Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M005461200 on October 12, 2000

J. Biol. Chem., Vol. 276, Issue 2, 1195-1203, January 12, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/2/1195    most recent
M005461200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brennan, P.
Right arrow Articles by Rowe, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brennan, P.
Right arrow Articles by Rowe, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Mechanism of Action of a Novel Latent Membrane Protein-1 Dominant Negative*

Paul BrennanDagger, J. Eike Floettmann§, Anja Mehl, Matthew Jones, and Martin Rowe

From the Department of Medicine, Tenovus Building, University of Wales College of Medicine, Heath Park, Cardiff, CF14 4XX, United Kingdom

Received for publication, June 22, 2000, and in revised form, September 25, 2000



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Latent membrane protein-1 (LMP1) is a signaling molecule expressed by Epstein-Barr virus during latency. LMP1 is essential for B-cell immortalization by Epstein-Barr virus and transforms rodent fibroblasts. It activates many distinct signaling pathways including the transcription factors NFkappa B and AP1. We have generated a mutant of LMP1 with four point mutations; amino acids 204, 206, and 208 were mutated to alanine, and amino acid 384 was mutated to glycine. This mutant, termed LMP1AAAG, is not only unable to activate nuclear signaling pathways, but also inhibits signaling from wild type LMP1. We have demonstrated the effectiveness, selectivity, and mechanism of this inhibitory molecule. It inhibits LMP1-stimulated NFkappa B, STAT, and Jun transcriptional activity. It is selective, as it does not inhibit TNF or interleukin-2 signaling. We have demonstrated that it does not sequester the downstream signaling molecule, TRAF2, but instead binds LMP1 and interferes with its ability to bind TRAF2. This demonstrates the importance of the interplay between the signaling domains of LMP1 and the oligomeric structure of LMP1 for effective signaling. It identifies a tool that will be useful to probe LMP1 function in disease.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Epstein-Barr virus is found in a latent state following infection and growth transformation of B-lymphocytes (1). One of the limited number of genes expressed during this state is latent membrane protein-1 (LMP1),1 which has been shown to be essential for B-cell immortalization by EBV (2). LMP1 has also been shown to transform rodent fibroblasts (3, 4) and cause lymphomas in transgenic mice (5, 6). Cell transformation by LMP1 is at least in part due to the up-regulation of various anti-apoptotic proteins such as bcl-2, A20, mcl-1, and bfl-1 (7-10). LMP1 also plays a role in the immunogenicity of EBV by up-regulating a number of proteins involved in immune regulation such as the TAP-1 and TAP-2 peptide transporter components of the endogenous antigen processing pathway, major histocompatibility complex class I, and the intercellular adhesion molecules, ICAM-1 and LFA-3 (11, 12).

LMP1 is a 63-kDa integral membrane protein in which three signaling domains have been characterized (Fig. 1A). The protein has six hydrophobic transmembrane segments and is thought to spontaneously oligomerize to stimulate intracellular pathways. The three signaling domains are entitled C-terminal activating region-1 (CTAR1), CTAR2, and CTAR3 (13-15). CTAR1 has been shown to bind the complex of cellular proteins belonging to the family of tumor necrosis factor receptor-binding proteins (TRAFs) (16-18). CTAR2 binds TRADD and other signaling molecules (19, 20). Both of these domains can activate NFkappa B transcriptional activity independently but they function optimally together (21). Likewise, activation of the p38 kinase pathway is also mediated via both CTAR1 and CTAR2 (22). In contrast, LMP1 activates the JNK kinase pathways via CTAR2 (23, 24). The activation of NFkappa B and p38 have been shown to be required for a number of LMP1-regulated genes, demonstrating the importance of these pathways (22, 25). Recently a third signaling domain of LMP1 was described and termed CTAR3 (14). This has been suggested to bind Jak 3 and activate the DNA binding of STAT1 (14). No function has been ascribed to the activation of the Jak-STAT pathway by LMP1, and the interaction of CTAR3 with the other signaling domains of LMP1 remains to be elucidated.

The functional domains of LMP1 were initially identified by deletional analysis. Recently, more detailed analysis has identified point mutations of critical residues that can abolish functions. By comparison of the LMP1 sequence with the functional domains of CD40, a PXQXT motif in CTAR1 was identified and substitution of the critical Pro204/Gln206/Thr208 residues to alanines abolished TRAF binding and NFkappa B activation from the CTAR1 of LMP1 (16, 26, 27). In the CTAR2 region, substitution of a critical Tyr384 residue completely abolished TRADD binding, and the activation of NFkappa B and AP1 (24, 28, 29). The critical residues in CTAR3 for Jak3 binding have not been identified.

This project was instigated to test the hypothesis that mutation of LMP1 could yield not only a nonsignaling form of the protein but also generate a dominant inhibitor. We have generated such a mutant, LMP1AAAG, in which both CTAR1 and CTAR2 were inactivated by four point mutations: P204A, Q206A, T208A, and Y384G. This report describes the key features of the LMP1AAAG mutant which enhance our understanding of the mechanism of LMP1 signaling. First, this mutant is unexpectedly defective in the ability to activate a STAT-regulated reporter, a function that was shown to be regulated by CTAR3. Second, the LMP1AAAG mutant was found to function as a dominant inhibitory molecule when coexpressed with wild type LMP1. The efficiency, specificity and mechanism of the dominant negative molecule have been examined.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture-- Jurkat is a cell line derived from an EBV negative T cell lymphoma (30). Eli-BL is an EBV-positive B cell line established from a Burkitt's lymphoma, and it displays a latency I form of infection in which Epstein-Barr virus nuclear antigen 1 is the only viral protein detected (31). DG75 is an EBV-negative Burkitt's lymphoma B cell line. Kit225 is a human leukemic cell line (32) that is dependent upon IL-2 for growth. The Kit225 cells were deprived of IL-2 for 24 h prior to transfection by washing the cells twice in phosphate-buffered saline. All the lymphoid cell lines were grown in suspension in RPMI 1640 medium supplemented with 10% fetal calf serum, 2 mM glutamine and antibiotics (200 units/ml penicillin and 200 µg/ml streptomycin), and were maintained at 37 °C in a humidified atmosphere with 5% CO2.

Plasmids-- Plasmid pSG5-LMP1 expresses a wild type LMP1 cDNA derived from the B95.8 strain of EBV, under the control of the SV-40 promoter of the SG5 vector. The pSG5-LMP1Delta (1-128) encodes an LMP1 protein deleted for the first 128 amino acids and corresponds to the truncated from of LMP1 (tr.LMP1) expressed during lytic cycle in B95.8 cells (13). The pSG5-LMP1AAAG mutant was constructed in two steps. First, a pSG5-LMP1AAA mutant was generated by site-directed mutagenesis, (23), to mutate the codons 204-208 from PXQXT to AXAXA. The LMP1 gene was then polymerase chain reaction-amplified from the pSG5-LMP1AAA mutant as a BglII fragment using a variant 3'primer (GAAGATCTTTAGTCATAGCCGCTTAGC) to mutate codon 384 from Tyr to Gly, and was cloned into the BglII site of pSG5 to create pSG5-LMP1AAAG. The presence of all the correct mutations was confirmed by sequencing. The same polymerase chain reaction product was also cloned into pEGFP-C1 (CLONTECH) to generate the pEGFP/LMP1AAAG plasmid encoding a mutant LMP1AAAG protein with an N terminus GFP tag. Generation of the plasmid pSG5-CD2/LMP1 has been reported previously (29). The TRAF2 expression vectors were kindly provided by Elliott Kieff (17), pcDNA3-TRAF2Delta (6-86) encodes a dominant negative mutant form of TRAF2 that retains the ability to bind LMP1 but is unable to affect signaling functions such as activation of NFkappa B.

The reporter plasmid, 3Enh-luc (33) was used to assay NFkappa B activity. The STAT reporter, GRR luciferase is the luciferase analog of the GRRCAT reporter described previously (34). The lex-Jun fusion protein plasmid (from Dr. R. Treisman, ICRF, London) is a fusion of codons 3 to 199 of the bacterial protein, LexA and codons 1 to 194 of c-Jun, which contains the transactivation domain of Jun. The lex reporter has been described previously (35).

Transfections, Reporter, and ICAM-1 Assays-- For transient expression, 0.5 to 1.5 × 107 cells from a suspension culture were transfected by electroporation using a Bio-Rad Genepulser II electroporator at 270 or 280 V and 950 microfarads at room temperature in 500 µl of growth medium. The cells were reseeded in 5 ml of fresh growth medium and were then incubated under normal conditions.

The activity of the luciferase reporter plasmids was measured 24 h post-transfection using a standard bioluminescence protocol (21). For chloramphenicol acetyltransferase assays, cells were lysed in buffer containing 10 mM Tris (pH 8.0), 1 mM EDTA, 150 mM NaCl, 0.65% Nonidet P-40. Samples were then assayed for CAT activity by radioisotope method (34).

The induction of ICAM-1 protein in transfected cells was routinely assayed by immunofluorescence staining of viable cells, followed by flow cytometry using a Becton Dickinson FACSCalibur analyzer as described previously (21). Briefly, at 48 h post-transfection the cells were washed and stained with a phycoerythrin-conjugated monoclonal antibody to human CD54 (MCA675PE; Serotec) at 4 °C for 60 min. The transfected population was marked by the expression of co-transfected EGFP-C1 plasmid (CLONTECH), and the GFP-positive population was gated for analysis of ICAM-1 staining.

Immunoprecipitations and Western Blotting-- For each immunoprecipitation, 15 × 106 cells of the DG75 line in 0.5 ml of growth medium were electroporated at 270 V and 950 microfarads with up to 20 µg of plasmid DNA as indicated in the Results section. At 24 h post-transfection, DG75 B-cells were washed twice with phosphate-buffered saline, then lysed for 45 min on ice in 800 µl of Nonidet P-40-lysis buffer (0.5% Nonidet P-40, 50 mM HEPES buffer, 0.25 M NaCl, 2 mM EDTA) to which a 5% protease inhibitor mixture (Sigma; P8340) was added immediately prior to use. The lysates were clarified by centrifugation at 13,000 × g for 5 min, and the soluble fraction was then precleared for 4 h with 20 µl of Sepharose-Protein G or with Sepharose-Protein G to which 1 µg of control antibody had been covalently cross-linked. The precleared lysate was then incubated for 4 h with 20 µl of Sepharose-Protein G to which 1 µg of OX34 or a mixture of 0.5 µg of CS.3 and 0.5 µg of CS.4, had been covalently cross-linked. CS.3 and CS.4 bind epitopes in the repeat regions of LMP1. The immunoprecipitates were washed 4 times and eluted by boiling in 40 µl of SDS gel sample buffer. Half of the eluate was separated by SDS-PAGE and subjected to Western blotting to detect LMP1 and TRAF2.

For Western blotting analysis performed in parallel with reporter assays, cells were washed in phosphate-buffered saline and lysed for 30 min on ice in luciferase lysis buffer and processed as described previously (36). Typically, the lysates from 2 × 105 cells was applied to each track of the gel. LMP1 was detected with the mouse monoclonal antibodies CS.1-4 used at 1 µg/ml, or with a 1/1000 dilution of a rabbit polyclonal serum raised to a beta -galactosidase fusion protein containing 189 amino acids of the C terminus of LMP1 (37). TRAF2 was detected with rabbit polyclonal antibodies reactive with a C terminus epitope corresponding to amino acids 478-497 (Santa Cruz; sc876) and was used at 1 µg/ml. All primary antibody incubations were for 90 min at room temperature.

Microscopy-- For LMP1 staining, DG75 cells were stained with a mouse monoclonal antibody to LMP1, LMPO25 (10 µg/ml), using standard protocols with Texas Red- conjugated anti-mouse IgG (EY Laboratories) as a secondary antibody. For two color analysis of GFP-tagged LMP1AAAG and CD2-tagged wild type LMP1, CD2 staining was performed using OX34 (10 µg/ml) and detected with Texas Red conjugate as described previously (38). The cells were visualized on a Leica TCS4D confocal microscope. A Z series was performed and equatorial region was illustrated in all cases.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Generation of a Nonfunctional LMP1 Mutant, LMP1AAAG-- To create a nonsignaling LMP1, a form of LMP1 was generated in which four of critical residues in CTAR1 and CTAR2 are mutated. A schematic of this mutant, called LMP1AAAG, is shown in Fig. 1A. Fig. 1A also shows a schematic of a rare but naturally occurring truncated LMP1 (tr.LMP1) that can be expressed in a limited number of strains of EBV, and is postulated to inhibit LMP1 function (39). These two mutants and a wild type form of LMP1 were expressed in DG75 B-cells and analyzed by Western blotting (Fig. 1B). The molecular weight of the LMP1AAAG is the same as wild type LMP1 (compare second and third lanes of Fig. 1B), whereas the truncated form (Fig. 1B, 4th lane) runs at a reduced molecular weight.



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 1.   Essential features of some LMP1 molecules used in this study. A, schematic showing the structure of wild type LMP1, dominant negative LMP1 (LMP1AAAG) and a naturally occurring truncated LMP1 mutant (tr.LMP1). Functional C-terminal signaling domains are illustrated (gray boxes). The four point mutations in LMP1AAAG are indicated. B, Western blotting showing wild type LMP1, LMP1AAAG, and tr.LMP1 following transfection of expression vectors in DG75 cells. The products of all three constructs were detected with an anti-LMP1 antibody (CS.1-4) following SDS-PAGE and transfer onto polyvinylidene difluoride membrane.

The ability of LMP1AAAG to activate LMP1 signaling pathways was tested. Jurkat cells were co-transfected with a range of amounts of an expression vector for wild type LMP1 or LMP1AAAG together with an NFkappa B reporter construct (3enh luciferase) that contains three copies of an NFkappa B-binding site upstream of the luciferase gene. After 18 h the cells were lysed and a luciferase assay was performed. Fig. 2A shows that while wild type LMP1 signals strongly to NFkappa B, LMP1AAAG does not activate NFkappa B reporter activity. This experiment was also performed in two B-cell lines, Eli-BL cells and DG75, and an epithelial cell line, 293. LMP1AAAG was not able to stimulate NFkappa B transcriptional activity in any of these lines (data not shown).



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2.   LMP1AAAG cannot activate nuclear signals. Jurkat cells were transfected with a range of concentrations of wild type LMP1 (solid squares) or LMP1AAAG (empty circles) expression plasmids together with the NFkappa B reporter, 3enh luciferase (A), or a STAT reporter, GRR luciferase (B). Samples were harvested and the luciferase activity was detected as described under "Experimental Procedures." C, expression of wt LMP1 and LMP1AAAG was determined by Western blotting with the CS.1-4 mixture of monoclonal anti-LMP1 antibodies.

It was possible that mutation of CTAR1 and CTAR2 would only affect signaling to pathways activated by CTAR1 and CTAR2. For this reason we tested the ability of LMP1 to trigger STAT transcriptional activity as LMP1 effects on STAT signaling have recently been mapped to a new domain entitled CTAR3 (Fig. 1A). A GRR reporter assay was chosen to test for STAT transcriptional activity. This is a well characterized reporter construct based on the STAT-binding site from the Fcgamma R promoter. It has been shown to bind various STATs (34, 40) and has been used as a reporter in many different studies (34, 38). Eli-BL cells were co-transfected with the GRR reporter (10 µg) together with various amounts of both wild type LMP1 and LMP1AAAG expression vectors. Fig. 2B shows that while wild type LMP1 was able to stimulate GRR luciferase transcriptional activity, LMP1AAAG showed no stimulatory capacity for this reporter. This was somewhat surprising and suggests that either CTAR1 or CTAR2 are required for the activation of STAT transcriptional activity.

Protein expression of LMP1AAAG was examined to demonstrate that the mutant expressed at a similar level to wild type. Fig. 2C shows the results from the expression of wild type and LMP1AAAG in Eli-BL cells. Cells were transfected with a range of amounts of an LMP1 expression vector, cells were lysed, and cellular proteins were resolved by SDS-PAGE. Western blot analysis was performed with an anti-LMP1 antibody (CS.1-4) and similar levels of both wt LMP1 and LMP1AAAG were seen (Fig. 2C). Similar data were also obtained with DG75 and 293 cells (data not shown).

LMP1AAAG Acts as a Dominant Negative Molecule-- Since the LMP1AAAG could not activate LMP1 signaling pathways, it was postulated that it may be able to inhibit wild type LMP1 activity by preventing the formation of a functional signaling complex. NFkappa B transcriptional activity was tested by co-transfection of the reporter with various amounts of an expression vector for wild type LMP1 (from 0.1 to 4 µg) in combination with a constant 5 µg of LMP1AAAG. Fig. 3A shows that expression of LMP1AAAG dramatically inhibits the activation of NFkappa B by wild type LMP1. A ratio of 1 µg of wild type LMP1 plasmid to 5 µg of LMP1AAAG plasmid inhibited NFkappa B transcriptional activity by greater than 90%. Over a number of experiments, the expression of equal levels of LMP1AAAG to wild type LMP1 inhibited signaling by 50-75%, demonstrating the efficiency of the mutant. A dose response of LMP1AAAG (0-12 µg) was tested with a fixed amount of wild type LMP1 expression vector (2 µg) (Fig. 3B). This shows that the inhibition correlates with amount of LMP1AAAG.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3.   LMP1AAAG inhibits LMP1-induced NFkappa B transcriptional activity. A, Jurkat cells were transfected with an NFkappa B reporter and a range of concentrations of wt LMP1 expression vector in the absence (solid squares) or presence of 5 µg of LMP1AAAG vectors (empty circles). B, Jurkat cells were transfected with a reporter for NFkappa B with a single concentration of wt LMP1 vector (2 µg) in the presence of a range of concentrations of LMP1AAAG expression vector. C, Jurkat cells were transfected with an NFkappa B reporter in the presence of LMP1AAAG or tr.LMP1 expression vectors to investigate the efficiency of the two inhibitory molecules.

A naturally occurring truncated LMP1, tr.LMP1, which lacks amino acids 1-127, has been postulated to inhibit LMP1 signaling (39). We compared the LMP1AAAG mutant with the putative inhibitory effects of the truncated from of LMP1 (Fig. 3C). A direct comparison of the two molecules suggests that a much lower level of expression of LMP1AAAG is efficient relative to tr.LMP1 (compare 3rd bar with 5th bar and 4th bar with 6th bar). In this experiment, the co-transfection of 3 µg of LMP1AAAG expression vector inhibited wild type LMP1 activation of NFkappa B by greater than 90%, whereas 3 µg of the expression vector for tr.LMP1 had very little effect.

LMP1AAAG Inhibits STAT Transcriptional Activity and Jun Transactivation-- Two other nuclear signals stimulated by LMP1 were also tested. The STAT reporter (GRR luciferase) was tested in Eli-BL cells (Fig. 4A). This showed that LMP1AAAG effectively inhibited STAT transcriptional activity stimulated by LMP1. A Jun-transactivation assay was also performed (Fig. 4B). Jurkat cells were co-transfected with a mammalian expression vector for a chimeric protein with the DNA-binding domain from the bacterial lex protein and the transactivation domain of c-Jun (amino acids 1-194) (41) together with a reporter that contains two binding sites for lex- protein upstream of the CAT gene (35). This reporter therefore gives a measurement of Jun phosphorylation in vivo, which requires the activity of Jun N-terminal kinase (JNK) or p38 stress activated protein kinase. When co-transfected with this reporter, LMP1 could induce Jun transactivation, and this activation was inhibited by coexpression of the LMP1AAAG (Fig. 4B).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4.   LMP1AAAG inhibits STAT-regulated transcription and Jun transactivation. A, Eli-BL cells were co-transfected with GRR luciferase reporter (10 µg) and the constructs indicated. Cells were incubated overnight and luciferase activity was assayed. B, Jurkat cells were co-transfected with 4 µg of the lex operon CAT reporter, 2 µg of the mammalian expression vector for the fusion protein of the Jun-transactivation domain with the lex-DNA-binding domain, and the other plasmids indicated. Cells were incubated overnight and CAT activity was assayed.

LMP1AAAG Inhibits Induction of ICAM-1 by LMP1-- It is important to demonstrate that the LMP1AAAG can also block downstream biological functions of LMP1, i.e. endogenous protein changes, and not just affect reporter constructs. Fig. 5 demonstrates that LMP1AAAG efficiently inhibits the LMP1-mediated induction of the ICAM-1 (CD54) adhesion molecule. Jurkat cells were co-transfected with a GFP vector and a wild type LMP1 plasmid. The GFP vector allows the identification of transfected cells by flow cytometry. The cells were left for 48 h and expression of ICAM-1 was determined using phycoerythrin-conjugated CD54 antibodies and flow cytometric analysis. Fig. 5A (top panel) shows the expression of ICAM-1 in Jurkat cells transfected with EGFP and control vector DNA. When Jurkat cells were transfected with the GFP-LMP1AAAG expression vector no increase in ICAM-1 levels was detected demonstrating that LMP1AAAG could not signal effectively (Fig. 5A, 2nd panel). In contrast, cells transfected with wild type LMP1 and EGFP expression vectors showed a dramatic increase in ICAM-1 expression (Fig. 5A, 3rd panel). This can be represented in two ways. The first consists of determining the percentage of cells whose fluorescence intensity crosses an arbitrary threshold gate. In the example shown in Fig. 5A, expression of wt LMP1 caused an increase from 2.7 to 34.2% of ICAM-1 positive cells. The effects upon ICAM-1 can also be determined by measuring the increase in mean fluorescence intensity which, in Fig. 5A, shows a 3-fold increase in the level of expression of ICAM-1 caused by expression of wt LMP1 (control transfectant, mean fluorescence intensity of 68; wt LMP1 transfectant, mean fluorescence intensity 195). When wild type LMP1 and GFP-LMP1AAAG expression vectors were co-transfected, no increase in either the percentage of positive cells or the mean fluorescence intensity was detected (Fig. 5A, compare top and bottom panels). A dose response of LMP1 plasmid was performed in the presence and absence of a constant amount of LMP1AAAG. Whether the data are expressed as mean fluorescence intensity (Fig. 5B) or as a percentage of ICAM-1 positive cells (not shown), LMP1AAAG dramatically inhibits LMP1 signaling. These results demonstrate that LMP1AAAG can inhibit endogenous cellular gene expression in addition to synthetic reporter genes.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5.   LMP1AAAG inhibits ICAM-1 protein up-regulation by LMP1. Jurkat cells were co-transfected with 2 µg of pEGFP-C1 marker plasmid together with variable amounts (0-2.0 µg) of wt LMP1 expression plasmid with or without a constant 20 µg of LMP1AAAG expression plasmid. At 48 h post-transfection, the cells were stained with phycoerythrin (PE)-conjugated CD54 antibodies to ICAM-1 and analyzed by two-color flow cytometry. A, FACS profiles of ICAM-1 staining in the EGFP-positive population of four cultures transfected, respectively, with empty vector, LMP1AAAG, wt LMP1, and wt LMP1 + LMP1AAAG. B, dose-response curves showing the mean fluorescence intensity of ICAM-1 staining of cultures transfected with increasing amounts of wt LMP1 vector with (solid squares) or without (open circles) a constant 20 µg LMP1AAAG vector.

LMP1AAAG Is Selective as It Does Not Inhibit TNF or Interleukin-2 Signaling-- The usefulness of a dominant-negative molecule is enhanced if it is also specific for its intended target. We therefore examined whether LMP1AAAG might interfere with the signaling pathways activated by other receptor molecules. The selectivity of the LMP1AAAG inhibitor was tested in two different systems. Jurkat cells were transfected with the 3enh (NFkappa B) luciferase reporter and increasing amounts of the LMP1AAAG vector. The cells were left overnight to ensure expression, and were then stimulated with TNF. The results in Fig. 6A show that doses of LMP1AAAG which inhibit wt LMP1 signaling by more than 75% had no effect on TNF activation of NFkappa B. The LMP1AAAG molecule retains the putative Jak3-binding site (CTAR3) and while it appears unable to signal to STAT transcriptional activity, it could theoretically act to sequester Jak3 and thus inhibit Jak 3-dependent signaling from other receptors. This possibility was tested in Kit225 cells, a leukemic cell line that is stimulated by the cytokine, IL-2. In these cells, IL-2 utilizes Jak3 and activates STAT5 and STAT3, which have been previously shown to activate the GRR reporter (34). The Kit225 cells were transfected with the LMP1AAAG expression plasmid, and the ability of IL-2 to activate the GRR reporter was tested. Fig. 6B shows that IL-2 was fully functional in the presence of similar levels of LMP1AAAG that were shown to inhibit wt LMP1 signaling. This provides evidence for the specificity of LMP1AAAG and suggests that it acts proximal to the LMP1 molecule itself rather than binding or sequestering signaling machinery that may be utilized by other signaling pathways.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6.   LMP1AAAG does not affect TNF or interleukin-2 signaling. A, Jurkat cells were transfected with an NFkappa B reporter with and without wt LMP1 and LMP1AAAG constructs as indicated. The cells were incubated overnight to allow expression, and one set of cultures which had not been transfected with wt LMP1 vector were instead stimulated with TNF (10 ng/ml) for 6 h. Samples were then assayed for luciferase. B, Kit225 cells were cultured in the absence of IL-2 for 24 h and then co-transfected with 10 µg of STAT reporter (GRR luciferase) and either SG5 empty vector or SG5-LMP1AAAG as indicated. Replicate cultures were either stimulated overnight with IL-2 (20 ng/ml) or were left untreated before assaying for luciferase.

LMP1AAAG Cellular Localization Is Indistinguishable from that of Wild Type LMP1-- All the mutants of LMP1 utilized in this study were expressed in DG75 B-cells and their cellular localization was investigated by staining with the LMP1 antibody, LMPO25. Cells were transfected with 5 µg of each expression vector and left to express overnight. The cells were fixed with 2% paraformaldehyde and acetone and then stained as described previously. The staining was visualized with a Leica confocal microscope and a Z series was acquired. Fig. 7A shows the staining of wild type LMP1, LMP1AAAG, and tr.LMP1. The staining of wild type LMP1 produced a characteristic pattern, with an accumulation of LMP1 into a "cap" at one end of the cell. The pattern of staining produced by LMP1AAAG was indistinguishable from wild type LMP1. In contrast the truncated LMP1 (tr.LMP1) has a substantially different cellular distribution. It does not appear to form a single aggregate but rather has a diffuse cellular distribution with some accumulation at the cell surface membrane.



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 7.   Wild type LMP1 and LMP1AAAG have similar cellular distributions. A, DG75 cells were transfected with wild type LMP1 vector (left-hand panel), LMP1AAAG vector (middle panel), or tr.LMP1 vector (right-hand panel). Localization of the constructs was investigated after overnight expression by staining using LMPO25 antibody with a Texas Red anti-immunglobulin antibody conjugate. Cells were visualized by confocal microscopy. B, DG75 were co-transfected with an expression vector for a rat CD2 wild type LMP1 fusion protein and a GFP-tagged LMP1AAAG expression vector (right-hand panel). Cells were left to express the constructs overnight. The CD2 tagged was visualized using OX34 antibody and a Texas Red anti-immunglobulin antibody conjugate. Cells were visualize by confocal microscopy.

The similarity of the wild type LMP1 and LMP1AAAG was striking and was confirmed by expression of GFP-tagged forms of both proteins. This prevents any artifacts due to fixation and allowed the visualization of LMP1 in live cells. The results obtained (data not shown) were very similar to that seen by staining with LMPO25 (Fig. 7). To see if wild type LMP1 and LMP1AAAG could colocalize, constructs that could be distinguished had to be utilized. We used a fusion protein comprising the extracellular and transmembrane domains of rat CD2 tagged to the N terminus of wild type LMP1, and a GFP-tagged LMP1AAAG. Fig. 7B shows the image of an equatorial region of a DG75 cell which had been co-transfected with expression vectors for the CD2-WTLMP1 and LMP1AAAG-GFP. The cells were fixed and stained for rat CD2 using the OX34 antibody and a Texas Red secondary antibody. GFP was visualized in the fluorescein isothiocyanate channel and a specific channel for Texas Red was used to visualize CD2-tagged LMP1. A comparison of the two pictures shows an overlapping distribution of the two proteins. Taken together, the results suggest that both wild type LMP1 and LMP1AAAG normally localize to the same subcellular region and that, if coexpressed in the same cell, may physically interact.

LMP1AAAG Binds Wild Type LMP1-- The images of wild type LMP1 and LMP1AAAG together with the specificity of LMP1AAAG suggested an hypothesis that LMP1AAAG may be forming a complex with wild type LMP1. This complex may inhibit the signaling of wild type LMP1. This hypothesis was tested by investigating whether wild type LMP1 could bind LMP1AAAG by performing co-precipitation experiments. The CD2-tagged wtLMP1 expression vector was transfected alone or together with either LMP1AAAG or tr.LMP1 vectors into DG75 B cells, and cell lysates were immunoprecipitated with a specific CD2 antibody (OX34). The presence of CD2-wtLMP1, LMP1AAAG, and tr.LMP1 in the immunoprecipitates was assayed by Western blotting with a rabbit polyclonal antibody to LMP1. The results are illustrated in Fig. 8. The anti-CD2 antibody specifically precipitated CD2-wtLMP1 (lane 1) but did not pull-down LMP1AAAG (lane 4) or tr.LMP1 (lane 5) when these LMP1 molecules were expressed alone. However, inspection of the immunoprecipitates in the second lane shows that when LMP1AAAG is coexpressed with CD2-wtLMP1, LMP1AAAG does indeed form a complex with the wild type protein. In contrast, the truncated LMP1 (third lane) does not complex with the wild type protein. The lower panel shows the input lysates used for the immunoprecipitations and shows that similar levels of LMP1AAAG and tr.LMP1 were expressed. These results demonstrate that LMP1AAAG will form a complex with wild type LMP1.



View larger version (92K):
[in this window]
[in a new window]
 
Fig. 8.   LMP1AAAG binds wild type LMP1. Western blots, probed with a rabbit antiserum to LMP1, indicating the LMP1 molecules co-immunoprecipitating with wild type LMP1. For each immunoprecipitation, 15 × 106 DG75 cells were co-transfected with 10 µg each of the SG5 expression plasmids as indicated, and lysates were prepared 24 h post-transfection. The wild type LMP1 was expressed as a CD2/LMP1 fusion protein which was precipitated with OX34 monoclonal antibody to rat CD2. Lanes 1-3 show the OX34 immunoprecipitates from cells co-transfected with CD2/LMP1 chimera and SG5 vector (lane 1), LMP1AAAG (lane 2), or tr.LMP1 (lane 3). Lane 4 shows the OX34 immunoprecipitate from cells transfected with LMP1AAAG only, while lane 5 shows the anti-CD2 immunoprecipitate from cells transfected with tr.LMP1 only. The upper blot shows the LMP1 species in the resolved anti-CD2 immunoprecipitates, while the lower blot shows the LMP1 species in the input lysates (equivalent to ~2% of the lysate used for immunoprecipitation).

LMP1AAAG Prevents the Recruitment of TRAF2 to Wild Type LMP1-- A complex between wild type LMP1 and LMP1AAAG may be unable to bind signaling molecules. To investigate this possibility, co-immunoprecipitation experiments were performed to investigate the ability of the TNF adaptor molecule, TRAF2, to bind LMP1. TRAF2 is postulated to be a major component of the LMP1 signaling machinery. DG75 cells were transfected with vectors for wild type LMP1, LMP1AAAG, and the truncated LMP1 (tr.LMP1), in the presence of TRAF2. Cells were left overnight to allow expression. The cells were then lysed and the LMP1 was immunoprecipitated with antibodies CS-3 and CS-4. These immunoprecipitates were resolved by SDS-PAGE and the presence of TRAF2 in the immunoprecipitates was detected by Western blotting. The results from a representative experiment are illustrated in Fig. 9A. These show that TRAF2 binds to wild type LMP1 but binds at a substantially reduced level to both LMP1AAAG and tr.LMP1. Experiments were performed to determine whether LMP1AAAG could inhibit the recruitment of TRAF2 to wild type LMP1. This was done by co-transfecting a range of amounts of a vector for GFP-tagged LMP1AAAG (EGFP-LMP1AAAG) with a constant amount of wild type LMP1 (3 µg) and TRAF2 (6 µg) vectors. Cells were lysed and LMP1 was immunoprecipitated as before. Fig. 9B shows that LMP1AAAG prevents the interaction of TRAF2 with wild type LMP1 (top panel). The bottom panel (Fig. 9B) shows the expression of both wild type LMP1 and the GFP-tagged LMP1AAAG.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 9.   LMP1AAAG has impaired TRAF2 binding ability and it inhibits the binding of TRAF2 to wt LMP1. Western blots indicating the co-precipitation of TRAF2 with LMP1 complexes. For each immunoprecipitation, 15 × 106 DG75 cells were transfected as indicated and lysates were prepared at 24 h post-transfection. Immunoprecipitations were performed using a pool of CS.3 and CS.4 mouse monoclonal antibodies to LMP1. A, to compare the ability of different LMP1 molecules to bind TRAF2, cells were transfected with 6 µg pCMV-TRAF2Delta (8-26) together with 3 µg of either pSG5 vector (first lane), pSG5-LMP1 (second lane), pSG5-LMP1AAAG (third lane), or pSG5-LMP1Delta (1-128) (fourth lane). The upper panel shows a Western blot of material immunoprecipitated with antibodies to LMP1, and probed with rabbit anti-TRAF2 antibodies. The middle and lower panels show Western blots of the input lysates probed with rabbit anti-TRAF2 antibodies (middle panel) or with CS.1-4 antibodies to LMP1 (lower panel). B, the dose responsive dominant-negative effect of LMP1AAAG on wt LMP1 binding to TRAF2 was assayed. LMP1AAAG was expressed as an EGFP-LMP1AAAG-tagged protein so that the expression levels obtained with the indicated doses of pEGFP-LMP1AAAG DNA (1-8 µg) could be compared with the expression of the lower molecular weight wt LMP1 coexpressed from 3 µg of SG5-LMP1 plasmid. A Western blot of the LMP1 immunoprecipitates was probed with rabbit anti-TRAF2 antibodies (upper blot), and the input lysates were probed with CS.1-4 anti-LMP1 antibodies (lower blot). C, the in vitro binding of TRAF2 to wild type LMP1 or a complex of wild type LMP1 and LMP1AAAG was investigated by adding lysates that contained TRAF2 to immunoprecipitates of LMP1 from DG75 cells that had been transfected with wild type LMP1 or both wild type LMP1 and LMP1AAAG. The immunoprecipitates were then resolved by SDS-PAGE and the presence of newly bound TRAF2 was investigated by Western blotting.

Clearly, LMP1AAAG interferes with the ability of wild type LMP1 to bind TRAF2 in the cellular context. It is possible that this is a result of LMP1AAAG sequestering wild type LMP1 to a different subcellular location, away from TRAF2, While this appears unlikely from the results in Fig. 7, we conducted additional experiments to examine whether LMP1AAAG interfered with the ability of wild type LMP1 to bind TRAF2 in vitro. In this set of experiments, LMP1 molecules were first precipitated from lysates of transfected DG75 B-cells and were then incubated with TRAF2-containing lysates from separately transfected DG75 cells. Fig. 9C shows that the while immune precipitates of wild type LMP1 can effectively bind exogenously added TRAF2, the complex of wild type LMP1 with LMP1AAAG could not bind TRAF2. Together these immunoprecipitation experiments suggest a mechanism whereby LMP1AAAG binds to wild type LMP1 and prevents the recruitment of TRAF2. This prevents LMP1 signal transduction to the nucleus.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

This study describes a novel inhibitor of the oncogenic protein LMP1. It characterizes the efficacy, selectivity, and mechanism of the inhibitor. The efficacy was tested by inhibition of reporter constructs and ICAM-1 protein expression changes induced by LMP1. It was shown to be both nonfunctional and to be dominant inhibitory when expressed at similar levels to wild type LMP1. It was shown to be selective as it does not inhibit TNF or IL-2 signaling. Finally an investigation into the mechanism demonstrates that it does not sequester downstream signaling molecules but binds wild type LMP1 and inhibits the binding of at least one signaling molecule, TRAF2.

All described previously, mutants of LMP1 that are unable to activate NFkappa B have had deletions of either CTAR1 or CTAR2. LMP1AAAG is the first mutant that is unable to activate NFkappa B and contains only point mutations. This reduces the likelihood of dramatic structural effects that can result from amino acid deletions. It strengthens the hypothesis that all the signals required for NFkappa B activation lie completely within CTAR1 and CTAR2.

While in terms of NFkappa B, this is not surprising, it is still an important confirmation of our expectations. However, the fact that proper functioning of CTAR1 and CTAR2 is required for GRR luciferase activity, and thus STAT activation, was unexpected since Gires et al. (14) recently described CTAR3 as a Jak-binding domain. Our result does not necessarily contradict the results from Gires et al. (14) but casts them in a new light. It suggests that while CTAR3 may be a distinct signaling motif of LMP1, it does not function in isolation to activate STATs. The mechanism of this activation is intriguing and is currently the subject of investigation. Gires et al. (14) measured STAT1 DNA binding whereas this present study has measured STAT transcriptional activity. STAT proteins have been shown to be modulated by both tyrosine and serine phosphorylation (34, 40, 42) and the Jak kinases can only phosphorylate tyrosine residues. The serine phosphorylation of STATs has been shown to be important for transcriptional activity but not DNA binding. Distinct signaling pathways have been shown to be utilized by both IL-2 (34) and interferon signaling (42) for the regulation of STAT transcriptional activity. Thus, while CTAR3 may control STAT tyrosine phosphorylation, CTAR1 or CTAR2 may be required for other signaling pathways necessary for STAT transcriptional activity.

The interplay between the domains of LMP1 has been postulated previously. It has been shown that for optimal functions, CTAR1 and CTAR2 must be in the same signaling complex (21). The inhibitory effects of LMP1AAAG further elucidates the importance of cooperation between LMP1 molecules. It is apparent that this cooperation is not just of a structural nature but also requires the cooperative binding of signaling molecules. We have shown that LMP1AAAG does not prevent normal cellular localization of LMP1 (Fig. 7). Furthermore, a complex of wild type LMP1 and LMP1AAAG is unable to bind TRAF2, a key signaling molecule, both in vitro and in whole cells (Fig. 9). This suggests that the cooperation between the domains of LMP1 is required between molecules for the regulation of gene expression events. Furthermore, this cooperation acts at the level of the recruitment of receptor proximal signaling molecules and not at the level of cooperating nuclear signals, demonstrating the importance of the formation of an intact signaling complex. TRAF2 has been shown to bind the TNF receptor, to which LMP1 has been compared, as a trimeric complex. If it binds LMP1 using a similar mechanism, it is likely that the presence, in a signaling complex of a protein that cannot bind TRAF2 will inhibit TRAF binding to other members of the signaling complex. There may also be interplay between CTAR3 and one or both of the other signaling domains of LMP1. Since STAT regulation is proposed to be controlled by CTAR3, but LMP1AAAG, in which CTAR3 is intact, cannot signal to the STAT reporter, some cooperation between CTAR1 or CTAR2 and CTAR3 must exist.

LMP1AAAG was substantially more efficient than the naturally occurring truncated from of LMP1 (tr.LMP1) (Fig. 3). Furthermore, localization and immunoprecipitation experiments, which characterized the mechanism of LMP1AAAG, show tr.LMP1 to function very differently. Truncated LMP1 does not oligomerize with wild type LMP1 (Fig. 8 and Ref. 39) and it has substantially reduced TRAF2 binding (Fig. 9) suggesting that it cannot sequester this signaling molecule. Our data suggests that whatever mechanism tr.LMP1 utilizes, it is less efficient than that of LMP1AAAG.

The regulation of the Jak-STAT signaling pathway by LMP1 is of interest since constitutive STAT activity has been shown to be a feature of leukemic cell lines (43). Lymphoblastoid cell lines, B-cells that are immortalized by Epstein-Barr virus, contain STAT complexes that can bind DNA (44).2 The importance of these DNA binding complexes is unknown but the ability of LMP1 to regulate not only the DNA binding (14) but also the transcriptional activity of STATs, as shown in the present study, suggests that the STATs that are binding DNA in lymphoblastoid cell lines are also likely to be transcriptionally active. STATs may offer novel therapeutic targets for LMP1-associated disease and the ability of LMP1AAAG to inhibit STAT transcriptional ability increases its usefulness.

LMP1AAAG will be a useful tool to characterize the role of LMP1 in survival and disease pathogenesis. It has advantages over currently available technology, such as antisense technology or even LMP1-deleted recombinant viruses, as it is specific and allows the study of LMP1 in cells that have already been infected with EBV. LMP1AAAG is being cloned into an inducible vector to make stable cell lines with this mutant to test its effects on the growth of lymphoblastoid cell lines, as a model of post-transplant lymphoproliferative disorder. Furthermore, inducible LMP1AAAG may be useful in characterizing the role of LMP1 in the growth of nasopharyngeal carcinomas tumors transplanted into nude mice (45). With regard to Hodgkin's disease, published data suggests that LMP1 down-regulation of the cell surface protein, CD99, plays a critical role in the progression to Hodgkin's disease (46). LMP1AAAG inhibits the LMP1 mediated down-regulation of the CD99 promoter3 suggesting that it may be inhibitory for disease progression. Other disease models are currently under investigation.

In summary, this study enhances our understanding of LMP1 signaling specifically and as a model of the TNF receptor superfamily. We have characterized the effectiveness and mechanism of a receptor-based dominant inhibitor, LMP1AAAG. This mutant suggests cooperation within the LMP1 oligomer in binding of the signaling molecule, TRAF2. The application of this type of receptor based inhibitory molecule may prove useful in establishing the function and mechanism of action of both LMP1 and other receptors in vitro and in a cell specific fashion in vivo. It has also been suggested that LMP1AAAG may have useful therapeutic applications.


    ACKNOWLEDGEMENTS

We thank Eddie Wang, Sinead Keating, and Ceri Fielding for reading the manuscript.


    FOOTNOTES

* The work was supported by the Leukemia Research Fund, London, the Wellcome Trust, and European Biomed-2 Award BMH4-CT97-2567.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed. Tel.: 44-29-20744517; Fax: 44-29-20745003; E-mail: brennanp@cardiff.ac.uk.

§ Present address: Dept. of Molecular Biology, AstraZeneca R&D Charnwood, Bakewell Road, Loughborough, LE11 5RH United Kingdom.

Published, JBC Papers in Press, October 12, 2000, DOI 10.1074/jbc.M005461200

2 P. Brennan, unpublished data.

3 I. Lee, M. K. Kim, E. Y. Choi, A. Mehl, K. L. Jung, M. Rowe, and S. H. Park, manuscript in preparation.


    ABBREVIATIONS

The abbreviations used are: LMP1, latent membrane protein-1; EBV, Epstein-Barr virus; tr.LMP1, truncated LMP1; ICAM-1, intercellular adhesion molecule-1; NFkappa B, nuclear factor kappa B; TNF, tumor necrosis factor; JNK, Jun N-terminal kinase; JAK3, Janus activating tyrosine kinase 3; STAT, signal transducing and transcription factor; TRFR, tumor necrosis factor receptor; TRAF, tumor necrosis factor receptor-associated factor; TRADD, TNFR-associated death domain; IL, interleukin; EGFP, enhanced green fluorescent protein; SAPK, stress-activated protein kinase; CAT, chloramphenicol acetyltransferase; PAGE, polyacrylamide gel electrophoresis; wt, wild type.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES


1. Rickinson, A. B., and Kieff, E. (1996) in Fields Virology (Fields, B. N. , Knipe, D. M. , and Howley, P. M., eds), Vol. 2 , pp. 2397-2446, Lippincott-Raven, Philadelphia
2. Kaye, K. M., Izumi, K. M., and Kieff, E. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 9150-0154
3. Wang, D., Liebowitz, D., and Kieff, E. (1985) Cell 43, 831-840
4. Baichwal, V. R., and Sugden, B. (1988) Oncogene 2, 461-467
5. Kulwichit, W., Edwards, R. H., Davenport, E. M., Baskar, J. F., Godfrey, V., and Raab-Traub, N. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 11963-11968
6. Uchida, J., Yasui, T., Takaoka-Shichijo, Y., Muraoka, M., Kulwichit, W., Raab-Traub, N., and Kikutani, H. (1999) Science 286, 300-303
7. Laherty, C. D., Hu, H. M., Opipari, A. W., Wang, F., and Dixit, V. M. (1992) J. Biol. Chem. 267, 24157-24160
8. Wang, S., Rowe, M., and Lundgren, E. (1996) Cancer Res. 56, 4610-4613
9. Henderson, S., Rowe, M., Gregory, C., Croom-Carter, D., Wang, F., Longnecker, R., Kieff, E., and Rickinson, A. (1991) Cell 65, 1107-1115
10. D'Souza, B., Rowe, M., and Walls, D. (2000) J. Virol. 74, 6652-6658
11. Gregory, C. D., Murray, R. J., Edwards, C. F., and Rickinson, A. B. (1988) J. Exp. Med. 167, 1811-1824
12. Rowe, M., Khanna, R., Jacob, C. A., Argaet, V., Kelly, A., Powis, S., Belich, M., Croom-Carter, D., Lee, S., Burrows, S. R., Trowsdale, J., Moss, D. J., and Rickinson, A. B. (1995) Eur. J. Immunol. 25, 1374-1384
13. Huen, D. S., Henderson, S. A., Croom-Carter, D., and Rowe, M. (1995) Oncogene 10, 549-560
14. Gires, O., Kohlhuber, F., Kilger, E., Baumann, M., Kieser, A., Kaiser, C., Zeidler, R., Scheffer, B., Ueffing, M., and Hammerschmidt, W. (1999) EMBO J. 18, 3064-3073
15. Eliopoulos, A. G., and Rickinson, A. B. (1998) Curr. Biol. 8, R196-198
16. Devergne, O., Hatzivassiliou, E., Izumi, K. M., Kaye, K. M., Kleijnen, M. F., Kieff, E., and Mosialos, G. (1996) Mol. Cell. Biol. 16, 7098-7108
17. Kaye, K. M., Devergne, O., Harada, J. N., Izumi, K. M., Yalamanchili, R., Kieff, E., and Mosialos, G. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 11085-11090
18. Mosialos, G., Birkenbach, M., Yalamanchili, R., VanArsdale, T., Ware, C., and Kieff, E. (1995) Cell 80, 389-399
19. Izumi, K. M., and Kieff, E. D. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 12592-12597
20. Liu, Z. G., Hsu, H., Goeddel, D. V., and Karin, M. (1996) Cell 87, 565-576
21. Floettmann, J. E., Eliopoulos, A. G., Jones, M., Young, L. S., and Rowe, M. (1998) Oncogene 17, 2383-2392
22. Eliopoulos, A. G., Gallagher, N. J., Blake, S. M., Dawson, C. W., and Young, L. S. (1999) J. Biol. Chem. 274, 16085-16096
23. Eliopoulos, A. G., Blake, S. M., Floettmann, J. E., Rowe, M., and Young, L. S. (1999) J. Virol. 73, 1023-1035
24. Kieser, A., Kaiser, C., and Hammerschmidt, W. (1999) EMBO J. 18, 2511-2521
25. Devergne, O., McFarland, E. C., Mosialos, G., Izumi, K. M., Ware, C. F., and Kieff, E. (1998) J. Virol. 72, 7900-7908
26. Eliopoulos, A. G., Stack, M., Dawson, C. W., Kaye, K. M., Hodgkin, L., Sihota, S., Rowe, M., and Young, L. S. (1997) Oncogene 14, 2899-2916
27. Brodeur, S. R., Cheng, G., Baltimore, D., and Thorley-Lawson, D. A. (1997) J. Biol. Chem. 272, 19777-19784
28. Izumi, K. M., McFarland, E. C., Riley, E. A., Rizzo, D., Chen, Y., and Kieff, E. (1999) J. Virol. 73, 9908-9916
29. Floettmann, J. E., and Rowe, M. (1997) Oncogene 15, 1851-1858
30. Brattsand, G., Cantrell, D. A., Ward, S., Ivars, F., and Gullberg, M. (1990) J. Immunol. 144, 3651-3658
31. Rowe, M., Lear, A. L., Croom-Carter, D., Davies, A. H., and Rickinson, A. B. (1992) J. Virol. 66, 122-131
32. Hori, T., Uchiyama, T., Tsudo, M., Umadome, H., Ohno, H., Fukuhara, S., Kita, K., and Uchino, H. (1987) Blood 70, 1069-1072
33. Arenzana-Seisdedos, F., Fernandez, B., Dominguez, I., Jacque, J. M., Thomas, D., Diaz-Meco, M. T., Moscat, J., and Virelizier, J. L. (1993) J. Virol. 67, 6596-6604
34. Beadling, C., Ng, J., Babbage, J. W., and Cantrell, D. A. (1996) EMBO J. 15, 1902-1913
35. Marais, R., Wynne, J., and Treisman, R. (1993) Cell 73, 381-393
36. Rowe, M., and Jones, M. (2001) in Methods in Molecular Biology: Epstein-Barr Virus Protocols (Wilson, J. B., ed) , Humana Press Inc., Totowa, NJ, in press
37. Rowe, M., Evans, H. S., Young, L. S., Hennessy, K., Kieff, E., and Rickinson, A. B. (1987) J. Gen. Virol. 68, 1575-1586
38. Brennan, P., Babbage, J. W., Burgering, B. M., Groner, B., Reif, K., and Cantrell, D. A. (1997) Immunity 7, 679-689
39. Erickson, K. D., and Martin, J. M. (2000) J. Virol. 74, 1057-1060
40. Ng, J., and Cantrell, D. (1997) J. Biol. Chem. 272, 24542-24549
41. Lin, A., Minden, A., Martinetto, H., Claret, F. X., Lange-Carter, C., Mercurio, F., Johnson, G. L., and Karin, M. (1995) Science 268, 286-290
42. Decker, T., and Kovarik, P. (1999) Cell. Mol. Life Sci. 55, 1535-1546
43. Bowman, T., Garcia, R., Turkson, J., and Jove, R. (2000) Oncogene 19, 2474-2488
44. Weber-Nordt, R. M., Egen, C., Wehinger, J., Ludwig, W., Gouilleux-Gruart, V., Mertelsmann, R., and Finke, J. (1996) Blood 88, 809-816
45. Busson, P., Ganem, G., Flores, P., Mugneret, F., Clausse, B., Caillou, B., Braham, K., Wakasugi, H., Lipinski, M., and Tursz, T. (1988) Int. J. Cancer 42, 599-606
46. Kim, S. H., Shin, Y. K., Lee, I. S., Bae, Y. M., Sohn, H. W., Suh, Y. H., Ree, H. J., Rowe, M., and Park, S. H. (2000) Blood 95, 294-300


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Virol.Home page
B. A. Mainou, D. N. Everly Jr., and N. Raab-Traub
Unique Signaling Properties of CTAR1 in LMP1-Mediated Transformation
J. Virol., September 15, 2007; 81(18): 9680 - 9692.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R.-C. Jiang, H.-D. Qin, M.-S. Zeng, W. Huang, B.-J. Feng, F. Zhang, H.-K. Chen, W.-H. Jia, L.-Z. Chen, Q.-S. Feng, et al.
A Functional Variant in the Transcriptional Regulatory Region of Gene LOC344967 Cosegregates with Disease Phenotype in Familial Nasopharyngeal Carcinoma
Cancer Res., January 15, 2006; 66(2): 693 - 700.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
I. Najjar, F. Baran-Marszak, C. Le Clorennec, C. Laguillier, O. Schischmanoff, I. Youlyouz-Marfak, M. Schlee, G. W. Bornkamm, M. Raphael, J. Feuillard, et al.
Latent Membrane Protein 1 Regulates STAT1 through NF-{kappa}B-Dependent Interferon Secretion in Epstein-Barr Virus-Immortalized B Cells
J. Virol., April 15, 2005; 79(8): 4936 - 4943.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
N. Lam, M. L. Sandberg, and B. Sugden
High Physiological Levels of LMP1 Result in Phosphorylation of eIF2{alpha} in Epstein-Barr Virus-Infected Cells
J. Virol., February 15, 2004; 78(4): 1657 - 1664.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. N. D'Souza, L. C. Edelstein, P. M. Pegman, S. M. Smith, S. T. Loughran, A. Clarke, A. Mehl, M. Rowe, C. Gelinas, and D. Walls
Nuclear Factor {kappa}B-Dependent Activation of the Antiapoptotic bfl-1 Gene by the Epstein-Barr Virus Latent Membrane Protein 1 and Activated CD40 Receptor
J. Virol., February 15, 2004; 78(4): 1800 - 1816.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. G. P. Atkinson, H. J. Coope, M. Rowe, and S. C. Ley
Latent Membrane Protein 1 of Epstein-Barr Virus Stimulates Processing of NF-{kappa}B2 p100 to p52
J. Biol. Chem., December 19, 2003; 278(51): 51134 - 51142.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
U. Dirmeier, B. Neuhierl, E. Kilger, G. Reisbach, M. L. Sandberg, and W. Hammerschmidt
Latent Membrane Protein 1 Is Critical for Efficient Growth Transformation of Human B Cells by Epstein-Barr Virus
Cancer Res., June 1, 2003; 63(11): 2982 - 2989.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Prince, S. Keating, C. Fielding, P. Brennan, E. Floettmann, and M. Rowe
Latent Membrane Protein 1 Inhibits Epstein-Barr Virus Lytic Cycle Induction and Progress via Different Mechanisms
J. Virol., April 15, 2003; 77(8): 5000 - 5007.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. Richardson, C. Fielding, M. Rowe, and P. Brennan
Epstein-Barr Virus Regulates STAT1 through Latent Membrane Protein 1
J. Virol., April 1, 2003; 77(7): 4439 - 4443.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. G. Eliopoulos, E. R. Waites, S. M. S. Blake, C. Davies, P. Murray, and L. S. Young
TRAF1 Is a Critical Regulator of JNK Signaling by the TRAF-Binding Domain of the Epstein-Barr Virus-Encoded Latent Infection Membrane Protein 1 but Not CD40
J. Virol., December 20, 2002; 77(2): 1316 - 1328.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. M. Mehl, M. Jones, M. Rowe, and P. Brennan
Characterization of a CD40-Dominant Inhibitory Receptor Mutant
J. Immunol., December 1, 2001; 167(11): 6388 - 6393.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. K. Busch and G. A. Bishop
Multiple Carboxyl-Terminal Regions of the EBV Oncoprotein, Latent Membrane Protein 1, Cooperatively Regulate Signaling to B Lymphocytes Via TNF Receptor-Associated Factor (TRAF)-Dependent and TRAF-Independent Mechanisms
J. Immunol., November 15, 2001; 167(10): 5805 - 5813.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. A. Fielding, K. Sandvej, A. Mehl, P. Brennan, M. Jones, and M. Rowe
Epstein-Barr Virus LMP-1 Natural Sequence Variants Differ in Their Potential To Activate Cellular Signaling Pathways
J. Virol., October 1, 2001; 75(19): 9129 - 9141.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/2/1195    most recent
M005461200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brennan, P.
Right arrow Articles by Rowe, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brennan, P.
Right arrow Articles by Rowe, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement