manufacturer's directions at the concentrations indicated on the
figures. Ten hours post-treatment, the medium was replaced with fresh
medium, and the cells were cultured for the indicated times.
Thapsigargin (0.5 µM final concentration; Sigma) was
added directly to the medium of MCF-7 cells 24 h
post-transfection.
-32P]dATP. Both procedures
followed the manufacturers' protocols. The reverse transcription
reaction was carried out at 70 °C for 15 min, followed by PCR: one
cycle of 95 °C for 3 min; 22 cycles of 95 °C for 30 s,
56 °C for 30 s, and 72 °C for 1 min; and a final extension
at 72 °C for 7 min. The forward and reverse primers used were
GCATTGTTCCCATAGAGTTCC and GCATTGTTCCCATAGAGTTCC, respectively. Under
these conditions, the linear concentration-dependent response of PCR was maintained (data not shown). The resulting products (Bcl-xL, 300 bp; and Bcl-xS, 162 bp) were
separated on 8% nondenaturing polyacrylamide gels, and the gels were
autoradiographed with Kodak BioMax film. All autoradiograms were
captured by a Dage-MTI CCD72 video camera, and the images were
processed using NIH IMAGE Version 1.61 software. NIH IMAGE was also
used to quantify the density of the bands. The percentage of
Bcl-xS in each lane was determined by dividing the
intensity of the 162-bp band (Bcl-xS) by the total intensities of the 300-bp (Bcl-xL) and 162-bp
(Bcl-xS) bands. The calculations reflect the fact that the
number of radioactive adenosine nucleotides in the Bcl-xL
band is 1.2 times higher than that in the Bcl-xS band.
Thus, the percent of correction is higher than appears from the autoradiograms.
20 °C for at least 24 h.
They were then washed with 1× phosphate-buffered saline and treated
with 20 µM propidium iodide and 1 mg/ml RNase A in 1×
phosphate-buffered saline for 30 min in the dark. Cells were analyzed
by flow cytometry using a Becton Dickinson FACSort for two measures of
apoptosis: subdiploid DNA and loss of cell volume (30-32).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (13K):
[in a new window]
Fig. 1.
Alternative splicing of Bcl-x
pre-mRNA. Use of the downstream or upstream alternative
5'-splice site within exon II yields the anti-apoptotic
Bcl-xL or pro-apoptotic Bcl-xS isoform,
respectively. The thin line indicates the Bcl-xL
splicing pathway, predominant in many cancer cells. The dotted
line indicates the splicing pathway for Bcl-xS
mRNA. Boxes, exons; thick lines, introns;
solid black boxes, the 189-nucleotide portion of exon II
included in Bcl-xL; thick bars below the
pre-mRNA, antisense oligonucleotides. The oligonucleotide antisense
to the 5'-splice site (5'-Bcl-x AS), but not that antisense to the
3'-splice site (3'-Bcl-x AS), of Bcl-x pre-mRNA induced a shift in
splicing from Bcl-xL to Bcl-xS.

View larger version (31K):
[in a new window]
Fig. 2.
Shift in splicing from Bcl-xL to
Bcl-xS by treatment of PC-3 cells with 5'-Bcl-x AS.
The results from the analysis of total cellular RNA by RT-PCR are
shown. A: upper panel, dose dependence of cells
treated for 24 h. Lane 1, mock-transfected cells;
lanes 2-7, cells transfected with 5'-Bcl-x AS; lanes
8-11, cells transfected with an oligonucleotide with randomized
sequence. The lengths of the PCR products (in base pairs) are indicated
to the right. Lower panel, quantitative analysis of the
results. Black bar, mock-transfected cells; gray
bars, 5'-Bcl-x AS oligonucleotide-transfected cells; white
bars, randomized oligonucleotide-treated cells. B:
upper panel, time course. Lane 1,
mock-transfected cells; lanes 2-6, RNA isolated
from 5'-Bcl-x AS oligonucleotide (0.08 µM)-transfected
cells 6, 12, 24, 48, and 72 h post-transfection, respectively;
lanes 7-11, cells transfected with the
randomized oligonucleotide (0.08 µM). Lower
panel, quantitation of the results. Designations are as the same
as described for A.

View larger version (35K):
[in a new window]
Fig. 3.
Western blot analysis of Bcl-x proteins from
PC-3 cells transfected with 0.08 µM
5'-Bcl-x AS. The times post-transfection are indicated above the
lanes. Upper panel, Bcl-xL protein; lower
panel, Bcl-xS protein. Lanes 2-5, cells
treated with 5'-Bcl-x AS; lanes 6-9, cells treated with the
randomized oligonucleotide. See "Experimental Procedures" for
details.

View larger version (22K):
[in a new window]
Fig. 4.
Apoptosis of PC-3 cells treated with 5'-Bcl-x
AS (0.08 µM) for 36 h.
A, FACS analysis plots. The left
panels show dot plots of forward scatter (cell size)
versus side scatter (cell granularity). Cells that have
degraded their DNA are shown in green and are smaller in
size. The right panels show the DNA histograms
(with subdiploid DNA to the left of the bars). B,
quantitation of subdiploid DNA. The asterisk indicates a
statistically significant difference from mock and randomized
oligonucleotide treatments (p < 0.0001; significance
level = 5%). Results are from at least three independent
experiments. Black bar, mock-transfected cells; gray
bars, 5'-Bcl-x AS oligonucleotide-transfected cells; white
bars, random oligonucleotide-transfected cells. C,
inhibition of colony formation in cells treated with the 5'-Bcl-x AS
oligonucleotide (p < 0.0001; significance level = 5%). The number of experiments and designations are the same as
described for B.

View larger version (25K):
[in a new window]
Fig. 5.
Inefficient induction of apoptosis in PC-3
cells by 3'-Bcl-x AS targeted to the 3'-splice site of Bcl-x
pre-mRNA. A, Western blot analysis of Bcl-x
proteins from PC-3 cells transfected for 36 h with 0.08 µM 3'- and 5'-Bcl-x AS oligonucleotides. Upper
panel, Bcl-xL protein; lower panel,
Bcl-xS protein. Lane 1, mock-transfected cells;
lane 2, 3'-Bcl-x AS oligonucleotide-treated cells;
lane 3, 5'-Bcl-x AS oligonucleotide-treated cells;
lane 4, randomized oligonucleotide (0.08 µM)-treated cells. B, FACS analysis of
subdiploid DNA in cells treated for 36 h with 3'- and 5'-Bcl-x AS
oligonucleotides. Gray bars, treatment with 5'-Bcl-x AS;
hatched bars, treatment with 3'-Bcl-x AS.

View larger version (36K):
[in a new window]
Fig. 6.
Shift in splicing from Bcl-xL to
Bcl-xS in MCF-7 cells treated with 5'-Bcl-x AS for 24 h. Upper panel, analysis of total RNA by RT-PCR.
Lane 1, mock-transfected cells; lanes 2-6,
5'-Bcl-x AS oligonucleotide-treated cells; lanes 7-11,
randomized oligonucleotide-treated cells. Lower panel,
quantitation of the results. Designations are the same as described in
the legend to Fig. 2A.

View larger version (15K):
[in a new window]
Fig. 7.
Apoptosis of MCF-7 cells treated with
5'-Bcl-x AS. Shown are the results from FACS analysis for
subdiploid DNA of MCF-7 cells transfected for 24 h with 0.4 µM 5'-Bcl-x AS, followed by a 48-h treatment with 0.5 µM thapsigargin (Thaps). Left three
bars, no thapsigargin (72 h post-transfection); middle three
bars, plus thapsigargin (48 h after thapsigargin treatment,
72 h post-transfection); right three bars, cells
cultured in the presence of charcoal-stripped serum (CS;
72 h post-transfection). See "Experimental Procedures" for
details. The asterisk indicates a significant difference from mock
transfections (p = 0.04; significance level = 5%). Black bars, mock-transfected cells; gray
bars, 5'-Bcl-x AS oligonucleotide-transfected cells; white
bars, randomized oligonucleotide-transfected cells.

View larger version (11K):
[in a new window]
Fig. 8.
Inhibition of colony formation in MCF-7 cells
treated with 5'-Bcl-x AS (0.4 µM)
as well as thapsigargin (5 µM for
48 h). Asterisks indicate significant difference
from mock- and randomized oligonucleotide-treated cells
(p = 0.0002; significance level = 5%).
Designations are the same as described in the legend to Fig. 7. Results
are from at least three independent experiments. Thaps,
thapsigargin.

View larger version (14K):
[in a new window]
Fig. 9.
PARP cleavage in PC-3 and MCF-7 cells treated
with 5'-Bcl-x AS. Total protein from 5'-Bcl-x AS
oligonucleotide-treated cells was analyzed by immunoblotting with
anti-PARP antibody. The protein samples were collected at 12, 24, and
48 h for PC-3 cells and at 24, 48, 72, and 120 h for MCF-7
cells after oligonucleotide treatment. Band intensities were
quantitated, and the results are expressed as the level of cleavage of
PARP above background generated by treatment with the randomized
oligonucleotide. Black bars, PC-3 cells (0.08 µM 5'-Bcl-x AS); white bars, MCF-7 cells (0.4 µM 5'-Bcl-x AS).

View larger version (51K):
[in a new window]
Fig. 10.
Expression of Bcl-xL,
Bcl-xS, and Bcl-2 proteins in PC-3 and MCF-7 cells.
Total protein from PC-3 and MCF-7 cells was analyzed by Western
blotting for Bcl-xL (A), Bcl-xS
(B), and Bcl-2 (C) proteins. Lanes
1-3, PC-3 cells subjected to mock, 5'-Bcl-x AS (0.08 µM, 36 h), and randomized oligonucleotide (0.08 µM, 36 h) treatment, respectively; lanes
4-6, analogous treatment (0.4 µM, 36 h) of
MCF-7 cells.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
ACKNOWLEDGEMENT
![]()
FOOTNOTES
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Adams, J. M.,
and Cory, S.
(1998)
Science
281,
1322-1326
2.
Antonsson, B.,
and Martinou, J. C.
(2000)
Exp. Cell Res.
256,
50-57
3.
Lowe, S. W.,
and Lin, A. W.
(2000)
Carcinogenesis
21,
485-495
4.
Reed, J. C.
(1999)
J. Clin. Oncol.
17,
2941-2953
5.
Shinoura, N.,
Yoshida, Y.,
Asai, A.,
Kirino, T.,
and Hamada, H.
(1999)
Oncogene
18,
5703-5713
6.
Kawakami, K.,
Tsukuda, M.,
Mizuno, H.,
Nishimura, G.,
Ishii, A.,
and Hamajima, K.
(1999)
Anticancer Research
19,
3927-3932
7.
Taylor, S. T.,
Hickman, J. A.,
and Dive, C.
(2000)
J. Natl. Cancer Inst.
92,
18-23
8.
Liu, Q. Y.,
and Stein, C. A.
(1997)
Clin. Cancer Res.
3,
2039-2046
9.
Han, J. S.,
Núñez, G.,
Wicha, M. S.,
and Clarke, M. F.
(1998)
Springer Semin. Immunopathol.
19,
279-288
10.
Wang, D. G.
(1999)
Clin. Endocrinol.
51,
1-9
11.
Mercatante, D.,
and Kole, R.
(2000)
Pharmacol. Ther.
85,
237-243
12.
Jiang, Z. H.,
and Wu, J. Y.
(1999)
Proc. Soc. Exp. Biol. Med.
220,
64-72
13.
Boise, L. H.,
González-García, M.,
Postema, C. E.,
Ding, L.,
Lindsten, T.,
Turka, L. A.,
Mao, X.,
Núñez, G.,
and Thompson, C. B.
(1993)
Cell
74,
597-608
14.
Tu, Y.,
Renner, S.,
Xu, F.,
Fleishman, A.,
Taylor, J.,
Weisz, J.,
Vescio, R.,
Rettig, M.,
Berenson, J.,
Krajewski, S.,
Reed, J. C.,
and Lichtenstein, A.
(1998)
Cancer Res.
58,
256-262
15.
Reeve, J. G.,
Xiong, J.,
Morgan, J.,
and Bleehen, N. M.
(1996)
Br. J Cancer
73,
1193-1200
16.
Olopade, O. I.,
Adeyanju, M. O.,
Safa, A. R.,
Hagos, F.,
Mick, R.,
Thompson, C. B.,
and Recant, W. M.
(1997)
Cancer J. Sci. Am.
3,
230-237
17.
Liu, R.,
Page, C.,
Beidler, D. R.,
Wicha, M. S.,
and Núñez, G.
(1999)
Am. J. Pathol.
155,
1861-1867
18.
Schmitt, E.,
Cimoli, G.,
Steyaert, A.,
and Bertrand, R.
(1998)
Exp. Cell Res.
240,
107-121
19.
Krajewska, M.,
Krajewski, S.,
Epstein, J. I.,
Shabaik, A.,
Sauvageot, J.,
Song, K.,
Kitada, S.,
and Reed, J. C.
(1996)
Am. J. Pathol.
148,
1567-1576
20.
Minn, A. J.,
Boise, L. H.,
and Thompson, C. B.
(1996)
J. Biol. Chem.
271,
6306-6312
21.
Clarke, M. F.,
Apel, I. J.,
Benedict, M. A.,
Eipers, P. G.,
Sumantran, V.,
González-García, M.,
Doedens, M.,
Fukunaga, N.,
Davidson, B.,
Dick, J. E.,
Minn, A. J.,
Boise, L. H.,
Thompson, C. B.,
Wicha, M.,
and Núñez, G.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
11024-11028
22.
Ealovega, M. W.,
McGinnis, P. K.,
Sumantran, V. N.,
Clarke, M. F.,
and Wicha, M. S.
(1996)
Cancer Res.
56,
1965-1969
23.
Sumantran, V. N.,
Ealovega, M. W.,
Núñez, G.,
Clarke, M. F.,
and Wicha, M. S.
(1995)
Cancer Res.
55,
2507-2510
24.
Sierakowska, H.,
Sambade, M. J.,
Agrawal, S.,
and Kole, R.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
12840-12844
25.
Sierakowska, H.,
Sambade, M. J.,
Schumperli, D.,
and Kole, R.
(1999)
RNA
5,
369-377
26.
Wilton, S. D.,
Lloyd, F.,
Carville, K.,
Fletcher, S.,
Honeyman, K.,
Agrawal, S.,
and Kole, R.
(1999)
Neuromuscul. Disorders
9,
330-338
27.
Friedman, K. J.,
Kole, J.,
Cohn, J. A.,
Knowles, M. R.,
Silverman, L. M.,
and Kole, R.
(1999)
J. Biol. Chem.
274,
36193-36199
28.
Teixeira, C.,
Reed, J. C.,
and Pratt, M. A. C.
(1995)
Cancer Res.
55,
3902-3907
29.
Philips, A.,
Chalbos, D.,
and Rochefort, H.
(1993)
J. Biol. Chem.
268,
14103-14108
30.
Cohen, J. J.
(1993)
Immunol. Today
14,
126-130
31.
Fiers, W.,
Beyaert, R.,
Declercq, W.,
and Vandenabeele, P.
(1999)
Oncogene
18,
7719-7730
32.
Wyllie, A. H.
(1980)
Nature
284,
555-556
33.
Sproat, B. S.,
and Lamond, A. I.
(1993)
in
Antisense Research and Applications
(Crooke, S. T.
, and Lebleu, B., eds)
, pp. 351-363, CRC Press, Inc., Boca Raton, FL
34.
Stein, D.,
Foster, E.,
Huang, S. B.,
Weller, D.,
and Summerton, J.
(1997)
Antisense Nucleic Acid Drug Dev.
7,
151-157
35.
Brown, J. M.,
and Wouters, B. G.
(1999)
Cancer Res.
59,
1391-1399
36.
Sergeev, I. N.,
and Rhoten, W. B.
(1998)
Endocrine
9,
321-327
37.
Qi, X. M.,
He, H.,
Zhong, H.,
and Distelhorst, C. W.
(1997)
Oncogene
15,
1207-1212
38.
Srivastava, R. K.,
Sollott, S. J.,
Khan, L.,
Hansford, R.,
Lakatta, E. G.,
and Longo, D. L.
(1999)
Mol. Cell. Biol.
19,
5659-5674
39.
Taylor, J. K.,
Zhang, Q. Q.,
Monia, B. P.,
Marcusson, E. G.,
and Dean, N. M.
(1999)
Oncogene
18,
4495-4504
40.
Leech, S. H.,
Olie, R. A.,
Gautschi, O.,
Simoes-Wust, A. P.,
Tschopp, S.,
Haner, R.,
Hall, J.,
Stahel, R. A.,
and Zangemeister-Wittke, U.
(2000)
Int. J. Cancer
86,
570-576
41.
Taylor, J. K.,
Zhang, Q. Q.,
Wyatt, J. R.,
and Dean, N. M.
(1999)
Nat. Biotechnol.
17,
1097-1100
42.
Carrol, A. G.,
Voeller, H. J.,
Sugars, L.,
and Gelmann, E. P.
(1993)
Prostate
23,
123-134
43.
Isaacs, W. B.,
Carter, B. S.,
and Ewing, C. M.
(1991)
Cancer Res.
51,
4716-4720
44.
Nieves-Neira, W.,
and Pommier, Y.
(1999)
Int. J. Cancer
82,
396-404
45.
Zapata, J. M.,
Krajewska, M.,
Krajewski, S.,
Huang, R. P.,
Takayama, S.,
Wang, H. G.,
Adamson, E.,
and Reed, J. C.
(1998)
Breast Cancer Res. Treat
47,
129-140
46.
Zelphati, O.,
and Szoka, F. C. J.
(1996)
Pharm. Res. (N. Y.)
13,
1367-1372
47.
Krajewski, S.,
Krajewska, M.,
Shabaik, A.,
Wang, H. G.,
Irie, S.,
Fong, L.,
and Reed, J. C.
(1994)
Cancer Res.
54,
5501-5507
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
Y. Hai, W. Cao, G. Liu, S.-P. Hong, S. A. Elela, R. Klinck, J. Chu, and J. Xie A G-tract element in apoptotic agents-induced alternative splicing Nucleic Acids Res., June 1, 2008; 36(10): 3320 - 3331. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Shkreta, U. Froehlich, E. R. Paquet, J. Toutant, S. A. Elela, and B. Chabot Anticancer drugs affect the alternative splicing of Bcl-x and other human apoptotic genes Mol. Cancer Ther., June 1, 2008; 7(6): 1398 - 1409. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kuraoka, S. Ito, T. Wada, M. Hayashida, L. Lee, M. Saijo, Y. Nakatsu, M. Matsumoto, T. Matsunaga, H. Handa, et al. Isolation of XAB2 Complex Involved in Pre-mRNA Splicing, Transcription, and Transcription-coupled Repair J. Biol. Chem., January 11, 2008; 283(2): 940 - 950. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Zhang, J. J. Peairs, P. Yang, J. Tyrrell, J. Roberts, R. Kole, and G. J. Jaffe The Importance of Bcl-xL in the Survival of Human RPE Cells Invest. Ophthalmol. Vis. Sci., August 1, 2007; 48(8): 3846 - 3853. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Frank, J. L. Bermejo, K. Hemminki, C. Sutter, B. Wappenschmidt, A. Meindl, M. Kiechle-Bahat, P. Bugert, R. K. Schmutzler, C. R. Bartram, et al. Copy number variant in the candidate tumor suppressor gene MTUS1 and familial breast cancer risk Carcinogenesis, July 1, 2007; 28(7): 1442 - 1445. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Du, J. M. Pollard, and R. A. Gatti Correction of prototypic ATM splicing mutations and aberrant ATM function with antisense morpholino oligonucleotides PNAS, April 3, 2007; 104(14): 6007 - 6012. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Hayes, P. E. Carrigan, and L. J. Miller Serine-Arginine Protein Kinase 1 Overexpression Is Associated with Tumorigenic Imbalance in Mitogen-Activated Protein Kinase Pathways in Breast, Colonic, and Pancreatic Carcinomas Cancer Res., March 1, 2007; 67(5): 2072 - 2080. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Jenkins, A. Swiatoniowski, M. R. Power, and T.-J. Lin Pseudomonas aeruginosa-Induced Human Mast Cell Apoptosis Is Associated with Up-Regulation of Endogenous Bcl-xS and Down-Regulation of Bcl-xL J. Immunol., December 1, 2006; 177(11): 8000 - 8007. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Massiello, J. R. Roesser, and C. E. Chalfant SAP155 Binds to ceramide-responsive RNA cis-element 1 and regulates the alternative 5' splice site selection of Bcl-x pre-mRNA FASEB J, August 1, 2006; 20(10): 1680 - 1682. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. O. Watermann, Y. Tang, A. zur Hausen, M. Jager, S. Stamm, and E. Stickeler Splicing Factor Tra2-{beta}1 Is Specifically Induced in Breast Cancer and Regulates Alternative Splicing of the CD44 Gene. Cancer Res., May 1, 2006; 66(9): 4774 - 4780. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Komuro, T. Yasuda, A. Iwamoto, and K. S. Akagawa Catalase Plays a Critical Role in the CSF-independent Survival of Human Macrophages via Regulation of the Expression of BCL-2 Family J. Biol. Chem., December 16, 2005; 280(50): 41137 - 41145. [Abstract] [Full Text] [PDF] |
||||