Originally published In Press as doi:10.1074/jbc.M008681200 on November 1, 2000
J. Biol. Chem., Vol. 276, Issue 2, 1164-1172, January 12, 2001
KiSS-1 Represses 92-kDa Type IV Collagenase
Expression by Down-regulating NF-
B Binding to the Promoter as a
Consequence of I
B
-induced Block of p65/p50 Nuclear
Translocation*
Chunhong
Yan,
Heng
Wang, and
Douglas D.
Boyd
From the Department of Cancer Biology, MD Anderson Cancer Center,
Houston, Texas 77030
Received for publication, September 22, 2000, and in revised form, October 20, 2000
 |
ABSTRACT |
The 92-kDa type IV collagenase (MMP-9) plays a
critical role in tissue remodeling. We undertook a study to determine
whether the KiSS-1 gene, previously shown to
suppress cancer spread (metastases), negatively regulates MMP-9
expression. Six cell lines positive for MMP-9 mRNA were
deficient in KiSS-1 mRNA. One of these cell lines,
HT-1080, stably transfected with a KiSS-1 expression
construct, demonstrated substantially lower MMP-9 enzyme
activity/protein and in vitro invasiveness. The lower MMP-9
enzyme activity reflected reduced steady-state mRNA levels which,
in turn, was due to attenuated transcription. Activation of ERKs and
JNKs by phorbol 12-myristate 13-acetate and tumor necrosis
factor
, respectively, leading to increased MMP-9 amounts was not
antagonized by KiSS-1 expression, suggesting that MAPK
pathways modulating MMP-9 synthesis are not the target of
KiSS-1. Although MMP-9 expression is regulated by AP-1,
Sp1, and Ets transcription factors, KiSS-1 did not alter the binding of these factors to the MMP-9 promoter. However, NF-
B binding to the MMP-9 promoter required for expression of this collagenase was reduced by KiSS-1 expression. Diminished
NF-
B binding reflected less p50/p65 in the nucleus secondary to
increased I
B
levels in the cytosols of the KiSS-1
transfectants. Thus, KiSS-1 diminishes MMP-9 expression by
effecting reduced NF-
B binding to the promoter.
 |
INTRODUCTION |
Tissue remodeling in physiological and pathological conditions
such as trophoblast implantation, bone development, angiogenesis (1-3), and the spread of cancer (invasion/metastases) (4-6) requires
proteolytic action to degrade the surrounding extracellular matrix and
to activate cytokines such as tumor growth factor
and interleukin
1
(2, 3). There is now compelling evidence implicating the type IV
collagen-degrading 92-kDa type IV collagenase (MMP-9) (4, 7, 8) in
these processes. Thus, mice null for the MMP-9 gene exhibited an
abnormal pattern of skeletal growth plate vascularization (1).
Additionally, MMP-9 was shown to be required for human bronchial
epithelial cell migration and spreading following injury (9). In
cancer, MMP-9 mRNA/protein is produced in both cancer and normal
cells (10-12), and there is strong evidence implicating this type IV
collagenase in the spread of the disease. Thus, Bernhard et
al. (7) reported that the overexpression of this metalloproteinase
in nonmetastatic rat embryo cells conferred a metastatic phenotype upon
these cells. In contrast, inhibition of MMP-9 expression by a ribozyme
blocked metastasis of rat sarcoma cells (6).
The MMP-9 gene, located on chromosome 20 (13), covers 13 exons spanning
7.7 kilobases. Transcription gives rise to a 2.5-kilobase mRNA (14,
15). Translation of the message produces a 92-kDa precursor that is
subsequently processed by the proteolytic removal of 73 amino acids at
the amino terminus of the metalloproteinase (8, 16-18). The activity
of the enzyme is controlled by the levels of physiological inhibitors
including tissue inhibitor of metalloproteinases 1 and 2, which form
noncovalent bonds with the enzyme (19, 20).
Regulation of MMP-9 protein levels has been ascribed to transcriptional
activation of the gene (21) and to reduced mRNA turnover (22). The
5' flanking sequence contains putative binding sites for AP-1, NF-
B,
Sp1, and Ets transcription factors within the first 670 base pairs, and
these have been implicated in the induction of MMP-9 gene expression by
TNF-
,1 v-Src, c-Ha-Ras,
Tat, and contact inhibition using transient transfection of cultured
cells (15, 21, 23-26). In addition, studies with transgenic mice have
demonstrated the requirement of regions
522/+19 and
2722/
7745 for developmental regulation in mice (27) and for
tissue-specific expression in osteoclasts and migrating keratinocytes,
respectively (27, 28).
Although MMP-9 has been implicated in the invasive/metastatic phentoype
of many cancers, how its expression is regulated is still poorly
understood. In the last 5 years, a great deal of interest has been
focused on a group of genes collectively referred to as
metastases-associated genes, which modulate cancer metastases but not
tumorigenesis (29, 30). One of these is the KiSS-1 gene,
which was discovered by subtractive hybridization and is reduced in its
expression in metastatic cancer (31). Further, its enforced expression
in MDA-MB-435 breast cancer cells and melanoma suppressed the
metastatic potential of these cells by 95% without affecting their
tumorigenicity (31, 32). The KiSS-1 gene is comprised of 4 exons, the first two of which are not translated. The third exon
contains 38 noncoding base pairs at the 5' end followed by 100 base
pairs of translated sequence. The terminal exon contains 332 base pairs
of translated sequence. The gene maps to chromosome 1q32 (33), and its
sequence predicts a unique hydrophilic 145-amino acid protein with a
leader sequence and a predicted molecular mass of 15.4 kDa (34).
However, the mechanism by which KiSS-1 represses the
metastatic phenotype is unknown. Because MMP-9 has a well established
role in tumor cell invasion and metastases, we undertook the present
study to determine whether the expression of this collagenase is
regulated by KiSS-1.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture and Stable Transfections--
HT-1080 cells were
maintained in McCoys 5A medium supplemented with 10% fetal bovine
serum. For stable transfections, cells were transfected at ~60%
confluence using poly-L-ornithine as described previously
(35). Essentially, the cells were incubated with 20 µg of DNA and 9.3 µg of poly-L-ornithine (Sigma) for 6 h and
then shocked for 4 min with 25% glycerol. Cells were incubated for 2 days and then selected with 600 µg/ml of G418 (active concentration). Clones were isolated, expanded, and screened for KiSS-1
cDNA integration by PCR.
Invasion Assays--
These were carried out as described
previously but with minor modifications (36). Briefly, Matrigel® was
diluted in cold serum-free medium, and 25 µg of the preparation was
added to the porous filters (pore size, 8 µm) and allowed to gel at
37 °C. Cells are dispersed with
Ca2+/Mg2+-free medium containing 3 mM EDTA, and 250,000 cells dispensed into the Transwell®.
The Transwell® was subsequently inserted into a well, with the latter
also containing culture medium. The cells were incubated at 37 °C
for 5 h. After this time, cells on both the upper and lower
aspects of the membrane were stained with Diff-Quik (Baxter Scientific
Products, McGaw Park, IL) and enumerated.
Northern Blotting--
The level of steady state mRNAs was
determined by Northern blot analysis (37). Total cellular RNA was
extracted from 90% confluent cultures using 5.0 M
guanidinium isothiocyanate and purified on a cesium chloride cushion
(5.7 M) by centrifugation at 150,000 × g
for 20 h. Purified RNA was electrophoresed in a 1.5%
agarose-formaldehyde gel and transferred to Nytran-modified nylon by
capillary action using 10× SSC. The Northern blot was probed at
42 °C with random-primed radiolabeled cDNAs (38). The
KiSS-1 cDNA coding sequence was generated by restriction
digestion of the KiSS-1 expression plasmid with
XhoI/BamHI, yielding a 0.7-kilobase fragment. The
blots were then washed at 65 °C using 0.25× SSC in the presence of
0.75% SDS. Loading efficiencies were checked by reprobing the blot
with a radioactive GAPDH cDNA.
Nuclear Run-on Experiments--
Nuclear run-on experiments were
as described previously (39). Nuclei from ~6 × 107
cells were isolated and incubated in the presence of
[
32P]-labeled UTP in transcription buffer (150 mM KCl, 5 mM MgCl2, 1 mM MnCl2, 20 mM Hepes, pH 7.9, 10%
glycerol, 5 mM DTT). Nuclei were then treated with DNase I
and proteinase K, and the RNA was extracted with phenol/chloroform and
precipitated. Radioactive RNA (6.6 × 107 cpm) was
hybridized to nylon-immobilized cDNAs corresponding to MMP-9 (38),
MMP-2 (40), and GAPDH. Quantitation of the data was accomplished using
QuantityOne® software (Bio-Rad).
Mobility Shift Assays (EMSA)--
Nuclear extract was prepared
essentially as described elsewhere (41). Cultured cells were collected
by centrifugation, washed, and suspended in a buffer containing 10 mM Hepes, pH 7.9, 10 mM KCl, 0.1 mM
EDTA, 0.1 mM EGTA, 1 mM DTT, and 0.5 mM PMSF. After 15 min on ice, the cells were vortexed in
the presence of 0.5% Nonidet P-40. The nuclear pellet was then
collected by centrifugation and extracted in a buffer containing 20 mM Hepes, pH 7.9, 0.4 M NaCl, 1 mM
EDTA, 1 mM EGTA, 1 mM DTT, and 1 mM
PMSF for 15 min at 4 °C.
Nuclear extract (10-20 µg) was preincubated at 4 °C for 30 min
with 1 µg of the indicated antibody or a 100-fold excess of an
unlabeled oligonucleotide spanning the MMP-9 cis element of interest. The sequences were as follows: AP-1, CTGACCCCTGAGTCAGCACTT; NF-
B, CAGTGGAATTCCCCAGCC; Ets, GGAGAGGAAGCT; and Sp-1,
TCCTTCCGCCCCCA. After this time, the reaction mixture was incubated at
4 °C for 20 min in a buffer (25 mM Hepes buffer, pH 7.9, 0.5 mM EDTA, 0.5 mM DTT, 0.05 M
NaCl, and 2.5% glycerol) with 2 µg of poly(dI·dC) and 5 fmol (2 × 104 cpm) of a Klenow end-labeled
([32P]ATP) oligonucleotide that spans the DNA binding
site in the MMP-9 promoter. The reaction mixture was electrophoresed at
4 °C in a 6% polyacrylamide gel using TBE (89 mM Tris,
89 mM boric acid, and 1 mM EDTA) running
buffer. The gel was rinsed with water, dried, and exposed to x-ray film overnight.
Zymography--
Zymography was performed as described
previously (24). Culture supernatants were denatured in the absence of
reducing agent and were electrophoresed in a 7.5% polyacrylamide gel
containing 0.1% (w/v) gelatin. The gel was incubated at room
temperature for 2 h in the presence of 2.5% Triton X-100 and
subsequently at 37 °C overnight in a buffer containing 10 mM CaCl2, 0.15 M NaCl, and 50 mM Tris, pH 7.5. The gel was then stained for protein with
0.25% Coomassie and photographed on a light box. Proteolysis was
detected as a white zone in a dark field.
Western Blotting--
For analysis of p65 and p50 NF-
B
proteins and I
B (42), 2-3 × 106 cells were washed
with cold phosphate-buffered saline and were suspended in lysis buffer
(10 mM Hepes, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5 mM PMSF, and proteinase inhibitors). The cells were allowed
to swell on ice for 10 min, after which 20 µl of 10% Nonidet P-40
was added. The samples were then vortexed and centrifuged for 30 s
at 12,000 × g. Supernatants were saved as cytosol
extract, whereas the pellets were resuspended in ice-cold nuclear
extraction buffer (20 mM Hepes, pH 7.9, 0.4 M
NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM
DTT, 1 mM PMSF, and proteinase inhibitors). The nuclear
pellets were incubated on ice for 30 min followed by centrifugation for
5 min at 12,000 × g at 4 °C. The supernatants were
retained as nuclear extract.
For the ERK and JNK1 immunoblotting, the cells were lysed in RIPA
buffer (50 mM Tris-HCl, pH 7.4, 1% Nonidet P-40, 0.25%
sodium deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM NaF, 1 mM Na3VO4, 1 mM PMSF, and 1 µg/ml aprotinin, leupeptin, and pepstatin)
on ice for 30 min. The cell lysates were then cleared by
centrifugation, and the protein contents were determined by BCA assay.
Proteins (60 µg) or conditioned medium were resolved in
polyacrylamide gels and then transferred to nitrocellulose membrane. The blot was blocked in 5% milk solution and incubated in primary antibody solution at 4 °C overnight. The antibodies to
phosphorylated JNKs and ERKs was purchased from New England Biolabs
(Beverley, MA) (catalog number 9251S) and Promega (Madison, WI)
(catalog number V8031), respectively. A mouse monoclonal antibody
(catalog number 1M10L) (Oncogene Research Products, Cambridge, MA) was used for the detection of MMP-9. All the other antibodies were purchased from Santa Cruz Biotechnology. After being washed with TBS
(10 mM Tris-HCl, pH 8.0, 150 mM NaCl) buffer,
the blot was incubated with an horseradish peroxidase-conjugated
secondary antibody, and proteins were visualized with ECL reagents
(PerkinElmer Life Sciences) according to the manufacturer's recommendation.
PCR--
To verify the insertion of KiSS-1 cDNA into the
genome, PCR was performed using genomic DNA as the template. To prepare
the genomic DNA, the cells were lysed in a solution containing 10 mM Tris-HCl, pH 8.0, 100 mM EDTA, pH 8.0, 20 µg/ml RNase A, and 0.5% SDS at 37 °C for 1 h. The cell
lysates were then treated with 100 µg/ml proteinase K at 50 °C
overnight and extracted twice with phenol/chloroform (1:1). DNA was
precipitated with ammonium acetate/ethanol.
The PCR reaction mixture contained 50 ng of genomic DNA, 1.5 mM MgCl2, 0.2 mM each of dATP,
dTTP, dGTP, and dCTP, 0.5 µM of each of the primers, and
1× Q solution (Qiagen). The upstream primer
(5'-CCACTGCTTACTGGCTTATCG-3') was complementary to the cytomegalovirus
promoter sequence in the plasmid pcDNA3, whereas the downstream
primer (5'-CAGTAGCAGCAGGCTTCCTC-3') was complementary to the KiSS-1
cDNA sequence (nucleotides 376 to 395). After the template genomic
DNA was denatured at 95 °C, the PCR reaction was initiated by adding
1 unit of Taq DNA polymerase (Qiagen). The template was
amplified for 32 cycles. Each PCR cycle consisted of denaturation at
95 °C, annealing at 65 °C, and extension at 72 °C (1 min, 1 min, and 40 s, respectively). The PCR cycles were terminated by
extending at 72 °C for 7 min. The PCR products were resolved in a
2% agarose gel.
RT-PCR--
Total RNA was isolated from cultured cells using the
TRIZOL reagent (Life Technologies, Inc.) according to the
manufacturer's instructions. After denaturation at 65 °C for 5 min,
RNA (2 µg) was added to 20 µl of RT mixture (10 µg/ml oligo(dT),
1× RT buffer (Promega, Madison, WI), 0.5 mM each of four
deoxynucleosides, 1 unit/µl RNasein (Promega, Madison, WI, USA), and
10 units of avian myeloblastosis virus reverse transcriptase
(Promega, Madison, WI)). The RNA was reverse transcribed at 42 °C
for 60 min, and 2 µl of the products were used as the template for
multiplex PCR, which contains both the target KiSS-1, MMP-9 or MMP-2
primers, and
-actin primers for normalization. The primers used were
MMP-9 (PCR product size, 120 bp), 5'-GAGGTTCGACGTGAAGGCGCAGATG-3' and 5'-CATAGGT-CACGTAGCCCACTTGGTC-3'; MMP-2 (PCR product size, 447 bp),
5'-ACCTGGATGCCGTCGTGGAC-3' and 5'-TGTGGCAGCACCAGGGCAGC-3'; KiSS-1 (PCR
product size, 389 bp), 5'-AATTCTAGACCCACAGGCCA-3' and
5'-GCATGCTCTGACTCCTTTGGG-3'; and
-actin (product size, 621 bp),
5'-ACACTGTGCCCATCTACGAGG-3' and 5'-AGGGGCCGGACTCGTCATACT-3'. The PCR
conditions were identical to those described above, with the exception
that the annealing temperature was 62 and 68 °C for MMP-9 and
KiSS-1, respectively. The concentration ratio of target cDNA
primers to
-actin primers and the PCR cycle number was optimized for
each reaction.
For amplification of KiSS-1 cDNA, the reaction mixture contained
0.5 µM KiSS-1 primers and 0.05 µM
-actin
primer, whereas the cycle number was 30. For MMP-9 amplification, the
concentration of
-actin primers was 0.025 µM, and the
cycle number was 34. For MMP-2 amplification, the concentration of
-actin primers was 0.05 µM, and the cycle number was
32. The PCR products were resolved on 2% agarose gel.
Chromatin Immunoprecipitation Assays--
Cells (2-3 × 106) were treated with 1% formaldehyde in fresh medium at
37 °C for 10 min followed by the addition of 0.125 M glycine. After rinsing with ice-cold phosphate-buffered saline, the
cells were resuspended in 200 µl of SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.1) and incubated
for 10 min on ice. The cell lysates were then sonicated with a Sonic
Dismembrator (Fisher) at 30% maximum power for six 20-s pulses on ice.
After removing cell debris by centrifugation, the cell lysates were diluted 10-fold in IP buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl, pH 8.1, 167 mM NaCl) supplemented with 1 mM PMSF and
protease inhibitor mixture (Roche Molecular Biochemicals). At this
step, 1% of the diluted chromatin solutions was saved to control
(input DNA) for the total DNA amounts of each sample. The diluted
chromatin solutions were then precleared with 80 µl of a 50% protein
A-agarose slurry containing 20 µg of ssDNA and 1 mg/ml bovine serum
albumin (Upstate Biotechnology, Lake Placid, NY) for 30 min at 4 °C
with agitation to reduce nonspecific background. Anti-p65 antibody (2 µg; Santa Cruz Biotechnology) was then added to 1 ml of chromatin
solution and rotated overnight at 4 °C. The immune complexes were
then mixed with 80 µl of a 50% protein A-agarose slurry containing
20 µg of ssDNA and 1 mg/ml bovine serum albumin. After
centrifugation, the agarose beads were washed once in 1 ml of Solution
1 (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 150 mM NaCl) followed by
two additional washes in 1 ml of Solution 2 (0.1% SDS, 1% Triton
X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 500 mM NaCl) and 1 ml of Solution 3 (0.25 M LiCl,
1% Nonidet P-40, 1% sodium deoxycholate, 1 mM EDTA, 10 mM Tris-HCl, pH 8.1), respectively. The beads were finally
washed twice in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). The immune complexes were eluted by
adding 250 µl of 1% SDS in 0.1 M NaHCO3 to
the pelleted beads and incubated at room temperature for 15 min. NaCl
(20 µl of a 5 M solution) was then added to the eluted solution and incubated at 65 °C for 4 h. After being treated
with proteinase K, the DNAs in the samples were recovered by
phenol/chloroform extraction and ethanol precipitation using 20 µg of
glycogen as carrier. The precipitated DNAs were then dissolved in 20 µl of TE and blotted into nylon membrane. The slot blot was
hybridized with [32P]-labeled MMP-9 promoter (+52 to
670) fragments.
 |
RESULTS |
Expression of KiSS-1 in HT-1080 Cells Decreases MMP-9
Protein/mRNA--
Although KiSS-1 has been shown to
dramatically attenuate the metastatic capacity of cancer cells, the
mechanism as to how this is achieved is not known. We hypothesized that
this may be due, at least in part, to a suppression of the expression
of MMP-9, which degrades the extracellular matrix. To test this
hypothesis, MMP-9-producing HT-1080 cells, which demonstrate an
invasive phenotype (43) and which have undetectable KiSS-1
expression, were stably transfected with an expression construct
encoding the KiSS-1 coding sequence. G418-resistant colonies
were cloned and expanded, and genomic DNA was screened by PCR for the
integration of the KiSS-1 sequence into the DNA of the
recipient cells. Several clones (numbers 4, 5, 7, and 10) positive for
the exogenous KiSS-1 sequence were detected (Fig.
1A). The 470-base pair
amplified sequence was not due to the detection of the endogenous
KiSS-1 gene, because the 5' PCR primer employed is unique to
the cytomegalovirus promoter of the pcDNA3 expression plasmid.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 1.
Expression of an exogenous KiSS-1 construct
in HT-1080 cells reduces in vitro invasion.
A, DNA (50 ng) extracted from HT-1080 cells stably
transfected with KiSS-1, or the empty vector
(pcDNA3), was subjected to PCR using upstream and
downstream primers complementary to the cytomegalovirus promoter and to
the KiSS-1 cDNA sequence, respectively. Reaction
products were resolved in an agarose gel. B, total RNA (2 µg) extracted from the indicated HT-1080 clones was reverse
transcribed, and the cDNAs were subsequently subjected to multiplex
PCR using primers for -actin and KiSS-1. The negative
control contained no input DNA. Reaction products were resolved by
electrophoresis. C, HT-1080 cells (250,000) harboring the
pcDNA3 only (V3) or the KiSS-1 plasmid
(K7) were plated on Matrigel®-coated porous filters. After
5 h, cells on the lower and upper aspect of the membrane were
stained and counted. The data are averages ± S.D. of three
separate observations.
|
|
To verify the expression of the integrated KiSS-1 cDNA,
we performed RT-PCR. RNA from HT-1080 cells transfected with the empty vector or the KiSS-1 expression construct was purified and
subjected to RT-PCR. HT-1080 cells transfected with the empty vector
(clones 1 and 3) showed no amplified product using primers
corresponding to the KiSS-1 coding sequence (Fig.
1B). These data indicate that the expression of
KiSS-1 mRNA (endogenous) in HT-1080 cells transfected with the pcDNA3 vector is below the detection limit of RT-PCR. In
contrast, an amplified product (of the predicted size, 389 base pairs)
corresponding to the KiSS-1 mRNA was readily detected in
HT-1080 clones 4, 5, 7, and 10, which were positive for genomic integration of the exogenous KiSS-1 plasmid.
To corroborate the earlier findings (31, 32) that KiSS-1
functions as a metastases suppressor gene, in vitro invasion assays were performed. In these assays, cells are plated on an extracellular matrix-coated porous filter, and invasion is defined as
the percent of cells penetrating this impervious barrier. Expectedly, HT-1080 cells bearing the vector alone (clone 3-V3) (Fig.
1C) penetrated the extracellular matrix-coated porous filter
(32 ± 3% invaded). In contrast, a representative
KiSS-1-expressing clone (clone 7-K7) showed over a 65%
reduction in invasiveness (Fig. 1C). This reduced
invasiveness was not due to diminished adhesion. Thus,
KiSS-1 clone 7 demonstrated an adhesion rate (percent of cells attached 1 h post-plating) of 44 ± 2 compared with
46 ± 4% for the vector clone 3. Thus, these data illustrate that
in HT-1080 cells, KiSS-1 represses invasion, which is a
crucial component of the metastatic phenotype.
Because the ability of cells to demonstrate an invasive/metastatic
phenotype requires proteolysis, we hypothesized that KiSS-1 negatively regulates MMP-9 expression. To answer this question, conditioned medium from clones positive for KiSS-1
expression or the vector only were assayed for MMP-9 enzyme activity by
zymography (Fig. 2A).
Conditioned medium from HT-1080 cells harboring the empty vector
(pcDNA3) contained a collagenase activity that was indistinguishable in size (92 kDa) from MMP-9. The amount of this enzyme was greatly reduced in the KiSS-1 transfectants and
below the detection limit of this assay for clones 4 and 7. In
contrast, the activity of a metalloproteinase, whose size was identical to that of the 72-kDa type IV collagenase MMP-2 (44, 45), was not
reduced in the KiSS-1 transfectants.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 2.
Reduced MMP-9 activity/protein in HT-1080
cells made to express KiSS-1. At 80% confluence, the indicated
HT-1080 clones were changed to serum-free medium and incubated for 2 days. After this time, conditioned medium was collected and clarified
by centrifugation, and cells were counted. Aliquots of conditioned
medium, corrected for differences in cell number, was subjected to
zymography (A) using an acrylamide gel containing gelatin or
to immunoblotting for MMP-9 protein (B). The data are
representative of at least duplicate experiments. C, RNA (2 µg) extracted from the various cell lines or resected tumors was
reverse transcribed and subjected to multiplex RT-PCR using primers to
amplify the MMP-9, -actin, and KiSS-1 transcripts. The
KiSS-1 and MMP-9 plasmids used as positive controls
corresponded to 50 ng of DNA and were amplified without the reverse
transcription step.
|
|
Because the reduced MMP-9 enzyme activity evident by zymography could
arguably be due to the increased presence of a physiological inhibitor
such as tissue inhibitor of metalloproteinases family members (20), we
also assayed the conditioned medium for MMP-9 protein amounts by
Western blotting (Fig. 2B). Similar to the zymography data,
immunoblotting of conditioned medium from the KiSS-1-transfected HT-1080 clones showed a marked reduction
in the amount of this metalloproteinase when compared with the empty vector (pcDNA3) clones. Thus, it is likely that the reduced MMP-9 enzyme activity is due to a diminished amount of the protein.
If KiSS-1 is indeed a negative regulator of MMP-9 protein
levels, we would predict that other cell lines or resected cancer that
secrete this collagenase would be deficient in KiSS-1
expression. To address this question, 5 squamous cell carcinoma cell
lines from the oral cavity (UM-SCC-1, TU-159, Tu167, Tu177, and Tu684) and two resected tumors, which all secrete MMP-9, were analyzed for
KiSS-1 mRNA levels by RT-PCR (Fig. 2C). The
level of KiSS-1 mRNA was below the detection limit of
RT-PCR, whereas amplified fragments corresponding to the
-actin and
MMP-9 transcripts were evident with these 5 different oral cancer cell
lines and the resected tumors. In contrast, a cell line positive for
KiSS-1 expression (MDA 231) had a level of MMP-9 mRNA
barely detectable by RT-PCR. Thus, in summary, various squamous cell
carcinoma cell lines and two resected oral cancers characterized by the
synthesis of this collagenase are deficient in the expression of this
metastases suppressor gene.
KiSS-1 Expression Reduces the Transcription of the MMP-9
Gene--
To determine whether the reduced amount of MMP-9 activity
was a consequence of less mRNA encoding this collagenase, we then compared MMP-9 mRNA levels in the HT-1080 clones expressing the KiSS-1 or the empty vector. An amplified fragment of the
predicted size (120 base pairs) was readily detected in HT-1080 cells
and two clones bearing the empty pcDNA3 vector (Fig.
3) by RT-PCR. However, in all four of the
KiSS-1-expressing clones examined, the amount of MMP-9
mRNA determined by RT-PCR was substantially less than that evident
for the untransfected HT-1080 or HT-1080 cells harboring the pcDNA3
vector (Fig. 3). In contrast to MMP-9, KiSS-1 expression in
HT-1080 cells did not affect the levels of MMP-2 mRNA, a
metalloproteinase encoded by a separate gene (45). Thus, although a
fragment of the correct size (447 base pairs) was easily detected in
HT-1080 cells, the amount of this amplified product was unchanged in
HT-1080 cells stably expressing the KiSS-1 cDNA (data
not shown).

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 3.
Diminished MMP-9 mRNA levels in HT-1080
clones stably expressing an exogenous KiSS-1. At 90% confluence,
HT-1080 cells expressing pcDNA3 or the KiSS-1 construct
were harvested, and RNA was extracted. After reverse transcription, RNA
was subjected to multiplex PCR using primers specific for MMP-9 and
-actin. As a positive control, the MMP-9 plasmid (50 ng) was
amplified. For the negative control, RT-PCR was performed using buffer
only.
|
|
Although the RT-PCR indicated that steady-state MMP-9 mRNA levels
were lower in the KiSS-1-transfected HT-1080 cells, it was not clear whether this was because of decreased transcription or
increased mRNA degradation. Therefore, to determine the
contribution of reduced MMP-9 mRNA synthesis to the diminished
levels of mRNA evident in the KiSS-1-transfectants,
nuclear run-on experiments were carried out. Nuclei from
KiSS-1 transfectants, verified by Northern blotting to be
overexpressing KiSS-1 (Fig.
4A), and from vector-only
clones were isolated. Nuclei were then incubated with radioactive dUTP,
and RNA was isolated and hybridized to various cDNAs. It is
apparent from Fig. 4B that the KiSS-1-expresssing HT-1080 clones (numbers 4 and 7) have a lower rate of MMP-9 mRNA synthesis when compared with the pcDNA3 vector pool. Thus, for the
pcDNA3 vector pool, the ratio of MMP-9/GADPH mRNA synthesis was
0.98, whereas for representative KiSS-1-expressing clones (numbers 4 and 7), it was reduced by 75% to 0.24 and 0.23. In contrast, the nuclear run-on experiments indicated that the mRNA for MMP-2 was transcribed essentially at the same rate in HT-1080 cells
expressing the vector or the KiSS-1. These findings suggest that the decreased steady-state MMP-9 mRNA observed in the
KiSS-1 transfectants is due largely to a reduced rate of
synthesis. Further, the attenuated MMP-9 transcription is not a
consequence of a generalized shut-down of gene transcription.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 4.
Reduced MMP-9 transcription in HT-1080 cells
expressing KiSS-1. A, total RNA was extracted and purified
from 90% confluent HT-1080 cells or clones harboring pcDNA3 or
KiSS-1. Purified RNA (20 µg) was resolved by
electrophoresis and then transferred to a nylon membrane. The filter
was subsequently probed with multiprime-labeled cDNAs specific for
KiSS-1 or GAPDH. B, nuclei from 90% confluent
cells were isolated and incubated with [ 32P]-labeled
UTP. Radioactive mRNA was subsequently purified and hybridized with
nylon filter-immobilized cDNAs specific for MMP-9, MMP-2, or GAPDH.
The intensity of the MMP-9 and GADPH signals was measured using
QuantityOne® software. The data are typical of duplicate
experiments.
|
|
Because MMP-9 gene expression is known to be growth-associated
(46-48), we considered the possibility that the diminished
metalloproteinase synthesis evident in the KiSS-1
transfectants was secondary to a slower proliferation rate. To address
this possibility, HT-1080 cells expressing either the KiSS-1
or the vector were assayed for proliferation. The growth rates of
HT-1080 KiSS-1 clones 4, 5, 7, and 10, once established in
logarithmic phase, were unchanged relative to HT-1080 vector clones 1 and 3 (data not shown). Thus, the reduced expression of MMP-9 evident
in KiSS-1-transfected HT-1080 cells cannot be due to a
slower proliferative rate.
Stimulation of MMP-9 Activity by Agents That Increase ERK and JNK
Activity Is Unaffected by KiSS-1 Expression--
MMP-9 expression is
regulated partly by ERK- and JNK-dependent signaling
pathways (49, 50). We therefore determined whether stimulation of these
MAPK signaling cascades leading to increased MMP-9 expression was
countered by KiSS-1 expression. To address this question, we
employed the phorbol ester, PMA, and TNF-
for activating the ERKs
(51-53) and JNKs (54), respectively.
HT-1080 cells expressing either the empty vector pcDNA3 or
KiSS-1 were treated with PMA, and conditioned medium was
collected and analyzed for metalloproteinase activity (Fig.
5A). Expectedly, PMA treatment
strongly elevated MMP-9 (but not MMP-2) activity in HT-1080 cells
harboring the vector only (clones 1 and 3). However, although the basal
MMP-9 activity was reduced in all KiSS-1 clones, these
clones all responded to the phorbol ester with a strong increase in the
activity of this collagenase. Expectedly, PMA increased the amount of
phospho-ERK in HT-1080 cells (Fig. 5B) bearing either the
empty vector (pcDNA3) or the KiSS-1 expression construct, confirming that the phorbol ester was indeed activating the
ERK pathway. Equally important, KiSS-1 did not decrease the amount of activated ERKs in the untreated HT-1080 cells.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 5.
Stimulation of MMP-9 enzyme activity by
phorbol ester or TNF- is unaffected by KiSS-1
expression. A and C, at 80% confluence, the
indicated clones were changed to serum-free medium supplemented with or
without varying amounts of PMA or TNF- . After 24 h, conditioned
medium was harvested and clarified, and cells were counted. Aliquots of
conditioned medium normalized for any differences in cell number were
subjected to zymography. B and D, the indicated
clones were treated for varying times with PMA (100 nM) or
TNF- . The resulting cellular extracts (equal protein) were subjected
to Western blotting using antibodies specific for the phosphorylated
MAPKs or that recognized the total (phosphorylated and
unphosphorylated) amounts. The experiment was performed at least
twice.
|
|
Similarly, TNF-
was an effective stimulant for MMP-9 activity and
JNK activation (Fig. 5, C and D) in both the
vector clone and the KiSS-1 transfectants. Furthermore, the
amount of activated JNKs (phosphorylated p54 and p46) in untreated
HT-1080 cells was undetectable by immunoblotting. Taken together, these
data argue against the possibility that KiSS-1 represses
MMP-9 expression by interfering with either ERK or JNK activation.
KiSS-1 Does Not Affect AP-1 Binding to the MMP-9
Promoter--
Several studies from ours and other laboratories (15,
21, 24, 48) have reported on the trans-acting factors
regulating the expression of MMP-9. These include transcription factors
in the AP-1, NF-
B, Sp1, and Ets families (15, 21, 24, 48). We
therefore speculated that KiSS-1 reduces MMP-9 expression by modulating the binding of one, or more, of these DNA-binding proteins to the MMP-9 promoter. Toward this end, we first investigated the
possibility that the ability of KiSS-1 to down-regulate
MMP-9 expression was due to reduced binding of AP-1 factors, because these transcription factors have been shown to be a converging point
for many regulators of MMP-9 synthesis including v-Src, c-Ha-Ras, and
TNF-
. Nuclear extracts were generated from HT-1080 cells stably
expressing the pcDNA3 vector, KiSS-1, or no exogenous construct and were added to an oligonucleotide spanning the proximal AP-1 motif at
79 of the MMP-9 promoter, which has been implicated in
the regulation of expression of this collagenase by diverse stimuli
(15, 21, 24, 48). Nuclear extract from HT-1080 cells (parental)
resulted in a shifted band in EMSA (data now shown) that was specific
for AP-1, because it could be competed by an excess of an unlabeled
AP-1 consensus sequence but not by an oligonucleotide containing an
NF-
B binding motif. However, a comparison of nuclear extracts
generated from HT-1080 cells stably expressing either the empty vector
or the KiSS-1 coding sequence revealed that the intensity of
the shifted band was indistinguishable (data not shown). These data
indicate that it is unlikely that KiSS-1 down-regulates
MMP-9 transcription by reducing the amount of AP-1 transcription
factor(s) bound to the
79 recognition motif in the MMP-9 promoter.
Similarly, KiSS-1 expression did not effect any change in
the binding of transcription factors to the Ets or Sp1 motifs in the
MMP-9 promoter (data not shown).
KiSS-1 Reduces NF-
B Binding to the MMP-9 Promoter Subsequent to
Cytosolic "Trapping" of p65/p50 by I
B--
We next tested the
possibility that KiSS-1 effects a reduction in the binding
of NF-
B to the MMP-9 promoter sequence, because (a)
constitutive expression of this metalloproteinase in HT-1080 cells is
achieved partly via trans-activation of an NF-
B motif (at
600) in the MMP-9 promoter (21), and (b) our own studies have shown that mutation of this NF-
B motif in the MMP-9 promoter results in up to a 75% reduction in promoter activity. Nuclear extract
from untransfected HT-1080 cells bound to an oligonucleotide spanning
the NF-
B motif at
600, as evident by a shifted band (parenthesis) in EMSA (Fig.
6A) that could be competed by
an excess of an oligonucleotide bearing a consensus NF-
B motif
(lane 3) but not an AP-1 consensus site (lane 4).
Interestingly, the amount of the shifted band was greatly reduced (Fig.
6A), with nuclear extract generated from representative
KiSS-1 clones (numbers 4 and 7) (lanes 7 and
8) when compared with nuclear extract (equal protein) from
the pcDNA3 vector clones (numbers 1 and 3) (lanes 5 and
6). Note, however, that the amount of a nonspecific band (marked with an asterisk) bound to the oligonucleotide was
not decreased in nuclear extract from the KiSS-1
transfectants.

View larger version (72K):
[in this window]
[in a new window]
|
Fig. 6.
KiSS-1 reduces the amount of
NF- B bound to the MMP-9 promoter.
A, nuclear extract (10 µg) from the indicated cells was
reacted with a radioactive oligonucleotide (CAGTGGAATTCCCCAGCC)
spanning the MMP-9 promoter NF- B motif at 600 without or with an
excess of unlabeled oligonucleotides. Competitors included
oligonucleotides spanning the NF- B binding site (-600) and the AP-1
motif at 79. Bound complexes were resolved by electrophoresis.
wt, wild-type. B, EMSA was carried out as
described for A with the exception that an oligonucleotide
corresponding to the mutated (mt) NF- B motif at 600 was
included, where indicated, as a competitor (CAGTttAATTCCCCAGCC). Also,
antibodies to Ets-1 and the p65 and p50 NF- B family members were
included in the reaction mixture where shown. wt, wild
type
|
|
To confirm the identity of NF-
B factors bound to the MMP-9
oligonucleotide, the following experiments were carried out. First, we
tested the ability of an oligonucleotide bearing a mutated NF-
B
binding site to compete for the shifted band in EMSA using HT-1080
nuclear extract (Fig. 6B). The oligonucleotide harboring nucleotide substitutions at the NF-
B motif, rendering it incapable of binding NF-
B, failed to compete for the shifted band in gel retardation assays (Fig. 6B, lane 4). Second, the
identity of the transcription factors in the slower-migrating band
(marked with a parenthesis) was determined using antibodies
specific for p65 or p50 NF-
B proteins. Addition of the anti-p65
antibody to the HT-1080 nuclear extract resulted in a
"supershifted" band (indicated with a bracket) (Fig.
6B, lane 5). Similarly, an antibody to the p50
NF-
B protein also retarded the mobility of the shifted band (Fig.
6B, lane 6) with a concomitant reduction in the
intensity of the shifted band (marked with a parenthesis).
In contrast, a control antibody directed at the Ets-1 transcription
factor had no effect (lane 7) on the migration profile.
Taken together, these data indicate that in
KiSS-1-tranfected cells NF-
B, which trans-regulates MMP-9 expression, is bound in reduced amount
to this promoter.
To corroborate the data generated by the EMSA, which is an in
vitro assay that does not address the contribution of the in vivo environment of the promoter (DNA wrapped around a histone protein core) to transcription factor binding, we performed chromatin immunoprecipitation assays. Cultured HT-1080 cells bearing the pcDNA3 vector (clone 3) or clones harboring the KiSS-1
expression construct (clones 4 and 7) were treated with formaldehyde to
cross-link transcription factors to the DNA in vivo.
Subsequently, cells were lysed, and DNA was fragmented by sonication
and subjected to immunoprecipitation with the anti-p65 antibody. The
immunoprecipitated DNA, after reversal of cross-links, was purified and
hybridized with a MMP-9 promoter-specific probe (Fig.
7A). For the empty vector
clone (number 3), the signal ratio (p65 precipitable/input amount) was
0.69 as determined using QuantityOne® software (Bio-Rad). This
ratio was reduced (to 0.34 and 0.13) with chromatin derived from the
two KiSS-1-expressing clones.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 7.
Reduced in vivo binding of
NF- B to the MMP-9 promoter is associated with
higher I B amounts and reduced nuclear
localization of p65/p50. A, cell lysates were sonicated and
chromatin incubated without or with an anti-p65 antibody and protein
A-agarose. DNA in immunocomplexes was recovered by proteinase K
treatment and phenol/chloroform extraction and was hybridized to a
radioactive MMP-9 promoter probe. As a control, a fixed portion (1%)
of the total cell lysate was also hybridized to the radioactive MMP-9
promoter probe (Input). Quantitation of the bands was
accomplished using QuantityOne® software. The background detected in
the absence of an immunoprecipitating antibody (No Ab) was
subtracted from all quantitations. B, subcellular fractions
(equal protein) from the indicated clones was subjected to Western
blotting for the p50 and p65 NF- B proteins. C, the
cytosolic fraction was analyzed for I B protein by Western
blotting (Santa Cruz Biotechnology antibody sc-371). The blot was
reprobed with an antibody to -actin.
|
|
Western blotting revealed that the decreased amount of NF-
B proteins
bound to the MMP-9 promoter in the KiSS-1 transfectants is
due, in part, to lower amounts of these proteins in the nuclear compartment with an accompanying increase in the cytosolic subcellular fraction (Fig. 7B). Because the ankyrin repeat-containing
I
B proteins mask the nuclear localization signal of the NF-
B
proteins located at the carboxyl terminus of the Rel homology domain
(55), we speculated that the reduced presence of p65/p50 in the nuclear fractions of the KiSS-1 transfectants was a consequence of
higher amounts of I
B. Indeed, immunoblotting (Fig. 7C)
revealed larger amounts of I
B
in the cytosols of the
KiSS-1-transfected HT-1080 cells. Thus, this observation
would suggest that the diminished amounts of p65/p50 in the nuclear
compartment of the KiSS-1 transfectants is due to an
inhibition of nuclear translocation of the NF-
B proteins by
I
B
. Thus, for the KiSS-1 transfectants, the MMP-9 promoter is bound with less NF-
B as a result of blockade of p65/p50 nuclear migration because of the increased I
B
cytosolic amounts.
 |
DISCUSSION |
The MMP-9 collagenase plays a critical role in tissue remodeling
in both physiology and pathology. Thus, this metalloproteinase is a key
regulator of growth plate angiogenesis (1), and cell migration required
for respiratory epithelium repair has been attributed to this enzyme
(9). In cancer, receptor-bound MMP-9 is required for tumor invasion and
angiogenesis (2). We undertook the current study to determine whether
KiSS-1, a gene that suppresses the invasive/metastatic
phenotype of divergent tumors (31, 32), regulates MMP-9 expression. Our
finding that MMP-9 expression is down-regulated by KiSS-1
provides the first explanation as to how this metastases suppressor
gene diminishes the spread of cancer. It should be emphasized, however,
that the reduction in MMP-9 expression is probably one of multiple
mechanisms responsible for diminished metastases achieved with
KiSS-1. On the other hand, it is clear that
KiSS-1 expression does not have a global effect on
collagenase synthesis. Thus, the expression of a separate
metalloproteinase (the 72-kDA type IV collagenase, MMP-2) was not
reduced by this metastases suppressor gene, and this observation might
partly account for the incomplete inhibition of in vitro
invasion by KiSS-1 expression.
For KiSS-1, the down-regulation of MMP-9 enzyme activity is
largely due to altered transcription as occurs with v-Src and c-Ha-Ras
(21, 24). Further, our data suggest that the diminished synthesis of
MMP-9 in the KiSS-1 transfectants can be partly accounted for by decreased promoter binding of NF-
B.
trans-Activation of gene expression by NF-
B has been
ascribed to multiple mechanisms including the degradation of the
I
Bs, increased DNA binding affinity, and increased
trans-acting potential (55-58). The findings, herein, point
to a decreased binding of the p65 and p50 NF-
B proteins to the MMP-9
promoter, although reduced trans-acting potential of the
bound transcription factor, as previously reported for c-Rel or p65,
cannot be ruled out at this stage (56). The attenuated binding of the
p65/p50 evident in our study could potentially be due to a lower
affinity for its MMP-9 binding site, reduced production of the
transcription factor themselves, or a consequence of increased I
B
synthesis as occurs in interleukin 10-treated cells (57). However, we
found no evidence that the total amount of p65/p50
(i.e. whole cell lysates) differed between the
vector control and the KiSS-1 transfections. On the other
hand, the observation of higher amounts of I
B
in the
KiSS-1 transfectants is consistent with the contention of
increased synthesis (or decreased degradation), thereby preventing the
nuclear localization of p65/p50 and thus diminishing activation of the
MMP-9 expression by these NF-
B proteins.
How KiSS-1 regulates I
B amounts thereby sequestering the
p65/p50 NF-
B proteins in the cytosolic compartment is currently unknown. The KiSS-1 sequence predicts a 15.4-kDa protein
(34) lacking any signature transcriptional domains arguing against the
possibility that it acts directly at the level of MMP-9 gene transcription. On the other hand, the presence of a putative signal peptide is consistent with the notion that the molecule is secreted. If
KiSS-1 is indeed secreted, it could potentially interfere
with a variety of growth factors/cytokines previously shown to
up-regulate MMP-9 expression (47, 49, 59) or, alternatively, generate a
suppressive signal via an autocrine mechanism. However, preliminary findings (data not shown) have failed to show a repression of MMP-9
mRNA levels in untransfected HT-1080 cells incubated with conditioned medium from KiSS-1-transfected HT-1080 cells
arguing against the above-mentioned scenario.
Another possibility is that KiSS-1 interferes with MAPKs
that connect the cell surface to the nuclear transcriptional machinery. However, our observations again would argue against this possibility. First, KiSS-1 expression did not decrease the amount of the
phosphorylated ERKs, and the activity of the JNKs was undetectable in
untransfected HT-1080 cells. Second, the ability of the phorbol ester,
PMA (activating the ERKs), and TNF-
(which activates the JNKs) to
stimulate MMP-9 activity in the HT-1080 cells was not blunted by
KiSS-1 expression. Thus, it is unlikely that the ability of
KiSS-1 to repress MMP-9 synthesis is by an antagonism of the
signaling events culminating in the activation of either the ERKs or
the JNKs. However, these observations do not rule out the possibility
that KiSS-1 interferes with these signaling cascades
downstream of ERK or JNK activation. Alternatively, other signaling
cascades, not examined in the current study, may themselves be
sensitive to KiSS-1 expression. For example, activation of
NF-
B by the interaction of atypical protein kinase C
(60, 61)
with p62 and RIP, culminating in the activation of I
B kinase
and phosphorylation of I
B, may represent a
KiSS-1 target.
Interestingly, although the regulation of MMP-9 expression by the
KiSS-1 metastasis suppressor is unique to date, this
collagenase has recently been shown to physically interact with the
metastases-promoting CD44 gene product (62). In pioneering work, CD44,
which encodes a membrane glycoprotein, was reported to act as a
receptor for proteolytically active MMP-9 thereby promoting tumor
invasion and angiogenesis possibly via activation of transforming
growth factor
. (2). Thus, for CD44 the interaction with MMP-9 is a
physical one and obviously separate from that of KiSS-1,
which regulates MMP-9 synthesis by interfering with the
trans-activation of MMP-9 gene expression by NF-
B.
Another gene modulating the spread of cancer is KAI-1 (29) which, like
KiSS-1, is a potent suppressor of metastasis (29, 63).
However, the mechanism by which KAI-1 suppresses tumor cell invasion is
also distinct from that of KiSS-1 and is related to its
effects on cell-cell aggregation and binding to fibronectin substratum
(64) rather than any change in the activity and/or amount of any
collagenase (or, for that matter, protease).
Thus, in conclusion, we report for the first time that
KiSS-1 down-regulates MMP-9 expression, a finding that
explains, at least partly, how KiSS-1 attenuates the
invasive/metastatic phenotype of different cancers (31, 32). Equally
important, we have also demonstrated that the suppression of MMP-9
synthesis by KiSS-1 can be partly accounted for by reduced
binding of NF-
B to the promoter secondary to the cytosolic
sequestration of the p50/p65 NF-
B proteins by I
B
.
 |
ACKNOWLEDGEMENTS |
We are grateful to Dr. Danny Welch for the
KiSS-1 expression construct. We also thank
Dr. Ernest Lengyel for critical appraisal of the manuscript.
Drs. Janet Price and Gary Clayman kindly provided RNA from the MDA
231 cell line and oral cancer cell lines/tissues, respectively.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grants R01 CA58311, R01 DE10845, and P50 DE11906-01 (to D. B.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should addressed: Dept. of Cancer Biology,
Box 179, MD Anderson Cancer Center, 1515 Holcombe Blvd., Houston,
TX 77030. Tel.: 713-792-8953; Fax: 713-745-1927; E-mail: dboyd@mdanderson.org.
Published, JBC Papers in Press, November 1, 2000, DOI 10.1074/jbc.M008681200
 |
ABBREVIATIONS |
The abbreviations used are:
TNF-
, tumor
necrosis factor-
;
PCR, polymerase chain reaction;
DTT, dithiothreitol;
PMSF, phenylmethylsulfonyl fluoride;
JNK(s), c-Jun
NH2-terminal kinase(s);
ERK(s), extracellular
signal-regulated kinase(s);
RT, reverse transcriptase;
bp, base pair(s);
PMA, phorbol 12-myristate 13-acetate;
MAPK, mitogen-activated
protein kinase.
 |
REFERENCES |
| 1.
|
Vu, T. H.,
Shipley, J. M.,
Bergers, G.,
Berger, J. E.,
Helms, J. A.,
Hanahan, D.,
Shapiro, S. D.,
Senior, R. M.,
and Werb, Z.
(1998)
Cell
93,
411-422
|
| 2.
|
Yu, Q.,
and Stamenkovic, I.
(2000)
Genes Dev.
14,
163-176
|
| 3.
|
Vu, T. H.,
and Werb, Z.
(2000)
Genes Dev.
14,
2123-2133
|
| 4.
|
Bernhard, E. J.,
Muschel, R. J.,
and Hughes, E. N.
(1990)
Cancer Res.
50,
3872-3877
|
| 5.
|
Moses, M. A.,
Wiederschain, D.,
Loughlin, K. R.,
Zurakowski, D.,
Lamb, C. C.,
and Freeman, M. R.
(1998)
Cancer Res.
58,
1395-1399
|
| 6.
|
Hua, J.,
and Muschel, R. J.
(1996)
Cancer Res.
56,
5279-5284
|
| 7.
|
Bernhard, E. J.,
Gruber, S. B.,
and Muschel, R. J.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
4293-4297
|
| 8.
|
Sorsa, T.,
Salo, T.,
Koivunen, E.,
Tyynela, J.,
Konttinen, Y. T.,
Bergmann, U.,
Tuuttila, A.,
Niemi, E.,
Teronen, O.,
Heikkila, P.,
Tschesche, H.,
Leinonen, J.,
Osman, S.,
and Stenman, U.-H.
(1997)
J. Biol. Chem.
272,
21067-21074
|
| 9.
|
Legrand, C.,
Gilles, C.,
Zahm, J. M.,
Polette, M.,
Buisson, A. C.,
Kaplan, H.,
Birembaut, P.,
and Tournier, J. M.
(1999)
J. Cell Biol.
146,
517-529
|
| 10.
|
Miyajima, Y.,
Nakano, R.,
and Morimatsu, M.
(1995)
Ann. Otol. Rhinol. Laryngol.
104,
678-684
|
| 11.
|
Davidson, B.,
Goldberg, I.,
Kopolovic, J.,
Lerner-Geva, L.,
Gotlieb, W. H.,
Weis, B.,
Ben-Baruch, G.,
and Reich, R.
(1999)
Gynecol. Oncol.
72,
380-386
|
| 12.
|
Pyke, C.,
Ralkiaer, E.,
Huhtala, P.,
Hurskainen, T.,
Dano, K.,
and Tryggvason, K.
(1992)
Cancer Res.
52,
1336-1341
|
| 13.
|
Linn, R.,
DuPont, B. R.,
Knight, C. B.,
Plaetke, R.,
and Leach, R. J.
(1996)
Cytogenet. Cell Genet.
72,
159-161
|
| 14.
|
Huhtala, P.,
Tuuttila, A.,
Chow, L.,
Lohi, J.,
Keski-Oja, J.,
and Tryggvason, K.
(1991)
J. Biol. Chem.
266,
16485-16490
|
| 15.
|
Sato, H.,
and Seiki, M.
(1993)
Oncogene
8,
395-405
|
| 16.
|
Wilhelm, S. M.,
Collier, I. E.,
Marmer, B. L.,
Eisen, A. Z.,
Grant, G.,
and Goldberg, G.
(1989)
J. Biol. Chem.
264,
17213-17221
|
| 17.
|
Mazzieri, R.,
Missiero, L.,
Zenetta, L.,
Mones, S.,
Onisto, M.,
Garbisa, S.,
and Migantti, P.
(1997)
EMBO J.
16,
2319-2332
|
| 18.
|
Fridman, R.,
Toth, M.,
Pena, D.,
and Mobashery, S.
(1995)
Cancer Res.
55,
2548-2555
|
| 19.
|
Goldberg, G.,
Strongin, A.,
Collier, I. E.,
Genrich, T.,
and Marmer, B. L.
(1992)
J. Biol. Chem.
267,
4583-4591
|
| 20.
|
Olson, M. W.,
Gervasi, D. C.,
Mobashery, S.,
and Fridman, R.
(1997)
J. Biol. Chem.
272,
29975-29983
|
| 21.
|
Sato, H.,
Kita, M.,
and Seiki, M.
(1993)
J. Biol. Chem.
268,
23460-23468
|
| 22.
|
Sehgal, I.,
and Thompson, T. C.
(1999)
Mol. Biol. Cell
10,
407-416
|
| 23.
|
Himelstein, B. P.,
Lee, E. J.,
Sato, H.,
Seiki, M.,
and Muschel, R. J.
(1998)
Clin. Exp. Metastasis
16,
169-177
|
| 24.
|
Gum, R.,
Lengyel, E.,
Juarez, J.,
Chen, J.-H.,
Sato, H.,
Seiki, M.,
and Boyd, D.
(1996)
J. Biol. Chem.
271,
10672-10682
|
| 25.
|
Fini, M. E.,
Bartlett, J. D.,
Matsubara, M.,
Rinehart, W. B.,
Mody, M. K.,
Girard, M. T.,
and Rainville, M.
(1994)
J. Biol. Chem.
269,
28620-28628
|
| 26.
|
Kumar, A.,
Dhawan, S.,
Mukhopadhyay, A.,
and Aggarwal, B. B.
(1999)
FEBS Lett.
462,
140-144
|
| 27.
|
Mohan, R.,
Rinehart, W. B.,
Bargagna-Mohan, P.,
and Fini, M. E.
(1998)
J. Biol. Chem.
273,
25903-25914
|
| 28.
|
Munaut, C.,
Salonurmi, T.,
Kontusaari, S.,
Reponen, P.,
Morita, T.,
Foidart, J.,
and Tryggvason, K.
(1999)
J. Biol. Chem.
274,
5588-5596
|
| 29.
|
Dong, J. T.,
Lamb, P. W.,
Rinker-Schaeffer, C. W.,
Vukanovic, J.,
Ichikawa, T.,
Isaacs, J. T.,
and Barrett, J. C.
(1995)
Science
268,
884-886
|
| 30.
|
Christensen, C. R. L.,
Klingelhofer, J.,
Tarabykina, S.,
Hulgaard, E. F.,
Kramerov, D.,
and Lukanidin, E.
(1998)
Cancer Res.
58,
1238-1244
|
| 31.
|
Lee, J.-H.,
Miele, M. E.,
Hicks, D. J.,
Phillips, K. K.,
Trent, J. M.,
Weissman, B. E.,
and Welch, D. R.
(1996)
J. Natl. Cancer Inst.
88,
1731-1737
|
| 32.
|
Lee, J.-H.,
and Welch, D. R.
(1997)
Cancer Res.
57,
2384-2387
|
| 33.
|
West, A.,
Vojta, P. J.,
Welch, D. R.,
and Weissmann, B. E.
(1998)
Genomics
54,
145-148
|
| 34.
|
Welch, D. R.
(1997)
J. Natl. Cancer Inst.
89,
1549-1549
|
| 35.
|
Nead, M. A.,
and McCance, D. J.
(1995)
J. Invest. Dermatol.
105,
668-671
|
| 36.
|
Schlechte, W.,
Brattain, M.,
and Boyd, D.
(1990)
Cancer Commun.
2,
173-179
|
| 37.
|
Boyd, D.,
Ziober, B.,
Chakrabarty, S.,
and Brattain, M. G.
(1989)
Cancer Res.
49,
816-820
|
| 38.
|
Juarez, C.,
Clayman, G.,
Nakajima, M.,
Tanabe, K.,
Saya, H.,
Nicolson, G. L.,
and Boyd, D.
(1993)
Int. J. Cancer
54,
73-80
|
| 39.
|
Allgayer, H.,
Wang, H.,
Gallick, G. E.,
Crabtree, A.,
Mazar, A.,
Jones, T.,
Kraker, A. J.,
and Boyd, D. D.
(1999)
J. Biol. Chem.
274,
18428-18445
|
| 40.
|
Collier, I. E.,
Wilhelm, S. M.,
Eisen, A. Z.,
Marmer, B. L.,
Grant, G.,
Seltzer, J. L.,
Kronberger, A.,
He, D.,
Bauer, E. A.,
and Goldberg, G. I.
(1988)
J. Biol. Chem.
263,
6579-6587
|
| 41.
|
Schreiber, E.,
Matthias, P.,
Muller, M. M.,
and Schaffner, W.
(1989)
Nucleic Acids Res.
17,
6419-6420
|
| 42.
|
Singh, S.,
and Aggarwal, B. B.
(1995)
J. Biol. Chem.
270,
10631-10639
|
| 43.
|
Tanaka, K.,
Iwamoto, Y.,
Ito, Y.,
Ishibashi, T.,
Nakabeppu, Y.,
Sekiguchi, M.,
and Sugioka, Y.
(1995)
Cancer Res.
55,
2927-2935
|
| 44.
|
Collier, I. E.,
Bruns, G. A. P.,
Goldberg, G. I.,
and Gerhard, D. S.
(1991)
Genomics
9,
429-434
|
| 45.
|
Huhtala, P.,
Chow, L.,
and Tryggvason, K.
(1990)
J. Biol. Chem.
265,
11077-11082
|
| 46.
|
Shima, I.,
Sasaguri, Y.,
Kusukawa, J.,
Nakano, R.,
Yamana, H.,
Fufita, H.,
Kakegawa, T.,
and Morimatsu, M.
(1993)
Br. J. Cancer
67,
721-727
|
| 47.
|
Putnins, E. E.,
Firth, J. D.,
and Uitto, V.-J.
(1995)
J. Invest. Dermatol.
104,
989-994
|
| 48.
|
Himelstein, B. P.,
Lee, E. J.,
Sato, H.,
Seiki, M.,
and Muschel, R. J.
(1997)
Oncogene
14,
1995-1998
|
| 49.
|
McCawley, L. J.,
Li, S.,
Wattenberg, E. V.,
and Hudson, L. G.
(1999)
J. Biol. Chem.
274,
4347-4353
|
| 50.
|
Gum, R.,
Wang, H.,
Lengyel, E.,
Juarez, J.,
and Boyd, D.
(1997)
Oncogene
14,
1481-1493
|
| 51.
|
Minden, A.,
Lin, A.,
Smeal, T.,
Derijard, B.,
Cobb, M.,
Davis, R.,
and Karin, M.
(1994)
Mol. Cell. Biol.
14,
6683-6688
|
| 52.
|
Pulverer, B. J.,
Hughes, K.,
Franklin, C. C.,
Kraft, A. S.,
Leevers, S. J.,
and Woodgett, J. R.
(1993)
Oncogene
8,
407-415
|
| 53.
|
Jones, L. G.,
Ella, K. M.,
Bradshaw, C. D.,
Gause, K. C.,
Dey, M.,
Wisehart-Johnson, A. E.,
Spivey, E. C.,
and Meier, K. E.
(1994)
J. Biol. Chem.
269,
23790-23799
|
| 54.
|
Westwick, J. K.,
Weitzel, C.,
Minden, A.,
Karin, M.,
and Brenner, D. A.
(1994)
J. Biol. Chem.
269,
26396-26401
|
| 55.
|
Mercurio, F.,
and Manning, A.
(1999)
Curr. Opin. Cell Biol.
11,
226-232
|
| 56.
|
Martin, A. G.,
and Fresno, M.
(2000)
J. Biol. Chem.
275,
24383-24391
|
| 57.
|
Lentsch, A. B.,
Stanley, T. P.,
Sarma, V.,
and Ward, P. A.
(1997)
J. Clin. Invest.
100,
2443-2448
|
| 58.
|
Trecca, D.,
Guerrini, L.,
Fracchiolla, N. S.,
Pomati, M.,
Baldini, L.,
Maiolo, A. T.,
and Neri, A.
(1997)
Oncogene
14,
791-799
|
| 59.
|
Shimizu, S.,
Nishikawa, Y.,
Kuroda, K.,
Takagi, S.,
Kozaki, K.,
Hyuga, S.,
Saga, S.,
and Matsuyama, M.
(1996)
Cancer Res.
56,
3366-3370
|
| 60.
|
Sanz, L.,
Diaz-Meco, M. T.,
Nakano, H.,
and Moscat, J.
(2000)
EMBO J.
19,
1576-1586
|
| 61.
|
Sanz, L.,
Sanchez, P.,
Lallena, M.-J.,
Diaz-Meco, M. T.,
and Moscat, J.
(1999)
EMBO J.
18,
3044-3053
|
| 62.
|
Reeder, J. A.,
Gotley, D. C.,
Walsh, M. D.,
Fawcett, J.,
and Antalis, T. M.
(1998)
Cancer Res.
58,
3719-3726
|
| 63.
|
Lombardi, D. P.,
Geradts, J.,
Foley, J. F.,
Chiao, C.,
Lamb, P. W.,
and Barrett, J. C.
(1999)
Cancer Res.
59,
5724-5731
|
| 64.
|
Takaoka, A.,
Hinoda, Y.,
Satoh, S.,
Adachi, H.,
Itoh, F.,
Adachi, M.,
and Imai, K.
(1998)
Oncogene
16,
1443-1453
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
