JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M008377200 on October 30, 2000

J. Biol. Chem., Vol. 276, Issue 2, 1138-1145, January 12, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/2/1138    most recent
M008377200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nguyên, D.-T.
Right arrow Articles by Raymond, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nguyên, D.-T.
Right arrow Articles by Raymond, M.

Multiple Yap1p-binding Sites Mediate Induction of the Yeast Major Facilitator FLR1 Gene in Response to Drugs, Oxidants, and Alkylating Agents*

Duc-Thang Nguyên, Anne-Marie Alarco, and Martine RaymondDagger

From the Institut de Recherches Cliniques de Montréal, Montréal, Québec, H2W 1R7, Canada

Received for publication, September 13, 2000, and in revised form, October 24, 2000



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The bZip transcription factor Yap1p plays an important role in oxidative stress response and multidrug resistance in Saccharomyces cerevisiae. We have previously demonstrated that the FLR1 gene, encoding a multidrug transporter of the major facilitator superfamily, is a transcriptional target of Yap1p. The FLR1 promoter contains three potential Yap1p response elements (YREs) at positions -148 (YRE1), -167 (YRE2), and -364 (YRE3). To address the function of these YREs, the three sites have been individually mutated and tested in transactivation assays. Our results show that (i) each of the three YREs is functional and important for the optimal transactivation of FLR1 by Yap1p and that (ii) the three YREs are not functionally equivalent, mutation of YRE3 being the most deleterious, followed by YRE2 and YRE1. Simultaneous mutation of the three YREs abolished transactivation of the promoter by Yap1p, demonstrating that the three sites are essential for the regulation of FLR1 by Yap1p. Gel retardation assays confirmed that Yap1p differentially binds to the three YREs (YRE3 > YRE2 > YRE1). We show that the transcription of FLR1 is induced upon cell treatment with the oxidizing agents diamide, diethylmaleate, hydrogen peroxide, and tert-butyl hydroperoxide, the antimitotic drug benomyl, and the alkylating agent methylmethane sulfonate and that this induction is mediated by Yap1p through the three YREs. Finally, we show that FLR1 overexpression confers resistance to diamide, diethylmaleate, and menadione but hypersensitivity to H2O2, demonstrating that the Flr1p transporter participates in Yap1p-mediated oxidative stress response in S. cerevisiae.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The Saccharomyces cerevisiae transcription factor Yap1p plays an important role in oxidative stress response and multidrug resistance (MDR)1 by activating target genes involved in cellular detoxification (1-3). Yap1p belongs to the bZip (basic domain/leucine zipper) family of transcription factors that includes the yeast Gcn4p and the mammalian activator protein-1 proteins Fos and Jun (4). It activates transcription by binding to specific DNA sequences located in the promoter of its targets (2). Yap1p targets involved in oxidative stress response include TRX2 (thioredoxin) (5), GSH1 (gamma -glutamylcysteine synthetase) (6), GSH2 (glutathione synthetase) (7), TRR1 (thioredoxin reductase) (8), GLR1 (glutathione reductase) (9), GPX2 (glutathione peroxidase) (10), TSA1 (thioredoxin peroxidase) (10, 11), and AHP1 (alkyl hydroperoxide reductase) (12). Yap1p also regulates the transcription of genes encoding membrane-associated transporters such as YCF1, coding for an ATP binding cassette (ABC) transporter, which functions as a glutathione S-conjugate pump (13), as well as ATR1 and FLR1, coding for MDR transporters of the major facilitator superfamily (14, 15). Large-scale studies investigating Yap1p-dependent transcription have identified several additional genes that appear to be directly or indirectly regulated by Yap1p (11, 16, 17), underscoring the importance of this transcription factor in regulating stress response pathways.

Yap1p was originally identified on the basis of its ability to bind to an activator protein-1 recognition element found in the SV40 enhancer (5'-TGACTAA) (4, 18). This sequence is present in the GSH1 promoter and is required for Yap1p-mediated regulation of GSH1 expression (6). However, it was recently demonstrated that Yap1p preferentially interacts with the sequence 5'-TTAC/GTAA (19). This sequence, which is palindromic and contains two identical TTA half-sites, has been shown to function in an orientation-independent manner (13, 14). It is present in the TRX2, YCF1, GLR1, and ATR1 promoters and mediates their transcriptional activation by Yap1p (5, 9, 13, 14). It thus appears that the consensus Yap1p response element (YRE) corresponds to the sequence 5'-TT/GAC/GTAA (2).

The activity of Yap1p is predominantly regulated at the level of nuclear export. Under unstressed conditions, Yap1p shuttles between the cytosol and the nucleoplasm but is mainly cytosolic. It is actively exported from the nucleus by the exportin Crm1p, which interacts with the C-terminal cysteine-rich domain (CRD) of Yap1p (20-23). This domain contains a leucine-rich nuclear export sequence embedded within three cysteine residues invariably conserved among homologues of the Yap1p family (20-22). Removal of the CRD, mutation of the nuclear export sequence or of the cysteines as well as treatment of the cells with oxidative agents such as hydrogen peroxide (H2O2), diamide (DA), or diethylmaleate (DEM) all disrupt the Crm1p/ nuclear export sequence interaction, resulting in the accumulation of Yap1p in the nucleus and Yap1p-dependent transcriptional activation (20-24). The CRD is thought to behave as a specialized export signal that is sensitive to the redox state of the cells, the oxidation status of the cysteines affecting the accessibility of the nuclear export sequence to Crm1p, thereby regulating Yap1p activity (21, 22).

The FLR1 gene (YBR008c) was predicted to code for an integral membrane protein with 12 transmembrane domains belonging to multidrug permease subfamily I (25). We have demonstrated that FLR1 overexpression confers resistance to cycloheximide, 4-nitroquinoline N-oxide, and the azole derivative fluconazole, a drug widely used in antifungal therapy (hence FLR1, for fluconazole resistance 1) (15). FLR1 overexpression has also been shown to confer resistance to different toxic compounds including cerulenin, benomyl (BN), methotrexate, and diazaborine (26-28), further demonstrating its involvement in MDR. We have also demonstrated that FLR1 is a transcriptional target of Yap1p and that the FLR1 promoter contains three potential YREs, suggesting that the regulation of FLR1 expression by Yap1p could be mediated through these sequences (15). In the present study, we show that the three elements are functional, although not equivalent, and important for the optimal transactivation of FLR1 by Yap1p in response to different classes of compounds, including drugs, oxidants, and alkylating agents. We also show that FLR1 overexpression confers resistance to DA, DEM, and menadione (MD) but hypersensitivity to H2O2, indicating that the Flr1p transporter, in addition to its role in MDR, also modulates oxidative stress response in S. cerevisiae.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Strains, Media, and Drugs-- S. cerevisiae strains MRY13-1A (a ade2 his3 leu2 trp1 ura3 can1) and MRY13-1B (a ade2 leu2 trp1 ura3 can1 flr1Delta ::HIS3) have been described elsewhere (15). Strain FY1679 (a/alpha ura3-52/ura3-52 HIS3/his3Delta 200 TRP1/trp1Delta 63 LEU2/leu2Delta 1) (29) used for PCR amplification was kindly provided by Bernard Turcotte (McGill University, Montreal, Canada). Strain NMY7 (a ade2 his3 leu2 ura3 can1 yap1Delta ::HIS3) was generated in this study and is described below. Cells were grown in YPD (yeast extract/peptone/dextrose) medium or in synthetic dextrose (SD) medium lacking histidine (SD-his), uracil (SD-ura), or leucine (SD-leu) (30). Cell transformation was performed by the lithium acetate procedure (31). Cultures were routinely grown at 30 °C. Stock solutions of DA and DEM were prepared in dimethyl sulfoxide (Me2SO) at a final concentration of 1 M. The stock solutions of MD were prepared in water at a final concentration of 1 M. Methylmethane sulfonate (MMS) was prepared in water at a final concentration of 9 M, and BN was prepared in Me2SO at a final concentration of 100 mM. H2O2 (30%) and tert-butyl hydroperoxide (t-BHP) (70%) were diluted in water and Me2SO, respectively. All compounds were obtained from Sigma.

Construction of a yap1Delta Deletion Strain-- The yap1Delta disruption strain was obtained by allele replacement using the one-step PCR amplification method (32). A DNA fragment containing the HIS3 selectable marker from plasmid pJJ217 (33) flanked by YAP1 sequences was amplified using the following primers: 5'-GCAACCGAAGAAGAAGGGTAGCAAAACTAGCAAAAAGCAAGGGATCCGCTGCACGGTCCTG and 5'-GTCATCATTGGGTGTGTCAATTGGCTCGCTATTGCTGTGGCTCGGGGACACCAAATATGGCG. Each primer contains a sequence of 41-42 nucleotides derived from the YAP1 ORF (underlined) followed by a stretch of 20 nucleotides derived from HIS3. The resulting 1.8-kilobase PCR product allowed disruption of the YAP1 ORF from amino acids 61 to 169, a region overlapping the bZip domain essential for Yap1p function (34). The PCR fragment was gel-purified and used to transform MRY13-1A cells to histidine prototrophy. Southern analysis of isolated His+ colonies confirmed the presence of the yap1Delta ::HIS3 allele. One disruptant (NMY7) was selected for further studies.

Construction of Wild-type and Mutant FLR1 Promoter-lacZ Fusion Plasmids-- An FLR1 promoter-lacZ fusion plasmid was constructed using a PCR-amplified DNA fragment overlapping the promoter region and the translation initiation codon as well as a short portion of the FLR1 ORF (positions -828 to +25, relative to the translational start site). This PCR fragment was generated with Pfu DNA polymerase (Stratagene) using genomic DNA from FY1679 and oligonucleotides 5'-CGGGATCCGGTAGAAGAGTTACGGAA (forward primer) and 5'-CCCAAGCTTTGTCTGTACGTTGAAGTGTA (reverse primer). These primers introduce a BamHI (forward) and a HindIII (reverse) site (underlined) for in-frame directional cloning into plasmid YIp368 (35). The PCR product was digested with BamHI and HindIII and cloned first into plasmid pAlter to give pAlter/FLR1 (Promega Corp., Madison, WI). DNA sequencing confirmed that no mutation had been introduced in the promoter during the PCR amplification. For construction of the individual YRE mutants, pAlter/FLR1 was mutagenized using the Altered Sites II in vitro mutagenesis system (Promega Corp.). Oligonucleotides used were as follows: 5'-ATGGGCGGGATAATTCTAGAGGTAAAAGGGGAAC for the YRE1 mutation; 5'-TGGTATCAATCATCTCTAGAATGGGCGGGATAAT for the YRE2 mutation; and 5'-CGTTATGATGGTGATCTAGAAGTATAGGAATGCC for the YRE3 mutation (mutated nucleotides are underlined). For construction of the triple YRE mutant, the BamHI-HindIII FLR1 promoter fragment carrying a mutated YRE3 was retrieved from pAlter, cloned into M13mp8, and used as a template for the simultaneous mutation of YRE1 and YRE2 using the Sculptor in vitro mutagenesis system (Amersham Pharmacia Biotech). The oligonucleotide used to mutate YRE1 and YRE2 was 5'-GTTCCCCTTTTACCTCTAGAATTATCCCGCCCATTCTAGAGATGATTGATACC (mutated nucleotides are underlined). The mutations were confirmed by DNA sequencing. The resulting FLR1 fragments were excised from pAlter (wild-type or individual mutations) or from M13mp8 (triple mutation) by digestion with BamHI and HindIII and cloned into YIp368. DNA sequence analysis confirmed proper in-frame insertion of the different FLR1 promoter constructs with lacZ.

Transcriptional Assays-- The YIp368 constructs containing the wild-type or mutated FLR1 promoter fused to lacZ as well as YIp368 as a control were linearized with BstEII that cleaves within the LEU2 gene and used to transform strain MRY13-1A. Strain NMY7 was transformed with the YIp368 or YIp368/FLR1-linearized plasmids. Individual Leu+ colonies were analyzed by Southern blot to confirm proper integration. Selected MRY13-1A integrants were transformed with plasmid YEp352 (36) or with YEp352/YAP1 for Yap1p overexpression (15). For drug inductions, cells were grown to an A600 of 0.8-1, at which point drugs were added, and the growth was continued for 1 h before harvesting the cells. Protein extracts were prepared, and beta -galactosidase assays were performed as described previously (15). Protein concentrations were determined by the method of Bradford (37) using bovine serum albumin as standard. A range of concentrations was tested for each compound using the wild-type FLR1 promoter-lacZ construct in MRY13-1A cells (DA, 1-10 mM; DEM, 1-20 mM; H2O2, 0.1-10 mM; t-BHP, 0.05-5 mM; MMS, 2-20 mM). Concentrations yielding maximal induction of the promoter were chosen for further experiments (2.5 mM for DA, 10 mM for DEM, 0.5 mM for H2O2, 0.6 mM for t-BHP, and 10 mM for MMS). BN was only assayed at 5 µM, a concentration previously shown to induce FLR1 transcription (27).

Preparation of Anti-Yap1p Antibodies-- A glutathione S-transferase (GST)-YAP1 in-frame gene fusion was constructed by inserting a 381-base pair blunt-ended SspI fragment of YAP1 (positions +1057 and +1437 with respect to the initiation codon) into the SmaI site of vector pGEX-4T-3 (Amersham Pharmacia Biotech), generating plasmid pGEX-YAP350. The resulting fusion protein contained 127 amino acids of Yap1p (positions 353 to 479 in the protein). Escherichia coli DH5alpha cells transformed with pGEX-YAP350 were treated with isopropyl-beta -D-thiogalactoside (0.1 mM) for 4 h at 30 °C to induce the expression of the fusion protein. The fusion protein was purified from a crude bacterial lysate by affinity chromatography on immobilized glutathione (38) and used to raise polyclonal antibodies in two New Zealand White rabbits, yielding antibodies of high titers (Y1 and Y2). The specificity of these antisera for Yap1p was confirmed by Western blot using extracts of yap1Delta and YAP1-overexpressing strains. The Y1 antiserum and corresponding pre-immune serum were used without any further purification for the supershift experiments.

Electrophoretic Mobility Shift Assay (EMSA)-- MRY13-1A [YEp352], MRY13-1A [YEp352/YAP1], and NMY7 [YEp352] transformants were grown to log-phase (A600 of 0.6-0.8) in SD-ura medium at 30 °C, collected, washed in 1/20 volume of extraction buffer (200 mM Tris-HCl, pH 8.0, 400 mM (NH4)2SO4, 10 mM MgCl2, 1 mM EDTA, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride, 7 mM 2-mercaptoethanol, 1 µg/ml leupeptin, 1 µg/ml pepstatin), and resuspended in 1/500 volume of cold storage buffer (20 mM HEPES, pH 8.0, 5 mM EDTA, 20% glycerol, 1 mM phenylmethylsulfonyl fluoride, 7 mM 2-mercaptoethanol, 1 µg/ml leupeptin, 1 µg/ml pepstatin). Cells were lysed by glass-bead disruption as described previously (39) and centrifuged at 12,000 × g for 1 h at 4 °C. The supernatants were harvested, and the proteins were quantified by the method of Bradford (37). The following pairs of complementary oligonucleotides were used as probes in the EMSA: 5'-GGATAATTAGTCAGGTAAAAGG and 5'-CCTTTTACCTGACTAATTATCC (YRE1); 5'-TCAATCATCTGACTAATGGGC and 5'-GCCCATTAGTCAGATGATTGA (YRE2); 5'-GATGGTGATTACTAAGTATAGG and 5'-CCTATACTTAGTAATCACCATC (YRE3). Both oligonucleotides (3.6 pmol) from each pair were 5'-end-labeled with [gamma -32P]ATP using T4 polynucleotide kinase. The complementary oligonucleotides were mixed in 250 mM NaCl, boiled for 3 min, and allowed to anneal at room temperature. The probes were purified using G25-Sephadex columns (Amersham Pharmacia Biotech). EMSAs (20 µl final volume) were performed with 20 µg of protein extracts in a buffer containing 20 mM HEPES, pH 7.9, 50 mM NaCl, 5% glycerol, 1 mM EDTA, 5 mM MgCl2, 1 mM dithiothreitol, and 1 µg of poly(dI·dC). Where needed, 7.5 µl of the anti-Yap1p or pre-immune serum were added to the above mixture, which was incubated at room temperature for 20 min. The binding reactions were started by the addition of the double-stranded 32P-labeled probe (2 × 104 cpm) to the protein extracts and incubated at room temperature for 20 min. The resulting complexes were loaded on 5% nondenaturing polyacrylamide gels and electrophoresed at 200 V at 4 °C for 5 h. Gels were dried and autoradiographed for 16 h at -80 °C using two intensifying screens (Eastman Kodak Co.).

Construction of an FLR1-overexpression Plasmid-- A 1655-base pair DNA fragment overlapping the entire FLR1 ORF was amplified by PCR using genomic DNA from FY1679, Pfu DNA polymerase (Stratagene), and oligonucleotides 5'-GCTCTAGAATGGTATACACTTCAACG (forward primer) and 5'-GGCTTTCTACTCCTCTGTGTACGA (reverse primer). The resulting PCR fragment was gel-purified, phosphorylated with T4 polynucleotide kinase, and cloned blunt into plasmid p425GPD (kindly provided by Martin Funk, Institut fur Molekularbiologie und Tumorforschung, Marburg, Germany) (40) at the SmaI site, yielding plasmid p425GPD/FLR1.

Resistance Assays-- Resistance assays were performed in microtiter plates. Cells grown for 24 h on selective solid medium were resuspended in selective liquid medium at an A600 of 0.1. The cells were then diluted 100-fold in selective medium and added to round-bottom 96-well microtiter plates (50 µl/well) containing equal volumes (50 µl) of medium with different concentrations of the oxidant tested or of oxidant-free medium. The plates were incubated at 30 °C for 48 h in a humid chamber. Cell growth was evaluated by reading the optical density at 595 nm in a microplate reader (Vmax, Molecular Devices).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The FLR1 Promoter Contains Three Functional YREs-- We have previously shown that FLR1 is a transcriptional target of Yap1p (15). Computer-assisted analysis of the FLR1 promoter identified three potential YREs located at positions -148 (YRE1; 5'-TTAGTCA), -167 (YRE2; 5'-TGACTAA), and -364 (YRE3; 5'-TTACTAA) relative to the ATG translation initiation codon (Fig. 1). YRE1 and YRE2 match the SV40 activator protein-1 recognition element as well as the YRE present in the GSH1 promoter (5'-TGACTAA) (6), with YRE2 located on the coding strand and YRE1 on the noncoding strand (Fig. 1). YRE3 corresponds to the sequence 5'-TTA(C/G)TAA present in the TRX2, YCF1, GLR1, and ATR1 promoters (5, 9, 13, 14). To address the function of these YREs in the transactivation of FLR1 by Yap1p, each of these sites was individually mutated. The TTACTAA and TGACTAA sequences were replaced with TCTAGAA (the 4-base pair substitutions are underlined) (Fig. 1). The wild-type and mutated FLR1 promoters were fused to the E. coli lacZ gene in plasmid YIp368 (35). The resulting constructs as well as YIp368 as a negative control were integrated into strain MRY13-1A. Selected integrants were transformed with the multicopy plasmid YEp352 (36) or with YEp352 carrying the YAP1 gene under the control of its own promoter (YEp352/YAP1) (15). It is believed that the overexpression of YAP1 mimics conditions inducing Yap1p activity, such as exposure to pro-oxidants (5, 20, 21), most probably by increasing the concentration of Yap1p in the nucleus, where it can transactivate its targets. beta -Galactosidase activities were determined for each of the cotransformants (Fig. 2).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1.   Schematic representation of the FLR1 promoter. The three potential YREs located at positions -148 (YRE1), -167 (YRE2), and -364 (YRE3) are shown (positions are relative to the translation initiation codon indicated by the straight arrow). The mutations introduced in individual (MutYRE1, MutYRE2, MutYRE3) or triple (Mut3YRE) YREs are underlined. The arrows above and under the YREs indicate the orientation of two half-sites centered around an internal C, by analogy with those described for Gcn4p (51).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2.   Yap1p transactivation of the FLR1 promoter. Plasmid YIp368 (CTL) or YIp368/FLR1 containing either the wild-type FLR1 promoter (WT) or the FLR1 promoter carrying mutations in the YRE sites (MutYRE1, MutYRE2, MutYRE3, and Mut3YRE) and fused to the lacZ gene were integrated in strain MRY13-1A at the LEU2 locus. The resulting integrants were transformed with plasmid YEp352 or YEp352/YAP1, and beta -galactosidase activities were determined. Values represent the average of three independent experiments performed in duplicate.

Cells carrying the wild-type FLR1 promoter (WT) and transformed with the YEp352 control plasmid displayed very low beta -galactosidase activity, indicating that the FLR1 promoter is poorly transcribed under normal conditions. This result is consistent with the very low levels of FLR1 RNA transcripts detected by Northern blot in cells grown under normal conditions (15). Cells carrying the wild-type FLR1 promoter and transformed with the YEp352/YAP1 plasmid displayed a nearly 200-fold increase in beta -galactosidase activity, confirming that YAP1 overexpression strongly transactivates the FLR1 promoter. Indeed, YAP1 overexpression produced no detectable beta -galactosidase activity in cells carrying YIp368 but lacking the FLR1 promoter (CTL). Mutations in any of the three YREs decreased the ability of overexpressed Yap1p to transactivate the FLR1 promoter-lacZ fusion. Mutation of the most distal site (MutYRE3) had the most deleterious effect, causing a decrease of ~90% in beta -galactosidase activity when compared with the wild-type FLR1 promoter. Mutation of YRE2 (MutYRE2) and YRE1 (MutYRE1) resulted in a more moderate decrease in transactivation levels, with a reduction in beta -galactosidase activity of 75 and 40%, respectively. These results demonstrate that (i) each of the three YREs is functional and plays an important role in the optimal transactivation of FLR1 by Yap1p and that (ii) the three YREs are not functionally equivalent. Finally, simultaneous mutation of the three YREs (Mut3YRE) completely abolished beta -galactosidase activity in cells carrying YEp352/YAP1, demonstrating that the three identified YREs are essential for the transcriptional induction of FLR1 by Yap1p.

Yap1p Binds to the Three FLR1 YREs-- The binding of Yap1p to the three YREs was investigated by EMSA (Fig. 3). We used 32P-labeled double-stranded oligonucleotide probes overlapping each individual YRE and protein extracts prepared from strains expressing wild-type levels of Yap1p (MRY13-1A [YEp352]), overexpressing Yap1p (MRY13-1A [YEp352/YAP1]) or deleted for YAP1 (NMY7 [YEp352]). With the three probes used, the addition of MRY13-1A protein extracts led to the appearance of a slow-migrating complex (Fig. 3, lanes 4, 8, and 12; solid arrow). The presence of Yap1p in this complex was demonstrated by the following observations. First, this complex was absent when protein extracts prepared from the yap1Delta strain were used (Fig. 3, lanes 6, 10, and 14). Second, this complex was supershifted by the addition of the anti-Yap1p serum to the MRY13-1A protein extract before the binding reaction (Fig. 3, lanes 5, 9, and 13) but not by the pre-immune serum under similar conditions (data not shown). Third, Yap1p overexpression correlated with an increased amount of the complex (Fig. 3, lanes 7, 11, and 15). In addition, we found that Yap1p (both endogenous and overexpressed) binds more efficiently to YRE3 than to YRE2 and finally to YRE1 (Fig. 3, compare lanes 4, 8, and 12 for endogenous Yap1p and lanes 7, 11, and 15 for overexpressed Yap1p). These data show that Yap1p binds to the three YREs with different efficiency, a result consistent with those of the transactivation assays (YRE3 > YRE2 > YRE1) (Fig. 2). Finally, we detected additional complexes (three slow- and one fast-migrating) in the presence of the three protein extracts. These complexes are not related to Yap1p because they are still present with the extract from the yap1Delta strain (Fig. 3, lanes 6, 10, and 14). Moreover, they are not supershifted by the Yap1p antiserum (Fig. 3, lanes 5, 9, and 13), with the exception of the fast-migrating complex, which shows decreased intensity in two of these wells for reasons that are unclear (lanes 5 and 13). Nevertheless, our results demonstrate that Yap1p transactivates FLR1 through binding to the three YREs present in the promoter. They also provide evidence that the three YREs are functional but that they do not contribute equally to the transcriptional regulation of FLR1 by Yap1p.



View larger version (74K):
[in this window]
[in a new window]
 
Fig. 3.   Yap1p binds to the three YREs in the FLR1 promoter. Double-stranded 32P-labeled oligonucleotides overlapping the YRE1, YRE2, or YRE3 sequences were incubated with protein extracts prepared from strains MRY13-1A [YEp352] (YAP1), NMY7 [YEp352] (yap1Delta ), or MRY13-1A [YEp352/YAP1] (YAP1up-arrow ). An anti-Yap1p polyclonal antibody was added (lanes 5, 9, and 13) for supershift analysis. The position of the Yap1p-specific complexes is shown on the left (solid arrow). Nonspecific complexes are indicated (dashed arrow and brackets). The position of the wells and of the free probes is also indicated on the left.

FLR1 Transactivation upon Toxic Stress Is Mediated by Yap1p through the Three YREs-- Yap1p has been shown to regulate the expression of different target genes in response to oxidative stress. We therefore investigated the ability of the FLR1 promoter to be activated by Yap1p in response to different oxidizing agents. MRY13-1A integrants containing the wild-type or mutated FLR1 promoter-lacZ fusions were exposed to DA, DEM, H2O2, and t-BHP previously shown to induce Yap1p activity (5, 41). A wide range of concentrations was tested for each compound. The cells were harvested and assayed for beta -galactosidase activity. We found that 2.5 mM DA and 10 mM DEM caused a strong increase in beta -galactosidase activity (35- and 25-fold, respectively), whereas H2O2 at 0.5 mM and t-BHP at 0.6 mM resulted in a more moderate but still significant increase (5- and 4-fold, respectively), indicating that FLR1 transcription is induced by these oxidative agents (Fig. 4, WT). Mutations in YRE2 and YRE3 significantly reduced the level of transactivation achieved upon DA, DEM, H2O2, and t-BHP exposure, whereas mutation in YRE1 had a slight effect only on activation by DA, DEM, and t-BHP. The relative importance of each site was YRE2 > YRE3 > YRE1 for DA, H2O2 and t-BHP and YRE3 > YRE2 > YRE1 for DEM. Mutation of the three YREs completely abolished the transactivation of FLR1 induced by the three compounds. These results show that the three YREs are necessary for maximal induction, suggesting a direct involvement of Yap1p in the process. To test this hypothesis, the YIp368 plasmid carrying the wild-type FLR1 promoter fused to lacZ was integrated into strain NMY7 in which YAP1 is deleted. This integrant showed no induction of FLR1-lacZ transactivation upon DA, DEM, H2O2, or t-BHP exposure, confirming the essential role of Yap1p in the induction (Fig. 4, yap1Delta ). Taken together, our results demonstrate that FLR1 transcription is induced upon oxidative stress and that this induction is mediated by Yap1p through the three YREs present in the FLR1 promoter.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4.   Yap1p-mediated transactivation of the FLR1 promoter in response to oxidants, drugs, and alkylating agents. Plasmid YIp368/FLR1 containing the wild-type FLR1 promoter fused to the lacZ gene (WT) or YIp368 derivatives containing the FLR1 promoter mutated in the YRE sites (MutYRE1, MutYRE2, MutYRE3, and Mut3YRE) were integrated in strain MRY13-1A (YAP1). YIp368/FLR1 (WT) was also integrated in strain NMY7 (yap1Delta ). The resulting integrants were grown in the absence (-) or in the presence (+) of either DA (2.5 mM), DEM (10 mM), H2O2 (0.5 mM), t-BHP (0.6 mM), BN (5 µM), or MMS (10 mM) for 1 h before measuring beta -galactosidase activity. Values represent the average of three independent experiments performed in duplicate.

It has been shown that the expression of FLR1 is induced by BN and that this induction requires Pdr3p, a transcription factor of the zinc cluster family involved in MDR (27). We used our MRY13-1A (YAP1) or NMY7 (yap1Delta ) FLR1-lacZ integrants to investigate a potential role for Yap1p in this induction. As expected, we observed a strong increase in beta -galactosidase activity upon exposure of MRY13-1A cells to BN (75-fold) as compared with untreated cells (Fig. 4, BN and WT). However, no significant beta -galactosidase activity was detected with the NMY7 FLR1-lacZ integrant under the same conditions, demonstrating that Yap1p is essential for the induction. Mutation in any of the YREs decreased the level of FLR1 induction by BN, with the relative contribution of the YREs being YRE3 > YRE2 > YRE1 (Fig. 4, BN). As observed for the oxidants, the simultaneous mutation of the three YREs completely abolished the induction by BN. Thus, our results clearly demonstrate that the induction of FLR1 transcription by BN is mediated by Yap1p through the three YREs. Potential physical or genetic interactions between Yap1p and Pdr3p mediating the induction of FLR1 by BN remains to be elucidated.

A recent study investigating the global response of yeast to the alkylating agent MMS shows that FLR1 transcripts are induced by 15-fold upon cell exposure to this compound (42). To determine whether this induction is transcriptional and mediated by Yap1p, the MRY13-1A or NMY7 integrants containing the wild-type FLR1 promoter-lacZ fusion were exposed to MMS before beta -galactosidase activity determination. Our results showed a 40-fold increase in beta -galactosidase activities for the YAP1 cells exposed to MMS as compared with untreated cells, whereas yap1Delta FLR1-lacZ cells showed no detectable activity (Fig. 4, MMS). These results demonstrate that MMS induces FLR1 expression at the transcriptional level, and this induction is mediated by Yap1p. Mutation in any of the YREs similarly decreased the level of FLR1 induction by ~50-60%, whereas mutation of the three YREs completely abolished the induction (Fig. 4, MMS). Finally, we found that the pro-oxidant MD and the drug fluconazole were unable to induce FLR1 transcription over a wide range of concentrations tested (data not shown), demonstrating that the induction of FLR1 by DA, DEM, H2O2, t-BHP, BN, and MMS is specific. Taken together, our results demonstrate that the expression of FLR1 is induced by Yap1p in response to different classes of compounds. They also suggest that this induction is mediated by the direct binding of Yap1p to the three YREs in the FLR1 promoter.

Functional Consequences of FLR1 Overexpression on Cellular Response to Different Oxidants-- Since FLR1 is transactivated by Yap1p upon cell exposure to DA, DEM, and H2O2 (Fig. 4), it was of interest to assess the biological consequences of FLR1 overexpression on cellular tolerance to these compounds. To this end, MRY13-1A (FLR1) and MRY13-1B (flr1Delta ) isogenic strains transformed with plasmids YEp352 or YEp352/YAP1 (15) were tested for their ability to grow in the presence of increasing concentrations of these compounds using a microtiter plate growth inhibition assay (Fig. 5A). MD was also included in the assay. We found that overexpression of YAP1 in the wild-type strain (MRY13-1A [YEp352/YAP1]) resulted in a significant level of resistance to DA and MD that was strongly reduced in the flr1Delta background (MRY13-1B [YEp352/YAP1]), indicating that FLR1 is the major target of Yap1p conferring resistance to these compounds in S. cerevisiae. MRY13-1B [YEp352/YAP1] cells still retained a low level of resistance to DA and MD when compared with MRY13-1B [YEp352] cells, indicating the involvement of other YAP1-regulated molecular determinants of DA and MD resistance in S. cerevisiae, potentially YCF1 in the case of DA (43). Similarly, overexpression of YAP1 in MRY13-1A caused a significant level of resistance to DEM that was reduced by the flr1Delta deletion, demonstrating that YAP1 overexpression confers resistance to DEM and that FLR1 contributes to this resistance. Finally, YAP1 overexpression in MRY13-1A was found to confer hypersensitivity to H2O2 (Fig. 5A, H2O2; compare MRY13-1A [YEp352] and MRY13-1A [YEp352/YAP1]), as previously observed with constitutively active Yap1p mutants lacking the CRD (24). Surprisingly, however, this phenotype was reversed upon deletion of FLR1 (Fig. 5A, H2O2; compare MRY13-1A [YEp352/YAP1] and MRY13-1B [YEp352/YAP1]), indicating that YAP1-induced hypersensitivity to H2O2 is mediated, at least in part, by FLR1. In line with this, MRY13-1A wild-type cells were more sensitive to H2O2 than the MRY13-1B cells carrying the flr1 deletion (compare MRY13-1A [YEP352] and MRY13-1B [YEP352]), confirming that FLR1 expression confers H2O2 hypersensitivity.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 5.   FLR1 overexpression affects cell tolerance to different oxidants. A, growth assays were performed with strains MRY13-1A (FLR1) and MRY13-1B (flr1Delta ) carrying plasmids YEp352 or YEp352/YAP1. MRY13-1A [YEp352/YAP1] (closed squares), MRY13-1B [YEp352/YAP1] (open squares), MRY13-1A [YEp352] (closed circles), MRY13-1B [YEp352] (open circles). B, growth assays were performed with strain MRY13-1A [p425GPD/FLR1] (squares) or MRY13-1A [p425GPD] (circles). The cells were grown in selective medium in the absence or in the presence of the indicated compounds for 48 h. Cell growth is expressed as the percentage of growth in oxidant-containing medium relative to control growth in oxidant-free medium. Values represent the average of three independent experiments performed in duplicate.

To directly investigate if the overexpression of FLR1 causes the above-described phenotypes, we constructed an FLR1-overexpression plasmid by cloning the FLR1 ORF under the control of the strong glyceraldehyde-3-phosphate dehydrogenase (GPD) promoter in the multicopy vector p425GPD (40), yielding plasmid p425GPD/FLR1. This construct as well as the empty vector p425GPD were transformed into MRY13-1A cells, and the resulting transformants were analyzed for their ability to grow in the presence of increasing concentrations of DA, DEM, MD, and H2O2 by microtiter plate assay (Fig. 5B). This experiment showed that MRY13-1A [p425GPD/FLR1] transformants were significantly more resistant to DA and MD and slightly more resistant to DEM when compared with the MRY13-1A [p425GPD] control. Conversely, MRY13-1A [p425GPD/FLR1] transformants were more sensitive to H2O2 when compared with the control cells. These results confirm those obtained with the panel of MRY13-1A and MRY13-1B transformants (Fig. 5A) and clearly show that FLR1 overexpression confers resistance to DA, DEM, and MD but hypersensitivity to H2O2. They also demonstrate that a major facilitator transporter like Flr1p can modulate the cellular response to oxidative stress.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In this study, we have investigated the function of three potential YREs identified in the FLR1 promoter by computer-assisted sequence analysis with respect to their ability to mediate FLR1 regulation by Yap1p. Two independent pieces of evidence indicate that these three sequences are functional. First, mutation of any of the three YREs decreases the ability of overexpressed Yap1p to transactivate an FLR1 promoter-lacZ fusion (Fig. 2), demonstrating that the three YREs are necessary to mediate optimal induction of FLR1 by Yap1p. Second, the EMSA performed with oligonucleotides overlapping each YRE demonstrates that endogenous as well as overexpressed Yap1p can bind to the three sites (Fig. 3). As simultaneous mutation of the three YREs completely abolishes the induction of the FLR1 promoter by overexpressed Yap1p, we conclude that there is no other unidentified YRE in the FLR1 promoter.

Our results also demonstrate that the three YREs are not functionally equivalent. Upon transactivation of the FLR1 promoter with overexpressed Yap1p, mutation of YRE3 has the most deleterious effect (90% decrease in transactivation), followed by YRE2 and YRE1 (75 and 40% decreases, respectively) (Fig. 2). Moreover, we show by EMSA that Yap1p, endogenous and overexpressed, binds more efficiently to YRE3 than to YRE2 and then to YRE1 (Figs. 3). These results suggest that the relative importance of the three YREs can potentially be attributed to differences in the binding affinity of Yap1p for each YRE. As previously mentioned, YRE3 matches the 5'-TTA(C/G)TAA sequence, whereas YRE1 and YRE2 correspond to the SV40 activator protein-1 recognition element 5'-TGACTAA shown to be less efficient than the palindromic site in mediating the in vivo activation of a reporter gene by Yap1p (19). It is also possible that other factors such as the relative position of the YRE within the FLR1 promoter, the sequence context of each YRE, or the proximity of binding sites for other regulators also modulate the ability of a YRE to mediate activation of FLR1 by Yap1p. The FLR1 promoter contains consensus binding sequences for different transcription factors, including a TATA box at position 35 (5'-TATAAA), a stress response element at position 135 (5'-AGGGG) known to mediate transcriptional induction in response to different stresses, including oxidative stress (44), and a pleiotropic drug response element at position -439 (5'-TGCGCGGA) for binding of the two homologous transcription factors Pdr1p and Pdr3p involved in MDR (27). However, the functionality of these sequences has yet to be determined. Yap1p has also been shown to collaborate with the transcription factor Skn7p to regulate the expression of different target genes in response to H2O2 (8, 12). A consensus DNA binding sequence has not been precisely defined for Skn7p; it is thus not possible to predict whether this protein can bind to the FLR1 promoter. Interestingly, we also found that the relative importance of the three YREs varies with the inducer. Induction of the FLR1 promoter by DEM and BN resulted in a relative importance of the three YREs similar to that observed upon YAP1 overexpression (YRE3 > YRE2 > YRE1) (Fig. 4). However, YRE2 was found to be more important than YRE3 for the induction of FLR1 by DA, H2O2, and t-BHP (YRE2 > YRE3 > YRE1), whereas the three YREs were similarly involved in the induction by MMS (YRE3 congruent  YRE2 congruent  YRE1). The molecular basis for these differences is unclear. It is possible that different posttranslational modifications of Yap1p and/or binding to the FLR1 promoter of additional regulatory factors underlie the relative importance of the three YREs in response to specific inducers.

Taken together, our results demonstrate that (i) the FLR1 promoter contains three functional YREs, (ii) the two types of YRE sequences (5'-TTA(C/G)TAA and 5'-TGACTAA) coexist and function within the same promoter, and (iii) YREs differentially mediate transcriptional induction by Yap1p in response to various inducers. Unlike other Yap1p target genes described so far, the FLR1 promoter is the only one found to contain three YREs. The ATR1, YCF1, GSH1, and GLR1 promoters contain a single YRE (6, 9, 13, 14). The TRX2 promoter contains two YREs, but it is not known whether both YREs are functional and, if so, whether they are equally important for the transactivation of TRX2 by Yap1p (5). Interestingly, DNA microarray studies have identified an ORF (YKL071w) regulated by YAP1 and whose promoter is predicted to contain five YREs clustered within 60 base pairs (16). It will be interesting to see whether these five YREs are functional and equivalent for the regulation of YKL071w by Yap1p.

We show that FLR1 transcription is induced by Yap1p upon treatment of the cells with different oxidizing agents. FLR1 transcription was induced by DA, DEM, H2O2, and t-BHP but not by MD, indicating that the induction of FLR1 is specific for certain oxidants. This induction pattern is similar to that reported for TRX2, which is also induced by DA, H2O2, and t-BHP but not by MD (5, 8, 45), suggesting that the two genes are regulated by similar mechanisms. However, the demonstration that GSH1, conversely to FLR1 and TRX2, can be induced by MD (46) indicates that Yap1p targets are differentially regulated in response to specific oxidants. Again, it is possible that additional transcription factors bind to Yap1p-regulated promoters to confer oxidant-specific induction. Taken together, these results demonstrate that FLR1 belongs to the network of genes controlled by Yap1p in response to oxidative stress and that this network does not only consist of enzymes and molecules with antioxidant properties but also of transporters.

It has been recently reported that yeast exposure to MMS results in increased levels of FLR1 transcripts (42). We show here that this increase occurs at the transcriptional level, is mediated by Yap1p, and requires the three YREs (Fig. 4). The mechanisms by which Yap1p induces transcription in response to MMS are still unknown but appear to somehow differ from those involved in oxidative stress response. Transcriptional activation by Yap1p in response to oxidants has been shown to involve relocalization of Yap1p to the nucleus without affecting the levels of YAP1 expression (5, 20). Unlike oxidants, however, MMS exposure increases by ~6-fold the levels of YAP1 transcripts (42). In addition, we find that YRE1, which plays virtually no role in the activation of FLR1 by oxidants, is important for the induction of FLR1 by MMS (Fig. 4), uncovering further differences in the mechanism of induction by Yap1p in response to oxidants and alkylating agents. Whether MMS also affects the nuclear localization of Yap1p is under investigation.

To evaluate the biological consequences of FLR1 induction by oxidants, we have used a panel of isogenic flr1Delta and FLR1 strains overexpressing or not YAP1. These strains have proven useful in addressing the role of Yap1p in the tolerance of cells to a given compound and evaluating the contribution of Flr1p to this tolerance (15). In parallel, we also tested a strain overexpressing the FLR1 ORF under the control of a strong constitutive promoter. Our results show that FLR1 overexpression, achieved either from Yap1p overexpression or from the heterologous promoter, confers resistance to DA, MD, and to a lesser extent, DEM (Fig. 5). It had been shown that a yap1 deletion confers hypersensitivity to DA and MD and that YAP1 overexpression confers resistance to DA (5, 45), but the targets of Yap1p mediating these phenotypes were not known. The results presented here clearly demonstrate that FLR1 is the major target of Yap1p mediating resistance to both compounds in S. cerevisiae. Moreover, our results also show that YAP1 overexpression confers resistance to DEM and that FLR1 is one of the Yap1p targets mediating this resistance. These results constitute, to our knowledge, the first demonstration that a major facilitator behaves as a determinant of resistance to oxidants. Whether Flr1p functions by mediating the direct extracellular transport of these compounds, either unmodified or coupled to glutathione (47-49), by indirectly regulating the function of other proteins, including transporters, or by introducing changes in the plasma membrane properties affecting cell tolerance to these compounds remains to be elucidated.

The ability of DA, DEM, MMS, and BN to induce FLR1 transcription was found to correlate with the ability of the Flr1p transporter to protect the cells from the cytotoxic effects of these compounds (Fig. 5 and data not shown) (27). However, MD and fluconazole, which both belong to the spectrum of compounds to which Flr1p confers resistance, are unable to induce FLR1 transcription, indicating that Flr1p substrates do not necessarily function as transcriptional inducers. Conversely, it has been shown in the case of the MDR transporter P-glycoprotein that compounds that are not substrates can nevertheless induce transcription of the mdr1 gene (50). Taken together, these observations suggest that there is no strict correlation between transporter substrates and inducers.

Finally, we find that FLR1 overexpression confers hypersensitivity to H2O2 (Fig. 5). This phenotype is not only caused by FLR1 overexpression since deletion of the gene causes the cells to be more tolerant to H2O2, indicating that the endogenous levels of FLR1 are sufficient to sensitize the cells to this compound. Yap1p-mediated tolerance to H2O2 has been attributed to a number of genes, including TRX2, GLR1, and TSA1 (5, 9, 10, 12). Our results suggest that Yap1p-mediated response to H2O2 represents the sum of opposing phenotypes (namely H2O2 resistance conferred by TRX2/GLR1/TSA1 and H2O2 hypersensitivity conferred by FLR1) with the contribution of the targets conferring resistance exceeding that of FLR1 such that tolerance is the net result. However, we find that overexpression of YAP1 results in H2O2 hypersensitivity, suggesting that, under such conditions resulting in strong FLR1 transactivation (Fig. 2), the contribution of FLR1 exceeds that of the other Yap1p targets. This proposition is supported by the finding that YAP1 overexpression in an flr1Delta background results in H2O2 resistance rather than hypersensitivity (Fig. 5A). Moreover, constitutively active mutants of Yap1p lacking the CRD have also been shown to confer resistance to diamide but hypersensitivity to H2O2, although the same mutants were transcriptionally competent in the presence of either diamide or H2O2 (24). Given our results, it is possible that the H2O2 hypersensitivity observed for these mutants results from the transactivation of FLR1. The mechanism by which FLR1 expression sensitizes the cells to H2O2 is not known. However, this phenomenon is not restricted to major facilitators since overexpression of the CDR2 gene, which codes for a transporter of the ATP binding cassette family in Candida albicans, was also found to confer diamide resistance but H2O2 hypersensitivity.2 It remains to be seen if transporter-mediated H2O2 hypersensitivity is specific for FLR1 or also extends to other transporters regulated by Yap1p such as YCF1 and ATR1 (13, 14).


    ACKNOWLEDGEMENT

We are grateful to Dr. Bernard Turcotte (McGill University, Montreal) for critically reading the manuscript.


    FOOTNOTES

* This work was supported by Medical Research Council of Canada Grant MT-15679 (to M. R.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Supported by a scholarship from le Fonds de la Recherche en Santé du Québec (FRSQ). To whom correspondence should be addressed: Institut de Recherches Cliniques de Montréal, 110 Pine Ave. West, Montréal, Québec, Canada H2W 1R7. Tel.: 514-987-5770; Fax: 514-987-5764; E-mail: raymonm@ircm.qc.ca.

Published, JBC Papers in Press, October 30, 2000, DOI 10.1074/jbc.M008377200

2 S. Weber, C. Gauthier, A.-M. Alarco, R. Daoud, E. Georges, and M. Raymond, submitted for publication.


    ABBREVIATIONS

The abbreviations used are: MDR, multidrug resistance; BN, benomyl; CRD, cysteine-rich domain; DA, diamide; DEM, diethylmaleate; EMSA, electrophoretic mobility shift assay; FLR1, fluconazole resistance 1; MMS, methylmethane sulfonate; MD, menadione; ORF, open reading frame; PCR, polymerase chain reaction; t-BHP, tert-butyl hydroperoxide; YRE, Yap1p response element; SD, synthetic dextrose; WT, wild type; GPD, glyceraldehyde-3-phosphate dehydrogenase.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES


1. Bauer, B. E., Wolfger, H., and Kuchler, K. (1999) Biochim. Biophys. Acta 1461, 217-236
2. Toone, W. M., and Jones, N. (1999) Curr. Opin. Genet. Dev. 9, 55-61
3. Kolaczkowska, A., and Goffeau, A. (1999) Drug Resist Update. 2, 403-414
4. Moye-Rowley, W. S., Harshman, K. D., and Parker, C. S. (1989) Genes Dev. 3, 283-292
5. Kuge, S., and Jones, N. (1994) EMBO J. 13, 655-664
6. Wu, A. L., and Moye-Rowley, W. S. (1994) Mol. Cell. Biol. 14, 5832-5839
7. Sugiyama, K., Izawa, S., and Inoue, Y. (2000) J. Biol. Chem. 275, 15535-15540
8. Morgan, B. A., Banks, G. R., Toone, W. M., Raitt, D., Kuge, S., and Johnston, L. H. (1997) EMBO J. 16, 1035-1044
9. Grant, C. M., Collinson, L. P., Roe, J.-H., and Dawes, I. W. (1996) Mol. Microbiol. 21, 171-179
10. Inoue, Y., Matsuda, T., Sugiyama, K., Izawa, S., and Kimura, A. (1999) J. Biol. Chem. 274, 27002-27009
11. Lee, J., Godon, C., Lagniel, G., Spector, D., Garin, J., Labarre, J., and Toledano, M. B. (1999) J. Biol. Chem. 274, 16040-16046
12. Lee, J., Spector, D., Godon, C., Labarre, J., and Toledano, M. B. (1999) J. Biol. Chem. 274, 4537-4544
13. Wemmie, J. A., Szczypka, M. S., Thiele, D. J., and Moye-Rowley, W. S. (1994) J. Biol. Chem. 269, 32592-32597
14. Coleman, S. T., Tseng, E., and Moye-Rowley, W. S. (1997) J. Biol. Chem. 272, 23224-23230
15. Alarco, A. M., Balan, I., Talibi, D., Mainville, N., and Raymond, M. (1997) J. Biol. Chem. 272, 19304-19313
16. DeRisi, J. L., Iyer, V. R., and Brown, P. O. (1997) Science 278, 680-686
17. Dumond, H., Danielou, N., Pinto, M., and Bolotin-Fukuhara, M. (2000) Mol. Microbiol. 36, 830-845
18. Harshman, K. D., Moye-Rowley, W. S., and Parker, C. S. (1988) Cell 53, 321-330
19. Fernandes, L., Rodrigues-Pousada, C., and Struhl, K. (1997) Mol. Cell. Biol. 17, 6982-6993
20. Kuge, S., Jones, N., and Nomoto, A. (1997) EMBO J. 16, 1710-1720
21. Kuge, S., Toda, T., Iizuka, N., and Nomoto, A. (1998) Genes Cells 3, 521-532
22. Yan, C., Lee, L. H., and Davis, L. I. (1998) EMBO J. 17, 7416-7429
23. Kudo, N., Taoka, H., Toda, T., Yoshida, M., and Horinouchi, S. (1999) J. Biol. Chem. 274, 15151-15158
24. Coleman, S. T., Epping, E. A., Steggerda, S. M., and Moye-Rowley, W. S. (1999) Mol. Cell. Biol. 19, 8302-8313
25. Nelissen, B., De Wachter, R., and Goffeau, A. (1997) FEMS Microbiol. Rev. 21, 113-134
26. Oskouian, B., and Saba, J. D. (1999) Mol. Gen. Genet. 261, 346-353
27. Broco, N., Tenreiro, S., Viegas, C. A., and Sa-Correia, I. (1999) Yeast 15, 1595-1608
28. Jungwirth, H., Wendler, F., Platzer, B., Bergler, H., and Hogenauer, G. (2000) Eur. J. Biochem. 267, 4809-4816
29. Winston, F., Dollard, C., and Ricupero-Hovasse, S. L. (1995) Yeast 11, 53-55
30. Sherman, F. (1991) Methods Enzymol. 194, 3-21
31. Ito, H., Fukuda, Y., Murata, K., and Kimura, A. (1983) J. Bacteriol. 153, 163-168
32. Baudin, A., Ozier-Kalogeropoulos, O., Denouel, A., Lacroute, F., and Cullin, C. (1993) Nucleic Acids Res. 21, 3329-3330
33. Jones, J. S., and Prakash, L. (1990) Yeast 6, 363-366
34. Wemmie, J. A., Wu, A. L., Harshman, K. D., Parker, C. S., and Moye-Rowley, W. S. (1994) J. Biol. Chem. 269, 14690-14697
35. Myers, A. M., Tzagoloff, A., Kinney, D. M., and Lusty, C. J. (1986) Gene 45, 299-310
36. Hill, J. E., Myers, A. M., Koerner, T. J., and Tzagoloff, A. (1986) Yeast 2, 163-167
37. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254
38. Smith, D. B., and Johnson, K. S. (1988) Gene 67, 31-40
39. Hellauer, K., Rochon, M. H., and Turcotte, B. (1996) Mol. Cell. Biol. 16, 6096-6102
40. Mumberg, D., Muller, R., and Funk, M. (1995) Gene 156, 119-122
41. Wemmie, J. A., Steggerda, S. M., and Moye-Rowley, W. S. (1997) J. Biol. Chem. 272, 7908-7914
42. Jelinsky, S. A., and Samson, L. D. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 1486-1491
43. Wemmie, J. A., and Moye-Rowley, W. S. (1997) Mol. Microbiol. 25, 683-694
44. Marchler, G., Schuller, C., Adam, G., and Ruis, H. (1993) EMBO J. 12, 1997-2003
45. Stephen, D. W., Rivers, S. L., and Jamieson, D. J. (1995) Mol. Microbiol. 16, 415-423
46. Stephen, D. W., and Jamieson, D. J. (1997) Mol. Microbiol. 23, 203-210
47. Kosower, N. S., and Kosower, E. M. (1995) Methods Enzymol. 251, 123-133
48. Zadzinski, R., Fortuniak, A., Bilinski, T., Grey, M., and Bartosz, G. (1998) Biochem. Mol. Biol. Int. 44, 747-759
49. Meister, A. (1985) Methods Enzymol. 113, 571-585
50. Santoni-Rugiu, E., and Silverman, J. A. (1997) Carcinogenesis 18, 2255-2263
51. Ellenberger, T. E., Brandl, C. J., Struhl, K., and Harrison, S. C. (1992) Cell 71, 1223-1237


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Omberg, G. H. Golub, and O. Alter
A tensor higher-order singular value decomposition for integrative analysis of DNA microarray data from different studies
PNAS, November 20, 2007; 104(47): 18371 - 18376.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
B. Rognon, Z. Kozovska, A. T. Coste, G. Pardini, and D. Sanglard
Identification of promoter elements responsible for the regulation of MDR1 from Candida albicans, a major facilitator transporter involved in azole resistance
Microbiology, December 1, 2006; 152(12): 3701 - 3722.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Romero, P. Desai, N. DeLillo, and A. Vancura
Expression of FLR1 Transporter Requires Phospholipase C and Is Repressed by Mediator
J. Biol. Chem., March 3, 2006; 281(9): 5677 - 5685.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
T. Srikantha, R. Zhao, K. Daniels, J. Radke, and D. R. Soll
Phenotypic Switching in Candida glabrata Accompanied by Changes in Expression of Genes with Deduced Functions in Copper Detoxification and Stress
Eukaryot. Cell, August 1, 2005; 4(8): 1434 - 1445.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
J. B. Harry, B. G. Oliver, J. L. Song, P. M. Silver, J. T. Little, J. Choiniere, and T. C. White
Drug-Induced Regulation of the MDR1 Promoter in Candida albicans
Antimicrob. Agents Chemother., July 1, 2005; 49(7): 2785 - 2792.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Lucau-Danila, G. Lelandais, Z. Kozovska, V. Tanty, T. Delaveau, F. Devaux, and C. Jacq
Early Expression of Yeast Genes Affected by Chemical Stress
Mol. Cell. Biol., March 1, 2005; 25(5): 1860 - 1868.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
S. Lev, R. Hadar, P. Amedeo, S. E. Baker, O. C. Yoder, and B. A. Horwitz
Activation of an AP1-Like Transcription Factor of the Maize Pathogen Cochliobolus heterostrophus in Response to Oxidative Stress and Plant Signals
Eukaryot. Cell, February 1, 2005; 4(2): 443 - 454.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
P. M. Silver, B. G. Oliver, and T. C. White
Role of Candida albicans Transcription Factor Upc2p in Drug Resistance and Sterol Metabolism
Eukaryot. Cell, December 1, 2004; 3(6): 1391 - 1397.
[Abstract] [Full Text] [PDF]


Home page