![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 2, 1138-1145, January 12, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Institut de Recherches Cliniques de Montréal, Montréal, Québec, H2W 1R7, Canada
Received for publication, September 13, 2000, and in revised form, October 24, 2000
| |
ABSTRACT |
|---|
|
|
|---|
The bZip transcription factor Yap1p plays an
important role in oxidative stress response and multidrug resistance in
Saccharomyces cerevisiae. We have previously demonstrated
that the FLR1 gene, encoding a multidrug transporter of the
major facilitator superfamily, is a transcriptional target of Yap1p.
The FLR1 promoter contains three potential Yap1p response
elements (YREs) at positions The Saccharomyces cerevisiae transcription factor Yap1p
plays an important role in oxidative stress response and multidrug resistance (MDR)1 by
activating target genes involved in cellular detoxification (1-3).
Yap1p belongs to the bZip (basic domain/leucine zipper) family of
transcription factors that includes the yeast Gcn4p and the mammalian
activator protein-1 proteins Fos and Jun (4). It activates
transcription by binding to specific DNA sequences located in the
promoter of its targets (2). Yap1p targets involved in oxidative stress
response include TRX2 (thioredoxin) (5), GSH1
( Yap1p was originally identified on the basis of its ability to bind to
an activator protein-1 recognition element found in the SV40 enhancer
(5'-TGACTAA) (4, 18). This sequence is present in the GSH1
promoter and is required for Yap1p-mediated regulation of
GSH1 expression (6). However, it was recently demonstrated
that Yap1p preferentially interacts with the sequence 5'-TTAC/GTAA
(19). This sequence, which is palindromic and contains two identical
TTA half-sites, has been shown to function in an orientation-independent manner (13, 14). It is present in the
TRX2, YCF1, GLR1, and ATR1
promoters and mediates their transcriptional activation by Yap1p (5, 9,
13, 14). It thus appears that the consensus Yap1p response element
(YRE) corresponds to the sequence 5'-TT/GAC/GTAA (2).
The activity of Yap1p is predominantly regulated at the level of
nuclear export. Under unstressed conditions, Yap1p shuttles between the
cytosol and the nucleoplasm but is mainly cytosolic. It is actively
exported from the nucleus by the exportin Crm1p, which interacts with
the C-terminal cysteine-rich domain (CRD) of Yap1p (20-23). This
domain contains a leucine-rich nuclear export sequence embedded within
three cysteine residues invariably conserved among homologues of the
Yap1p family (20-22). Removal of the CRD, mutation of the nuclear
export sequence or of the cysteines as well as treatment of the cells
with oxidative agents such as hydrogen peroxide
(H2O2), diamide (DA), or diethylmaleate (DEM)
all disrupt the Crm1p/ nuclear export sequence interaction, resulting
in the accumulation of Yap1p in the nucleus and
Yap1p-dependent transcriptional activation (20-24). The
CRD is thought to behave as a specialized export signal that is
sensitive to the redox state of the cells, the oxidation status of the
cysteines affecting the accessibility of the nuclear export sequence to
Crm1p, thereby regulating Yap1p activity (21, 22).
The FLR1 gene (YBR008c) was predicted to code for an
integral membrane protein with 12 transmembrane domains belonging to multidrug permease subfamily I (25). We have demonstrated that FLR1 overexpression confers resistance to cycloheximide,
4-nitroquinoline N-oxide, and the azole derivative
fluconazole, a drug widely used in antifungal therapy (hence
FLR1, for fluconazole resistance 1) (15). FLR1 overexpression has also been shown
to confer resistance to different toxic compounds including cerulenin,
benomyl (BN), methotrexate, and diazaborine (26-28), further
demonstrating its involvement in MDR. We have also demonstrated that
FLR1 is a transcriptional target of Yap1p and that the
FLR1 promoter contains three potential YREs, suggesting that
the regulation of FLR1 expression by Yap1p could be mediated
through these sequences (15). In the present study, we show that the
three elements are functional, although not equivalent, and important
for the optimal transactivation of FLR1 by Yap1p in response
to different classes of compounds, including drugs, oxidants, and
alkylating agents. We also show that FLR1 overexpression
confers resistance to DA, DEM, and menadione (MD) but hypersensitivity
to H2O2, indicating that the Flr1p transporter, in addition to its role in MDR, also modulates oxidative stress response in S. cerevisiae.
Strains, Media, and Drugs--
S. cerevisiae strains
MRY13-1A (a ade2 his3 leu2 trp1 ura3 can1) and MRY13-1B (a
ade2 leu2 trp1 ura3 can1 flr1 Construction of a yap1 Construction of Wild-type and Mutant FLR1 Promoter-lacZ Fusion
Plasmids--
An FLR1 promoter-lacZ fusion
plasmid was constructed using a PCR-amplified DNA fragment overlapping
the promoter region and the translation initiation codon as well as a
short portion of the FLR1 ORF (positions Transcriptional Assays--
The YIp368 constructs containing the
wild-type or mutated FLR1 promoter fused to lacZ
as well as YIp368 as a control were linearized with BstEII
that cleaves within the LEU2 gene and used to transform
strain MRY13-1A. Strain NMY7 was transformed with the YIp368 or
YIp368/FLR1-linearized plasmids. Individual Leu+ colonies
were analyzed by Southern blot to confirm proper integration. Selected
MRY13-1A integrants were transformed with plasmid YEp352 (36) or with
YEp352/YAP1 for Yap1p overexpression (15). For drug inductions, cells
were grown to an A600 of 0.8-1, at which point
drugs were added, and the growth was continued for 1 h before harvesting the cells. Protein extracts were prepared, and
Preparation of Anti-Yap1p Antibodies--
A glutathione
S-transferase (GST)-YAP1 in-frame gene
fusion was constructed by inserting a 381-base pair blunt-ended
SspI fragment of YAP1 (positions +1057 and +1437
with respect to the initiation codon) into the SmaI site of
vector pGEX-4T-3 (Amersham Pharmacia Biotech), generating plasmid
pGEX-YAP350. The resulting fusion protein contained 127 amino acids of
Yap1p (positions 353 to 479 in the protein). Escherichia
coli DH5 Electrophoretic Mobility Shift Assay (EMSA)--
MRY13-1A
[YEp352], MRY13-1A [YEp352/YAP1], and NMY7 [YEp352] transformants
were grown to log-phase (A600 of 0.6-0.8) in
SD-ura medium at 30 °C, collected, washed in 1/20 volume of
extraction buffer (200 mM Tris-HCl, pH 8.0, 400 mM (NH4)2SO4, 10 mM MgCl2, 1 mM EDTA, 10% glycerol,
1 mM phenylmethylsulfonyl fluoride, 7 mM
2-mercaptoethanol, 1 µg/ml leupeptin, 1 µg/ml pepstatin), and resuspended in 1/500 volume of cold storage buffer (20 mM
HEPES, pH 8.0, 5 mM EDTA, 20% glycerol, 1 mM
phenylmethylsulfonyl fluoride, 7 mM 2-mercaptoethanol, 1 µg/ml leupeptin, 1 µg/ml pepstatin). Cells were lysed by glass-bead
disruption as described previously (39) and centrifuged at 12,000 × g for 1 h at 4 °C. The supernatants were
harvested, and the proteins were quantified by the method of Bradford
(37). The following pairs of complementary oligonucleotides were used
as probes in the EMSA: 5'-GGATAATTAGTCAGGTAAAAGG and 5'-CCTTTTACCTGACTAATTATCC (YRE1); 5'-TCAATCATCTGACTAATGGGC and 5'-GCCCATTAGTCAGATGATTGA (YRE2); 5'-GATGGTGATTACTAAGTATAGG and 5'-CCTATACTTAGTAATCACCATC (YRE3). Both oligonucleotides (3.6 pmol) from each pair were 5'-end-labeled with
[ Construction of an FLR1-overexpression Plasmid--
A 1655-base
pair DNA fragment overlapping the entire FLR1 ORF was
amplified by PCR using genomic DNA from FY1679, Pfu DNA polymerase (Stratagene), and oligonucleotides
5'-GCTCTAGAATGGTATACACTTCAACG (forward primer) and
5'-GGCTTTCTACTCCTCTGTGTACGA (reverse primer). The resulting PCR
fragment was gel-purified, phosphorylated with T4 polynucleotide
kinase, and cloned blunt into plasmid p425GPD (kindly provided by
Martin Funk, Institut fur Molekularbiologie und Tumorforschung,
Marburg, Germany) (40) at the SmaI site, yielding plasmid
p425GPD/FLR1.
Resistance Assays--
Resistance assays were performed in
microtiter plates. Cells grown for 24 h on selective solid medium
were resuspended in selective liquid medium at an
A600 of 0.1. The cells were then diluted
100-fold in selective medium and added to round-bottom 96-well
microtiter plates (50 µl/well) containing equal volumes (50 µl) of
medium with different concentrations of the oxidant tested or of
oxidant-free medium. The plates were incubated at 30 °C for 48 h in a humid chamber. Cell growth was evaluated by reading the optical
density at 595 nm in a microplate reader (Vmax, Molecular Devices).
The FLR1 Promoter Contains Three Functional YREs--
We have
previously shown that FLR1 is a transcriptional target of
Yap1p (15). Computer-assisted analysis of the FLR1 promoter identified three potential YREs located at positions
Cells carrying the wild-type FLR1 promoter (WT) and
transformed with the YEp352 control plasmid displayed very low
Yap1p Binds to the Three FLR1 YREs--
The binding of Yap1p to
the three YREs was investigated by EMSA (Fig.
3). We used 32P-labeled
double-stranded oligonucleotide probes overlapping each individual YRE
and protein extracts prepared from strains expressing wild-type levels
of Yap1p (MRY13-1A [YEp352]), overexpressing Yap1p (MRY13-1A
[YEp352/YAP1]) or deleted for YAP1 (NMY7 [YEp352]). With
the three probes used, the addition of MRY13-1A protein extracts led to
the appearance of a slow-migrating complex (Fig. 3, lanes 4,
8, and 12; solid arrow). The presence
of Yap1p in this complex was demonstrated by the following
observations. First, this complex was absent when protein extracts
prepared from the yap1 FLR1 Transactivation upon Toxic Stress Is Mediated by Yap1p through
the Three YREs--
Yap1p has been shown to regulate the expression of
different target genes in response to oxidative stress. We therefore
investigated the ability of the FLR1 promoter to be
activated by Yap1p in response to different oxidizing agents. MRY13-1A
integrants containing the wild-type or mutated FLR1
promoter-lacZ fusions were exposed to DA, DEM,
H2O2, and t-BHP previously shown to
induce Yap1p activity (5, 41). A wide range of concentrations was
tested for each compound. The cells were harvested and assayed for
It has been shown that the expression of FLR1 is induced by
BN and that this induction requires Pdr3p, a transcription factor of
the zinc cluster family involved in MDR (27). We used our MRY13-1A
(YAP1) or NMY7 (yap1
A recent study investigating the global response of yeast to the
alkylating agent MMS shows that FLR1 transcripts are induced by 15-fold upon cell exposure to this compound (42). To determine whether this induction is transcriptional and mediated by Yap1p, the
MRY13-1A or NMY7 integrants containing the wild-type FLR1 promoter-lacZ fusion were exposed to MMS before
Functional Consequences of FLR1 Overexpression on Cellular Response
to Different Oxidants--
Since FLR1 is transactivated by
Yap1p upon cell exposure to DA, DEM, and H2O2
(Fig. 4), it was of interest to assess the biological consequences of
FLR1 overexpression on cellular tolerance to these compounds. To this end, MRY13-1A (FLR1) and MRY13-1B
(flr1
To directly investigate if the overexpression of FLR1 causes
the above-described phenotypes, we constructed an
FLR1-overexpression plasmid by cloning the FLR1
ORF under the control of the strong glyceraldehyde-3-phosphate
dehydrogenase (GPD) promoter in the multicopy vector p425GPD
(40), yielding plasmid p425GPD/FLR1. This construct as well as the
empty vector p425GPD were transformed into MRY13-1A cells, and the
resulting transformants were analyzed for their ability to grow in the
presence of increasing concentrations of DA, DEM, MD, and
H2O2 by microtiter plate assay (Fig.
5B). This experiment showed that MRY13-1A [p425GPD/FLR1]
transformants were significantly more resistant to DA and MD and
slightly more resistant to DEM when compared with the MRY13-1A
[p425GPD] control. Conversely, MRY13-1A [p425GPD/FLR1]
transformants were more sensitive to H2O2 when
compared with the control cells. These results confirm those obtained
with the panel of MRY13-1A and MRY13-1B transformants (Fig.
5A) and clearly show that FLR1 overexpression
confers resistance to DA, DEM, and MD but hypersensitivity to
H2O2. They also demonstrate that a major
facilitator transporter like Flr1p can modulate the cellular response
to oxidative stress.
In this study, we have investigated the function of three
potential YREs identified in the FLR1 promoter by
computer-assisted sequence analysis with respect to their ability to
mediate FLR1 regulation by Yap1p. Two independent pieces of
evidence indicate that these three sequences are functional. First,
mutation of any of the three YREs decreases the ability of
overexpressed Yap1p to transactivate an FLR1
promoter-lacZ fusion (Fig. 2), demonstrating that the three
YREs are necessary to mediate optimal induction of FLR1 by
Yap1p. Second, the EMSA performed with oligonucleotides overlapping
each YRE demonstrates that endogenous as well as overexpressed Yap1p
can bind to the three sites (Fig. 3). As simultaneous mutation of the
three YREs completely abolishes the induction of the FLR1 promoter by overexpressed Yap1p, we conclude that there is no other
unidentified YRE in the FLR1 promoter.
Our results also demonstrate that the three YREs are not functionally
equivalent. Upon transactivation of the FLR1 promoter with
overexpressed Yap1p, mutation of YRE3 has the most deleterious effect
(90% decrease in transactivation), followed by YRE2 and YRE1 (75 and
40% decreases, respectively) (Fig. 2). Moreover, we show by EMSA that
Yap1p, endogenous and overexpressed, binds more efficiently to YRE3
than to YRE2 and then to YRE1 (Figs. 3). These results suggest that the
relative importance of the three YREs can potentially be attributed to
differences in the binding affinity of Yap1p for each YRE. As
previously mentioned, YRE3 matches the 5'-TTA(C/G)TAA sequence,
whereas YRE1 and YRE2 correspond to the SV40 activator protein-1
recognition element 5'-TGACTAA shown to be less efficient than the
palindromic site in mediating the in vivo activation of a
reporter gene by Yap1p (19). It is also possible that other factors
such as the relative position of the YRE within the FLR1
promoter, the sequence context of each YRE, or the proximity of binding
sites for other regulators also modulate the ability of a YRE to
mediate activation of FLR1 by Yap1p. The FLR1
promoter contains consensus binding sequences for different
transcription factors, including a TATA box at position 35 (5'-TATAAA),
a stress response element at position 135 (5'-AGGGG) known to mediate
transcriptional induction in response to different stresses, including
oxidative stress (44), and a pleiotropic drug response element at
position Taken together, our results demonstrate that (i) the FLR1
promoter contains three functional YREs, (ii) the two types of YRE sequences (5'-TTA(C/G)TAA and 5'-TGACTAA) coexist and function within the same promoter, and (iii) YREs differentially mediate transcriptional induction by Yap1p in response to various inducers. Unlike other Yap1p target genes described so far, the FLR1
promoter is the only one found to contain three YREs. The
ATR1, YCF1, GSH1, and GLR1
promoters contain a single YRE (6, 9, 13, 14). The TRX2
promoter contains two YREs, but it is not known whether both YREs are
functional and, if so, whether they are equally important for the
transactivation of TRX2 by Yap1p (5). Interestingly, DNA
microarray studies have identified an ORF (YKL071w) regulated by
YAP1 and whose promoter is predicted to contain five YREs
clustered within 60 base pairs (16). It will be interesting to see
whether these five YREs are functional and equivalent for the
regulation of YKL071w by Yap1p.
We show that FLR1 transcription is induced by Yap1p upon
treatment of the cells with different oxidizing agents. FLR1
transcription was induced by DA, DEM, H2O2, and
t-BHP but not by MD, indicating that the induction of
FLR1 is specific for certain oxidants. This induction
pattern is similar to that reported for TRX2, which is also
induced by DA, H2O2, and t-BHP but
not by MD (5, 8, 45), suggesting that the two genes are regulated by
similar mechanisms. However, the demonstration that GSH1,
conversely to FLR1 and TRX2, can be induced by MD
(46) indicates that Yap1p targets are differentially regulated in
response to specific oxidants. Again, it is possible that additional
transcription factors bind to Yap1p-regulated promoters to confer
oxidant-specific induction. Taken together, these results demonstrate
that FLR1 belongs to the network of genes controlled by
Yap1p in response to oxidative stress and that this network does not
only consist of enzymes and molecules with antioxidant properties but
also of transporters.
It has been recently reported that yeast exposure to MMS results in
increased levels of FLR1 transcripts (42). We show here that
this increase occurs at the transcriptional level, is mediated by
Yap1p, and requires the three YREs (Fig. 4). The mechanisms by which
Yap1p induces transcription in response to MMS are still unknown but
appear to somehow differ from those involved in oxidative stress
response. Transcriptional activation by Yap1p in response to oxidants
has been shown to involve relocalization of Yap1p to the nucleus
without affecting the levels of YAP1 expression (5, 20).
Unlike oxidants, however, MMS exposure increases by ~6-fold the
levels of YAP1 transcripts (42). In addition, we find that
YRE1, which plays virtually no role in the activation of
FLR1 by oxidants, is important for the induction of
FLR1 by MMS (Fig. 4), uncovering further differences in the
mechanism of induction by Yap1p in response to oxidants and alkylating
agents. Whether MMS also affects the nuclear localization of Yap1p is under investigation.
To evaluate the biological consequences of FLR1 induction by
oxidants, we have used a panel of isogenic flr1 The ability of DA, DEM, MMS, and BN to induce FLR1
transcription was found to correlate with the ability of the Flr1p
transporter to protect the cells from the cytotoxic effects of these
compounds (Fig. 5 and data not shown) (27). However, MD and
fluconazole, which both belong to the spectrum of compounds to which
Flr1p confers resistance, are unable to induce FLR1
transcription, indicating that Flr1p substrates do not necessarily
function as transcriptional inducers. Conversely, it has been shown in
the case of the MDR transporter P-glycoprotein that compounds that are
not substrates can nevertheless induce transcription of the
mdr1 gene (50). Taken together, these observations suggest
that there is no strict correlation between transporter substrates and inducers.
Finally, we find that FLR1 overexpression confers
hypersensitivity to H2O2 (Fig. 5). This
phenotype is not only caused by FLR1 overexpression since
deletion of the gene causes the cells to be more tolerant to
H2O2, indicating that the endogenous levels of
FLR1 are sufficient to sensitize the cells to this compound. Yap1p-mediated tolerance to H2O2 has been
attributed to a number of genes, including TRX2,
GLR1, and TSA1 (5, 9, 10, 12). Our results
suggest that Yap1p-mediated response to H2O2
represents the sum of opposing phenotypes (namely
H2O2 resistance conferred by
TRX2/GLR1/TSA1 and
H2O2 hypersensitivity conferred by
FLR1) with the contribution of the targets conferring
resistance exceeding that of FLR1 such that tolerance is the
net result. However, we find that overexpression of YAP1
results in H2O2 hypersensitivity, suggesting
that, under such conditions resulting in strong FLR1 transactivation (Fig. 2), the contribution of FLR1 exceeds
that of the other Yap1p targets. This proposition is supported by the finding that YAP1 overexpression in an flr1
148 (YRE1),
167 (YRE2), and
364
(YRE3). To address the function of these YREs, the three sites have
been individually mutated and tested in transactivation assays. Our
results show that (i) each of the three YREs is functional and
important for the optimal transactivation of FLR1 by Yap1p
and that (ii) the three YREs are not functionally equivalent, mutation
of YRE3 being the most deleterious, followed by YRE2 and YRE1.
Simultaneous mutation of the three YREs abolished transactivation of
the promoter by Yap1p, demonstrating that the three sites are essential
for the regulation of FLR1 by Yap1p. Gel retardation assays
confirmed that Yap1p differentially binds to the three YREs (YRE3 > YRE2 > YRE1). We show that the transcription of
FLR1 is induced upon cell treatment with the oxidizing
agents diamide, diethylmaleate, hydrogen peroxide, and
tert-butyl hydroperoxide, the antimitotic drug benomyl, and
the alkylating agent methylmethane sulfonate and that this induction is
mediated by Yap1p through the three YREs. Finally, we show that
FLR1 overexpression confers resistance to diamide,
diethylmaleate, and menadione but hypersensitivity to
H2O2, demonstrating that the Flr1p transporter
participates in Yap1p-mediated oxidative stress response in S. cerevisiae.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-glutamylcysteine synthetase) (6), GSH2 (glutathione synthetase) (7), TRR1 (thioredoxin reductase) (8),
GLR1 (glutathione reductase) (9), GPX2
(glutathione peroxidase) (10), TSA1 (thioredoxin peroxidase)
(10, 11), and AHP1 (alkyl hydroperoxide reductase) (12).
Yap1p also regulates the transcription of genes encoding
membrane-associated transporters such as YCF1, coding for an
ATP binding cassette (ABC) transporter, which functions as a
glutathione S-conjugate pump (13), as well as
ATR1 and FLR1, coding for MDR transporters of the
major facilitator superfamily (14, 15). Large-scale studies
investigating Yap1p-dependent transcription have identified
several additional genes that appear to be directly or indirectly
regulated by Yap1p (11, 16, 17), underscoring the importance of this
transcription factor in regulating stress response pathways.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
::HIS3)
have been described elsewhere (15). Strain FY1679 (a/
ura3-52/ura3-52 HIS3/his3
200
TRP1/trp1
63
LEU2/leu2
1) (29) used for PCR amplification was kindly provided by Bernard Turcotte (McGill University, Montreal, Canada). Strain NMY7 (a ade2 his3 leu2 ura3 can1
yap1
::HIS3) was generated in this study
and is described below. Cells were grown in YPD (yeast
extract/peptone/dextrose) medium or in synthetic dextrose (SD) medium
lacking histidine (SD-his), uracil (SD-ura), or leucine (SD-leu) (30).
Cell transformation was performed by the lithium acetate procedure
(31). Cultures were routinely grown at 30 °C. Stock solutions of DA
and DEM were prepared in dimethyl sulfoxide (Me2SO) at a
final concentration of 1 M. The stock solutions of MD were
prepared in water at a final concentration of 1 M.
Methylmethane sulfonate (MMS) was prepared in water at a final
concentration of 9 M, and BN was prepared in
Me2SO at a final concentration of 100 mM.
H2O2 (30%) and tert-butyl
hydroperoxide (t-BHP) (70%) were diluted in water and
Me2SO, respectively. All compounds were obtained from Sigma.
Deletion Strain--
The
yap1
disruption strain was obtained by allele replacement
using the one-step PCR amplification method (32). A DNA fragment containing the HIS3 selectable marker from plasmid pJJ217
(33) flanked by YAP1 sequences was amplified using the
following primers: 5'-GCAACCGAAGAAGAAGGGTAGCAAAACTAGCAAAAAGCAAGGGATCCGCTGCACGGTCCTG and
5'-GTCATCATTGGGTGTGTCAATTGGCTCGCTATTGCTGTGGCTCGGGGACACCAAATATGGCG. Each primer contains a sequence of 41-42 nucleotides derived
from the YAP1 ORF (underlined) followed by a stretch of 20 nucleotides derived from HIS3. The resulting 1.8-kilobase
PCR product allowed disruption of the YAP1 ORF from amino
acids 61 to 169, a region overlapping the bZip domain essential for
Yap1p function (34). The PCR fragment was gel-purified and used to
transform MRY13-1A cells to histidine prototrophy. Southern analysis of
isolated His+ colonies confirmed the presence of the
yap1
::HIS3 allele. One disruptant
(NMY7) was selected for further studies.
828 to +25,
relative to the translational start site). This PCR fragment was
generated with Pfu DNA polymerase (Stratagene) using genomic
DNA from FY1679 and oligonucleotides 5'-CGGGATCCGGTAGAAGAGTTACGGAA (forward primer) and
5'-CCCAAGCTTTGTCTGTACGTTGAAGTGTA (reverse primer). These
primers introduce a BamHI (forward) and a HindIII
(reverse) site (underlined) for in-frame directional cloning into
plasmid YIp368 (35). The PCR product was digested with BamHI
and HindIII and cloned first into plasmid pAlter to give
pAlter/FLR1 (Promega Corp., Madison, WI). DNA sequencing confirmed that
no mutation had been introduced in the promoter during the PCR
amplification. For construction of the individual YRE mutants,
pAlter/FLR1 was mutagenized using the Altered Sites II in
vitro mutagenesis system (Promega Corp.). Oligonucleotides used
were as follows: 5'-ATGGGCGGGATAATTCTAGAGGTAAAAGGGGAAC for the YRE1 mutation;
5'-TGGTATCAATCATCTCTAGAATGGGCGGGATAAT for the YRE2
mutation; and 5'-CGTTATGATGGTGATCTAGAAGTATAGGAATGCC for the YRE3 mutation (mutated nucleotides are underlined). For construction of
the triple YRE mutant, the BamHI-HindIII
FLR1 promoter fragment carrying a mutated YRE3 was retrieved
from pAlter, cloned into M13mp8, and used as a template for the
simultaneous mutation of YRE1 and YRE2 using the Sculptor in
vitro mutagenesis system (Amersham Pharmacia Biotech). The
oligonucleotide used to mutate YRE1 and YRE2 was
5'-GTTCCCCTTTTACCTCTAGAATTATCCCGCCCATTCTAGAGATGATTGATACC (mutated nucleotides are underlined). The mutations were
confirmed by DNA sequencing. The resulting FLR1 fragments
were excised from pAlter (wild-type or individual mutations) or from
M13mp8 (triple mutation) by digestion with BamHI and
HindIII and cloned into YIp368. DNA sequence analysis
confirmed proper in-frame insertion of the different FLR1
promoter constructs with lacZ.
-galactosidase assays were performed as described previously (15).
Protein concentrations were determined by the method of Bradford (37) using bovine serum albumin as standard. A range of concentrations was
tested for each compound using the wild-type FLR1
promoter-lacZ construct in MRY13-1A cells (DA, 1-10
mM; DEM, 1-20 mM;
H2O2, 0.1-10 mM; t-BHP,
0.05-5 mM; MMS, 2-20 mM). Concentrations
yielding maximal induction of the promoter were chosen for further
experiments (2.5 mM for DA, 10 mM for DEM, 0.5 mM for H2O2, 0.6 mM for
t-BHP, and 10 mM for MMS). BN was only assayed
at 5 µM, a concentration previously shown to induce
FLR1 transcription (27).
cells transformed with pGEX-YAP350 were treated with
isopropyl-
-D-thiogalactoside (0.1 mM) for 4 h at 30 °C to induce the expression of
the fusion protein. The fusion protein was purified from a crude
bacterial lysate by affinity chromatography on immobilized glutathione
(38) and used to raise polyclonal antibodies in two New Zealand White rabbits, yielding antibodies of high titers (Y1 and Y2). The
specificity of these antisera for Yap1p was confirmed by Western blot
using extracts of yap1
and
YAP1-overexpressing strains. The Y1 antiserum and
corresponding pre-immune serum were used without any further purification for the supershift experiments.
-32P]ATP using T4 polynucleotide kinase. The
complementary oligonucleotides were mixed in 250 mM NaCl,
boiled for 3 min, and allowed to anneal at room temperature. The probes
were purified using G25-Sephadex columns (Amersham Pharmacia Biotech).
EMSAs (20 µl final volume) were performed with 20 µg of protein
extracts in a buffer containing 20 mM HEPES, pH 7.9, 50 mM NaCl, 5% glycerol, 1 mM EDTA, 5 mM MgCl2, 1 mM dithiothreitol, and
1 µg of poly(dI·dC). Where needed, 7.5 µl of the anti-Yap1p or
pre-immune serum were added to the above mixture, which was incubated
at room temperature for 20 min. The binding reactions were started by
the addition of the double-stranded 32P-labeled probe
(2 × 104 cpm) to the protein extracts and incubated
at room temperature for 20 min. The resulting complexes were loaded on
5% nondenaturing polyacrylamide gels and electrophoresed at 200 V at
4 °C for 5 h. Gels were dried and autoradiographed for 16 h at
80 °C using two intensifying screens (Eastman Kodak Co.).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
148 (YRE1; 5'-TTAGTCA),
167 (YRE2; 5'-TGACTAA), and
364 (YRE3; 5'-TTACTAA) relative to the ATG translation initiation codon (Fig.
1). YRE1 and YRE2 match the SV40
activator protein-1 recognition element as well as the YRE present in
the GSH1 promoter (5'-TGACTAA) (6), with YRE2 located on the
coding strand and YRE1 on the noncoding strand (Fig. 1). YRE3
corresponds to the sequence 5'-TTA(C/G)TAA present in the
TRX2, YCF1, GLR1, and ATR1
promoters (5, 9, 13, 14). To address the function of these YREs in the
transactivation of FLR1 by Yap1p, each of these sites was
individually mutated. The TTACTAA and TGACTAA
sequences were replaced with TCTAGAA (the 4-base pair
substitutions are underlined) (Fig. 1). The wild-type and mutated
FLR1 promoters were fused to the E. coli lacZ
gene in plasmid YIp368 (35). The resulting constructs as well as YIp368
as a negative control were integrated into strain MRY13-1A. Selected
integrants were transformed with the multicopy plasmid YEp352 (36) or
with YEp352 carrying the YAP1 gene under the control of its
own promoter (YEp352/YAP1) (15). It is believed that the overexpression
of YAP1 mimics conditions inducing Yap1p activity, such as
exposure to pro-oxidants (5, 20, 21), most probably by increasing the
concentration of Yap1p in the nucleus, where it can transactivate its
targets.
-Galactosidase activities were determined for each of the
cotransformants (Fig. 2).

View larger version (17K):
[in a new window]
Fig. 1.
Schematic representation of the
FLR1 promoter. The three potential YREs located
at positions
148 (YRE1),
167 (YRE2), and
364 (YRE3) are shown
(positions are relative to the translation initiation codon indicated
by the straight arrow). The mutations introduced
in individual (MutYRE1, MutYRE2, MutYRE3) or triple (Mut3YRE) YREs are
underlined. The arrows above and under the YREs
indicate the orientation of two half-sites centered around an internal
C, by analogy with those described for Gcn4p (51).

View larger version (17K):
[in a new window]
Fig. 2.
Yap1p transactivation of the FLR1
promoter. Plasmid YIp368 (CTL) or YIp368/FLR1
containing either the wild-type FLR1 promoter
(WT) or the FLR1 promoter carrying mutations in
the YRE sites (MutYRE1, MutYRE2,
MutYRE3, and Mut3YRE) and fused to the
lacZ gene were integrated in strain MRY13-1A at the
LEU2 locus. The resulting integrants were transformed with
plasmid YEp352 or YEp352/YAP1, and
-galactosidase activities were
determined. Values represent the average of three independent
experiments performed in duplicate.
-galactosidase activity, indicating that the FLR1
promoter is poorly transcribed under normal conditions. This result is
consistent with the very low levels of FLR1 RNA transcripts
detected by Northern blot in cells grown under normal conditions (15).
Cells carrying the wild-type FLR1 promoter and transformed
with the YEp352/YAP1 plasmid displayed a nearly 200-fold
increase in
-galactosidase activity, confirming that YAP1
overexpression strongly transactivates the FLR1 promoter.
Indeed, YAP1 overexpression produced no detectable
-galactosidase activity in cells carrying YIp368 but lacking the
FLR1 promoter (CTL). Mutations in any of the three YREs
decreased the ability of overexpressed Yap1p to transactivate the
FLR1 promoter-lacZ fusion. Mutation of the most
distal site (MutYRE3) had the most deleterious effect, causing a
decrease of ~90% in
-galactosidase activity when compared with
the wild-type FLR1 promoter. Mutation of YRE2 (MutYRE2) and
YRE1 (MutYRE1) resulted in a more moderate decrease in transactivation
levels, with a reduction in
-galactosidase activity of 75 and 40%,
respectively. These results demonstrate that (i) each of the three YREs
is functional and plays an important role in the optimal
transactivation of FLR1 by Yap1p and that (ii) the three
YREs are not functionally equivalent. Finally, simultaneous mutation of
the three YREs (Mut3YRE) completely abolished
-galactosidase
activity in cells carrying YEp352/YAP1, demonstrating that
the three identified YREs are essential for the transcriptional induction of FLR1 by Yap1p.
strain were used (Fig. 3,
lanes 6, 10, and 14). Second, this
complex was supershifted by the addition of the anti-Yap1p serum to the MRY13-1A protein extract before the binding reaction (Fig. 3, lanes 5, 9, and 13) but not by the
pre-immune serum under similar conditions (data not shown). Third,
Yap1p overexpression correlated with an increased amount of the complex
(Fig. 3, lanes 7, 11, and 15). In
addition, we found that Yap1p (both endogenous and overexpressed) binds
more efficiently to YRE3 than to YRE2 and finally to YRE1 (Fig. 3,
compare lanes 4, 8, and 12 for
endogenous Yap1p and lanes 7, 11, and
15 for overexpressed Yap1p). These data show that Yap1p
binds to the three YREs with different efficiency, a result consistent
with those of the transactivation assays (YRE3 > YRE2 > YRE1) (Fig. 2). Finally, we detected additional complexes (three slow-
and one fast-migrating) in the presence of the three protein extracts.
These complexes are not related to Yap1p because they are still present
with the extract from the yap1
strain (Fig. 3,
lanes 6, 10, and 14). Moreover, they
are not supershifted by the Yap1p antiserum (Fig. 3, lanes
5, 9, and 13), with the exception of the
fast-migrating complex, which shows decreased intensity in two of these
wells for reasons that are unclear (lanes 5 and
13). Nevertheless, our results demonstrate that Yap1p
transactivates FLR1 through binding to the three YREs
present in the promoter. They also provide evidence that the three YREs
are functional but that they do not contribute equally to the
transcriptional regulation of FLR1 by Yap1p.

View larger version (74K):
[in a new window]
Fig. 3.
Yap1p binds to the three YREs in the
FLR1 promoter. Double-stranded
32P-labeled oligonucleotides overlapping the YRE1, YRE2, or
YRE3 sequences were incubated with protein extracts prepared from
strains MRY13-1A [YEp352] (YAP1), NMY7 [YEp352]
(yap1
), or MRY13-1A [YEp352/YAP1] (YAP1
).
An anti-Yap1p polyclonal antibody was added (lanes 5,
9, and 13) for supershift analysis. The position
of the Yap1p-specific complexes is shown on the left (solid
arrow). Nonspecific complexes are indicated (dashed
arrow and brackets). The position of the wells and of
the free probes is also indicated on the left.
-galactosidase activity. We found that 2.5 mM DA and 10 mM DEM caused a strong increase in
-galactosidase
activity (35- and 25-fold, respectively), whereas
H2O2 at 0.5 mM and t-BHP
at 0.6 mM resulted in a more moderate but still significant
increase (5- and 4-fold, respectively), indicating that FLR1
transcription is induced by these oxidative agents (Fig.
4, WT). Mutations in YRE2 and
YRE3 significantly reduced the level of transactivation achieved upon
DA, DEM, H2O2, and t-BHP exposure,
whereas mutation in YRE1 had a slight effect only on activation by DA,
DEM, and t-BHP. The relative importance of each site was
YRE2 > YRE3 > YRE1 for DA, H2O2 and
t-BHP and YRE3 > YRE2 > YRE1 for DEM. Mutation
of the three YREs completely abolished the transactivation of
FLR1 induced by the three compounds. These results show that
the three YREs are necessary for maximal induction, suggesting a direct
involvement of Yap1p in the process. To test this hypothesis, the
YIp368 plasmid carrying the wild-type FLR1 promoter fused to
lacZ was integrated into strain NMY7 in which
YAP1 is deleted. This integrant showed no induction of
FLR1-lacZ transactivation upon DA, DEM,
H2O2, or t-BHP exposure, confirming the essential role of Yap1p in the induction (Fig. 4,
yap1
). Taken together, our results demonstrate that
FLR1 transcription is induced upon oxidative stress and that
this induction is mediated by Yap1p through the three YREs present in
the FLR1 promoter.

View larger version (14K):
[in a new window]
Fig. 4.
Yap1p-mediated transactivation of the
FLR1 promoter in response to oxidants, drugs, and
alkylating agents. Plasmid YIp368/FLR1 containing the wild-type
FLR1 promoter fused to the lacZ gene
(WT) or YIp368 derivatives containing the FLR1
promoter mutated in the YRE sites (MutYRE1,
MutYRE2, MutYRE3, and Mut3YRE) were
integrated in strain MRY13-1A (YAP1). YIp368/FLR1
(WT) was also integrated in strain NMY7
(yap1
). The resulting integrants were grown in the
absence (
) or in the presence (+) of either DA (2.5 mM),
DEM (10 mM), H2O2 (0.5 mM), t-BHP (0.6 mM), BN (5 µM), or MMS (10 mM) for 1 h before
measuring
-galactosidase activity. Values represent the average of
three independent experiments performed in duplicate.
)
FLR1-lacZ integrants to investigate a potential
role for Yap1p in this induction. As expected, we observed a strong
increase in
-galactosidase activity upon exposure of MRY13-1A cells
to BN (75-fold) as compared with untreated cells (Fig. 4, BN
and WT). However, no significant
-galactosidase activity was detected with the NMY7 FLR1-lacZ integrant
under the same conditions, demonstrating that Yap1p is essential for
the induction. Mutation in any of the YREs decreased the level of
FLR1 induction by BN, with the relative contribution of the
YREs being YRE3 > YRE2 > YRE1 (Fig. 4, BN). As
observed for the oxidants, the simultaneous mutation of the three YREs
completely abolished the induction by BN. Thus, our results clearly
demonstrate that the induction of FLR1 transcription by BN
is mediated by Yap1p through the three YREs. Potential physical or
genetic interactions between Yap1p and Pdr3p mediating the induction of
FLR1 by BN remains to be elucidated.
-galactosidase activity determination. Our results showed a 40-fold
increase in
-galactosidase activities for the YAP1 cells
exposed to MMS as compared with untreated cells, whereas
yap1
FLR1-lacZ cells showed no
detectable activity (Fig. 4, MMS). These results demonstrate that MMS induces FLR1 expression at the transcriptional
level, and this induction is mediated by Yap1p. Mutation in any of the YREs similarly decreased the level of FLR1 induction by
~50-60%, whereas mutation of the three YREs completely abolished
the induction (Fig. 4, MMS). Finally, we found that the
pro-oxidant MD and the drug fluconazole were unable to induce
FLR1 transcription over a wide range of concentrations
tested (data not shown), demonstrating that the induction of
FLR1 by DA, DEM, H2O2,
t-BHP, BN, and MMS is specific. Taken together, our results
demonstrate that the expression of FLR1 is induced by Yap1p
in response to different classes of compounds. They also suggest that
this induction is mediated by the direct binding of Yap1p to the three
YREs in the FLR1 promoter.
) isogenic strains transformed with plasmids YEp352
or YEp352/YAP1 (15) were tested for their ability to grow in the
presence of increasing concentrations of these compounds using a
microtiter plate growth inhibition assay (Fig.
5A). MD was also included in
the assay. We found that overexpression of YAP1 in the
wild-type strain (MRY13-1A [YEp352/YAP1]) resulted in a significant
level of resistance to DA and MD that was strongly reduced in the
flr1
background (MRY13-1B [YEp352/YAP1]), indicating
that FLR1 is the major target of Yap1p conferring resistance
to these compounds in S. cerevisiae. MRY13-1B [YEp352/YAP1] cells still retained a low level of resistance to DA
and MD when compared with MRY13-1B [YEp352] cells, indicating the
involvement of other YAP1-regulated molecular determinants of DA and MD resistance in S. cerevisiae, potentially
YCF1 in the case of DA (43). Similarly, overexpression of
YAP1 in MRY13-1A caused a significant level of resistance to
DEM that was reduced by the flr1
deletion, demonstrating
that YAP1 overexpression confers resistance to DEM and that
FLR1 contributes to this resistance. Finally,
YAP1 overexpression in MRY13-1A was found to confer
hypersensitivity to H2O2 (Fig. 5A,
H2O2; compare MRY13-1A [YEp352] and MRY13-1A [YEp352/YAP1]), as previously observed with
constitutively active Yap1p mutants lacking the CRD (24). Surprisingly,
however, this phenotype was reversed upon deletion of FLR1
(Fig. 5A, H2O2; compare MRY13-1A [YEp352/YAP1] and MRY13-1B [YEp352/YAP1]),
indicating that YAP1-induced hypersensitivity to
H2O2 is mediated, at least in part, by
FLR1. In line with this, MRY13-1A wild-type cells were more
sensitive to H2O2 than the MRY13-1B cells
carrying the flr1 deletion (compare MRY13-1A [YEP352] and
MRY13-1B [YEP352]), confirming that FLR1 expression
confers H2O2 hypersensitivity.

View larger version (28K):
[in a new window]
Fig. 5.
FLR1 overexpression affects cell tolerance to
different oxidants. A, growth assays were performed
with strains MRY13-1A (FLR1) and MRY13-1B
(flr1
) carrying plasmids YEp352 or YEp352/YAP1. MRY13-1A
[YEp352/YAP1] (closed squares), MRY13-1B [YEp352/YAP1]
(open squares), MRY13-1A [YEp352] (closed
circles), MRY13-1B [YEp352] (open circles).
B, growth assays were performed with strain MRY13-1A
[p425GPD/FLR1] (squares) or MRY13-1A [p425GPD]
(circles). The cells were grown in selective medium in the
absence or in the presence of the indicated compounds for 48 h.
Cell growth is expressed as the percentage of growth in
oxidant-containing medium relative to control growth in oxidant-free
medium. Values represent the average of three independent experiments
performed in duplicate.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
439 (5'-TGCGCGGA) for binding of the two homologous
transcription factors Pdr1p and Pdr3p involved in MDR (27). However,
the functionality of these sequences has yet to be determined. Yap1p
has also been shown to collaborate with the transcription factor Skn7p
to regulate the expression of different target genes in response to
H2O2 (8, 12). A consensus DNA binding sequence
has not been precisely defined for Skn7p; it is thus not possible to
predict whether this protein can bind to the FLR1 promoter.
Interestingly, we also found that the relative importance of the three
YREs varies with the inducer. Induction of the FLR1 promoter
by DEM and BN resulted in a relative importance of the three YREs
similar to that observed upon YAP1 overexpression (YRE3 > YRE2 > YRE1) (Fig. 4). However, YRE2 was found to be more
important than YRE3 for the induction of FLR1 by DA,
H2O2, and t-BHP (YRE2 > YRE3 > YRE1), whereas the three YREs were similarly involved in
the induction by MMS (YRE3
YRE2
YRE1). The molecular basis for
these differences is unclear. It is possible that different
posttranslational modifications of Yap1p and/or binding to the
FLR1 promoter of additional regulatory factors underlie the
relative importance of the three YREs in response to specific inducers.
and
FLR1 strains overexpressing or not YAP1. These
strains have proven useful in addressing the role of Yap1p in the
tolerance of cells to a given compound and evaluating the contribution
of Flr1p to this tolerance (15). In parallel, we also tested a strain
overexpressing the FLR1 ORF under the control of a strong
constitutive promoter. Our results show that FLR1
overexpression, achieved either from Yap1p overexpression or from the
heterologous promoter, confers resistance to DA, MD, and to a lesser
extent, DEM (Fig. 5). It had been shown that a yap1 deletion
confers hypersensitivity to DA and MD and that YAP1
overexpression confers resistance to DA (5, 45), but the targets of
Yap1p mediating these phenotypes were not known. The results presented
here clearly demonstrate that FLR1 is the major target of
Yap1p mediating resistance to both compounds in S. cerevisiae. Moreover, our results also show that YAP1
overexpression confers resistance to DEM and that FLR1 is
one of the Yap1p targets mediating this resistance. These results constitute, to our knowledge, the first demonstration that a major facilitator behaves as a determinant of resistance to oxidants. Whether
Flr1p functions by mediating the direct extracellular transport of
these compounds, either unmodified or coupled to glutathione (47-49),
by indirectly regulating the function of other proteins, including
transporters, or by introducing changes in the plasma membrane
properties affecting cell tolerance to these compounds remains to be elucidated.
background results in H2O2 resistance rather
than hypersensitivity (Fig. 5A). Moreover, constitutively
active mutants of Yap1p lacking the CRD have also been shown to confer
resistance to diamide but hypersensitivity to
H2O2, although the same mutants were
transcriptionally competent in the presence of either diamide or
H2O2 (24). Given our results, it is possible
that the H2O2 hypersensitivity observed for
these mutants results from the transactivation of FLR1. The
mechanism by which FLR1 expression sensitizes the cells to
H2O2 is not known. However, this phenomenon is
not restricted to major facilitators since overexpression of the
CDR2 gene, which codes for a transporter of the ATP binding
cassette family in Candida albicans, was also found to
confer diamide resistance but H2O2
hypersensitivity.2 It remains
to be seen if transporter-mediated H2O2
hypersensitivity is specific for FLR1 or also extends to
other transporters regulated by Yap1p such as YCF1 and
ATR1 (13, 14).
| |
ACKNOWLEDGEMENT |
|---|
We are grateful to Dr. Bernard Turcotte (McGill University, Montreal) for critically reading the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported by Medical Research Council of Canada Grant MT-15679 (to M. R.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Supported by a scholarship from le Fonds de la Recherche en
Santé du Québec (FRSQ). To whom correspondence should be
addressed: Institut de Recherches Cliniques de Montréal, 110 Pine
Ave. West, Montréal, Québec, Canada H2W 1R7. Tel.:
514-987-5770; Fax: 514-987-5764; E-mail: raymonm@ircm.qc.ca.
Published, JBC Papers in Press, October 30, 2000, DOI 10.1074/jbc.M008377200
2 S. Weber, C. Gauthier, A.-M. Alarco, R. Daoud, E. Georges, and M. Raymond, submitted for publication.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: MDR, multidrug resistance; BN, benomyl; CRD, cysteine-rich domain; DA, diamide; DEM, diethylmaleate; EMSA, electrophoretic mobility shift assay; FLR1, fluconazole resistance 1; MMS, methylmethane sulfonate; MD, menadione; ORF, open reading frame; PCR, polymerase chain reaction; t-BHP, tert-butyl hydroperoxide; YRE, Yap1p response element; SD, synthetic dextrose; WT, wild type; GPD, glyceraldehyde-3-phosphate dehydrogenase.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Bauer, B. E., Wolfger, H., and Kuchler, K. (1999) Biochim. Biophys. Acta 1461, 217-236 |
| 2. | Toone, W. M., and Jones, N. (1999) Curr. Opin. Genet. Dev. 9, 55-61 |
| 3. | Kolaczkowska, A., and Goffeau, A. (1999) Drug Resist Update. 2, 403-414 |
| 4. | Moye-Rowley, W. S., Harshman, K. D., and Parker, C. S. (1989) Genes Dev. 3, 283-292 |
| 5. | Kuge, S., and Jones, N. (1994) EMBO J. 13, 655-664 |
| 6. | Wu, A. L., and Moye-Rowley, W. S. (1994) Mol. Cell. Biol. 14, 5832-5839 |
| 7. | Sugiyama, K., Izawa, S., and Inoue, Y. (2000) J. Biol. Chem. 275, 15535-15540 |
| 8. | Morgan, B. A., Banks, G. R., Toone, W. M., Raitt, D., Kuge, S., and Johnston, L. H. (1997) EMBO J. 16, 1035-1044 |
| 9. | Grant, C. M., Collinson, L. P., Roe, J.-H., and Dawes, I. W. (1996) Mol. Microbiol. 21, 171-179 |
| 10. | Inoue, Y., Matsuda, T., Sugiyama, K., Izawa, S., and Kimura, A. (1999) J. Biol. Chem. 274, 27002-27009 |
| 11. | Lee, J., Godon, C., Lagniel, G., Spector, D., Garin, J., Labarre, J., and Toledano, M. B. (1999) J. Biol. Chem. 274, 16040-16046 |
| 12. | Lee, J., Spector, D., Godon, C., Labarre, J., and Toledano, M. B. (1999) J. Biol. Chem. 274, 4537-4544 |
| 13. | Wemmie, J. A., Szczypka, M. S., Thiele, D. J., and Moye-Rowley, W. S. (1994) J. Biol. Chem. 269, 32592-32597 |
| 14. | Coleman, S. T., Tseng, E., and Moye-Rowley, W. S. (1997) J. Biol. Chem. 272, 23224-23230 |
| 15. | Alarco, A. M., Balan, I., Talibi, D., Mainville, N., and Raymond, M. (1997) J. Biol. Chem. 272, 19304-19313 |
| 16. | DeRisi, J. L., Iyer, V. R., and Brown, P. O. (1997) Science 278, 680-686 |
| 17. | Dumond, H., Danielou, N., Pinto, M., and Bolotin-Fukuhara, M. (2000) Mol. Microbiol. 36, 830-845 |
| 18. | Harshman, K. D., Moye-Rowley, W. S., and Parker, C. S. (1988) Cell 53, 321-330 |
| 19. | Fernandes, L., Rodrigues-Pousada, C., and Struhl, K. (1997) Mol. Cell. Biol. 17, 6982-6993 |
| 20. | Kuge, S., Jones, N., and Nomoto, A. (1997) EMBO J. 16, 1710-1720 |
| 21. | Kuge, S., Toda, T., Iizuka, N., and Nomoto, A. (1998) Genes Cells 3, 521-532 |
| 22. | Yan, C., Lee, L. H., and Davis, L. I. (1998) EMBO J. 17, 7416-7429 |
| 23. | Kudo, N., Taoka, H., Toda, T., Yoshida, M., and Horinouchi, S. (1999) J. Biol. Chem. 274, 15151-15158 |
| 24. | Coleman, S. T., Epping, E. A., Steggerda, S. M., and Moye-Rowley, W. S. (1999) Mol. Cell. Biol. 19, 8302-8313 |
| 25. | Nelissen, B., De Wachter, R., and Goffeau, A. (1997) FEMS Microbiol. Rev. 21, 113-134 |
| 26. | Oskouian, B., and Saba, J. D. (1999) Mol. Gen. Genet. 261, 346-353 |
| 27. | Broco, N., Tenreiro, S., Viegas, C. A., and Sa-Correia, I. (1999) Yeast 15, 1595-1608 |
| 28. | Jungwirth, H., Wendler, F., Platzer, B., Bergler, H., and Hogenauer, G. (2000) Eur. J. Biochem. 267, 4809-4816 |
| 29. | Winston, F., Dollard, C., and Ricupero-Hovasse, S. L. (1995) Yeast 11, 53-55 |
| 30. | Sherman, F. (1991) Methods Enzymol. 194, 3-21 |
| 31. | Ito, H., Fukuda, Y., Murata, K., and Kimura, A. (1983) J. Bacteriol. 153, 163-168 |
| 32. | Baudin, A., Ozier-Kalogeropoulos, O., Denouel, A., Lacroute, F., and Cullin, C. (1993) Nucleic Acids Res. 21, 3329-3330 |
| 33. | Jones, J. S., and Prakash, L. (1990) Yeast 6, 363-366 |
| 34. | Wemmie, J. A., Wu, A. L., Harshman, K. D., Parker, C. S., and Moye-Rowley, W. S. (1994) J. Biol. Chem. 269, 14690-14697 |
| 35. | Myers, A. M., Tzagoloff, A., Kinney, D. M., and Lusty, C. J. (1986) Gene 45, 299-310 |
| 36. | Hill, J. E., Myers, A. M., Koerner, T. J., and Tzagoloff, A. (1986) Yeast 2, 163-167 |
| 37. | Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 |
| 38. | Smith, D. B., and Johnson, K. S. (1988) Gene 67, 31-40 |
| 39. | Hellauer, K., Rochon, M. H., and Turcotte, B. (1996) Mol. Cell. Biol. 16, 6096-6102 |
| 40. | Mumberg, D., Muller, R., and Funk, M. (1995) Gene 156, 119-122 |
| 41. | Wemmie, J. A., Steggerda, S. M., and Moye-Rowley, W. S. (1997) J. Biol. Chem. 272, 7908-7914 |
| 42. | Jelinsky, S. A., and Samson, L. D. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 1486-1491 |
| 43. | Wemmie, J. A., and Moye-Rowley, W. S. (1997) Mol. Microbiol. 25, 683-694 |
| 44. | Marchler, G., Schuller, C., Adam, G., and Ruis, H. (1993) EMBO J. 12, 1997-2003 |
| 45. | Stephen, D. W., Rivers, S. L., and Jamieson, D. J. (1995) Mol. Microbiol. 16, 415-423 |
| 46. | Stephen, D. W., and Jamieson, D. J. (1997) Mol. Microbiol. 23, 203-210 |
| 47. | Kosower, N. S., and Kosower, E. M. (1995) Methods Enzymol. 251, 123-133 |
| 48. | Zadzinski, R., Fortuniak, A., Bilinski, T., Grey, M., and Bartosz, G. (1998) Biochem. Mol. Biol. Int. 44, 747-759 |
| 49. | Meister, A. (1985) Methods Enzymol. 113, 571-585 |
| 50. | Santoni-Rugiu, E., and Silverman, J. A. (1997) Carcinogenesis 18, 2255-2263 |
| 51. | Ellenberger, T. E., Brandl, C. J., Struhl, K., and Harrison, S. C. (1992) Cell 71, 1223-1237 |
This article has been cited by other articles:
![]() |
L. Omberg, G. H. Golub, and O. Alter A tensor higher-order singular value decomposition for integrative analysis of DNA microarray data from different studies PNAS, November 20, 2007; 104(47): 18371 - 18376. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Rognon, Z. Kozovska, A. T. Coste, G. Pardini, and D. Sanglard Identification of promoter elements responsible for the regulation of MDR1 from Candida albicans, a major facilitator transporter involved in azole resistance Microbiology, December 1, 2006; 152(12): 3701 - 3722. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Romero, P. Desai, N. DeLillo, and A. Vancura Expression of FLR1 Transporter Requires Phospholipase C and Is Repressed by Mediator J. Biol. Chem., March 3, 2006; 281(9): 5677 - 5685. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Srikantha, R. Zhao, K. Daniels, J. Radke, and D. R. Soll Phenotypic Switching in Candida glabrata Accompanied by Changes in Expression of Genes with Deduced Functions in Copper Detoxification and Stress Eukaryot. Cell, August 1, 2005; 4(8): 1434 - 1445. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Harry, B. G. Oliver, J. L. Song, P. M. Silver, J. T. Little, J. Choiniere, and T. C. White Drug-Induced Regulation of the MDR1 Promoter in Candida albicans Antimicrob. Agents Chemother., July 1, 2005; 49(7): 2785 - 2792. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lucau-Danila, G. Lelandais, Z. Kozovska, V. Tanty, T. Delaveau, F. Devaux, and C. Jacq Early Expression of Yeast Genes Affected by Chemical Stress Mol. Cell. Biol., March 1, 2005; 25(5): 1860 - 1868. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lev, R. Hadar, P. Amedeo, S. E. Baker, O. C. Yoder, and B. A. Horwitz Activation of an AP1-Like Transcription Factor of the Maize Pathogen Cochliobolus heterostrophus in Response to Oxidative Stress and Plant Signals Eukaryot. Cell, February 1, 2005; 4(2): 443 - 454. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Silver, B. G. Oliver, and T. C. White Role of Candida albicans Transcription Factor Upc2p in Drug Resistance and Sterol Metabolism Eukaryot. Cell, December 1, 2004; 3(6): 1391 - 1397. [Abstract] [Full Text] [PDF] |
||||
![]() |
|