|
Originally published In Press as doi:10.1074/jbc.M011295200 on February 13, 2001
J. Biol. Chem., Vol. 276, Issue 20, 16641-16648, May 18, 2001
The Essential HupB and HupN Proteins of Pseudomonas
putida Provide Redundant and Nonspecific DNA-bending
Functions*
Frank
Bartels §,
Silvia
Fernández¶,
Andreas
Holtel ,
Kenneth N.
Timmis , and
Víctor
de
Lorenzo¶**
From the Division of Microbiology, Gesellschaft
für Biotechnologische Forschung (GBF), D-38124,
Braunschweig, Germany and ¶ Department of Microbial Biotechnology,
Centro Nacional de Biotecnología, Consejo Superior de
Investigaciones Científicas, (CSIC), Campus de Cantoblanco,
28049 Madrid, Spain
Received for publication, December 14, 2000, and in revised form, February 12, 2001
 |
ABSTRACT |
A protein mixture containing two major components
able to catalyze a -recombination reaction requiring nonspecific DNA
bending was obtained by fractionation of a Pseudomonas
putida extract. N-terminal sequence analysis and genomic data
base searches identified the major component as an analogue of HupB of
Pseudomonas aeruginosa and Escherichia coli,
encoding one HU protein variant. The minor component of the
fraction, termed HupN, was divergent enough from HupB to predict a
separate DNA-bending competence. The determinants of the two proteins
were cloned and hyperexpressed, and the gene products were purified.
Their activities were examined in vitro in
-recombination assays and in vivo by complementation of
the Hbsu function of Bacillus subtilis. HupB and
HupN were equally efficient in all tests, suggesting that they are
independent and functionally redundant DNA bending proteins. This was
reflected in the maintenance of in vivo activity of the
54 Ps promoter of the toluene degradation
plasmid, TOL, which requires facilitated DNA bending, in
hupB or hupN strains. However,
hupB/hupN double mutants were not viable. It is suggested
that the requirement for protein-facilitated DNA bending is met in
P. putida by two independent proteins that ensure an
adequate supply of an essential cellular activity.
 |
INTRODUCTION |
Because of the topological changes that DNA must undergo during
basic cellullar functions, factor-directed DNA bending is frequently
involved in a variety of replication, recombination, and transcription
mechanisms (1, 2). The abundant polypeptides that assist the
maintenance of the DNA structure and its conformational transitions in
bacteria are generically termed nucleoid-associated proteins. This
somewhat vague term includes, in the case of Escherichia coli, factors such as HU, H-NS, StpA, Lrp (leucine-responsive protein), Fis, and the integration host factor IHF (3,
4).1 With different degrees
of specificity, these proteins bind distinct sites or attach to less
specific DNA segments and compact, relax, or change the architecture of
given chromosomal regions (5-7). Among these proteins, HU has been
identified as the major component of the bacterial nucleoid, the
function of which is to facilitate a whole spectrum of molecular
processes that involve DNA bending. With at least 30,000 molecules
(dimers)/cell, HU statistically can bind every 200 bp of the E. coli chromosome (3). The HU protein of E. coli consists
of two genetically unlinked polypeptides of about 9 kDa, which are
encoded by two highly similar genes, hupA and
hupB (8-11). In contrast to IHF, which binds strongly to a
consensus DNA motif (12, 13), HU does not generally bind in a
sequence-specific manner. The HU proteins of E. coli are functional both as homodimers and heterodimers, although each form
seems to be specialized in nonidentical roles (14-16).
HU mutants, which bear deletions of both the
hupA and hupB genes in E. coli, are
viable but exhibit many growth defects (17, 18). In addition, these
mutants are sensitive to and UV irradiation because of the
involvement of HU in DNA repair and homologous recombination (19, 20).
Although HU proteins are conserved in most microorganisms, only enteric
bacteria seem to harbor two genes encoding polypeptides able to
form a heterodimer (21). In other eubacteria such as Bacillus
subtilis, an essential single gene (hbs) gives rise to
a homodimeric HU protein (21, 22), which is named Hbsu in this species.
The life cycle and the natural niches of E. coli are
relatively simple compared with those of not-so-distant relatives, such as Pseudomonas putida, which thrive in soils polluted with
toxic chemicals (23, 24). In these niches, the transduction of
environmental signals occurs through a whole collection of mechanisms
that very frequently involve regulated DNA bending (1). This is
particularly true for promoters of metabolic pathways that are
dependent on factor sigma 54 ( 54), such as the
Pu and Ps promoters of the toluene degradation plasmid (TOL) or the Po promoter of the pVI150 (catabolism
of methyl phenols), the expression of which is finely regulated by multiple environmental inputs (25, 26). Although such transduction pathways involving DNA bending can be reproduced to some extent in
E. coli, it cannot be taken for granted that the same
factors facilitating DNA bending are identical in bacteria living in
more complex habitats. To address this issue, we fractionated a cell extract, P. putida, and sought proteins that were
generically able to facilitate DNA bending. As shown below, the most
active fraction contained two independent HU variants the function of which appeared to be to back up each other for essential DNA
bending functions.
 |
EXPERIMENTAL PROCEDURES |
Strains, Plasmids, and Plasmid Construction--
Plasmid pFBT8
contains a genomic 6-kb SacI fragment from the P. putida chromosome spanning the hupB sequence and cloned
in vector pZERO-2 (Invitrogen). The hupB gene was amplified
from pFTB8 with primers PLHU1N
(5'-TTCATATG(NdeI)AACAA GTCG GAA CTGATTG-3') and
PRHU1B (5'-TGGGATCC(BamHI)GA CTT AGTTGA CGGC
GTC-3'), which generated an~300-bp PCR product bound by a leading ATG
overlapping a NdeI site and a stop codon, TAA, followed by a
BamHI sequence. This fragment was digested with
NdeI and BamHI and cloned in the corresponding
sites of expression vector pT7-7 (gift of Stanley Tabor, Harvard
Medical School), giving rise to plasmid pFBT17. Similarly, the
hupN sequence was amplified with oligonucleotides PLNAK3
(5'-ACCACCATGG(NcoI)CATTGACCAAAGACC-3') and
PRNAK4
(5'-TTTGGATCC(BamHI)ATTACTTGTTGATGGCGTCG-3'), which left NcoI and BamHI sites at the start and
end of the ORF. The resulting ~300-bp product was cloned as a
NcoI-BamHI insert in pET-3d (Stratagene),
originating plasmid pFBT12. The inserts of pFBT17
(hupB+) and pFBT12
(hupN+) were resequenced to ensure that no error
had been entered in the ORFs during the cloning procedures.
For expression of hupB and hupN in B. subtilis, the corresponding inserts of pFBT17 and pFBT12 were
transferred to shuttle vector pHP13 (27), which contains origins of
replication functional in both E. coli and B. subtilis, as well as chloramphenicol (cat, CmR) and erythromycin resistance gene markers. To transfer
hupB to such a shuttle plasmid, pFBT17 was digested with
XbaI, a site for which is located upstream of the optimized
Shine-Dalgarno sequences and the translation initiation regions
present in the plasmids. The resulting XbaI end of the
digested pFBT17 was then blunt-ended with T4 DNA polymerase and the
plasmid subsequently digested with BamHI. This released the
hupB sequence as a segment bounded by a blunt end and a
BamHI site. Such purified fragment was then cloned in pHP13
digested with SmaI and BamHI, thereby giving rise
to plasmids pHP13-hupB. The same procedure was used to
generate an equivalent plasmid with hupN, except that the
fragment inserted in the shuttle pHP13 was bounded by a blunt-ended
extreme (formerly a XbaI site in pFBT12) and a
HindIII site. Ligation of such a
hupN+ fragment to pHP13, digested with
SmaI and the HindIII originated plasmid
pHP13-hupN. In these constructs, the hupB and
hupN genes are located downstream of the cat gene
of pHP13, so that their transcription originates from the
cat promoter.
The plasmids employed for overproduction of hupB and
hupN in P. putida (see below) were constructed by
transferring the inserts of pFBT17 and pFBT12 into the broad host range
and kanamycin resistance expression vector pVLT33 (28). To this
purpose, both pFBT17 and pFBT12 were digested with XbaI. The
resulting ends were filled in as described above, and digested with
BamHI. This originated DNA segments each flanked by
one blunt end an a BamHI extreme. The DNA fragments were
ligated to vector pVLT33, which had been digested with
EcoRI, filled in with the Klenow fragment of DNA polymerase + dNTPs (29), and subsequently digested with BamHI. Because
of this pedigree, the resulting plasmids, pFBT18
(hupB+) and pFBT16
(hupN+), bore each of the genes preceded by an
optimal Shine-Dalgarno and translation initiation region sequences and
located downstream of a strong Ptac promoter inducible with
isopropyl- -D-galactopyranoside. A variant of pFBT18
named pFBT22 contained a xylE gene (encoding the enzyme
catechol 2,3-dioxygenase) in addition to hupB. For the
construction of pFBT22, xylE was entered in pFBT18 by
digesting it with BamHI + HindIII and ligating
the result to the 960-bp fragment released from pXYLE1 (30) when
cleaved with the same enzymes.
Fractionation of Cell Extracts of P. putida KT2442 and N-terminal
Analysis of Predominant Proteins--
The isolation of protein
fractions enriched in the DNA bending activity was based on the
protocol of Padas et al. (31). P. putida strain
KT2442 (a rifampicin-resistant variant of P. putida
KT2440 (32)) was grown at 30 °C to stationary phase
(A600 = 3) in 4 liters of LB medium (with
50 µg/ml rifampicin). Cells were centrifuged at 10,800 × g for 12 min at 4 °C and stored at 70 °C until
further utilization. Subsequent manipulations were carried out at
0-6 °C. 12 g of the frozen cell paste were resuspended in 150 ml of buffer A (25 mM Tris-HCl, pH 7.4, 1 mM
EDTA, 3 mM -mercaptoethanol, 100 mM NaCl)
added together with 3 mg of DNase I, and lysed with a French
press. After centrifugation at 30,000 × g for 30 min, the supernatant was added stepwise for 30 min with ammonium
sulfate at 55 and 85%. After centrifugation of the 85% ammonium
sulfate extract, the pellet was resuspended in 12 ml of buffer A and
dialyzed overnight against 5 liters of buffer A using a
MWCO/2000 tubes (Spectrum Medical Industries). The dialyzed protein solution was applied to a 2-ml heparin-Sepharose CL-6B (Amersham Pharmacia Biotech) column equilibrated with buffer A. Bound protein was eluted with a 30-ml gradient of 0.1-1.5
M NaCl in buffer A. The fractions enriched in proteins with
a molecular size within the range of 7 to 12 kDa (as judged by
denaturing polyacrylamide gel electrophoresis) were diluted in buffer A
and subsequently loaded on a 4-ml SP-Sepharose High Performance
(Amersham Pharmacia Biotech) column equilibrated with buffer A. A 40-ml gradient of 0.1-1.5 M NaCl in buffer A was applied.
Fractions enriched in proteins within the same size range given
above were selected for further analysis. For identification of
major proteins, the fractions of interest were run in a denaturing
Tricine-sodium dodecyl sulfate-gel electrophoresis system (33) and
blotted on a polyvinylidene difluoride membrane (Millipore). The
membrane was stained with Coomassie Brilliant Blue R250, washed in
water, and air-dried. The protein bands in the range of 9 kDa were
excised from the membrane, and their N-terminal amino acids were
determined through and automated Edman degradation microsequencing
protocol (34). Protein concentrations were determined with the Protein Assay ESL (Roche Molecular Biochemicals), which is based on complexing Cu2+ ions by the protein to be measured in a reaction
exclusively dependent on the number of peptide bonds.
In Vitro Monitoring of Nonspecific DNA Bending Activity--
The
assay (35) is based on the site-specific recombination between
so-called six sites brought about by the -recombinase encoded by plasmid pSM19035 of Streptococcus pyogenes as
part of its replication mechanism (36). The 5.8-kb test plasmid pCB8 (36) contains two directly repeated target six sites
separated by 2.2 kb. Reaction mixtures were set up in a volume of 25 µl containing 10 nM pCB8, 25 mM Tris-HCl,
pH7.5, 50 mM NaCl, 10 mM MgCl2, and
50 nM of purified -recombinase. The materials tested for
DNA bending included both crude extracts and protein fractions from
P. putida as well as purified HupB and HupN proteins,
which were added to the assays in amounts indicated in each case.
Samples containing 50 nM of the chromatin-associated
protein Hbsu from B. subtilis were also used as positive
controls for the performance of the assay. After incubation for 30 min
at 30 °C, the reaction was stopped by heating (70 °C, 10 min).
The DNA was then digested in the same buffer with PstI and
SalI, and the resulting fragments were analyzed by
agarose-gel electrophoresis (37).
Separate Overproduction in P. putida of HupB and HupN and
Purification of the Proteins--
To avoid cross-contamination between
the HU proteins of P. putida and E. coli, we
systematically used a P. putida host for overexpression of
the HupB and HupN products. To this end, the hupN+ plasmid, pFBT16, was electroporated into
the wild type strain P. putida KT2442, whereas the
hupB+ plasmid pFBT18 was placed into a
hupN deletion mutant (see below). The purification
procedure for HupB and HupN was carried out basically according to Ref.
31. Each of the expression strains were grown in 4-5 liters of LB
medium (with 50 µg/ml kanamycin) at 30 °C with vigorous shaking to
an A600 of 0.6-0.8. Following the addition of 1 mM isopropyl- -D-galactopyranoside, the
cultures were further incubated for 3-4 h at the same temperature.
13-18 g of wet cell paste were harvested by centrifugation for 10 min
in the cold at 16,300 × g. Cells resuspended in 3 ml
of buffer A (see above)/gram of paste were lysed with a French press
and cleared by centrifugation at 35,000 × g for 30 min. The proteins that precipitated within the 55-85% saturation
range of ammonium sulfate were resuspended in 2 ml of buffer A/gram of
cells and dialyzed extensively against buffer A. The resulting protein
solution (35-40 ml) was loaded at a flow of 1 ml/min in a 5-ml
heparin-Sepharose CL-6B (Amersham Pharmacia Biotech) column
equilibrated with buffer A. After washing the column extensively with
buffer A, an 80-ml gradient of 0.1-1.7 M NaCl in buffer A
was applied to the column at the same 1 ml/min flow rate. 2-ml
fractions were collected and analyzed in Tricine-SDS-PAGE (33). HupN
eluted from the column within 0.55-0.75 M NaCl with a
purity in the best fractions 95%, and thus no further purification was pursued. On the contrary, HupB eluted at 0.51-0.76 M
NaCl, but the fractions were significantly contaminated with a few
additional proteins. The HupB-containing fractions were therefore
pooled and dialyzed overnight against buffer A, and 15 ml of the
dialysate was loaded at a 1 ml/min rate on a 3-ml SP-Sepharose High
Performance (Amersham Pharmacia Biotech) column equilibrated with
buffer A. After washing the column with 3 ml of buffer A, a 60-ml
gradient of 0.1-1.0 M NaCl was applied, also at 1 ml/min,
to elute the protein. 1.5-ml fractions were collected and analyzed in
Tricine-SDS-PAGE as before. The fractions corresponding to 0.3 M NaCl contained >95% pure HupB. Fractions containing
either pure HupN or HupB were pooled separately, dialyzed
against buffer A, and added with glycerol to a concentration of 44%
(v/v). The preparations were stored at 20 °C and contained,
respectively, 1.0 mg/ml (HupN) and 2.0 mg/ml (HupB).
Cross-linking of HupB and HupN--
The physical association
between HupB and HupN monomers was examined through covalent binding of
surface-exposed Lys residues on the polypeptides with suberic acid
(disuccinimidyl suberate, Sigma). Stock solutions of suberic acid were
prepared at a concentration of 10 mg/ml in dimethyl sulfoxide. A
typical 100-µl cross-linking reaction contained 50 mM
Tris-HCl, pH 7.5, 1 mM EDTA, 10 mM
MgCl2, 25 mM NaCl, 4 µM HupB or
HupN, 0.2 mg/ml suberic acid, in 100 µl reaction volume.
Control reactions were set up by replacing the HU proteins by
30 µg/ml lysozyme, which exists only as a monomer. To examine the
formation of multimers in the presence of DNA the reactions were added
where indicated with 200 nM pCB8 plasmid. One way or the
other, mixtures were incubated for 15 min at room temperature and the
reactions stopped with an excess (4 mM) of lysine. Samples
were then dialyzed in Microcon-10 concentrators (Millipore) and
examined in denaturing 15% polyacrylamide-Tricine-SDS gels (33).
Construction of a P. putida Ps-lacZ Reporter Strain--
A
specialized P. putida strain bearing a transcriptional
lacZ fusion to the HU-dependent Ps
promoter of the TOL plasmid (38, 39) was generated as follows. The
2.4-kb HpaI fragment of plasmid pTK19 (T. Köhler,
University of Geneva) containing the complete xylR
gene and the Ps promoter was cloned into the SmaI
site of the lacZ vector pUJ8 (40), thereby generating a
Ps-lacZ fusion. Such a fusion was excised from the resulting
plasmid as a 6.5-kb NotI fragment, which was cloned into the
NotI site of a tellurite resistance pUT/mini-Tn5
delivery plasmid (41). The hybrid
xylR+/Ps-lacZ mini-transposon
generated thereby was integrated into the chromosome of P. putida KT2442 (described in detail in Ref. 42). One
lac+ TelR P. putida
exconjugant sensitive to piperacillin (43) and displaying a good
-galactosidase induction upon cell exposure to benzylalcohol (44)
was picked up as a reference strain to monitor the phenotypes of
hupB and hupN mutants.
Construction of hupB and hupN Deletions in P. putida
Ps-lacZ Strain--
To generate P. putida variants lacking
either hupB or hupN, we entered directed
deletions of each gene into the chromosome by homologous recombination.
In the case of hupB, plasmid pFBT8 was used as the template
to generate two PCR products with the pairs of primers PLKB1
(5'-GGAATTC(EcoRI)ACGTGCCGATGTGGCCATGACCGGCG-3')/PRKB2 (5'-TCAGGATCC(BamHI)TTAAGTATGTAATGAAAAGCTTATGAAACGTGTGC-3')
and PLKB3(5'-TAAGGATC
C(BamHI)TGACAAACCGGCAAGGCAATCAAGATCGAAGCC-3')/PRKB4 (5'-ACGTAAGCTT(HindIII)GCATCAGTTGACGGCGCTGCATGTCGGC-3').
The first product (456 bp) was digested with EcoRI + BamHI, whereas the second product (492 bp) was treated with
BamHI + HindIII. The digested DNAs were purified
and ligated together to vector pUC18Not (45) digested with
EcoRI + HindIII (46). This originated a plasmid
that had a NotI insert spanning the genomic DNA sequence starting at 474 bp and going to 36 bp upstream of the
leading ATG of hupB, followed by an artificial
BamHI site and followed by the sequence +189 downstream of
the ATG to +386 after the stop codon of the structural gene. Such a
NotI fragment thus contains a genomic deletion of 224 bp
that engages the hupB sequence. The presence of two in-frame
stop codons around the BamHI site employed to create the
deletion ensured the loss of the entire HupB function. The 947-bp
NotI fragment was then passed on to suicide delivery vector
pKNG101 (47) (resulting in plasmid pKNG101 hupB) and recombined in the chromosome of P. putida Ps-lacZ as
described (47). The chromosomal deletion was confirmed by PCR with
primers PLKOB5 (5'-GCCATGCCTCCCAGCACACG-3') and PRKOB7
(5'-GCGTCCTGGCTATGAGTGGC-3'). A similar approach was used to produce a
hupN strain. In this case, genomic DNA was directly used
to generate two PCR products with the pairs of primers PLKN1
(5'-GGAATTC(EcoRI)-TCGGCG
CGCTGCAAAAGTTGC-3')/PRKN2 (5'-TCAGGATCC(BamHI)TTAATCAAA
TTCGATGGTTATGCAGCGGACTACG-3') and PLKN3 (5'-TAAGGATC
C(BamHI)TGAGACCAACTGATTGCCGACATCGCCGAATCG3')/ PRKN4
(5'-ACGTAAGCTT(HindIII)CCCGGGCAAGCCGGGCGCGGTTTCG-3').
The PCR products digested, respectively, with EcoRI + BamHI and BamHI + HindIII were cloned
simultaneously into pUC18Not treated with EcoRI + HindIII as before. The resulting 690-bp insert was then placed into the NotI site of pKNG101, yielding
pKNG101 hupN, and was subsequently recombined into the
chromosome of the P. putida strain. This produced a genomic
deletion of a small 31-bp segment that eliminated the region between
coordinates 17 to +14 in respect to the leading ATG codon of the
gene. Such a deletion was confirmed with PCR using the primers PLKON5
(5'CGATAACGTCGTAGTCCGCTGC-3') and PRKON6
(5'-GTCAGCACTTTGGCT-GGAACGAAC-3').
Predictions of Evolutionary Distance among Homologous
Proteins--
Protein sequence alignment were assembled with programs
CLUSTAL X (Version 1.63b (43)) and Protdist of PHYLIP
(Phylogeny Inference Package, Version 3.5c (48)). The Swiss-Prot or
GenBankTM accession codes for the proteins examined
are the following: P05514 for HanA from Anabaena sp.
PCC7120; P02347 for HRL18 from Agrobacterium tumefaciens;
AF110185 for DbhB from Burkholderia pseudomallei; P02346
for HBst from Bacillus stearothermophilus; L25627 for HupB
from Campylobacter jejuni; P02342 for HupA from E. coli; P02341 for HupB from E. coli; P43722 for HupA from Hemophilus influenzae; O25506 for HU from
Helicobacter pylori J99; P05384 for HupB from
Pseudomonas aeruginosa; AAF65565 for HupB from
Pseudomonas fluorescens; AJ235270 for HupA from Rickettsia prowazekii; O06447 for HU from Streptomyces
lividans; P52680 for HupA from Serratia marcescens;
P52681 HupB from S. marcescens; P96045 for HU from
Streptococcus thermophilus; P15148 for HupA from
Salmonella typhimurium; P05515 for HupB from S. typhimurium; P73418 for HU from Synechocystis PCC6803;
P36206 for HU from Thermotoga maritima; and P28080 for HupA
from Vibrio proteolyticus. The sequence of the HupN protein from P. aeruginosa was deduced from the genomic data
available at the www.pseudomonas.com site (49). The complete HupB and HupN sequences from P. putida were assembled with the
assistance of the TIGR (The Institute for Genomic Research)
genomic data bank. The GenBankTM accession numbers of the
new HU proteins reported in this work are AF345628 (hupB of
P. putida); AF345629 (hupN of P. putida), and AF345630 (hupN of P. aeruginosa).
 |
RESULTS |
Identification of Nonspecific DNA-bending Activities in Protein
Extracts of P. putida--
To identify the proteins of P. putida with an ability to promote DNA bending in a
sequence-independent fashion, we resorted to the in vitro
test summarized in Fig. 1. The
-recombinase encoded by plasmid pSM19035 (36) is able to catalyze
DNA recombination between two directly oriented target sites
(six sites) both in vivo and in vitro.
However, this occurs only in the presence of native or heterologous
factors that facilitate DNA bending in a nonspecific fashion. In
Bacillus, such an activity is provided by the Hbsu protein
(an HU homologue) but can be replaced by entirely heterologous
factors such as mammalian or plant HMG B1-type proteins. This reaction
can be followed easily with test plasmid pCB8, which contains two
six sites in direct orientation and generates three DNA
fragments (one of 4.8 kb and two of 0.5 kb each) when it is digested
with PstI and SalI. Following recombination
in vitro the digestion of the resulting catenane with the
same enzymes produces two additional fragments of 2.7 and 2.1 kb (Fig.
1A). With this assay in hand, we tested protein fractions
from P. putida extracts retained in and eluted from
heparin columns (thus enriched in DNA-binding proteins) and then
fractionated in a second cation exchanger column. The result of such a
fractionation, as analyzed in a Tricine-SDS-PAGE system, is shown in
Fig. 1B. The fraction that eluted at 0.3 M NaCl
from the SP-Sepharose column (lane 1 in Fig.
1B) maximally stimulated the -recombination reaction, to
the point that a 100-fold dilution (~8 µg protein/ml) was as efficient as the positive control with 4.0 µg/ml of purified Hbsu (Fig. 1C). The addition of nondiluted fractions to the
reaction mixtures led to significant a degradation of the test DNA,
perhaps reflecting some contamination by the DNase added during the
preparation of the extracts.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 1.
Monitoring nonspecific DNA bending in protein
extracts of P. putida. A, rationale of the
-recombination assay. Intramolecular site-specific recombination
between two six sites (square boxes) engineered
in test plasmid pCB8 releases two separate circular closed
circled DNA products that give rise to a new combination of restriction
fragments upon digestion with SalI (S) and
PstI (P). The reaction is catalyzed by the
recombinase and any factor (such as HU) able to cause nonspecific
DNA bending. B, fractionation of P. putida
proteins. Selected fractions eluting from the SP-Sepharose column by
increasing salt concentrations were analyzed in a Tricine-SDS-PAGE
system. Lane 1, 300 mM NaCl; lane 2, 380 mM; lane 3, 450 mM; lane
4, 530 mM; lane 5, 600 mM;
lane 6, 680 mM; lane 7, 750 mM; lane 8, 830 mM; and lane
9, 900 mM. The protein bands subsequently subjected to
N-terminal analysis are bracketed. The band
marked in lane 1 is the HupB/HupN mixture, whereas the
band labeled in lane 6 corresponds to a homologue
of the 50 S ribosomal protein L35 from Pseudomonas
syringae. C, stimulation of -promoted DNA
recombination by protein fraction 1. Reactions were set up as explained
under "Experimental Procedures," and the products of the in
vitro recombination were analyzed with 0.8% agarose-gel
electrophoresis. The size of the products in kb is indicated on the
left. Lane M, molecular weight marker
(HindIII-digested DNA); lane 1, positive
control with 200 nM Hbsu; lane 2, negative
control with no HU protein; lane 3, 200 nM Hbsu
plus a 50-fold dillution of the SP-Sepharose fraction 1 (see protein
gel above); lanes 4-9, increasing concentrations of the
protein extract (lanes: 4, 1:2500; 5,
1:1000; 6, 1:500; 7, 1:250; 8, 1:100;
9, 1:5).
|
|
Categorizing of Proteins Candidate to Assist
-Recombination--
For identification of the protein(s) in the
extract described above that accounted for the most predominant
polypeptide(s) of fraction 1 (~9 kDa, Fig. 1B), the gel
was blotted and the band was subjected to N-terminal analyses as
explained under "Experimental Procedures." The band turned out to
be a non-equal mixture of two very similarly sized proteins. The most
abundant polypeptide (two-thirds of the band) was led by the sequence
MNKSELIDAIAASADIPKAVAGRALD. Searches in the Pseudomonas
genomic data bases of the University of Queensland, the
PathoGenesis Corporation, and TIGR, as well as in individually
deposited gene sequences in the EMBL, revealed that the product had a
maximum match with a P. aeruginosa gene previously named
hupB, which was proposed to be the HU protein of this
species (50). Such a gene has its counterpart in the genome of P. putida, and therefore we named this component of the
active fraction HupB (Fig. 2).

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 2.
Nucleotide sequence of the hupB
and hupN genes of P. putida and
amino acid composition of their products. The N-terminal amino
acids revealed by the Edman microsequencing analysis of the proteins of
the major band of fraction 1 of the protein extract of Fig.
1B are underlined.
|
|
The second, less abundant protein (one-third of the band) yielded an
N-terminal sequence ALTKDQLIADIXESIAAXXXTAKN (i.e., lacking a first Met residue). Such a sequence could be matched to
single ORFs present in both the P. aeruginosa and P. putida genomes, although no specific function had been assigned to
them. These ORFs give rise to 77% identical products in both species,
with the highest similarity in the N-terminal half of the predicted proteins. Apart from the mutual likeness, the ORFs had a 50%
similarity to the hupA gene of V. proteolyticus
(51). In addition, it matched an HU-like gene identified by
Nakazawa2 in P. putida mt-2 on the basis of complementation of an HU mutant of
E. coli. We thus designed the second component of the
-recombination active fraction as HupN, to differentiate it
from the previously described HU-like genes. It should be noted,
however, that the HupN and HupB proteins still possess 45% identical
amino acids (Fig. 2). Whether or not the relative ratio between HupB
and HupN found in the extract bears any meaning or is just the result
of the extraction and procedure remains unclear, although it is evident that both products are very abundant polypeptides.
These results provided a basis for understanding the nonspecific DNA
bending activity found in fraction 1, loaded in the gel of Fig.
1B. In fact, the HupB and HupN proteins became candidates, together or separately, for the HU homologue(s) of
P. putida. Although the fractionation procedure
employed did not rule out the possibility that other proteins with a
similar activity might exist, it seems apparent that the bulk of
proteins in the size range of typical nucleoid-associated factors
included mostly these two products. To sort out these issues, we
proceeded to the characterization in vitro and the
genetic/phenotypic analysis in vivo of the roles of HupB and
HupN in P. putida.
Purified HupB and HupN Are Competent in -Recombination
Assays--
To assign unequivocally the DNA bending activity found in
P. putida extracts to HupB, HupN, or a combination of the
two, we proceeded to overexpress them in its native host and separately purify each of them with the method described under "Experimental Procedures" (Fig. 3A). To
ensure the identity and quality of each of the purified polypeptides,
the samples were separately subjected to an N-terminal analysis, which
verified not only a purity 95% but also a complete absence of
cross-contamination by other host nucleoid-associated proteins. Prior
to running activity assays, the physical state of either protein was
determined through in vitro cross-linking experiments with
the lysine-specific agent suberic acid. As shown in Fig. 3B,
both HupB and HupN predominantly formed dimers (lanes 4 and
7), although a small portion of each of the samples remained
monomeric even after 15 min of treatment. Some tetrameric forms of HupN
(but not of HupB) could be observed also, as well as two potential
dimeric species, although their significance is unclear. The presence
of DNA in the reaction did not enhance the formation of oligomeric
forms of HupB (lane 5) or HupN (lane 8).

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 3.
Characterization of the HupB and HupN
products of P. putida. A, protein purification.
The gels show different stages of the purification of HupB and HupN as
discussed in the text. For HupN: lane 1, whole cell extract;
lane 2, whole cell extract of induced cells; lane
3, purest protein fractions (pooled) eluted from the
heparin-Sepharose CL-6B. For HupB: lane 1, whole cell
extract; lane 2, whole cell extract of induced cells;
lane 3, clear extract of induced cells; lane 4,
after ammonium sulfate fractionation; lane 5, purest
fractions (pooled) from the heparin column; lane 6, purest
fractions (pooled) from the SP-Sepharose column. B,
auto-cross-linking of HupB and HupN. Purified proteins were subjected
to the cross-linking protocol specified under "Experimental
Procedures" using the Lys-specific agent disuccinimidyl suberate.
Control lanes were loaded with similar amounts of nontreated lysozyme
(lane 1), HupB (lane 3), or HupN (lane
6). Lanes 4 and 7 and 5 and
8 are samples treated for 15 min with suberate. Samples
shown in lanes 5 and 8 also contained DNA. Sample
2 contained lysozyme treated with the same agent for 15 min.
M, molecular size markers. The double band resulting from
the cross-linking of HupN may reflect two different surfaces involved
in the dimerization. C, stimulation of -promoted DNA
recombination. Reactions were set up as explained under "Experimental
Procedures," and the products of the in vitro
recombination were analyzed with 0.8% agarose-gel electrophoresis.
Lane M, molecular weight marker (HindIII-digested
DNA); lane 1, positive control with 200 nM
Hbsu; lane 2, negative control with no HU protein;
lanes 3 and 8, 50 nM Hup
protein indicated; lanes 4 and 9, 75 nM; lanes 5 and 10, 100 nM; lanes 6 and 11, 150 nM; lanes 7 and 12, 200 nM.
|
|
In a subsequent step, the activity of each protein was assayed in a
-recombination assay in vitro using as a template the pCB8 plasmid as described above. As shown in Fig. 3C, both
HupB and HupN provided the DNA bending activity required for the
reaction, albeit at somewhat different degrees and qualities. Although
HupB abruptly stimulated -recombination (100% efficiency) at 150 nM, HupN initiated the reaction at 75 nM,
albeit at a lower efficiency. The reaction with HupN improved with
increasing concentrations of the factor, to reach saturation (100%
recombination) at 150 nM. These concentrations are in the
range of other HU proteins tested in this type of assay (35). These
results indicated that both HupB and HupN sufficed by themselves to
bend DNA in a sequence-independent fashion, and therefore, they both
contribute to providing this capacity to the active extract (Fig.
1C) and, presumably, to the cells in vivo as well
(see below).
Functional Complementation of B. subtilis Hbsu by HupB or
HupN--
The next step in the characterization of the HupB and HupN
proteins was to examine their functionality in vivo in an
entirely heterologous context. To this end, we took advantage of the
fact that the whole requirement for nonspecific DNA bending functions in B. subtilis is met by the protein Hbsu protein (52),
which is encoded by the hbs gene. This gene is in fact
essential for cell viability (22), and knockout mutants do not exist.
However, disabled Hbsu variants bearing amino acid substitutions
F47W and R55A still allow cell growth, although the bacteria
are deficient in DNA repair, homologous recombination, and
site-specific recombination mediated by protein (53). Such an
allele thus provides a good assay system in vivo to examine
the functional replacement of Hbsu by any other factors that supply the
same activities. Although HupB and HupN of P. putida exhibit
a respectable sequence similarity to Hbsu (53 and 43% respectively,
not shown), the divergence is great enough to make the test more
significant that a simple replacement of one HU variant by
another. On this basis, both hupB and hupN were
cloned separately in shuttle vector pHP13, and the resulting constructs
were transformed into Bacillus strain BG405, which bears the
mutated hbs gene (hbs-4755). To monitor
functional complementation between Hbsu and the P. putida
proteins, the transformants and their controls were then exposed to the
DNA-damaging agent methyl methane sulfonate (10 mM), and
the surviving cells were monitored as described previously (53). As
shown in Fig. 4, the Hbsu
strain harboring vector pHP13 without any insert exhibited a high
sensitivity to methyl methane sulfonate, whereas the wild type
Bacillus strain was only marginally affected. But B. subtilis BG405 (hbs) transformed with either
pHP13-hupB or pHP13-hupN was as resistant to
methyl methane sulfonate exposure as the wild type and as the
B. subtilis BG405 (pCB188) strain, the plasmid of which
encodes the wild type hbs gene (see "Experimental
Procedures"). These results indicated that both HupB and HupB can
complement in full the loss of Hbsu in B. subtilis and
strengthened the notion that each protein is capable by itself of
meeting in vivo any physiological demand of generic DNA
bending. In this respect, it is worth noticing that the HU-like
hlpA gene of the plastid genome of the cryptomonad alga
Chryptomonas was not as efficient as the P. putida hup genes in the same complementation assay
(54).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 4.
Complementation in vivo of
the hbs deficiency in B. subtilis. Strain
B. subtilis BG405, which bears an hbs allele
producing an Hbsu protein with mutations F47W/R55A was
transformed separately with pCB188 (wild type
hbs+, open squares), pHP13 (vector,
no insert, filled circles), pHP13-hupB
(hupB+, open triangles), and
pHP13-hupN (hupN+, filled
rhomboids). Cells were grown as indicated (53), exposed to
10 mM methylmethane sulfonate (MMS), and
its survival over time was monitored by plating and colony
counting. The graph represents the cell viability of each strain
following the treatment with the DNA-damaging agent. The control
B. subtilis strain BG397 (open circles) bears in
its chromosome the normal wild type hbs+
allele.
|
|
Phenotypes Endowed by hupB and hupN Deletions in P. putida--
To determine the functions of HupB and HupN, together and
separately, in their native context in vivo, we
produced deletion mutants of each gene through homologous recombination
of DNA segments into the chromosome of P. putida Ps-lacZ.
The replacement of DNA fragments between the delivery plasmid and the
chromosome occurred at high frequencies ( 10%). The changes in the
corresponding genomic sites caused by each of the deletions are
represented in Fig. 5. Single
hupB and hupN mutants did not display any
evident phenotype. They grew at the very same rate and yield that the wild type cells in a variety of rich and minimal media tested and were
as resistant to UV radiation as the wild type (not shown). As a more
specific test, we examined the effect of a lack of HupB or HupN
on the activity of the 54 promoter Ps of the
TOL plasmid pWW0 of P. putida mt-2 (55). This promoter and
its cognate activator, XylR, form part of an intricate regulatory
system that controls the expression of a plasmid-encoded pathway for
the biodegradation of toluene, m-xylene, and
p-xylene (26). XylR belongs to the family of the prokaryotic enhancer-binding proteins that act in concert with the
54-containing form of RNAP. The activation mechanism of
Ps requires the looping out of the distant
XylR·UAS complex to contact the 54-RNAP bound
downstream (56). This process involves the exacerbation of an
intrinsically curved DNA sequence located between the bound XylR·UAS
complex and the polymerase. When Ps and XylR are placed in
E. coli, the promoter activity becomes dependent on the host HU protein (39); this probably reflects the need of a helper DNA
bending factor to produce an optimal promoter geometry (39). To examine
whether such a requirement is fulfilled in P. putida by
either HupB or HupN, we monitored the activity of the chromosomal Ps-lacZ fusion born by the strain host to the deletions when
induced with the XylR effector benzylalcohol. Fig.
6 shows the results of triplicate
-galactosidase assays carried out with the hupB and
hupN single-deletion mutants compared with the parental
strain with no deletions. Although we could detect some minor changes in the mutants (more evident in the case of the hupB
strain), such variations did not exceed ~30% and could thus hardy be
considered significant. Taken together, the data presented above
suggested either that HupB and HupN are in fact redundant proteins,
having the same functions in a variety of systems, or that yet another factor(s) may exist in P. putida that compensate the loss of
each of them. This was ascertained with the assays in vivo
shown below.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 5.
Organization of
hupB and
hupN chromosomal deletions.
The diagrams show the DNA segments generated by PCR to create the
deletions that were assembled in the delivery vector pKNG101, as well
as the result of the double recombination event with the chromosome of
P. putida. The location of primers PLKOB5, PRKOB7, PLKON5,
and PRKON6 used to verify the deletions are indicated in their
corresponding sites. The amplification products generated with
the cognate oligonucleotides have the following sizes (in bp): wild
type hupB, 704; hupB, 451; wild
type hupN, 320; hupN, 299.
|
|

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 6.
Effect of hupB and
hupN deletions on the activity of the Ps
promoter. The reporter strain P. putida
Ps-lacZ (wild type (wt)) and its
hupB and hupN derivatives were
separately grown in mineral medium (44) at 30 °C up to an optical
density (A600) of 0.8, at which point 5 mM benzyl alcohol was added. Cultures were grown for an
additional 3 h, and the accumulation of -galactosidase was
measured by the method of Miller (64). The organization of the reporter
xylR/Ps-lacZ chromosomal insertion, engineered in a
tellurite-resistant transposon vector and flanked by the I end
(IE) and O end (OE) of Tn5, is
sketched at the top of the figure.
|
|
HupB and HupN Provide Essential functions for P. putida--
Because the function(s) of HupB and HupN could only be
hinted at ultimately by examining a double hupB/hupN mutant,
we set out to produce a hupB/ hupN
strain. This was attempted through a sequential recombination of each
of the deleted DNA segments into the chromosome of the target strain.
Unfortunately, after screening more than 1000 clones, we failed to
produce such a double mutant, regardless of the order in which each
delivery vector was used (see "Experimental Procedures"). That
recombination was not the problem was evidenced by the observation that
double chromosomal deletions hupB/ hupN
could easily be generated if the delivery plasmid for the
hupN DNA segment was recombined in the
hupB strain that had been transformed with the
hupB+ plasmid pFBT22. This gave us a clue that
perhaps cells lacking both HupB and HupN were not viable. To test this
notion, we set up the experiment shown in Fig.
7. In this assay, we employed the
double-deleted hupB/ hupN strain P. putida transformed with pFBT22 (hupB+).
This plasmid bears as well a xylE+ insert
(encoding catechol 2,3-dioxygenase), which allows an easy identification of plasmid-containing clones by spraying the plates with
catechol. This turns the cells yellow because of the production of
hydroxymuconic semialdehyde (57). As shown in Fig. 7, the growth of
this strain for >100 generations in LB medium without any antibiotic
(i.e. no external selection for pFBT22 maintenance) always
produced 100% yellow colonies when spread with catechol. On
the contrary, when the same plasmid was placed in the single deletion
hupB mutant, there was a progressive loss of
pFBT22 when cells were grown in nonselective medium. One round of
plating without kanamycin sufficed to caused the spontaneous loss of
80% of the plasmid in viable cells. As little as eight generations later, only 10% of cells bearing the single
hupB deletion maintained the
hupB+ construct. The addition of 50 mg/ml
kanamycin to the cultures ensured full plasmid retention under every
condition tested (Fig. 7). These results suggested that plasmid pFBT22
could not be cured spontaneously from the
hupB/hupN double-deletion mutant, because at
least one of the two genes must be kept functional for viability.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 7.
Comparison of the loss of the
hupB+/xylE+
plasmid pFBT22 from P. putida hupB
and hupB hupN. Cultures of
strains P. putida hupB (pFBT22) and P. putida hupB hupN (pFTB22) grown in the
presence of kanamycin to ensure plasmid retention were used to
inoculate fresh media with or without the antibiotic. Cultures were
then plated on either selective or nonselective medium immediately or
after eight generations. After overnight growth, the plates were
sprayed with 1% catechol to reveal colonies carrying xylE
gene and thus the pFBT22. The bars represent the percentage
of plasmid-containing clones detected in each case. Solid
bars, P. putida hupB (pFBT22);
hatched bars, P. putida hupB
hupN (pFTB22).
|
|
 |
DISCUSSION |
All of the results reported in this article support
the idea that HupB and HupN are two distinct proteins, albeit
structurally related, which are necessary and sufficient by themselves
to provide essential factor-mediated but nonspecific DNA bending
functions in P. putida. That no other factors can take over
such a function is suggested by the nonviability of
hupB/hupN double-deletion (Fig. 7) and, to a
minor extent, by the virtual absence of any additional DNA bending
activity in cell extracts (Fig. 1). The phylogenetic tree in Fig.
8 shows a prediction of the relationship between the HupB and HupN proteins from both pseudomonads and other
eubacterial HU-like proteins. The most salient feature of such an
analysis is that HupN clearly branches away from the HupA/HupB-type proteins of -proteobacteria. In fact, it has been generally believed that the existence of two genes encoding HU proteins was exclusive to
enteric bacteria (21). This view appeared to be true for P. aeruginosa, for which only one gene (hupB) and
its corresponding gene product had been assigned to the HU function
(50). The N-terminal sequence of the HU protein from P. aeruginosa was determined and found to be a HupB homodimer (58,
59). However, a hupN analogue very close to the P. putida gene does exist in the P. aeruginosa chromosome
(49) but was detected neither biochemically nor genetically in this
genus; whether this reflects a genuine lack of expression or a
limitation of the techniques employed is uncertain. On the contrary,
our results demonstrate unequivocally that both HupB and HupN are
expressed and are perfectly active in P. putida.

View larger version (67K):
[in this window]
[in a new window]
|
Fig. 8.
Phylogenetic tree of selected HU proteins of
eubacteria. The sequences belonging to the -, -, -, and
-subgroup of the proteobacteria are marked with a gray
background. The horizontal bar indicates the percent of
sequence divergence (i.e. evolutionary distance). The
proteins are labeled with trivial abbreviations designating their
corresponding organisms: Ana-HanA, Anabaena sp.;
Atu-Dbh1, A. tumefaciens; Bps-DbhB, B. pseudomallei; Bst-HBst, B. stearothermophilus; Cje-HupB, C. jejuni;
Eco-HupA and Eco-HupB, E. coli;
Hin-HupA, H. influenzae; Hpy-Hup,
H. pylori; Pae-HupB and Pae-HupN,
P. aeruginosa; Pfl-HupB, P. fluorescens; Ppu-HupB and Ppu-HupN, P. putida; Rpr-HupA, R. prowazekii;
Sli-HU, S. lividans; Sma-HupA and
Sma-HupB, S. marcescens; Sth-HU, S. thermophilus; Sty-HupA and Sty-HupB,
S. typhimurium; Syn-HU, Synechocystis;
Tma-HU, T. maritima; and Vpr-HupA, V. proteolyticus.
|
|
The presence of two genes for the HU function in some bacterial genera
and only one in others is intriguing. Unlike the IHF protein,
which necessarily requires the assembly of a heterodimer to
function (60, 61), each of the two HU proteins (hupA and hupB) of E. coli seem to be able to function
independently, although they do form functional heterodimers as well
(15, 16). It has been claimed (15) that the subunit composition of HU
from E. coli changes during growth and that this may
reflect a certain specialization of the functions of each protein
species. We cannot distinguish, however, any gross phenotypic
differences between P. putida cells expressing either one of
the Hup proteins or both of them. Although we did not examine the
formation of heterodimers between the two proteins, it seems clear as
well that each polypeptide fulfills by itself (i.e.
homodimers, Fig. 3B) every function assigned to HU or
HU-like proteins (Fig. 8), suggesting that if the formation of
heterodimers between them does occur, it is irrelevant for cell physiology.
A second aspect of the redundancy of HU activities is that double
hupA hupB mutants of E. coli (i.e.
lacking any HU-related function) do exist that are viable. In our
studies and those of others (17, 18), however, such mutants survive
very poorly, develop multiple morphologies, and are quite
unpredictable, surely because of the accumulation of compensatory
mutations. Although it could be argued that such mutations may
originate in a decrease of DNA-binding specificity of IHF that
takes over some HU functions, the fact is that
HU /IHF exist as well (62), an issue that
deserves further studies. Under the conditions of the experiment shown
in Fig. 7, which is short enough so as not to allow the overgrowth of
bacteria bearing compensatory mutations, it is clear that the
functionality of at least one HU protein is essential for gross
viability in P. putida.
Although we could detect none but subtle differences in vivo
and in vitro between HupB and HupN in the laboratory tests
described in this article, we cannot rule out that small
changes can make a difference when P. putida thrives
in its natural habitats. Ecological fitness under the tougher
environmental conditions that predominate in the polluted sites that
P. putida colonizes depend to a large extent on an ability
to integrate different environmental signals in the outcome of
catabolic promoters (63). Such signals frequently involve DNA bending
as a signal transmission mechanism (1, 2), and thus small differences
in expression, like those shown in Fig. 6, may turn out to be
significant. With the data at hand, however, the simplest explanation
for the presence of two proteins fully competent in nonspecific DNA
bending in some bacterial species (including P. putida) is
that one simply acts as a backup for the other. The redundancy of HU
factors in the same cell would thus reveal the evolutionary importance
of such a function, not a specialization in a particular role in the
physiology of the bacteria.
 |
ACKNOWLEDGEMENT |
The authors are indebted to M. Kiess for
N-terminal sequencing and to J. C. Alonso (Centro Nacional de
Biotecnología, Madrid) for critical reading of the
manuscript. Discussions with A. Oppenheim (Hebrew University,
Jerusalem) contributed significantly to the outcome of this project.
 |
FOOTNOTES |
*
This work was supported by Contracts BIO4-CT97-2040 and
QLRT-99-00041 from the European Commission and by Grants
BIO98-0808 and DGCYT BMC2000-0548 from the Spanish Comisión
Interministerial de Ciencia y Tecnología (CICYT).The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF345628 (hupB of P. putida); AF345629 (hupN
of P. putida), and AF345630 (hupN of P. aeruginosa).
Supported by the Fonds der Chemische Industrie.
§
Current address: Fresenius HemoCare Adsorber Technology GmbH,
Frankfurter Str. 6-8, 66606 St. Wendel, Germany.
**
To whom correspondence should be addressed: Dept. of Microbial
Biotechnology, Centro Nacional de Biotecnología-CSIC, Campus de
Cantoblanco, 28049 Madrid, Spain. Tel.: +34 91-585-4536; Fax: +34 91-585-4506; E-mail: vdlorenzo@cnb.uam.es.
Published, JBC Papers in Press, February 13, 2001, DOI 10.1074/jbc.M011295200
2
T. Nakazawa, personal communication.
 |
ABBREVIATIONS |
The abbreviations used are:
IHF, integration host factor;
bp, base pair(s);
kb, kilobase pair(s);
TOL, toluene degradation plasmid;
PCR, polymerase chain reaction;
ORF, open
reading frame;
Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine;
PAGE, polyacrylamide gel electrophoresis.
 |
REFERENCES |
| 1.
|
Perez-Martin, J.,
Rojo, F.,
and de Lorenzo, V.
(1994)
Microbiol. Rev.
58,
268-290
|
| 2.
|
Perez-Martin, J.,
and de Lorenzo, V.
(1997)
Annu. Rev. Microbiol.
51,
593-628
|
| 3.
|
Drlica, K.,
and Rouvière-Yaniv, J.
(1987)
Microbiol. Rev.
51,
301-319
|
| 4.
|
Pettijohn, D. E.
(1996)
in
Escherichia coli and Salmonella: Cellular and Molecular Biology
(Neidhardt, F. C.
, Curtis, R., III
, Ingraham, J. L.
, Lin, E. C. C.
, Low, K. B.
, Magasanik, B.
, Reznikoff, W. S.
, Riley, M.
, Schaechter, M.
, and Umbarger, H. E., eds), 2nd Ed., Vol. 1
, pp. 158-166, American Society for Microbiology, Washington, D. C.
|
| 5.
|
Pettijohn, D. E.
(1988)
J. Biol. Chem.
263,
12793-12796
|
| 6.
|
Schmidt, M. B.
(1988)
Trends Biochem. Sci.
13,
131-135
|
| 7.
|
Azam, T. A.,
and Ishihama, A.
(1999)
J. Biol. Chem.
274,
33105-33113
|
| 8.
|
Kano, Y.,
Yoshino, S.,
Wada, M.,
Yokoyama, K.,
Nobuhara, M.,
and Imamoto, F.
(1985)
Mol. Gen. Genet.
201,
360-362
|
| 9.
|
Kano, Y.,
Wada, M.,
Nagase, T.,
and Imamoto, F.
(1986)
Gene
45,
37-44
|
| 10.
|
Kano, Y.,
Osato, K.,
Wada, M.,
and Imamoto, F.
(1987)
Mol. Gen. Genet.
209,
408-410
|
| 11.
|
Kano, Y.,
Wada, M.,
and Imamoto, F.
(1988)
Gene
69,
331-335
|
| 12.
|
Craig, N. L.,
and Nash, H. A.
(1984)
Cell
39,
707-716
|
| 13.
|
Goodrich, J. A.,
Schwartz, M. L.,
and McClure, W. R.
(1990)
Nucleic Acids Res.
18,
4993-5000
|
| 14.
|
Rouviere-Yaniv, J.,
and Kjeldgaard, N. O.
(1979)
FEBS Lett.
106,
297-300
|
| 15.
|
Claret, L.,
and Rouviere-Yaniv, J.
(1997)
J. Mol. Biol.
273,
93-104
|
| 16.
|
Pinson, V.,
Takahashi, M.,
and Rouviere-Yaniv, J.
(1999)
J. Mol. Biol.
287,
485-497
|
| 17.
|
Wada, M.,
Kano, Y.,
Ogawa, T.,
Okazaki, T.,
and Imamoto, F.
(1988)
J. Mol. Biol.
204,
581-591
|
| 18.
|
Huisman, O.,
Faelen, M.,
Girard, D.,
Jaffe, A.,
Toussaint, A.,
and Rouviere-Yaniv, J.
(1989)
J. Bacteriol.
171,
3704-3712
|
| 19.
|
Boubrik, F.,
and Rouvière-Yaniv, J.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
3958-3962
|
| 20.
|
Li, S.,
and Waters, R.
(1998)
J. Bacteriol.
180,
3750-3756
|
| 21.
|
Oberto, J.,
and Rouviere-Yaniv, J.
(1996)
J. Bacteriol.
178,
293-297
|
| 22.
|
Micka, B.,
and Marahiel, M. A.
(1992)
Biochimie (Paris)
74,
641-650
|
| 23.
|
Chaudhry, G. R.,
and Chapalamadugu, S.
(1991)
Microbiol. Rev.
55,
59-79
|
| 24.
|
Williams, P. A.,
and Sayers, J. R.
(1994)
Biodegradation
5,
195-217
|
| 25.
|
Shingler, V.,
Bartilson, M.,
and Moore, T.
(1993)
J. Bacteriol.
175,
1596-1604
|
| 26.
|
Ramos, J. L.,
Marques, S.,
and Timmis, K. N.
(1997)
Annu. Rev. Microbiol.
51,
341-373
|
| 27.
|
Haima, P.,
Bron, S.,
and Venema, G.
(1987)
Mol. Gen. Genet.
209,
335-342
|
| 28.
|
De Lorenzo, V.,
Eltis, L.,
Kessler, B.,
and Timmis, K. N.
(1993)
Gene
123,
17-24
|
| 29.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd Ed.
, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 30.
|
Stein, D. C.
(1992)
Gene
117,
157-158
|
| 31.
|
Padas, P. M.,
Wilson, K. S.,
and Vorgias, C. E.
(1992)
Gene
117,
39-44
|
| 32.
|
Franklin, F. C. H.,
Bagdasarian, M.,
Bagdasarian, M. M.,
and Timmis, K. N.
(1981)
Proc. Natl. Acad. Sci. U. S. A.
78,
7458-7462
|
| 33.
|
Schägger, H.,
and von Jagow, G.
(1987)
Anal. Biochem.
166,
368-379
|
| 34.
|
Maiorino, M.,
Roche, C.,
Kiess, M.,
Koenig, K.,
Gawlik, D.,
Matthes, M.,
Naldini, E.,
Pierce, R.,
and Flohe, L.
(1996)
Eur. J. Biochem.
238,
838-844
|
| 35.
|
Alonso, J. C.,
Weise, F.,
and Rojo, F.
(1995)
J. Biol. Chem.
270,
2938-2945
|
| 36.
|
Rojo, F.,
and Alonso, J. C.
(1994)
J. Mol. Biol.
238,
159-172
|
| 37.
|
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K.
(eds)
(1989)
Current Protocols in Molecular Biology
, John Wiley and Sons, Inc., New York
|
| 38.
|
Abril, M. A.,
Michan, C.,
Timmis, K. N.,
and Ramos, J. L.
(1989)
J. Bacteriol.
171,
6782-6790
|
| 39.
|
Perez-Martin, J.,
and de Lorenzo, V.
(1995)
J. Bacteriol.
177,
3758-3763
|
| 40.
|
De Lorenzo, V.,
Herrero, M.,
Jakubzik, U.,
and Timmis, K. N.
(1990)
J. Bacteriol.
172,
6568-6572
|
| 41.
|
Sanchez-Romero, J. M.,
Diaz-Orejas, R.,
and De Lorenzo, V.
(1998)
Appl. Environ. Microbiol.
64,
4040-4046
|
| 42.
|
De Lorenzo, V.,
and Timmis, K. N.
(1994)
Methods Enzymol.
235,
386-405
|
| 43.
|
Fernández, S.,
de Lorenzo, V.,
and Pérez-Martín, J.
(1995)
Mol. Microbiol.
16,
205-213
|
| 44.
|
Holtel, A.,
Marques, S.,
Möhler, I.,
Jakubzik, U.,
and Timmis, K. N.
(1994)
J. Bacteriol.
176,
1773-1776
|
| 45.
|
Herrero, M.,
de Lorenzo, V.,
and Timmis, K. N.
(1990)
J. Bacteriol.
172,
6557-6567
|
| 46.
|
de Lorenzo, V.,
Herrero, M.,
Sánchez, J. M.,
and Timmis, K. N.
(1998)
FEMS Microbiol. Ecol.
27,
211-224
|
| 47.
|
Kaniga, K.,
Delor, I.,
and Cornelis, G. R.
(1991)
Gene
109,
137-141
|
| 48.
|
Felsenstein, J.
(1985)
Evolution
39,
783-791
|
| 49.
|
Stover, C. K.,
Pham, X. Q.,
Erwin, A. L.,
Mizoguchi, S. D.,
Warrener, P.,
Hickey, M. J.,
Brinkman, F. S. L.,
Hufnagle, W. O.,
Kowalik, D. J.,
Lagrou, M.,
Garber, R. L.,
Goltry, L.,
Tolentino, E.,
Westbrock-Wadman, S.,
Yuan, Y.,
Brody, L. L.,
Coulter, S. N.,
Folger, K. R.,
Kas, A.,
Larbig, K.,
Lim, R.,
Smith, K.,
Spencer, D.,
Wong, G. K.-S.,
Wu, Z.,
Paulsen, I. T.,
Reizer, J.,
Saier, M. H.,
Hancock, R. E. W.,
Lory, S.,
and Olson, M. V.
(2000)
Nature
406,
959-964
|
| 50.
|
Delic-Attree, I.,
Toussaint, B.,
and Vignais, P. M.
(1995)
Gene
154,
61-64
|
| 51.
|
Giladi, H.,
Wang, W. X.,
and Oppenheim, A. B.
(1992)
Nucleic Acids Res.
20,
4092
|
| 52.
|
Micka, B.,
Groch, N.,
Heinemann, U.,
and Marahiel, M. A.
(1991)
J. Bacteriol.
173,
3191-3198
|
| 53.
|
Fernandez, S.,
Rojo, F.,
and Alonso, J. C.
(1997)
Mol. Microbiol.
23,
1169-1179
|
| 54.
|
Grasser, K. D.,
Ritt, C.,
Krieg, M.,
Fernandez, S.,
Alonso, J. C.,
and Grimm, R.
(1997)
Eur. J. Biochem.
249,
70-76
|
| 55.
|
Assinder, S. J.,
and Williams, P. A.
(1990)
Adv. Microb. Physiol.
31,
1-69
|
| 56.
|
Su, W.,
Porter, S.,
Kustu, S.,
and Echols, H.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
5504-5508
|
| 57.
|
Murray, K.,
and Williams, P. A.
(1974)
J. Bacteriol.
117,
1153-1157
|
| 58.
|
Hawkins, A. R.,
and Wootton, J. C.
(1981)
FEBS Lett.
130,
275-278
|
| 59.
|
Toussaint, B.,
Delic-Attree, I.,
and Vignais, P. M.
(1993)
Biochem. Biophys. Res. Commun.
196,
416-421
|
| 60.
|
Nash, H. A.,
and Robertson, C. A.
(1981)
J. Biol. Chem.
256,
9246-9253
|
| 61.
|
Nash, H. A.,
Robertson, C. A.,
Flamm, E.,
Weisberg, R. A.,
and Miller, H. I.
(1987)
J. Bacteriol.
169,
4124-4127
|
| 62.
|
Mendelson, I.,
Gottesman, M.,
and Oppenheim, A. B.
(1991)
J. Bacteriol.
173,
1670-1676
|
| 63.
|
Cases, I.,
and de Lorenzo, V.
(2001)
EMBO J.
20,
1-11
|
| 64.
|
Miller, J. H.
(1972)
Experiments in Molecular Genetics
, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
I. de Bruijn and J. M. Raaijmakers
Regulation of Cyclic Lipopeptide Biosynthesis in Pseudomonas fluorescens by the ClpP Protease
J. Bacteriol.,
March 15, 2009;
191(6):
1910 - 1923.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Valls, M. Buckle, and V. de Lorenzo
In Vivo UV Laser Footprinting of the Pseudomonas putidasigma 54Pu Promoter Reveals That Integration Host Factor Couples Transcriptional Activity to Growth Phase
J. Biol. Chem.,
January 11, 2002;
277(3):
2169 - 2175.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|