|
Originally published In Press as doi:10.1074/jbc.M005461200 on October 12, 2000
J. Biol. Chem., Vol. 276, Issue 2, 1195-1203, January 12, 2001
Mechanism of Action of a Novel Latent Membrane Protein-1 Dominant
Negative*
Paul
Brennan ,
J. Eike
Floettmann§,
Anja
Mehl,
Matthew
Jones, and
Martin
Rowe
From the Department of Medicine, Tenovus Building, University of
Wales College of Medicine, Heath Park,
Cardiff, CF14 4XX, United Kingdom
Received for publication, June 22, 2000, and in revised form, September 25, 2000
 |
ABSTRACT |
Latent membrane protein-1 (LMP1) is a signaling
molecule expressed by Epstein-Barr virus during latency. LMP1 is
essential for B-cell immortalization by Epstein-Barr virus and
transforms rodent fibroblasts. It activates many distinct signaling
pathways including the transcription factors NF B and AP1. We have
generated a mutant of LMP1 with four point mutations; amino acids 204, 206, and 208 were mutated to alanine, and amino acid 384 was mutated to
glycine. This mutant, termed LMP1AAAG, is not only
unable to activate nuclear signaling pathways, but also inhibits
signaling from wild type LMP1. We have demonstrated the effectiveness,
selectivity, and mechanism of this inhibitory molecule. It inhibits
LMP1-stimulated NF B, STAT, and Jun transcriptional activity. It is
selective, as it does not inhibit TNF or interleukin-2 signaling. We
have demonstrated that it does not sequester the downstream signaling
molecule, TRAF2, but instead binds LMP1 and interferes with its ability
to bind TRAF2. This demonstrates the importance of the interplay
between the signaling domains of LMP1 and the oligomeric structure of
LMP1 for effective signaling. It identifies a tool that will be useful
to probe LMP1 function in disease.
 |
INTRODUCTION |
Epstein-Barr virus is found in a latent state following infection
and growth transformation of B-lymphocytes (1). One of the limited
number of genes expressed during this state is latent membrane
protein-1 (LMP1),1 which has
been shown to be essential for B-cell immortalization by
EBV (2). LMP1 has also been shown to transform rodent
fibroblasts (3, 4) and cause lymphomas in transgenic mice (5, 6). Cell
transformation by LMP1 is at least in part due to the up-regulation of
various anti-apoptotic proteins such as bcl-2, A20, mcl-1, and bfl-1
(7-10). LMP1 also plays a role in the immunogenicity of EBV by
up-regulating a number of proteins involved in immune regulation such
as the TAP-1 and TAP-2 peptide transporter components of the endogenous
antigen processing pathway, major histocompatibility complex
class I, and the intercellular adhesion molecules, ICAM-1 and
LFA-3 (11, 12).
LMP1 is a 63-kDa integral membrane protein in which three signaling
domains have been characterized (Fig. 1A). The protein has
six hydrophobic transmembrane segments and is thought to spontaneously oligomerize to stimulate intracellular pathways. The three signaling domains are entitled C-terminal activating region-1 (CTAR1), CTAR2, and
CTAR3 (13-15). CTAR1 has been shown to bind the complex of cellular
proteins belonging to the family of tumor necrosis factor receptor-binding proteins (TRAFs) (16-18). CTAR2 binds TRADD and other
signaling molecules (19, 20). Both of these domains can activate NF B
transcriptional activity independently but they function optimally
together (21). Likewise, activation of the p38 kinase pathway is also
mediated via both CTAR1 and CTAR2 (22). In contrast, LMP1 activates the
JNK kinase pathways via CTAR2 (23, 24). The activation of NF B and
p38 have been shown to be required for a number of LMP1-regulated
genes, demonstrating the importance of these pathways (22, 25).
Recently a third signaling domain of LMP1 was described and termed
CTAR3 (14). This has been suggested to bind Jak 3 and activate the DNA
binding of STAT1 (14). No function has been ascribed to the activation of the Jak-STAT pathway by LMP1, and the interaction of CTAR3 with the
other signaling domains of LMP1 remains to be elucidated.
The functional domains of LMP1 were initially identified by deletional
analysis. Recently, more detailed analysis has identified point
mutations of critical residues that can abolish functions. By
comparison of the LMP1 sequence with the functional domains of CD40, a
PXQXT motif in CTAR1 was identified and
substitution of the critical
Pro204/Gln206/Thr208
residues to alanines abolished TRAF binding and NF B activation from
the CTAR1 of LMP1 (16, 26, 27). In the CTAR2 region, substitution of a
critical Tyr384 residue completely abolished TRADD binding,
and the activation of NF B and AP1 (24, 28, 29). The critical
residues in CTAR3 for Jak3 binding have not been identified.
This project was instigated to test the hypothesis that mutation of
LMP1 could yield not only a nonsignaling form of the protein but also
generate a dominant inhibitor. We have generated such a mutant,
LMP1AAAG, in which both CTAR1 and CTAR2 were inactivated by
four point mutations: P204A, Q206A, T208A, and Y384G. This report
describes the key features of the LMP1AAAG mutant which
enhance our understanding of the mechanism of LMP1 signaling. First,
this mutant is unexpectedly defective in the ability to activate a
STAT-regulated reporter, a function that was shown to be regulated by
CTAR3. Second, the LMP1AAAG mutant was found to function as
a dominant inhibitory molecule when coexpressed with wild type LMP1.
The efficiency, specificity and mechanism of the dominant negative
molecule have been examined.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture--
Jurkat is a cell line derived from an EBV
negative T cell lymphoma (30). Eli-BL is an EBV-positive B cell line
established from a Burkitt's lymphoma, and it displays a latency I
form of infection in which Epstein-Barr virus nuclear antigen 1 is the only viral protein detected (31). DG75 is an EBV-negative Burkitt's lymphoma B cell line. Kit225 is a human leukemic cell line (32) that is
dependent upon IL-2 for growth. The Kit225 cells were deprived of IL-2
for 24 h prior to transfection by washing the cells twice in
phosphate-buffered saline. All the lymphoid cell lines were grown in
suspension in RPMI 1640 medium supplemented with 10% fetal calf serum,
2 mM glutamine and antibiotics (200 units/ml penicillin and
200 µg/ml streptomycin), and were maintained at 37 °C in a
humidified atmosphere with 5% CO2.
Plasmids--
Plasmid pSG5-LMP1 expresses a wild type LMP1
cDNA derived from the B95.8 strain of EBV, under the control of the
SV-40 promoter of the SG5 vector. The pSG5-LMP1 (1-128) encodes an
LMP1 protein deleted for the first 128 amino acids and corresponds to
the truncated from of LMP1 (tr.LMP1) expressed during lytic cycle in
B95.8 cells (13). The pSG5-LMP1AAAG mutant was constructed
in two steps. First, a pSG5-LMP1AAA mutant was generated by
site-directed mutagenesis, (23), to mutate the codons 204-208 from
PXQXT to AXAXA. The
LMP1 gene was then polymerase chain reaction-amplified from
the pSG5-LMP1AAA mutant as a BglII fragment
using a variant 3'primer (GAAGATCTTTAGTCATAGCCGCTTAGC) to mutate codon
384 from Tyr to Gly, and was cloned into the BglII site of
pSG5 to create pSG5-LMP1AAAG. The presence of all the
correct mutations was confirmed by sequencing. The same polymerase
chain reaction product was also cloned into pEGFP-C1
(CLONTECH) to generate the
pEGFP/LMP1AAAG plasmid encoding a mutant
LMP1AAAG protein with an N terminus GFP tag. Generation of
the plasmid pSG5-CD2/LMP1 has been reported previously (29). The TRAF2
expression vectors were kindly provided by Elliott Kieff (17),
pcDNA3-TRAF2 (6-86) encodes a dominant negative mutant form of
TRAF2 that retains the ability to bind LMP1 but is unable to affect
signaling functions such as activation of NF B.
The reporter plasmid, 3Enh-luc (33) was used to assay NF B activity.
The STAT reporter, GRR luciferase is the luciferase analog of the
GRRCAT reporter described previously (34). The lex-Jun fusion protein
plasmid (from Dr. R. Treisman, ICRF, London) is a fusion of codons 3 to
199 of the bacterial protein, LexA and codons 1 to 194 of c-Jun, which
contains the transactivation domain of Jun. The lex reporter has been
described previously (35).
Transfections, Reporter, and ICAM-1 Assays--
For transient
expression, 0.5 to 1.5 × 107 cells from a suspension
culture were transfected by electroporation using a Bio-Rad Genepulser
II electroporator at 270 or 280 V and 950 microfarads at room
temperature in 500 µl of growth medium. The cells were reseeded in 5 ml of fresh growth medium and were then incubated under normal conditions.
The activity of the luciferase reporter plasmids was measured 24 h
post-transfection using a standard bioluminescence protocol (21). For
chloramphenicol acetyltransferase assays, cells were lysed in buffer
containing 10 mM Tris (pH 8.0), 1 mM EDTA, 150 mM NaCl, 0.65% Nonidet P-40. Samples were then assayed for
CAT activity by radioisotope method (34).
The induction of ICAM-1 protein in transfected cells was routinely
assayed by immunofluorescence staining of viable cells, followed by
flow cytometry using a Becton Dickinson FACSCalibur analyzer as
described previously (21). Briefly, at 48 h post-transfection the
cells were washed and stained with a phycoerythrin-conjugated monoclonal antibody to human CD54 (MCA675PE; Serotec) at 4 °C for 60 min. The transfected population was marked by the expression of
co-transfected EGFP-C1 plasmid (CLONTECH), and the
GFP-positive population was gated for analysis of ICAM-1 staining.
Immunoprecipitations and Western Blotting--
For each
immunoprecipitation, 15 × 106 cells of the DG75 line
in 0.5 ml of growth medium were electroporated at 270 V and 950 microfarads with up to 20 µg of plasmid DNA as indicated in the Results section. At 24 h post-transfection, DG75 B-cells were washed twice with phosphate-buffered saline, then lysed for 45 min on
ice in 800 µl of Nonidet P-40-lysis buffer (0.5% Nonidet P-40, 50 mM HEPES buffer, 0.25 M NaCl, 2 mM
EDTA) to which a 5% protease inhibitor mixture (Sigma; P8340) was
added immediately prior to use. The lysates were clarified by
centrifugation at 13,000 × g for 5 min, and the
soluble fraction was then precleared for 4 h with 20 µl of
Sepharose-Protein G or with Sepharose-Protein G to which 1 µg of
control antibody had been covalently cross-linked. The precleared
lysate was then incubated for 4 h with 20 µl of Sepharose-Protein G to which 1 µg of OX34 or a mixture of 0.5 µg of
CS.3 and 0.5 µg of CS.4, had been covalently cross-linked. CS.3 and
CS.4 bind epitopes in the repeat regions of LMP1. The immunoprecipitates were washed 4 times and eluted by boiling in 40 µl
of SDS gel sample buffer. Half of the eluate was separated by SDS-PAGE
and subjected to Western blotting to detect LMP1 and TRAF2.
For Western blotting analysis performed in parallel with reporter
assays, cells were washed in phosphate-buffered saline and lysed for 30 min on ice in luciferase lysis buffer and processed as described
previously (36). Typically, the lysates from 2 × 105
cells was applied to each track of the gel. LMP1 was detected with the
mouse monoclonal antibodies CS.1-4 used at 1 µg/ml, or with a 1/1000
dilution of a rabbit polyclonal serum raised to a -galactosidase
fusion protein containing 189 amino acids of the C terminus of LMP1
(37). TRAF2 was detected with rabbit polyclonal antibodies reactive
with a C terminus epitope corresponding to amino acids 478-497 (Santa
Cruz; sc876) and was used at 1 µg/ml. All primary antibody
incubations were for 90 min at room temperature.
Microscopy--
For LMP1 staining, DG75 cells were stained with
a mouse monoclonal antibody to LMP1, LMPO25 (10 µg/ml), using
standard protocols with Texas Red- conjugated anti-mouse IgG (EY
Laboratories) as a secondary antibody. For two color analysis of
GFP-tagged LMP1AAAG and CD2-tagged wild type LMP1, CD2
staining was performed using OX34 (10 µg/ml) and detected with Texas
Red conjugate as described previously (38). The cells were visualized
on a Leica TCS4D confocal microscope. A Z series was performed and
equatorial region was illustrated in all cases.
 |
RESULTS |
Generation of a Nonfunctional LMP1 Mutant,
LMP1AAAG--
To create a nonsignaling LMP1, a form of
LMP1 was generated in which four of critical residues in CTAR1 and
CTAR2 are mutated. A schematic of this mutant, called
LMP1AAAG, is shown in Fig.
1A. Fig. 1A also
shows a schematic of a rare but naturally occurring truncated LMP1
(tr.LMP1) that can be expressed in a limited number of strains of EBV,
and is postulated to inhibit LMP1 function (39). These two mutants and
a wild type form of LMP1 were expressed in DG75 B-cells and analyzed by
Western blotting (Fig. 1B). The molecular weight of the
LMP1AAAG is the same as wild type LMP1 (compare
second and third lanes of Fig. 1B),
whereas the truncated form (Fig. 1B, 4th lane) runs at a
reduced molecular weight.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 1.
Essential features of some LMP1 molecules
used in this study. A, schematic showing the structure
of wild type LMP1, dominant negative LMP1 (LMP1AAAG) and a
naturally occurring truncated LMP1 mutant (tr.LMP1). Functional
C-terminal signaling domains are illustrated (gray boxes).
The four point mutations in LMP1AAAG are indicated.
B, Western blotting showing wild type LMP1,
LMP1AAAG, and tr.LMP1 following transfection of expression
vectors in DG75 cells. The products of all three constructs were
detected with an anti-LMP1 antibody (CS.1-4) following SDS-PAGE and
transfer onto polyvinylidene difluoride membrane.
|
|
The ability of LMP1AAAG to activate LMP1 signaling pathways
was tested. Jurkat cells were co-transfected with a range of amounts of
an expression vector for wild type LMP1 or LMP1AAAG
together with an NF B reporter construct (3enh luciferase) that contains three copies of an NF B-binding site upstream of the luciferase gene. After 18 h the cells were lysed and a
luciferase assay was performed. Fig.
2A shows that while wild type
LMP1 signals strongly to NF B, LMP1AAAG does not activate
NF B reporter activity. This experiment was also performed in two
B-cell lines, Eli-BL cells and DG75, and an epithelial cell line, 293. LMP1AAAG was not able to stimulate NF B transcriptional
activity in any of these lines (data not shown).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 2.
LMP1AAAG cannot activate nuclear
signals. Jurkat cells were transfected with a range of
concentrations of wild type LMP1 (solid squares) or
LMP1AAAG (empty circles) expression plasmids
together with the NF B reporter, 3enh luciferase (A), or a
STAT reporter, GRR luciferase (B). Samples were harvested
and the luciferase activity was detected as described under
"Experimental Procedures." C, expression of wt LMP1 and
LMP1AAAG was determined by Western blotting with the
CS.1-4 mixture of monoclonal anti-LMP1 antibodies.
|
|
It was possible that mutation of CTAR1 and CTAR2 would only affect
signaling to pathways activated by CTAR1 and CTAR2. For this reason we
tested the ability of LMP1 to trigger STAT transcriptional activity as
LMP1 effects on STAT signaling have recently been mapped to a new
domain entitled CTAR3 (Fig. 1A). A GRR reporter assay was
chosen to test for STAT transcriptional activity. This is a well
characterized reporter construct based on the STAT-binding site from
the Fc R promoter. It has been shown to bind various STATs (34, 40)
and has been used as a reporter in many different studies (34, 38).
Eli-BL cells were co-transfected with the GRR reporter (10 µg)
together with various amounts of both wild type LMP1 and
LMP1AAAG expression vectors. Fig. 2B shows that
while wild type LMP1 was able to stimulate GRR luciferase
transcriptional activity, LMP1AAAG showed no stimulatory
capacity for this reporter. This was somewhat surprising and suggests
that either CTAR1 or CTAR2 are required for the activation of STAT
transcriptional activity.
Protein expression of LMP1AAAG was examined to demonstrate
that the mutant expressed at a similar level to wild type. Fig.
2C shows the results from the expression of wild type and
LMP1AAAG in Eli-BL cells. Cells were transfected with a
range of amounts of an LMP1 expression vector, cells were lysed, and
cellular proteins were resolved by SDS-PAGE. Western blot analysis was
performed with an anti-LMP1 antibody (CS.1-4) and similar levels of
both wt LMP1 and LMP1AAAG were seen (Fig. 2C).
Similar data were also obtained with DG75 and 293 cells (data not shown).
LMP1AAAG Acts as a Dominant Negative
Molecule--
Since the LMP1AAAG could not activate LMP1
signaling pathways, it was postulated that it may be able to inhibit
wild type LMP1 activity by preventing the formation of a functional
signaling complex. NF B transcriptional activity was tested by
co-transfection of the reporter with various amounts of an expression
vector for wild type LMP1 (from 0.1 to 4 µg) in combination with a
constant 5 µg of LMP1AAAG. Fig.
3A shows that expression of
LMP1AAAG dramatically inhibits the activation of NF B by
wild type LMP1. A ratio of 1 µg of wild type LMP1 plasmid to 5 µg
of LMP1AAAG plasmid inhibited NF B transcriptional
activity by greater than 90%. Over a number of experiments, the
expression of equal levels of LMP1AAAG to wild type LMP1
inhibited signaling by 50-75%, demonstrating the efficiency of the
mutant. A dose response of LMP1AAAG (0-12 µg) was tested
with a fixed amount of wild type LMP1 expression vector (2 µg) (Fig.
3B). This shows that the inhibition correlates with amount
of LMP1AAAG.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 3.
LMP1AAAG inhibits LMP1-induced
NF B transcriptional activity.
A, Jurkat cells were transfected with an NF B reporter and
a range of concentrations of wt LMP1 expression vector in the absence
(solid squares) or presence of 5 µg of
LMP1AAAG vectors (empty circles). B,
Jurkat cells were transfected with a reporter for NF B with a single
concentration of wt LMP1 vector (2 µg) in the presence of a range of
concentrations of LMP1AAAG expression vector. C,
Jurkat cells were transfected with an NF B reporter in the presence
of LMP1AAAG or tr.LMP1 expression vectors to investigate
the efficiency of the two inhibitory molecules.
|
|
A naturally occurring truncated LMP1, tr.LMP1, which lacks amino acids
1-127, has been postulated to inhibit LMP1 signaling (39). We compared
the LMP1AAAG mutant with the putative inhibitory effects of
the truncated from of LMP1 (Fig. 3C). A direct comparison of
the two molecules suggests that a much lower level of expression of
LMP1AAAG is efficient relative to tr.LMP1 (compare
3rd bar with 5th bar and 4th bar with
6th bar). In this experiment, the co-transfection of 3 µg
of LMP1AAAG expression vector inhibited wild type LMP1
activation of NF B by greater than 90%, whereas 3 µg of the
expression vector for tr.LMP1 had very little effect.
LMP1AAAG Inhibits STAT Transcriptional Activity and Jun
Transactivation--
Two other nuclear signals stimulated by LMP1 were
also tested. The STAT reporter (GRR luciferase) was tested in Eli-BL
cells (Fig. 4A). This showed
that LMP1AAAG effectively inhibited STAT transcriptional
activity stimulated by LMP1. A Jun-transactivation assay was also
performed (Fig. 4B). Jurkat cells were co-transfected with a
mammalian expression vector for a chimeric protein with the DNA-binding
domain from the bacterial lex protein and the transactivation domain of
c-Jun (amino acids 1-194) (41) together with a reporter that contains two binding sites for lex- protein upstream of the CAT gene
(35). This reporter therefore gives a measurement of Jun
phosphorylation in vivo, which requires the activity of Jun
N-terminal kinase (JNK) or p38 stress activated protein kinase. When
co-transfected with this reporter, LMP1 could induce Jun
transactivation, and this activation was inhibited by coexpression of
the LMP1AAAG (Fig. 4B).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 4.
LMP1AAAG inhibits STAT-regulated
transcription and Jun transactivation. A, Eli-BL cells
were co-transfected with GRR luciferase reporter (10 µg) and the
constructs indicated. Cells were incubated overnight and luciferase
activity was assayed. B, Jurkat cells were co-transfected
with 4 µg of the lex operon CAT reporter, 2 µg of the mammalian
expression vector for the fusion protein of the Jun-transactivation
domain with the lex-DNA-binding domain, and the other plasmids
indicated. Cells were incubated overnight and CAT activity was
assayed.
|
|
LMP1AAAG Inhibits Induction of ICAM-1 by LMP1--
It
is important to demonstrate that the LMP1AAAG can also
block downstream biological functions of LMP1, i.e.
endogenous protein changes, and not just affect reporter constructs.
Fig. 5 demonstrates that
LMP1AAAG efficiently inhibits the LMP1-mediated induction
of the ICAM-1 (CD54) adhesion molecule. Jurkat cells were
co-transfected with a GFP vector and a wild type LMP1 plasmid. The GFP
vector allows the identification of transfected cells by flow
cytometry. The cells were left for 48 h and expression of ICAM-1
was determined using phycoerythrin-conjugated CD54 antibodies and flow
cytometric analysis. Fig. 5A (top panel) shows
the expression of ICAM-1 in Jurkat cells transfected with EGFP and
control vector DNA. When Jurkat cells were transfected with the
GFP-LMP1AAAG expression vector no increase in ICAM-1 levels
was detected demonstrating that LMP1AAAG could not signal
effectively (Fig. 5A, 2nd panel). In contrast, cells
transfected with wild type LMP1 and EGFP expression vectors showed a
dramatic increase in ICAM-1 expression (Fig. 5A, 3rd panel).
This can be represented in two ways. The first consists of determining
the percentage of cells whose fluorescence intensity crosses an
arbitrary threshold gate. In the example shown in Fig. 5A,
expression of wt LMP1 caused an increase from 2.7 to 34.2% of ICAM-1
positive cells. The effects upon ICAM-1 can also be determined by
measuring the increase in mean fluorescence intensity which, in Fig.
5A, shows a 3-fold increase in the level of expression of
ICAM-1 caused by expression of wt LMP1 (control transfectant, mean
fluorescence intensity of 68; wt LMP1 transfectant, mean fluorescence intensity 195). When wild type LMP1 and
GFP-LMP1AAAG expression vectors were co-transfected, no
increase in either the percentage of positive cells or the mean
fluorescence intensity was detected (Fig. 5A, compare
top and bottom panels). A dose response of LMP1
plasmid was performed in the presence and absence of a constant amount
of LMP1AAAG. Whether the data are expressed as mean
fluorescence intensity (Fig. 5B) or as a percentage of
ICAM-1 positive cells (not shown), LMP1AAAG dramatically
inhibits LMP1 signaling. These results demonstrate that
LMP1AAAG can inhibit endogenous cellular gene expression in
addition to synthetic reporter genes.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 5.
LMP1AAAG inhibits ICAM-1 protein
up-regulation by LMP1. Jurkat cells were co-transfected with 2 µg of pEGFP-C1 marker plasmid together with variable amounts (0-2.0
µg) of wt LMP1 expression plasmid with or without a constant 20 µg
of LMP1AAAG expression plasmid. At 48 h
post-transfection, the cells were stained with phycoerythrin
(PE)-conjugated CD54 antibodies to ICAM-1 and analyzed by
two-color flow cytometry. A, FACS profiles of ICAM-1
staining in the EGFP-positive population of four cultures transfected,
respectively, with empty vector, LMP1AAAG, wt LMP1, and wt
LMP1 + LMP1AAAG. B, dose-response curves showing
the mean fluorescence intensity of ICAM-1 staining of cultures transfected with increasing amounts
of wt LMP1 vector with (solid squares) or without
(open circles) a constant 20 µg LMP1AAAG
vector.
|
|
LMP1AAAG Is Selective as It Does Not Inhibit TNF or
Interleukin-2 Signaling--
The usefulness of a dominant-negative
molecule is enhanced if it is also specific for its intended target. We
therefore examined whether LMP1AAAG might interfere with
the signaling pathways activated by other receptor molecules. The
selectivity of the LMP1AAAG inhibitor was tested in two
different systems. Jurkat cells were transfected with the 3enh (NF B)
luciferase reporter and increasing amounts of the LMP1AAAG
vector. The cells were left overnight to ensure expression, and were
then stimulated with TNF. The results in Fig.
6A show that doses of
LMP1AAAG which inhibit wt LMP1 signaling by more than 75%
had no effect on TNF activation of NF B. The LMP1AAAG
molecule retains the putative Jak3-binding site (CTAR3) and while it
appears unable to signal to STAT transcriptional activity, it could
theoretically act to sequester Jak3 and thus inhibit Jak
3-dependent signaling from other receptors. This
possibility was tested in Kit225 cells, a leukemic cell line that is
stimulated by the cytokine, IL-2. In these cells, IL-2 utilizes Jak3
and activates STAT5 and STAT3, which have been previously shown to activate the GRR reporter (34). The Kit225 cells were transfected with
the LMP1AAAG expression plasmid, and the ability of IL-2 to
activate the GRR reporter was tested. Fig. 6B shows that
IL-2 was fully functional in the presence of similar levels of
LMP1AAAG that were shown to inhibit wt LMP1 signaling. This
provides evidence for the specificity of LMP1AAAG and
suggests that it acts proximal to the LMP1 molecule itself rather than
binding or sequestering signaling machinery that may be utilized by
other signaling pathways.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 6.
LMP1AAAG does not affect TNF or
interleukin-2 signaling. A, Jurkat cells were
transfected with an NF B reporter with and without wt LMP1 and
LMP1AAAG constructs as indicated. The cells were incubated
overnight to allow expression, and one set of cultures which had not
been transfected with wt LMP1 vector were instead stimulated with TNF
(10 ng/ml) for 6 h. Samples were then assayed for luciferase.
B, Kit225 cells were cultured in the absence of IL-2 for
24 h and then co-transfected with 10 µg of STAT reporter (GRR
luciferase) and either SG5 empty vector or SG5-LMP1AAAG as
indicated. Replicate cultures were either stimulated overnight with
IL-2 (20 ng/ml) or were left untreated before assaying for
luciferase.
|
|
LMP1AAAG Cellular Localization Is Indistinguishable
from that of Wild Type LMP1--
All the mutants of LMP1 utilized in
this study were expressed in DG75 B-cells and their cellular
localization was investigated by staining with the LMP1 antibody,
LMPO25. Cells were transfected with 5 µg of each expression vector
and left to express overnight. The cells were fixed with 2%
paraformaldehyde and acetone and then stained as described previously.
The staining was visualized with a Leica confocal microscope and a Z
series was acquired. Fig. 7A
shows the staining of wild type LMP1, LMP1AAAG, and
tr.LMP1. The staining of wild type LMP1 produced a characteristic pattern, with an accumulation of LMP1 into a "cap" at one end of
the cell. The pattern of staining produced by LMP1AAAG was
indistinguishable from wild type LMP1. In contrast the truncated LMP1
(tr.LMP1) has a substantially different cellular distribution. It does
not appear to form a single aggregate but rather has a diffuse cellular
distribution with some accumulation at the cell surface membrane.

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 7.
Wild type LMP1 and LMP1AAAG have
similar cellular distributions. A, DG75 cells were
transfected with wild type LMP1 vector (left-hand panel),
LMP1AAAG vector (middle panel), or tr.LMP1
vector (right-hand panel). Localization of the constructs
was investigated after overnight expression by staining using LMPO25
antibody with a Texas Red anti-immunglobulin antibody conjugate. Cells
were visualized by confocal microscopy. B, DG75 were
co-transfected with an expression vector for a rat CD2 wild type LMP1
fusion protein and a GFP-tagged LMP1AAAG expression vector
(right-hand panel). Cells were left to express the
constructs overnight. The CD2 tagged was visualized using OX34 antibody
and a Texas Red anti-immunglobulin antibody conjugate. Cells were
visualize by confocal microscopy.
|
|
The similarity of the wild type LMP1 and LMP1AAAG was
striking and was confirmed by expression of GFP-tagged forms of both
proteins. This prevents any artifacts due to fixation and allowed the
visualization of LMP1 in live cells. The results obtained (data not
shown) were very similar to that seen by staining with LMPO25 (Fig. 7).
To see if wild type LMP1 and LMP1AAAG could colocalize,
constructs that could be distinguished had to be utilized. We used a
fusion protein comprising the extracellular and transmembrane domains
of rat CD2 tagged to the N terminus of wild type LMP1, and a GFP-tagged
LMP1AAAG. Fig. 7B shows the image of an
equatorial region of a DG75 cell which had been co-transfected with
expression vectors for the CD2-WTLMP1 and LMP1AAAG-GFP. The
cells were fixed and stained for rat CD2 using the OX34 antibody and a
Texas Red secondary antibody. GFP was visualized in the fluorescein
isothiocyanate channel and a specific channel for Texas Red was
used to visualize CD2-tagged LMP1. A comparison of the two pictures
shows an overlapping distribution of the two proteins. Taken together,
the results suggest that both wild type LMP1 and LMP1AAAG
normally localize to the same subcellular region and that, if coexpressed in the same cell, may physically interact.
LMP1AAAG Binds Wild Type LMP1--
The images of wild
type LMP1 and LMP1AAAG together with the specificity of
LMP1AAAG suggested an hypothesis that LMP1AAAG
may be forming a complex with wild type LMP1. This complex may inhibit
the signaling of wild type LMP1. This hypothesis was tested by
investigating whether wild type LMP1 could bind LMP1AAAG by
performing co-precipitation experiments. The CD2-tagged wtLMP1 expression vector was transfected alone or together with either LMP1AAAG or tr.LMP1 vectors into DG75 B cells, and cell
lysates were immunoprecipitated with a specific CD2 antibody (OX34).
The presence of CD2-wtLMP1, LMP1AAAG, and tr.LMP1 in the
immunoprecipitates was assayed by Western blotting with a rabbit
polyclonal antibody to LMP1. The results are illustrated in Fig.
8. The anti-CD2 antibody specifically precipitated CD2-wtLMP1 (lane 1) but did not pull-down
LMP1AAAG (lane 4) or tr.LMP1 (lane 5)
when these LMP1 molecules were expressed alone. However, inspection
of the immunoprecipitates in the second lane shows that when
LMP1AAAG is coexpressed with CD2-wtLMP1,
LMP1AAAG does indeed form a complex with the wild type
protein. In contrast, the truncated LMP1 (third lane) does
not complex with the wild type protein. The lower panel
shows the input lysates used for the immunoprecipitations and shows
that similar levels of LMP1AAAG and tr.LMP1 were expressed.
These results demonstrate that LMP1AAAG will form a complex
with wild type LMP1.

View larger version (92K):
[in this window]
[in a new window]
|
Fig. 8.
LMP1AAAG binds wild type
LMP1. Western blots, probed with a rabbit antiserum to LMP1,
indicating the LMP1 molecules co-immunoprecipitating with wild type
LMP1. For each immunoprecipitation, 15 × 106 DG75
cells were co-transfected with 10 µg each of the SG5 expression
plasmids as indicated, and lysates were prepared 24 h
post-transfection. The wild type LMP1 was expressed as a CD2/LMP1
fusion protein which was precipitated with OX34 monoclonal antibody to
rat CD2. Lanes 1-3 show the OX34 immunoprecipitates from
cells co-transfected with CD2/LMP1 chimera and SG5 vector (lane
1), LMP1AAAG (lane 2), or tr.LMP1
(lane 3). Lane 4 shows the OX34 immunoprecipitate
from cells transfected with LMP1AAAG only, while lane
5 shows the anti-CD2 immunoprecipitate from cells transfected with
tr.LMP1 only. The upper blot shows the LMP1 species in the
resolved anti-CD2 immunoprecipitates, while the lower blot
shows the LMP1 species in the input lysates (equivalent to ~2% of
the lysate used for immunoprecipitation).
|
|
LMP1AAAG Prevents the Recruitment of TRAF2 to Wild Type
LMP1--
A complex between wild type LMP1 and LMP1AAAG
may be unable to bind signaling molecules. To investigate this
possibility, co-immunoprecipitation experiments were performed to
investigate the ability of the TNF adaptor molecule, TRAF2, to bind
LMP1. TRAF2 is postulated to be a major component of the LMP1 signaling
machinery. DG75 cells were transfected with vectors for wild type LMP1,
LMP1AAAG, and the truncated LMP1 (tr.LMP1), in the presence
of TRAF2. Cells were left overnight to allow expression. The cells were then lysed and the LMP1 was immunoprecipitated with antibodies CS-3 and
CS-4. These immunoprecipitates were resolved by SDS-PAGE and the
presence of TRAF2 in the immunoprecipitates was detected by Western
blotting. The results from a representative experiment are illustrated
in Fig. 9A. These show that
TRAF2 binds to wild type LMP1 but binds at a substantially reduced
level to both LMP1AAAG and tr.LMP1. Experiments were
performed to determine whether LMP1AAAG could inhibit the
recruitment of TRAF2 to wild type LMP1. This was done by
co-transfecting a range of amounts of a vector for GFP-tagged
LMP1AAAG (EGFP-LMP1AAAG) with a constant amount
of wild type LMP1 (3 µg) and TRAF2 (6 µg) vectors. Cells were lysed
and LMP1 was immunoprecipitated as before. Fig. 9B shows
that LMP1AAAG prevents the interaction of TRAF2 with wild
type LMP1 (top panel). The bottom panel (Fig.
9B) shows the expression of both wild type LMP1 and the
GFP-tagged LMP1AAAG.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 9.
LMP1AAAG has impaired TRAF2
binding ability and it inhibits the binding of TRAF2 to wt LMP1.
Western blots indicating the co-precipitation of TRAF2 with LMP1
complexes. For each immunoprecipitation, 15 × 106
DG75 cells were transfected as indicated and lysates were prepared at
24 h post-transfection. Immunoprecipitations were performed using
a pool of CS.3 and CS.4 mouse monoclonal antibodies to LMP1.
A, to compare the ability of different LMP1 molecules to
bind TRAF2, cells were transfected with 6 µg pCMV-TRAF2 (8-26)
together with 3 µg of either pSG5 vector (first lane),
pSG5-LMP1 (second lane), pSG5-LMP1AAAG
(third lane), or pSG5-LMP1 (1-128) (fourth
lane). The upper panel shows a Western blot of material
immunoprecipitated with antibodies to LMP1, and probed with rabbit
anti-TRAF2 antibodies. The middle and lower
panels show Western blots of the input lysates probed with rabbit
anti-TRAF2 antibodies (middle panel) or with CS.1-4
antibodies to LMP1 (lower panel). B, the dose
responsive dominant-negative effect of LMP1AAAG on wt LMP1
binding to TRAF2 was assayed. LMP1AAAG was expressed as an
EGFP-LMP1AAAG-tagged protein so that the expression levels
obtained with the indicated doses of pEGFP-LMP1AAAG DNA
(1-8 µg) could be compared with the expression of the lower
molecular weight wt LMP1 coexpressed from 3 µg of SG5-LMP1 plasmid. A
Western blot of the LMP1 immunoprecipitates was probed with rabbit
anti-TRAF2 antibodies (upper blot), and the input lysates
were probed with CS.1-4 anti-LMP1 antibodies (lower blot).
C, the in vitro binding of TRAF2 to wild type
LMP1 or a complex of wild type LMP1 and LMP1AAAG was
investigated by adding lysates that contained TRAF2 to
immunoprecipitates of LMP1 from DG75 cells that had been transfected
with wild type LMP1 or both wild type LMP1 and LMP1AAAG.
The immunoprecipitates were then resolved by SDS-PAGE and the presence
of newly bound TRAF2 was investigated by Western blotting.
|
|
Clearly, LMP1AAAG interferes with the ability of wild type
LMP1 to bind TRAF2 in the cellular context. It is possible that this is
a result of LMP1AAAG sequestering wild type LMP1 to a
different subcellular location, away from TRAF2, While this appears
unlikely from the results in Fig. 7, we conducted additional
experiments to examine whether LMP1AAAG interfered with the
ability of wild type LMP1 to bind TRAF2 in vitro. In this
set of experiments, LMP1 molecules were first precipitated from lysates
of transfected DG75 B-cells and were then incubated with
TRAF2-containing lysates from separately transfected DG75 cells. Fig.
9C shows that the while immune precipitates of wild type
LMP1 can effectively bind exogenously added TRAF2, the complex of wild
type LMP1 with LMP1AAAG could not bind TRAF2. Together
these immunoprecipitation experiments suggest a mechanism whereby
LMP1AAAG binds to wild type LMP1 and prevents the
recruitment of TRAF2. This prevents LMP1 signal transduction to the nucleus.
 |
DISCUSSION |
This study describes a novel inhibitor of the oncogenic protein
LMP1. It characterizes the efficacy, selectivity, and mechanism of the
inhibitor. The efficacy was tested by inhibition of reporter constructs
and ICAM-1 protein expression changes induced by LMP1. It was shown to
be both nonfunctional and to be dominant inhibitory when expressed at
similar levels to wild type LMP1. It was shown to be selective as it
does not inhibit TNF or IL-2 signaling. Finally an investigation into
the mechanism demonstrates that it does not sequester downstream
signaling molecules but binds wild type LMP1 and inhibits the binding
of at least one signaling molecule, TRAF2.
All described previously, mutants of LMP1 that are unable to activate
NF B have had deletions of either CTAR1 or CTAR2.
LMP1AAAG is the first mutant that is unable to activate
NF B and contains only point mutations. This reduces the likelihood
of dramatic structural effects that can result from amino acid
deletions. It strengthens the hypothesis that all the signals required
for NF B activation lie completely within CTAR1 and CTAR2.
While in terms of NF B, this is not surprising, it is still an
important confirmation of our expectations. However, the fact that
proper functioning of CTAR1 and CTAR2 is required for GRR luciferase
activity, and thus STAT activation, was unexpected since Gires et
al. (14) recently described CTAR3 as a Jak-binding domain. Our
result does not necessarily contradict the results from Gires et
al. (14) but casts them in a new light. It suggests that while
CTAR3 may be a distinct signaling motif of LMP1, it does not function
in isolation to activate STATs. The mechanism of this activation is
intriguing and is currently the subject of investigation. Gires
et al. (14) measured STAT1 DNA binding whereas this present
study has measured STAT transcriptional activity. STAT proteins have
been shown to be modulated by both tyrosine and serine phosphorylation
(34, 40, 42) and the Jak kinases can only phosphorylate tyrosine
residues. The serine phosphorylation of STATs has been shown to be
important for transcriptional activity but not DNA binding. Distinct
signaling pathways have been shown to be utilized by both IL-2 (34) and
interferon signaling (42) for the regulation of STAT transcriptional
activity. Thus, while CTAR3 may control STAT tyrosine phosphorylation,
CTAR1 or CTAR2 may be required for other signaling pathways necessary
for STAT transcriptional activity.
The interplay between the domains of LMP1 has been postulated
previously. It has been shown that for optimal functions, CTAR1 and
CTAR2 must be in the same signaling complex (21). The inhibitory effects of LMP1AAAG further elucidates the importance of
cooperation between LMP1 molecules. It is apparent that this
cooperation is not just of a structural nature but also requires the
cooperative binding of signaling molecules. We have shown that
LMP1AAAG does not prevent normal cellular localization of
LMP1 (Fig. 7). Furthermore, a complex of wild type LMP1 and
LMP1AAAG is unable to bind TRAF2, a key signaling molecule,
both in vitro and in whole cells (Fig. 9). This suggests
that the cooperation between the domains of LMP1 is required between
molecules for the regulation of gene expression events. Furthermore,
this cooperation acts at the level of the recruitment of receptor
proximal signaling molecules and not at the level of cooperating
nuclear signals, demonstrating the importance of the formation of an
intact signaling complex. TRAF2 has been shown to bind the TNF
receptor, to which LMP1 has been compared, as a trimeric complex. If it
binds LMP1 using a similar mechanism, it is likely that the presence,
in a signaling complex of a protein that cannot bind TRAF2 will inhibit TRAF binding to other members of the signaling complex. There may also
be interplay between CTAR3 and one or both of the other signaling
domains of LMP1. Since STAT regulation is proposed to be controlled by
CTAR3, but LMP1AAAG, in which CTAR3 is intact, cannot
signal to the STAT reporter, some cooperation between CTAR1 or CTAR2
and CTAR3 must exist.
LMP1AAAG was substantially more efficient than the
naturally occurring truncated from of LMP1 (tr.LMP1) (Fig. 3).
Furthermore, localization and immunoprecipitation experiments, which
characterized the mechanism of LMP1AAAG, show tr.LMP1 to
function very differently. Truncated LMP1 does not oligomerize with
wild type LMP1 (Fig. 8 and Ref. 39) and it has substantially reduced
TRAF2 binding (Fig. 9) suggesting that it cannot sequester this
signaling molecule. Our data suggests that whatever mechanism tr.LMP1
utilizes, it is less efficient than that of LMP1AAAG.
The regulation of the Jak-STAT signaling pathway by LMP1 is of interest
since constitutive STAT activity has been shown to be a feature of
leukemic cell lines (43). Lymphoblastoid cell lines, B-cells that are
immortalized by Epstein-Barr virus, contain STAT complexes that can
bind DNA (44).2 The
importance of these DNA binding complexes is unknown but the ability of
LMP1 to regulate not only the DNA binding (14) but also the
transcriptional activity of STATs, as shown in the present study,
suggests that the STATs that are binding DNA in lymphoblastoid cell
lines are also likely to be transcriptionally active. STATs may offer
novel therapeutic targets for LMP1-associated disease and the ability
of LMP1AAAG to inhibit STAT transcriptional ability
increases its usefulness.
LMP1AAAG will be a useful tool to characterize the role of
LMP1 in survival and disease pathogenesis. It has advantages over
currently available technology, such as antisense technology or even
LMP1-deleted recombinant viruses, as it is specific and allows the
study of LMP1 in cells that have already been infected with EBV.
LMP1AAAG is being cloned into an inducible vector to make
stable cell lines with this mutant to test its effects on the growth of
lymphoblastoid cell lines, as a model of post-transplant
lymphoproliferative disorder. Furthermore, inducible
LMP1AAAG may be useful in characterizing the role of LMP1
in the growth of nasopharyngeal carcinomas tumors transplanted into
nude mice (45). With regard to Hodgkin's disease, published data
suggests that LMP1 down-regulation of the cell surface protein, CD99,
plays a critical role in the progression to Hodgkin's disease (46). LMP1AAAG inhibits the LMP1 mediated down-regulation of the
CD99 promoter3 suggesting
that it may be inhibitory for disease progression. Other disease models
are currently under investigation.
In summary, this study enhances our understanding of LMP1 signaling
specifically and as a model of the TNF receptor superfamily. We have
characterized the effectiveness and mechanism of a receptor-based dominant inhibitor, LMP1AAAG. This mutant suggests
cooperation within the LMP1 oligomer in binding of the signaling
molecule, TRAF2. The application of this type of receptor based
inhibitory molecule may prove useful in establishing the function and
mechanism of action of both LMP1 and other receptors in
vitro and in a cell specific fashion in vivo. It has
also been suggested that LMP1AAAG may have useful
therapeutic applications.
 |
ACKNOWLEDGEMENTS |
We thank Eddie Wang, Sinead Keating, and Ceri
Fielding for reading the manuscript.
 |
FOOTNOTES |
*
The work was supported by the Leukemia Research Fund,
London, the Wellcome Trust, and European Biomed-2 Award BMH4-CT97-2567.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 44-29-20744517;
Fax: 44-29-20745003; E-mail: brennanp@cardiff.ac.uk.
§
Present address: Dept. of Molecular Biology, AstraZeneca R&D
Charnwood, Bakewell Road, Loughborough, LE11 5RH United Kingdom.
Published, JBC Papers in Press, October 12, 2000, DOI 10.1074/jbc.M005461200
2
P. Brennan, unpublished data.
3
I. Lee, M. K. Kim, E. Y. Choi, A. Mehl, K. L. Jung, M. Rowe, and S. H. Park, manuscript in preparation.
 |
ABBREVIATIONS |
The abbreviations used are:
LMP1, latent
membrane protein-1;
EBV, Epstein-Barr virus;
tr.LMP1, truncated LMP1;
ICAM-1, intercellular adhesion molecule-1;
NF B, nuclear factor B;
TNF, tumor necrosis factor;
JNK, Jun N-terminal kinase;
JAK3, Janus
activating tyrosine kinase 3;
STAT, signal transducing and
transcription factor;
TRFR, tumor necrosis factor receptor;
TRAF, tumor
necrosis factor receptor-associated factor;
TRADD, TNFR-associated
death domain;
IL, interleukin;
EGFP, enhanced green fluorescent
protein;
SAPK, stress-activated protein kinase;
CAT, chloramphenicol
acetyltransferase;
PAGE, polyacrylamide gel electrophoresis;
wt, wild
type.
 |
REFERENCES |
| 1.
|
Rickinson, A. B.,
and Kieff, E.
(1996)
in
Fields Virology
(Fields, B. N.
, Knipe, D. M.
, and Howley, P. M., eds), Vol. 2
, pp. 2397-2446, Lippincott-Raven, Philadelphia
|
| 2.
|
Kaye, K. M.,
Izumi, K. M.,
and Kieff, E.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
9150-0154
|
| 3.
|
Wang, D.,
Liebowitz, D.,
and Kieff, E.
(1985)
Cell
43,
831-840
|
| 4.
|
Baichwal, V. R.,
and Sugden, B.
(1988)
Oncogene
2,
461-467
|
| 5.
|
Kulwichit, W.,
Edwards, R. H.,
Davenport, E. M.,
Baskar, J. F.,
Godfrey, V.,
and Raab-Traub, N.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
11963-11968
|
| 6.
|
Uchida, J.,
Yasui, T.,
Takaoka-Shichijo, Y.,
Muraoka, M.,
Kulwichit, W.,
Raab-Traub, N.,
and Kikutani, H.
(1999)
Science
286,
300-303
|
| 7.
|
Laherty, C. D.,
Hu, H. M.,
Opipari, A. W.,
Wang, F.,
and Dixit, V. M.
(1992)
J. Biol. Chem.
267,
24157-24160
|
| 8.
|
Wang, S.,
Rowe, M.,
and Lundgren, E.
(1996)
Cancer Res.
56,
4610-4613
|
| 9.
|
Henderson, S.,
Rowe, M.,
Gregory, C.,
Croom-Carter, D.,
Wang, F.,
Longnecker, R.,
Kieff, E.,
and Rickinson, A.
(1991)
Cell
65,
1107-1115
|
| 10.
|
D'Souza, B.,
Rowe, M.,
and Walls, D.
(2000)
J. Virol.
74,
6652-6658
|
| 11.
|
Gregory, C. D.,
Murray, R. J.,
Edwards, C. F.,
and Rickinson, A. B.
(1988)
J. Exp. Med.
167,
1811-1824
|
| 12.
|
Rowe, M.,
Khanna, R.,
Jacob, C. A.,
Argaet, V.,
Kelly, A.,
Powis, S.,
Belich, M.,
Croom-Carter, D.,
Lee, S.,
Burrows, S. R.,
Trowsdale, J.,
Moss, D. J.,
and Rickinson, A. B.
(1995)
Eur. J. Immunol.
25,
1374-1384
|
| 13.
|
Huen, D. S.,
Henderson, S. A.,
Croom-Carter, D.,
and Rowe, M.
(1995)
Oncogene
10,
549-560
|
| 14.
|
Gires, O.,
Kohlhuber, F.,
Kilger, E.,
Baumann, M.,
Kieser, A.,
Kaiser, C.,
Zeidler, R.,
Scheffer, B.,
Ueffing, M.,
and Hammerschmidt, W.
(1999)
EMBO J.
18,
3064-3073
|
| 15.
|
Eliopoulos, A. G.,
and Rickinson, A. B.
(1998)
Curr. Biol.
8,
R196-198
|
| 16.
|
Devergne, O.,
Hatzivassiliou, E.,
Izumi, K. M.,
Kaye, K. M.,
Kleijnen, M. F.,
Kieff, E.,
and Mosialos, G.
(1996)
Mol. Cell. Biol.
16,
7098-7108
|
| 17.
|
Kaye, K. M.,
Devergne, O.,
Harada, J. N.,
Izumi, K. M.,
Yalamanchili, R.,
Kieff, E.,
and Mosialos, G.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
11085-11090
|
| 18.
|
Mosialos, G.,
Birkenbach, M.,
Yalamanchili, R.,
VanArsdale, T.,
Ware, C.,
and Kieff, E.
(1995)
Cell
80,
389-399
|
| 19.
|
Izumi, K. M.,
and Kieff, E. D.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
12592-12597
|
| 20.
|
Liu, Z. G.,
Hsu, H.,
Goeddel, D. V.,
and Karin, M.
(1996)
Cell
87,
565-576
|
| 21.
|
Floettmann, J. E.,
Eliopoulos, A. G.,
Jones, M.,
Young, L. S.,
and Rowe, M.
(1998)
Oncogene
17,
2383-2392
|
| 22.
|
Eliopoulos, A. G.,
Gallagher, N. J.,
Blake, S. M.,
Dawson, C. W.,
and Young, L. S.
(1999)
J. Biol. Chem.
274,
16085-16096
|
| 23.
|
Eliopoulos, A. G.,
Blake, S. M.,
Floettmann, J. E.,
Rowe, M.,
and Young, L. S.
(1999)
J. Virol.
73,
1023-1035
|
| 24.
|
Kieser, A.,
Kaiser, C.,
and Hammerschmidt, W.
(1999)
EMBO J.
18,
2511-2521
|
| 25.
|
Devergne, O.,
McFarland, E. C.,
Mosialos, G.,
Izumi, K. M.,
Ware, C. F.,
and Kieff, E.
(1998)
J. Virol.
72,
7900-7908
|
| 26.
|
Eliopoulos, A. G.,
Stack, M.,
Dawson, C. W.,
Kaye, K. M.,
Hodgkin, L.,
Sihota, S.,
Rowe, M.,
and Young, L. S.
(1997)
Oncogene
14,
2899-2916
|
| 27.
|
Brodeur, S. R.,
Cheng, G.,
Baltimore, D.,
and Thorley-Lawson, D. A.
(1997)
J. Biol. Chem.
272,
19777-19784
|
| 28.
|
Izumi, K. M.,
McFarland, E. C.,
Riley, E. A.,
Rizzo, D.,
Chen, Y.,
and Kieff, E.
(1999)
J. Virol.
73,
9908-9916
|
| 29.
|
Floettmann, J. E.,
and Rowe, M.
(1997)
Oncogene
15,
1851-1858
|
| 30.
|
Brattsand, G.,
Cantrell, D. A.,
Ward, S.,
Ivars, F.,
and Gullberg, M.
(1990)
J. Immunol.
144,
3651-3658
|
| 31.
|
Rowe, M.,
Lear, A. L.,
Croom-Carter, D.,
Davies, A. H.,
and Rickinson, A. B.
(1992)
J. Virol.
66,
122-131
|
| 32.
|
Hori, T.,
Uchiyama, T.,
Tsudo, M.,
Umadome, H.,
Ohno, H.,
Fukuhara, S.,
Kita, K.,
and Uchino, H.
(1987)
Blood
70,
1069-1072
|
| 33.
|
Arenzana-Seisdedos, F.,
Fernandez, B.,
Dominguez, I.,
Jacque, J. M.,
Thomas, D.,
Diaz-Meco, M. T.,
Moscat, J.,
and Virelizier, J. L.
(1993)
J. Virol.
67,
6596-6604
|
| 34.
|
Beadling, C.,
Ng, J.,
Babbage, J. W.,
and Cantrell, D. A.
(1996)
EMBO J.
15,
1902-1913
|
| 35.
|
Marais, R.,
Wynne, J.,
and Treisman, R.
(1993)
Cell
73,
381-393
|
| 36.
|
Rowe, M.,
and Jones, M.
(2001)
in
Methods in Molecular Biology: Epstein-Barr Virus Protocols
(Wilson, J. B., ed)
, Humana Press Inc., Totowa, NJ, in press
|
| 37.
|
Rowe, M.,
Evans, H. S.,
Young, L. S.,
Hennessy, K.,
Kieff, E.,
and Rickinson, A. B.
(1987)
J. Gen. Virol.
68,
1575-1586
|
| 38.
|
Brennan, P.,
Babbage, J. W.,
Burgering, B. M.,
Groner, B.,
Reif, K.,
and Cantrell, D. A.
(1997)
Immunity
7,
679-689
|
| 39.
|
Erickson, K. D.,
and Martin, J. M.
(2000)
J. Virol.
74,
1057-1060
|
| 40.
|
Ng, J.,
and Cantrell, D.
(1997)
J. Biol. Chem.
272,
24542-24549
|
| 41.
|
Lin, A.,
Minden, A.,
Martinetto, H.,
Claret, F. X.,
Lange-Carter, C.,
Mercurio, F.,
Johnson, G. L.,
and Karin, M.
(1995)
Science
268,
286-290
|
| 42.
|
Decker, T.,
and Kovarik, P.
(1999)
Cell. Mol. Life Sci.
55,
1535-1546
|
| 43.
|
Bowman, T.,
Garcia, R.,
Turkson, J.,
and Jove, R.
(2000)
Oncogene
19,
2474-2488
|
| 44.
|
Weber-Nordt, R. M.,
Egen, C.,
Wehinger, J.,
Ludwig, W.,
Gouilleux-Gruart, V.,
Mertelsmann, R.,
and Finke, J.
(1996)
Blood
88,
809-816
|
| 45.
|
Busson, P.,
Ganem, G.,
Flores, P.,
Mugneret, F.,
Clausse, B.,
Caillou, B.,
Braham, K.,
Wakasugi, H.,
Lipinski, M.,
and Tursz, T.
(1988)
Int. J. Cancer
42,
599-606
|
| 46.
|
Kim, S. H.,
Shin, Y. K.,
Lee, I. S.,
Bae, Y. M.,
Sohn, H. W.,
Suh, Y. H.,
Ree, H. J.,
Rowe, M.,
and Park, S. H.
(2000)
Blood
95,
294-300
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
B. A. Mainou, D. N. Everly Jr., and N. Raab-Traub
Unique Signaling Properties of CTAR1 in LMP1-Mediated Transformation
J. Virol.,
September 15, 2007;
81(18):
9680 - 9692.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R.-C. Jiang, H.-D. Qin, M.-S. Zeng, W. Huang, B.-J. Feng, F. Zhang, H.-K. Chen, W.-H. Jia, L.-Z. Chen, Q.-S. Feng, et al.
A Functional Variant in the Transcriptional Regulatory Region of Gene LOC344967 Cosegregates with Disease Phenotype in Familial Nasopharyngeal Carcinoma
Cancer Res.,
January 15, 2006;
66(2):
693 - 700.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Najjar, F. Baran-Marszak, C. Le Clorennec, C. Laguillier, O. Schischmanoff, I. Youlyouz-Marfak, M. Schlee, G. W. Bornkamm, M. Raphael, J. Feuillard, et al.
Latent Membrane Protein 1 Regulates STAT1 through NF-{kappa}B-Dependent Interferon Secretion in Epstein-Barr Virus-Immortalized B Cells
J. Virol.,
April 15, 2005;
79(8):
4936 - 4943.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Lam, M. L. Sandberg, and B. Sugden
High Physiological Levels of LMP1 Result in Phosphorylation of eIF2{alpha} in Epstein-Barr Virus-Infected Cells
J. Virol.,
February 15, 2004;
78(4):
1657 - 1664.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. N. D'Souza, L. C. Edelstein, P. M. Pegman, S. M. Smith, S. T. Loughran, A. Clarke, A. Mehl, M. Rowe, C. Gelinas, and D. Walls
Nuclear Factor {kappa}B-Dependent Activation of the Antiapoptotic bfl-1 Gene by the Epstein-Barr Virus Latent Membrane Protein 1 and Activated CD40 Receptor
J. Virol.,
February 15, 2004;
78(4):
1800 - 1816.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. G. P. Atkinson, H. J. Coope, M. Rowe, and S. C. Ley
Latent Membrane Protein 1 of Epstein-Barr Virus Stimulates Processing of NF-{kappa}B2 p100 to p52
J. Biol. Chem.,
December 19, 2003;
278(51):
51134 - 51142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. Dirmeier, B. Neuhierl, E. Kilger, G. Reisbach, M. L. Sandberg, and W. Hammerschmidt
Latent Membrane Protein 1 Is Critical for Efficient Growth Transformation of Human B Cells by Epstein-Barr Virus
Cancer Res.,
June 1, 2003;
63(11):
2982 - 2989.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Prince, S. Keating, C. Fielding, P. Brennan, E. Floettmann, and M. Rowe
Latent Membrane Protein 1 Inhibits Epstein-Barr Virus Lytic Cycle Induction and Progress via Different Mechanisms
J. Virol.,
April 15, 2003;
77(8):
5000 - 5007.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Richardson, C. Fielding, M. Rowe, and P. Brennan
Epstein-Barr Virus Regulates STAT1 through Latent Membrane Protein 1
J. Virol.,
April 1, 2003;
77(7):
4439 - 4443.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. G. Eliopoulos, E. R. Waites, S. M. S. Blake, C. Davies, P. Murray, and L. S. Young
TRAF1 Is a Critical Regulator of JNK Signaling by the TRAF-Binding Domain of the Epstein-Barr Virus-Encoded Latent Infection Membrane Protein 1 but Not CD40
J. Virol.,
December 20, 2002;
77(2):
1316 - 1328.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Mehl, M. Jones, M. Rowe, and P. Brennan
Characterization of a CD40-Dominant Inhibitory Receptor Mutant
J. Immunol.,
December 1, 2001;
167(11):
6388 - 6393.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. K. Busch and G. A. Bishop
Multiple Carboxyl-Terminal Regions of the EBV Oncoprotein, Latent Membrane Protein 1, Cooperatively Regulate Signaling to B Lymphocytes Via TNF Receptor-Associated Factor (TRAF)-Dependent and TRAF-Independent Mechanisms
J. Immunol.,
November 15, 2001;
167(10):
5805 - 5813.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Fielding, K. Sandvej, A. Mehl, P. Brennan, M. Jones, and M. Rowe
Epstein-Barr Virus LMP-1 Natural Sequence Variants Differ in Their Potential To Activate Cellular Signaling Pathways
J. Virol.,
October 1, 2001;
75(19):
9129 - 9141.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|