JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M011295200 on February 13, 2001

J. Biol. Chem., Vol. 276, Issue 20, 16641-16648, May 18, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/20/16641    most recent
M011295200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bartels, F.
Right arrow Articles by de Lorenzo, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bartels, F.
Right arrow Articles by de Lorenzo, V.

The Essential HupB and HupN Proteins of Pseudomonas putida Provide Redundant and Nonspecific DNA-bending Functions*

Frank BartelsDagger §, Silvia Fernández, Andreas HoltelDagger , Kenneth N. TimmisDagger ||, and Víctor de Lorenzo**

From the Dagger  Division of Microbiology, Gesellschaft für Biotechnologische Forschung (GBF), D-38124, Braunschweig, Germany and  Department of Microbial Biotechnology, Centro Nacional de Biotecnología, Consejo Superior de Investigaciones Científicas, (CSIC), Campus de Cantoblanco, 28049 Madrid, Spain

Received for publication, December 14, 2000, and in revised form, February 12, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

A protein mixture containing two major components able to catalyze a beta -recombination reaction requiring nonspecific DNA bending was obtained by fractionation of a Pseudomonas putida extract. N-terminal sequence analysis and genomic data base searches identified the major component as an analogue of HupB of Pseudomonas aeruginosa and Escherichia coli, encoding one HU protein variant. The minor component of the fraction, termed HupN, was divergent enough from HupB to predict a separate DNA-bending competence. The determinants of the two proteins were cloned and hyperexpressed, and the gene products were purified. Their activities were examined in vitro in beta -recombination assays and in vivo by complementation of the Hbsu function of Bacillus subtilis. HupB and HupN were equally efficient in all tests, suggesting that they are independent and functionally redundant DNA bending proteins. This was reflected in the maintenance of in vivo activity of the sigma 54 Ps promoter of the toluene degradation plasmid, TOL, which requires facilitated DNA bending, in Delta hupB or Delta hupN strains. However, hupB/hupN double mutants were not viable. It is suggested that the requirement for protein-facilitated DNA bending is met in P. putida by two independent proteins that ensure an adequate supply of an essential cellular activity.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Because of the topological changes that DNA must undergo during basic cellullar functions, factor-directed DNA bending is frequently involved in a variety of replication, recombination, and transcription mechanisms (1, 2). The abundant polypeptides that assist the maintenance of the DNA structure and its conformational transitions in bacteria are generically termed nucleoid-associated proteins. This somewhat vague term includes, in the case of Escherichia coli, factors such as HU, H-NS, StpA, Lrp (leucine-responsive protein), Fis, and the integration host factor IHF (3, 4).1 With different degrees of specificity, these proteins bind distinct sites or attach to less specific DNA segments and compact, relax, or change the architecture of given chromosomal regions (5-7). Among these proteins, HU has been identified as the major component of the bacterial nucleoid, the function of which is to facilitate a whole spectrum of molecular processes that involve DNA bending. With at least 30,000 molecules (dimers)/cell, HU statistically can bind every 200 bp of the E. coli chromosome (3). The HU protein of E. coli consists of two genetically unlinked polypeptides of about 9 kDa, which are encoded by two highly similar genes, hupA and hupB (8-11). In contrast to IHF, which binds strongly to a consensus DNA motif (12, 13), HU does not generally bind in a sequence-specific manner. The HU proteins of E. coli are functional both as homodimers and heterodimers, although each form seems to be specialized in nonidentical roles (14-16). HU- mutants, which bear deletions of both the hupA and hupB genes in E. coli, are viable but exhibit many growth defects (17, 18). In addition, these mutants are sensitive to gamma  and UV irradiation because of the involvement of HU in DNA repair and homologous recombination (19, 20). Although HU proteins are conserved in most microorganisms, only enteric bacteria seem to harbor two genes encoding polypeptides able to form a heterodimer (21). In other eubacteria such as Bacillus subtilis, an essential single gene (hbs) gives rise to a homodimeric HU protein (21, 22), which is named Hbsu in this species.

The life cycle and the natural niches of E. coli are relatively simple compared with those of not-so-distant relatives, such as Pseudomonas putida, which thrive in soils polluted with toxic chemicals (23, 24). In these niches, the transduction of environmental signals occurs through a whole collection of mechanisms that very frequently involve regulated DNA bending (1). This is particularly true for promoters of metabolic pathways that are dependent on factor sigma 54 (sigma 54), such as the Pu and Ps promoters of the toluene degradation plasmid (TOL) or the Po promoter of the pVI150 (catabolism of methyl phenols), the expression of which is finely regulated by multiple environmental inputs (25, 26). Although such transduction pathways involving DNA bending can be reproduced to some extent in E. coli, it cannot be taken for granted that the same factors facilitating DNA bending are identical in bacteria living in more complex habitats. To address this issue, we fractionated a cell extract, P. putida, and sought proteins that were generically able to facilitate DNA bending. As shown below, the most active fraction contained two independent HU variants the function of which appeared to be to back up each other for essential DNA bending functions.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Strains, Plasmids, and Plasmid Construction-- Plasmid pFBT8 contains a genomic 6-kb SacI fragment from the P. putida chromosome spanning the hupB sequence and cloned in vector pZERO-2 (Invitrogen). The hupB gene was amplified from pFTB8 with primers PLHU1N (5'-TTCATATG(NdeI)AACAA GTCG GAA CTGATTG-3') and PRHU1B (5'-TGGGATCC(BamHI)GA CTT AGTTGA CGGC GTC-3'), which generated an~300-bp PCR product bound by a leading ATG overlapping a NdeI site and a stop codon, TAA, followed by a BamHI sequence. This fragment was digested with NdeI and BamHI and cloned in the corresponding sites of expression vector pT7-7 (gift of Stanley Tabor, Harvard Medical School), giving rise to plasmid pFBT17. Similarly, the hupN sequence was amplified with oligonucleotides PLNAK3 (5'-ACCACCATGG(NcoI)CATTGACCAAAGACC-3') and PRNAK4 (5'-TTTGGATCC(BamHI)ATTACTTGTTGATGGCGTCG-3'), which left NcoI and BamHI sites at the start and end of the ORF. The resulting ~300-bp product was cloned as a NcoI-BamHI insert in pET-3d (Stratagene), originating plasmid pFBT12. The inserts of pFBT17 (hupB+) and pFBT12 (hupN+) were resequenced to ensure that no error had been entered in the ORFs during the cloning procedures.

For expression of hupB and hupN in B. subtilis, the corresponding inserts of pFBT17 and pFBT12 were transferred to shuttle vector pHP13 (27), which contains origins of replication functional in both E. coli and B. subtilis, as well as chloramphenicol (cat, CmR) and erythromycin resistance gene markers. To transfer hupB to such a shuttle plasmid, pFBT17 was digested with XbaI, a site for which is located upstream of the optimized Shine-Dalgarno sequences and the translation initiation regions present in the plasmids. The resulting XbaI end of the digested pFBT17 was then blunt-ended with T4 DNA polymerase and the plasmid subsequently digested with BamHI. This released the hupB sequence as a segment bounded by a blunt end and a BamHI site. Such purified fragment was then cloned in pHP13 digested with SmaI and BamHI, thereby giving rise to plasmids pHP13-hupB. The same procedure was used to generate an equivalent plasmid with hupN, except that the fragment inserted in the shuttle pHP13 was bounded by a blunt-ended extreme (formerly a XbaI site in pFBT12) and a HindIII site. Ligation of such a hupN+ fragment to pHP13, digested with SmaI and the HindIII originated plasmid pHP13-hupN. In these constructs, the hupB and hupN genes are located downstream of the cat gene of pHP13, so that their transcription originates from the cat promoter.

The plasmids employed for overproduction of hupB and hupN in P. putida (see below) were constructed by transferring the inserts of pFBT17 and pFBT12 into the broad host range and kanamycin resistance expression vector pVLT33 (28). To this purpose, both pFBT17 and pFBT12 were digested with XbaI. The resulting ends were filled in as described above, and digested with BamHI. This originated DNA segments each flanked by one blunt end an a BamHI extreme. The DNA fragments were ligated to vector pVLT33, which had been digested with EcoRI, filled in with the Klenow fragment of DNA polymerase + dNTPs (29), and subsequently digested with BamHI. Because of this pedigree, the resulting plasmids, pFBT18 (hupB+) and pFBT16 (hupN+), bore each of the genes preceded by an optimal Shine-Dalgarno and translation initiation region sequences and located downstream of a strong Ptac promoter inducible with isopropyl-beta -D-galactopyranoside. A variant of pFBT18 named pFBT22 contained a xylE gene (encoding the enzyme catechol 2,3-dioxygenase) in addition to hupB. For the construction of pFBT22, xylE was entered in pFBT18 by digesting it with BamHI + HindIII and ligating the result to the 960-bp fragment released from pXYLE1 (30) when cleaved with the same enzymes.

Fractionation of Cell Extracts of P. putida KT2442 and N-terminal Analysis of Predominant Proteins-- The isolation of protein fractions enriched in the DNA bending activity was based on the protocol of Padas et al. (31). P. putida strain KT2442 (a rifampicin-resistant variant of P. putida KT2440 (32)) was grown at 30 °C to stationary phase (A600 = 3) in 4 liters of LB medium (with 50 µg/ml rifampicin). Cells were centrifuged at 10,800 × g for 12 min at 4 °C and stored at -70 °C until further utilization. Subsequent manipulations were carried out at 0-6 °C. 12 g of the frozen cell paste were resuspended in 150 ml of buffer A (25 mM Tris-HCl, pH 7.4, 1 mM EDTA, 3 mM beta -mercaptoethanol, 100 mM NaCl) added together with 3 mg of DNase I, and lysed with a French press. After centrifugation at 30,000 × g for 30 min, the supernatant was added stepwise for 30 min with ammonium sulfate at 55 and 85%. After centrifugation of the 85% ammonium sulfate extract, the pellet was resuspended in 12 ml of buffer A and dialyzed overnight against 5 liters of buffer A using a MWCO/2000 tubes (Spectrum Medical Industries). The dialyzed protein solution was applied to a 2-ml heparin-Sepharose CL-6B (Amersham Pharmacia Biotech) column equilibrated with buffer A. Bound protein was eluted with a 30-ml gradient of 0.1-1.5 M NaCl in buffer A. The fractions enriched in proteins with a molecular size within the range of 7 to 12 kDa (as judged by denaturing polyacrylamide gel electrophoresis) were diluted in buffer A and subsequently loaded on a 4-ml SP-Sepharose High Performance (Amersham Pharmacia Biotech) column equilibrated with buffer A. A 40-ml gradient of 0.1-1.5 M NaCl in buffer A was applied. Fractions enriched in proteins within the same size range given above were selected for further analysis. For identification of major proteins, the fractions of interest were run in a denaturing Tricine-sodium dodecyl sulfate-gel electrophoresis system (33) and blotted on a polyvinylidene difluoride membrane (Millipore). The membrane was stained with Coomassie Brilliant Blue R250, washed in water, and air-dried. The protein bands in the range of 9 kDa were excised from the membrane, and their N-terminal amino acids were determined through and automated Edman degradation microsequencing protocol (34). Protein concentrations were determined with the Protein Assay ESL (Roche Molecular Biochemicals), which is based on complexing Cu2+ ions by the protein to be measured in a reaction exclusively dependent on the number of peptide bonds.

In Vitro Monitoring of Nonspecific DNA Bending Activity-- The assay (35) is based on the site-specific recombination between so-called six sites brought about by the beta -recombinase encoded by plasmid pSM19035 of Streptococcus pyogenes as part of its replication mechanism (36). The 5.8-kb test plasmid pCB8 (36) contains two directly repeated target six sites separated by 2.2 kb. Reaction mixtures were set up in a volume of 25 µl containing 10 nM pCB8, 25 mM Tris-HCl, pH7.5, 50 mM NaCl, 10 mM MgCl2, and 50 nM of purified beta -recombinase. The materials tested for DNA bending included both crude extracts and protein fractions from P. putida as well as purified HupB and HupN proteins, which were added to the assays in amounts indicated in each case. Samples containing 50 nM of the chromatin-associated protein Hbsu from B. subtilis were also used as positive controls for the performance of the assay. After incubation for 30 min at 30 °C, the reaction was stopped by heating (70 °C, 10 min). The DNA was then digested in the same buffer with PstI and SalI, and the resulting fragments were analyzed by agarose-gel electrophoresis (37).

Separate Overproduction in P. putida of HupB and HupN and Purification of the Proteins-- To avoid cross-contamination between the HU proteins of P. putida and E. coli, we systematically used a P. putida host for overexpression of the HupB and HupN products. To this end, the hupN+ plasmid, pFBT16, was electroporated into the wild type strain P. putida KT2442, whereas the hupB+ plasmid pFBT18 was placed into a Delta hupN deletion mutant (see below). The purification procedure for HupB and HupN was carried out basically according to Ref. 31. Each of the expression strains were grown in 4-5 liters of LB medium (with 50 µg/ml kanamycin) at 30 °C with vigorous shaking to an A600 of 0.6-0.8. Following the addition of 1 mM isopropyl-beta -D-galactopyranoside, the cultures were further incubated for 3-4 h at the same temperature. 13-18 g of wet cell paste were harvested by centrifugation for 10 min in the cold at 16,300 × g. Cells resuspended in 3 ml of buffer A (see above)/gram of paste were lysed with a French press and cleared by centrifugation at 35,000 × g for 30 min. The proteins that precipitated within the 55-85% saturation range of ammonium sulfate were resuspended in 2 ml of buffer A/gram of cells and dialyzed extensively against buffer A. The resulting protein solution (35-40 ml) was loaded at a flow of 1 ml/min in a 5-ml heparin-Sepharose CL-6B (Amersham Pharmacia Biotech) column equilibrated with buffer A. After washing the column extensively with buffer A, an 80-ml gradient of 0.1-1.7 M NaCl in buffer A was applied to the column at the same 1 ml/min flow rate. 2-ml fractions were collected and analyzed in Tricine-SDS-PAGE (33). HupN eluted from the column within 0.55-0.75 M NaCl with a purity in the best fractions >= 95%, and thus no further purification was pursued. On the contrary, HupB eluted at 0.51-0.76 M NaCl, but the fractions were significantly contaminated with a few additional proteins. The HupB-containing fractions were therefore pooled and dialyzed overnight against buffer A, and 15 ml of the dialysate was loaded at a 1 ml/min rate on a 3-ml SP-Sepharose High Performance (Amersham Pharmacia Biotech) column equilibrated with buffer A. After washing the column with 3 ml of buffer A, a 60-ml gradient of 0.1-1.0 M NaCl was applied, also at 1 ml/min, to elute the protein. 1.5-ml fractions were collected and analyzed in Tricine-SDS-PAGE as before. The fractions corresponding to 0.3 M NaCl contained >95% pure HupB. Fractions containing either pure HupN or HupB were pooled separately, dialyzed against buffer A, and added with glycerol to a concentration of 44% (v/v). The preparations were stored at -20 °C and contained, respectively, 1.0 mg/ml (HupN) and 2.0 mg/ml (HupB).

Cross-linking of HupB and HupN-- The physical association between HupB and HupN monomers was examined through covalent binding of surface-exposed Lys residues on the polypeptides with suberic acid (disuccinimidyl suberate, Sigma). Stock solutions of suberic acid were prepared at a concentration of 10 mg/ml in dimethyl sulfoxide. A typical 100-µl cross-linking reaction contained 50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 10 mM MgCl2, 25 mM NaCl, 4 µM HupB or HupN, 0.2 mg/ml suberic acid, in 100 µl reaction volume. Control reactions were set up by replacing the HU proteins by 30 µg/ml lysozyme, which exists only as a monomer. To examine the formation of multimers in the presence of DNA the reactions were added where indicated with 200 nM pCB8 plasmid. One way or the other, mixtures were incubated for 15 min at room temperature and the reactions stopped with an excess (4 mM) of lysine. Samples were then dialyzed in Microcon-10 concentrators (Millipore) and examined in denaturing 15% polyacrylamide-Tricine-SDS gels (33).

Construction of a P. putida Ps-lacZ Reporter Strain-- A specialized P. putida strain bearing a transcriptional lacZ fusion to the HU-dependent Ps promoter of the TOL plasmid (38, 39) was generated as follows. The 2.4-kb HpaI fragment of plasmid pTK19 (T. Köhler, University of Geneva) containing the complete xylR gene and the Ps promoter was cloned into the SmaI site of the lacZ vector pUJ8 (40), thereby generating a Ps-lacZ fusion. Such a fusion was excised from the resulting plasmid as a 6.5-kb NotI fragment, which was cloned into the NotI site of a tellurite resistance pUT/mini-Tn5 delivery plasmid (41). The hybrid xylR+/Ps-lacZ mini-transposon generated thereby was integrated into the chromosome of P. putida KT2442 (described in detail in Ref. 42). One lac+ TelR P. putida exconjugant sensitive to piperacillin (43) and displaying a good beta -galactosidase induction upon cell exposure to benzylalcohol (44) was picked up as a reference strain to monitor the phenotypes of hupB and hupN mutants.

Construction of Delta hupB and Delta hupN Deletions in P. putida Ps-lacZ Strain-- To generate P. putida variants lacking either hupB or hupN, we entered directed deletions of each gene into the chromosome by homologous recombination. In the case of hupB, plasmid pFBT8 was used as the template to generate two PCR products with the pairs of primers PLKB1 (5'-GGAATTC(EcoRI)ACGTGCCGATGTGGCCATGACCGGCG-3')/PRKB2 (5'-TCAGGATCC(BamHI)TTAAGTATGTAATGAAAAGCTTATGAAACGTGTGC-3') and PLKB3(5'-TAAGGATC C(BamHI)TGACAAACCGGCAAGGCAATCAAGATCGAAGCC-3')/PRKB4 (5'-ACGTAAGCTT(HindIII)GCATCAGTTGACGGCGCTGCATGTCGGC-3'). The first product (456 bp) was digested with EcoRI + BamHI, whereas the second product (492 bp) was treated with BamHI + HindIII. The digested DNAs were purified and ligated together to vector pUC18Not (45) digested with EcoRI + HindIII (46). This originated a plasmid that had a NotI insert spanning the genomic DNA sequence starting at -474 bp and going to -36 bp upstream of the leading ATG of hupB, followed by an artificial BamHI site and followed by the sequence +189 downstream of the ATG to +386 after the stop codon of the structural gene. Such a NotI fragment thus contains a genomic deletion of 224 bp that engages the hupB sequence. The presence of two in-frame stop codons around the BamHI site employed to create the deletion ensured the loss of the entire HupB function. The 947-bp NotI fragment was then passed on to suicide delivery vector pKNG101 (47) (resulting in plasmid pKNG101Delta hupB) and recombined in the chromosome of P. putida Ps-lacZ as described (47). The chromosomal deletion was confirmed by PCR with primers PLKOB5 (5'-GCCATGCCTCCCAGCACACG-3') and PRKOB7 (5'-GCGTCCTGGCTATGAGTGGC-3'). A similar approach was used to produce a Delta hupN strain. In this case, genomic DNA was directly used to generate two PCR products with the pairs of primers PLKN1 (5'-GGAATTC(EcoRI)-TCGGCG CGCTGCAAAAGTTGC-3')/PRKN2 (5'-TCAGGATCC(BamHI)TTAATCAAA TTCGATGGTTATGCAGCGGACTACG-3') and PLKN3 (5'-TAAGGATC C(BamHI)TGAGACCAACTGATTGCCGACATCGCCGAATCG3')/ PRKN4 (5'-ACGTAAGCTT(HindIII)CCCGGGCAAGCCGGGCGCGGTTTCG-3'). The PCR products digested, respectively, with EcoRI + BamHI and BamHI HindIII were cloned simultaneously into pUC18Not treated with EcoRI + HindIII as before. The resulting 690-bp insert was then placed into the NotI site of pKNG101, yielding pKNG101Delta hupN, and was subsequently recombined into the chromosome of the P. putida strain. This produced a genomic deletion of a small 31-bp segment that eliminated the region between coordinates -17 to +14 in respect to the leading ATG codon of the gene. Such a deletion was confirmed with PCR using the primers PLKON5 (5'CGATAACGTCGTAGTCCGCTGC-3') and PRKON6 (5'-GTCAGCACTTTGGCT-GGAACGAAC-3').

Predictions of Evolutionary Distance among Homologous Proteins-- Protein sequence alignment were assembled with programs CLUSTAL  X (Version 1.63b (43)) and Protdist of PHYLIP (Phylogeny Inference Package, Version 3.5c (48)). The Swiss-Prot or GenBankTM accession codes for the proteins examined are the following: P05514 for HanA from Anabaena sp. PCC7120; P02347 for HRL18 from Agrobacterium tumefaciens; AF110185 for DbhB from Burkholderia pseudomallei; P02346 for HBst from Bacillus stearothermophilus; L25627 for HupB from Campylobacter jejuni; P02342 for HupA from E. coli; P02341 for HupB from E. coli; P43722 for HupA from Hemophilus influenzae; O25506 for HU from Helicobacter pylori J99; P05384 for HupB from Pseudomonas aeruginosa; AAF65565 for HupB from Pseudomonas fluorescens; AJ235270 for HupA from Rickettsia prowazekii; O06447 for HU from Streptomyces lividans; P52680 for HupA from Serratia marcescens; P52681 HupB from S. marcescens; P96045 for HU from Streptococcus thermophilus; P15148 for HupA from Salmonella typhimurium; P05515 for HupB from S. typhimurium; P73418 for HU from Synechocystis PCC6803; P36206 for HU from Thermotoga maritima; and P28080 for HupA from Vibrio proteolyticus. The sequence of the HupN protein from P. aeruginosa was deduced from the genomic data available at the www.pseudomonas.com site (49). The complete HupB and HupN sequences from P. putida were assembled with the assistance of the TIGR (The Institute for Genomic Research) genomic data bank. The GenBankTM accession numbers of the new HU proteins reported in this work are AF345628 (hupB of P. putida); AF345629 (hupN of P. putida), and AF345630 (hupN of P. aeruginosa).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Identification of Nonspecific DNA-bending Activities in Protein Extracts of P. putida-- To identify the proteins of P. putida with an ability to promote DNA bending in a sequence-independent fashion, we resorted to the in vitro test summarized in Fig. 1. The beta -recombinase encoded by plasmid pSM19035 (36) is able to catalyze DNA recombination between two directly oriented target sites (six sites) both in vivo and in vitro. However, this occurs only in the presence of native or heterologous factors that facilitate DNA bending in a nonspecific fashion. In Bacillus, such an activity is provided by the Hbsu protein (an HU homologue) but can be replaced by entirely heterologous factors such as mammalian or plant HMG B1-type proteins. This reaction can be followed easily with test plasmid pCB8, which contains two six sites in direct orientation and generates three DNA fragments (one of 4.8 kb and two of 0.5 kb each) when it is digested with PstI and SalI. Following beta  recombination in vitro the digestion of the resulting catenane with the same enzymes produces two additional fragments of 2.7 and 2.1 kb (Fig. 1A). With this assay in hand, we tested protein fractions from P. putida extracts retained in and eluted from heparin columns (thus enriched in DNA-binding proteins) and then fractionated in a second cation exchanger column. The result of such a fractionation, as analyzed in a Tricine-SDS-PAGE system, is shown in Fig. 1B. The fraction that eluted at 0.3 M NaCl from the SP-Sepharose column (lane 1 in Fig. 1B) maximally stimulated the beta -recombination reaction, to the point that a 100-fold dilution (~8 µg protein/ml) was as efficient as the positive control with 4.0 µg/ml of purified Hbsu (Fig. 1C). The addition of nondiluted fractions to the reaction mixtures led to significant a degradation of the test DNA, perhaps reflecting some contamination by the DNase added during the preparation of the extracts.


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 1.   Monitoring nonspecific DNA bending in protein extracts of P. putida. A, rationale of the beta -recombination assay. Intramolecular site-specific recombination between two six sites (square boxes) engineered in test plasmid pCB8 releases two separate circular closed circled DNA products that give rise to a new combination of restriction fragments upon digestion with SalI (S) and PstI (P). The reaction is catalyzed by the recombinase beta  and any factor (such as HU) able to cause nonspecific DNA bending. B, fractionation of P. putida proteins. Selected fractions eluting from the SP-Sepharose column by increasing salt concentrations were analyzed in a Tricine-SDS-PAGE system. Lane 1, 300 mM NaCl; lane 2, 380 mM; lane 3, 450 mM; lane 4, 530 mM; lane 5, 600 mM; lane 6, 680 mM; lane 7, 750 mM; lane 8, 830 mM; and lane 9, 900 mM. The protein bands subsequently subjected to N-terminal analysis are bracketed. The band marked in lane 1 is the HupB/HupN mixture, whereas the band labeled in lane 6 corresponds to a homologue of the 50 S ribosomal protein L35 from Pseudomonas syringae. C, stimulation of beta -promoted DNA recombination by protein fraction 1. Reactions were set up as explained under "Experimental Procedures," and the products of the in vitro recombination were analyzed with 0.8% agarose-gel electrophoresis. The size of the products in kb is indicated on the left. Lane M, molecular weight marker (HindIII-digested lambda  DNA); lane 1, positive control with 200 nM Hbsu; lane 2, negative control with no HU protein; lane 3, 200 nM Hbsu plus a 50-fold dillution of the SP-Sepharose fraction 1 (see protein gel above); lanes 4-9, increasing concentrations of the protein extract (lanes: 4, 1:2500; 5, 1:1000; 6, 1:500; 7, 1:250; 8, 1:100; 9, 1:5).

Categorizing of Proteins Candidate to Assist beta -Recombination-- For identification of the protein(s) in the extract described above that accounted for the most predominant polypeptide(s) of fraction 1 (~9 kDa, Fig. 1B), the gel was blotted and the band was subjected to N-terminal analyses as explained under "Experimental Procedures." The band turned out to be a non-equal mixture of two very similarly sized proteins. The most abundant polypeptide (two-thirds of the band) was led by the sequence MNKSELIDAIAASADIPKAVAGRALD. Searches in the Pseudomonas genomic data bases of the University of Queensland, the PathoGenesis Corporation, and TIGR, as well as in individually deposited gene sequences in the EMBL, revealed that the product had a maximum match with a P. aeruginosa gene previously named hupB, which was proposed to be the HU protein of this species (50). Such a gene has its counterpart in the genome of P. putida, and therefore we named this component of the active fraction HupB (Fig. 2).


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 2.   Nucleotide sequence of the hupB and hupN genes of P. putida and amino acid composition of their products. The N-terminal amino acids revealed by the Edman microsequencing analysis of the proteins of the major band of fraction 1 of the protein extract of Fig. 1B are underlined.

The second, less abundant protein (one-third of the band) yielded an N-terminal sequence ALTKDQLIADIXESIAAXXXTAKN (i.e., lacking a first Met residue). Such a sequence could be matched to single ORFs present in both the P. aeruginosa and P. putida genomes, although no specific function had been assigned to them. These ORFs give rise to 77% identical products in both species, with the highest similarity in the N-terminal half of the predicted proteins. Apart from the mutual likeness, the ORFs had a 50% similarity to the hupA gene of V. proteolyticus (51). In addition, it matched an HU-like gene identified by Nakazawa2 in P. putida mt-2 on the basis of complementation of an HU mutant of E. coli. We thus designed the second component of the beta -recombination active fraction as HupN, to differentiate it from the previously described HU-like genes. It should be noted, however, that the HupN and HupB proteins still possess 45% identical amino acids (Fig. 2). Whether or not the relative ratio between HupB and HupN found in the extract bears any meaning or is just the result of the extraction and procedure remains unclear, although it is evident that both products are very abundant polypeptides.

These results provided a basis for understanding the nonspecific DNA bending activity found in fraction 1, loaded in the gel of Fig. 1B. In fact, the HupB and HupN proteins became candidates, together or separately, for the HU homologue(s) of P. putida. Although the fractionation procedure employed did not rule out the possibility that other proteins with a similar activity might exist, it seems apparent that the bulk of proteins in the size range of typical nucleoid-associated factors included mostly these two products. To sort out these issues, we proceeded to the characterization in vitro and the genetic/phenotypic analysis in vivo of the roles of HupB and HupN in P. putida.

Purified HupB and HupN Are Competent in beta -Recombination Assays-- To assign unequivocally the DNA bending activity found in P. putida extracts to HupB, HupN, or a combination of the two, we proceeded to overexpress them in its native host and separately purify each of them with the method described under "Experimental Procedures" (Fig. 3A). To ensure the identity and quality of each of the purified polypeptides, the samples were separately subjected to an N-terminal analysis, which verified not only a purity >= 95% but also a complete absence of cross-contamination by other host nucleoid-associated proteins. Prior to running activity assays, the physical state of either protein was determined through in vitro cross-linking experiments with the lysine-specific agent suberic acid. As shown in Fig. 3B, both HupB and HupN predominantly formed dimers (lanes 4 and 7), although a small portion of each of the samples remained monomeric even after 15 min of treatment. Some tetrameric forms of HupN (but not of HupB) could be observed also, as well as two potential dimeric species, although their significance is unclear. The presence of DNA in the reaction did not enhance the formation of oligomeric forms of HupB (lane 5) or HupN (lane 8).


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 3.   Characterization of the HupB and HupN products of P. putida. A, protein purification. The gels show different stages of the purification of HupB and HupN as discussed in the text. For HupN: lane 1, whole cell extract; lane 2, whole cell extract of induced cells; lane 3, purest protein fractions (pooled) eluted from the heparin-Sepharose CL-6B. For HupB: lane 1, whole cell extract; lane 2, whole cell extract of induced cells; lane 3, clear extract of induced cells; lane 4, after ammonium sulfate fractionation; lane 5, purest fractions (pooled) from the heparin column; lane 6, purest fractions (pooled) from the SP-Sepharose column. B, auto-cross-linking of HupB and HupN. Purified proteins were subjected to the cross-linking protocol specified under "Experimental Procedures" using the Lys-specific agent disuccinimidyl suberate. Control lanes were loaded with similar amounts of nontreated lysozyme (lane 1), HupB (lane 3), or HupN (lane 6). Lanes 4 and 7 and 5 and 8 are samples treated for 15 min with suberate. Samples shown in lanes 5 and 8 also contained DNA. Sample 2 contained lysozyme treated with the same agent for 15 min. M, molecular size markers. The double band resulting from the cross-linking of HupN may reflect two different surfaces involved in the dimerization. C, stimulation of beta -promoted DNA recombination. Reactions were set up as explained under "Experimental Procedures," and the products of the in vitro recombination were analyzed with 0.8% agarose-gel electrophoresis. Lane M, molecular weight marker (HindIII-digested lambda  DNA); lane 1, positive control with 200 nM Hbsu; lane 2, negative control with no HU protein; lanes 3 and 8, 50 nM Hup protein indicated; lanes 4 and 9, 75 nM; lanes 5 and 10, 100 nM; lanes 6 and 11, 150 nM; lanes 7 and 12, 200 nM.

In a subsequent step, the activity of each protein was assayed in a beta -recombination assay in vitro using as a template the pCB8 plasmid as described above. As shown in Fig. 3C, both HupB and HupN provided the DNA bending activity required for the reaction, albeit at somewhat different degrees and qualities. Although HupB abruptly stimulated beta -recombination (100% efficiency) at 150 nM, HupN initiated the reaction at 75 nM, albeit at a lower efficiency. The reaction with HupN improved with increasing concentrations of the factor, to reach saturation (100% recombination) at 150 nM. These concentrations are in the range of other HU proteins tested in this type of assay (35). These results indicated that both HupB and HupN sufficed by themselves to bend DNA in a sequence-independent fashion, and therefore, they both contribute to providing this capacity to the active extract (Fig. 1C) and, presumably, to the cells in vivo as well (see below).

Functional Complementation of B. subtilis Hbsu by HupB or HupN-- The next step in the characterization of the HupB and HupN proteins was to examine their functionality in vivo in an entirely heterologous context. To this end, we took advantage of the fact that the whole requirement for nonspecific DNA bending functions in B. subtilis is met by the protein Hbsu protein (52), which is encoded by the hbs gene. This gene is in fact essential for cell viability (22), and knockout mutants do not exist. However, disabled Hbsu variants bearing amino acid substitutions F47W and R55A still allow cell growth, although the bacteria are deficient in DNA repair, homologous recombination, and site-specific recombination mediated by protein beta  (53). Such an allele thus provides a good assay system in vivo to examine the functional replacement of Hbsu by any other factors that supply the same activities. Although HupB and HupN of P. putida exhibit a respectable sequence similarity to Hbsu (53 and 43% respectively, not shown), the divergence is great enough to make the test more significant that a simple replacement of one HU variant by another. On this basis, both hupB and hupN were cloned separately in shuttle vector pHP13, and the resulting constructs were transformed into Bacillus strain BG405, which bears the mutated hbs gene (hbs-4755). To monitor functional complementation between Hbsu and the P. putida proteins, the transformants and their controls were then exposed to the DNA-damaging agent methyl methane sulfonate (10 mM), and the surviving cells were monitored as described previously (53). As shown in Fig. 4, the Hbsu- strain harboring vector pHP13 without any insert exhibited a high sensitivity to methyl methane sulfonate, whereas the wild type Bacillus strain was only marginally affected. But B. subtilis BG405 (hbs) transformed with either pHP13-hupB or pHP13-hupN was as resistant to methyl methane sulfonate exposure as the wild type and as the B. subtilis BG405 (pCB188) strain, the plasmid of which encodes the wild type hbs gene (see "Experimental Procedures"). These results indicated that both HupB and HupB can complement in full the loss of Hbsu in B. subtilis and strengthened the notion that each protein is capable by itself of meeting in vivo any physiological demand of generic DNA bending. In this respect, it is worth noticing that the HU-like hlpA gene of the plastid genome of the cryptomonad alga Chryptomonas Phi  was not as efficient as the P. putida hup genes in the same complementation assay (54).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4.   Complementation in vivo of the hbs deficiency in B. subtilis. Strain B. subtilis BG405, which bears an hbs allele producing an Hbsu protein with mutations F47W/R55A was transformed separately with pCB188 (wild type hbs+, open squares), pHP13 (vector, no insert, filled circles), pHP13-hupB (hupB+, open triangles), and pHP13-hupN (hupN+, filled rhomboids). Cells were grown as indicated (53), exposed to 10 mM methylmethane sulfonate (MMS), and its survival over time was monitored by plating and colony counting. The graph represents the cell viability of each strain following the treatment with the DNA-damaging agent. The control B. subtilis strain BG397 (open circles) bears in its chromosome the normal wild type hbs+ allele.

Phenotypes Endowed by Delta hupB and Delta hupN Deletions in P. putida-- To determine the functions of HupB and HupN, together and separately, in their native context in vivo, we produced deletion mutants of each gene through homologous recombination of DNA segments into the chromosome of P. putida Ps-lacZ. The replacement of DNA fragments between the delivery plasmid and the chromosome occurred at high frequencies (>= 10%). The changes in the corresponding genomic sites caused by each of the deletions are represented in Fig. 5. Single Delta hupB and Delta hupN mutants did not display any evident phenotype. They grew at the very same rate and yield that the wild type cells in a variety of rich and minimal media tested and were as resistant to UV radiation as the wild type (not shown). As a more specific test, we examined the effect of a lack of HupB or HupN on the activity of the sigma 54 promoter Ps of the TOL plasmid pWW0 of P. putida mt-2 (55). This promoter and its cognate activator, XylR, form part of an intricate regulatory system that controls the expression of a plasmid-encoded pathway for the biodegradation of toluene, m-xylene, and p-xylene (26). XylR belongs to the family of the prokaryotic enhancer-binding proteins that act in concert with the sigma 54-containing form of RNAP. The activation mechanism of Ps requires the looping out of the distant XylR·UAS complex to contact the sigma 54-RNAP bound downstream (56). This process involves the exacerbation of an intrinsically curved DNA sequence located between the bound XylR·UAS complex and the polymerase. When Ps and XylR are placed in E. coli, the promoter activity becomes dependent on the host HU protein (39); this probably reflects the need of a helper DNA bending factor to produce an optimal promoter geometry (39). To examine whether such a requirement is fulfilled in P. putida by either HupB or HupN, we monitored the activity of the chromosomal Ps-lacZ fusion born by the strain host to the deletions when induced with the XylR effector benzylalcohol. Fig. 6 shows the results of triplicate beta -galactosidase assays carried out with the hupB and hupN single-deletion mutants compared with the parental strain with no deletions. Although we could detect some minor changes in the mutants (more evident in the case of the Delta hupB strain), such variations did not exceed ~30% and could thus hardy be considered significant. Taken together, the data presented above suggested either that HupB and HupN are in fact redundant proteins, having the same functions in a variety of systems, or that yet another factor(s) may exist in P. putida that compensate the loss of each of them. This was ascertained with the assays in vivo shown below.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 5.   Organization of Delta hupB and Delta hupN chromosomal deletions. The diagrams show the DNA segments generated by PCR to create the deletions that were assembled in the delivery vector pKNG101, as well as the result of the double recombination event with the chromosome of P. putida. The location of primers PLKOB5, PRKOB7, PLKON5, and PRKON6 used to verify the deletions are indicated in their corresponding sites. The amplification products generated with the cognate oligonucleotides have the following sizes (in bp): wild type hupB, 704; Delta hupB, 451; wild type hupN, 320; Delta hupN, 299.


View larger version (47K):
[in this window]
[in a new window]
 
Fig. 6.   Effect of hupB and hupN deletions on the activity of the Ps promoter. The reporter strain P. putida Ps-lacZ (wild type (wt)) and its Delta hupB and Delta hupN derivatives were separately grown in mineral medium (44) at 30 °C up to an optical density (A600) of 0.8, at which point 5 mM benzyl alcohol was added. Cultures were grown for an additional 3 h, and the accumulation of beta -galactosidase was measured by the method of Miller (64). The organization of the reporter xylR/Ps-lacZ chromosomal insertion, engineered in a tellurite-resistant transposon vector and flanked by the I end (IE) and O end (OE) of Tn5, is sketched at the top of the figure.

HupB and HupN Provide Essential functions for P. putida-- Because the function(s) of HupB and HupN could only be hinted at ultimately by examining a double hupB/hupN mutant, we set out to produce a Delta hupB/Delta hupN strain. This was attempted through a sequential recombination of each of the deleted DNA segments into the chromosome of the target strain. Unfortunately, after screening more than 1000 clones, we failed to produce such a double mutant, regardless of the order in which each delivery vector was used (see "Experimental Procedures"). That recombination was not the problem was evidenced by the observation that double chromosomal deletions Delta hupB/Delta hupN could easily be generated if the delivery plasmid for the Delta hupN DNA segment was recombined in the Delta hupB strain that had been transformed with the hupB+ plasmid pFBT22. This gave us a clue that perhaps cells lacking both HupB and HupN were not viable. To test this notion, we set up the experiment shown in Fig. 7. In this assay, we employed the double-deleted Delta hupB/Delta hupN strain P. putida transformed with pFBT22 (hupB+). This plasmid bears as well a xylE+ insert (encoding catechol 2,3-dioxygenase), which allows an easy identification of plasmid-containing clones by spraying the plates with catechol. This turns the cells yellow because of the production of hydroxymuconic semialdehyde (57). As shown in Fig. 7, the growth of this strain for >100 generations in LB medium without any antibiotic (i.e. no external selection for pFBT22 maintenance) always produced 100% yellow colonies when spread with catechol. On the contrary, when the same plasmid was placed in the single deletion Delta hupB mutant, there was a progressive loss of pFBT22 when cells were grown in nonselective medium. One round of plating without kanamycin sufficed to caused the spontaneous loss of >= 80% of the plasmid in viable cells. As little as eight generations later, only <= 10% of cells bearing the single Delta hupB deletion maintained the hupB+ construct. The addition of 50 mg/ml kanamycin to the cultures ensured full plasmid retention under every condition tested (Fig. 7). These results suggested that plasmid pFBT22 could not be cured spontaneously from the hupB/hupN double-deletion mutant, because at least one of the two genes must be kept functional for viability.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 7.   Comparison of the loss of the hupB+/xylE+ plasmid pFBT22 from P. putida Delta hupB and Delta hupBDelta hupN. Cultures of strains P. putida Delta hupB (pFBT22) and P. putida Delta hupBDelta hupN (pFTB22) grown in the presence of kanamycin to ensure plasmid retention were used to inoculate fresh media with or without the antibiotic. Cultures were then plated on either selective or nonselective medium immediately or after eight generations. After overnight growth, the plates were sprayed with 1% catechol to reveal colonies carrying xylE gene and thus the pFBT22. The bars represent the percentage of plasmid-containing clones detected in each case. Solid bars, P. putida Delta hupB (pFBT22); hatched bars, P. putida Delta hupB Delta hupN (pFTB22).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

All of the results reported in this article support the idea that HupB and HupN are two distinct proteins, albeit structurally related, which are necessary and sufficient by themselves to provide essential factor-mediated but nonspecific DNA bending functions in P. putida. That no other factors can take over such a function is suggested by the nonviability of hupB/hupN double-deletion (Fig. 7) and, to a minor extent, by the virtual absence of any additional DNA bending activity in cell extracts (Fig. 1). The phylogenetic tree in Fig. 8 shows a prediction of the relationship between the HupB and HupN proteins from both pseudomonads and other eubacterial HU-like proteins. The most salient feature of such an analysis is that HupN clearly branches away from the HupA/HupB-type proteins of gamma -proteobacteria. In fact, it has been generally believed that the existence of two genes encoding HU proteins was exclusive to enteric bacteria (21). This view appeared to be true for P. aeruginosa, for which only one gene (hupB) and its corresponding gene product had been assigned to the HU function (50). The N-terminal sequence of the HU protein from P. aeruginosa was determined and found to be a HupB homodimer (58, 59). However, a hupN analogue very close to the P. putida gene does exist in the P. aeruginosa chromosome (49) but was detected neither biochemically nor genetically in this genus; whether this reflects a genuine lack of expression or a limitation of the techniques employed is uncertain. On the contrary, our results demonstrate unequivocally that both HupB and HupN are expressed and are perfectly active in P. putida.


View larger version (67K):
[in this window]
[in a new window]
 
Fig. 8.   Phylogenetic tree of selected HU proteins of eubacteria. The sequences belonging to the alpha -, beta -, gamma -, and epsilon -subgroup of the proteobacteria are marked with a gray background. The horizontal bar indicates the percent of sequence divergence (i.e. evolutionary distance). The proteins are labeled with trivial abbreviations designating their corresponding organisms: Ana-HanA, Anabaena sp.; Atu-Dbh1, A. tumefaciens; Bps-DbhB, B. pseudomallei; Bst-HBst, B. stearothermophilus; Cje-HupB, C. jejuni; Eco-HupA and Eco-HupB, E. coli; Hin-HupA, H. influenzae; Hpy-Hup, H. pylori; Pae-HupB and Pae-HupN, P. aeruginosa; Pfl-HupB, P. fluorescens; Ppu-HupB and Ppu-HupN, P. putida; Rpr-HupA, R. prowazekii; Sli-HU, S. lividans; Sma-HupA and Sma-HupB, S. marcescens; Sth-HU, S. thermophilus; Sty-HupA and Sty-HupB, S. typhimurium; Syn-HU, Synechocystis; Tma-HU, T. maritima; and Vpr-HupA, V. proteolyticus.

The presence of two genes for the HU function in some bacterial genera and only one in others is intriguing. Unlike the IHF protein, which necessarily requires the assembly of a heterodimer to function (60, 61), each of the two HU proteins (hupA and hupB) of E. coli seem to be able to function independently, although they do form functional heterodimers as well (15, 16). It has been claimed (15) that the subunit composition of HU from E. coli changes during growth and that this may reflect a certain specialization of the functions of each protein species. We cannot distinguish, however, any gross phenotypic differences between P. putida cells expressing either one of the Hup proteins or both of them. Although we did not examine the formation of heterodimers between the two proteins, it seems clear as well that each polypeptide fulfills by itself (i.e. homodimers, Fig. 3B) every function assigned to HU or HU-like proteins (Fig. 8), suggesting that if the formation of heterodimers between them does occur, it is irrelevant for cell physiology.

A second aspect of the redundancy of HU activities is that double hupA hupB mutants of E. coli (i.e. lacking any HU-related function) do exist that are viable. In our studies and those of others (17, 18), however, such mutants survive very poorly, develop multiple morphologies, and are quite unpredictable, surely because of the accumulation of compensatory mutations. Although it could be argued that such mutations may originate in a decrease of DNA-binding specificity of IHF that takes over some HU functions, the fact is that HU-/IHF- exist as well (62), an issue that deserves further studies. Under the conditions of the experiment shown in Fig. 7, which is short enough so as not to allow the overgrowth of bacteria bearing compensatory mutations, it is clear that the functionality of at least one HU protein is essential for gross viability in P. putida.

Although we could detect none but subtle differences in vivo and in vitro between HupB and HupN in the laboratory tests described in this article, we cannot rule out that small changes can make a difference when P. putida thrives in its natural habitats. Ecological fitness under the tougher environmental conditions that predominate in the polluted sites that P. putida colonizes depend to a large extent on an ability to integrate different environmental signals in the outcome of catabolic promoters (63). Such signals frequently involve DNA bending as a signal transmission mechanism (1, 2), and thus small differences in expression, like those shown in Fig. 6, may turn out to be significant. With the data at hand, however, the simplest explanation for the presence of two proteins fully competent in nonspecific DNA bending in some bacterial species (including P. putida) is that one simply acts as a backup for the other. The redundancy of HU factors in the same cell would thus reveal the evolutionary importance of such a function, not a specialization in a particular role in the physiology of the bacteria.

    ACKNOWLEDGEMENT

The authors are indebted to M. Kiess for N-terminal sequencing and to J. C. Alonso (Centro Nacional de Biotecnología, Madrid) for critical reading of the manuscript. Discussions with A. Oppenheim (Hebrew University, Jerusalem) contributed significantly to the outcome of this project.

    FOOTNOTES

* This work was supported by Contracts BIO4-CT97-2040 and QLRT-99-00041 from the European Commission and by Grants BIO98-0808 and DGCYT BMC2000-0548 from the Spanish Comisión Interministerial de Ciencia y Tecnología (CICYT).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF345628 (hupB of P. putida); AF345629 (hupN of P. putida), and AF345630 (hupN of P. aeruginosa).

|| Supported by the Fonds der Chemische Industrie.

§ Current address: Fresenius HemoCare Adsorber Technology GmbH, Frankfurter Str. 6-8, 66606 St. Wendel, Germany.

** To whom correspondence should be addressed: Dept. of Microbial Biotechnology, Centro Nacional de Biotecnología-CSIC, Campus de Cantoblanco, 28049 Madrid, Spain. Tel.: +34 91-585-4536; Fax: +34 91-585-4506; E-mail: vdlorenzo@cnb.uam.es.

Published, JBC Papers in Press, February 13, 2001, DOI 10.1074/jbc.M011295200

2 T. Nakazawa, personal communication.

    ABBREVIATIONS

The abbreviations used are: IHF, integration host factor; bp, base pair(s); kb, kilobase pair(s); TOL, toluene degradation plasmid; PCR, polymerase chain reaction; ORF, open reading frame; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine; PAGE, polyacrylamide gel electrophoresis.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Perez-Martin, J., Rojo, F., and de Lorenzo, V. (1994) Microbiol. Rev. 58, 268-290
2. Perez-Martin, J., and de Lorenzo, V. (1997) Annu. Rev. Microbiol. 51, 593-628
3. Drlica, K., and Rouvière-Yaniv, J. (1987) Microbiol. Rev. 51, 301-319
4. Pettijohn, D. E. (1996) in Escherichia coli and Salmonella: Cellular and Molecular Biology (Neidhardt, F. C. , Curtis, R., III , Ingraham, J. L. , Lin, E. C. C. , Low, K. B. , Magasanik, B. , Reznikoff, W. S. , Riley, M. , Schaechter, M. , and Umbarger, H. E., eds), 2nd Ed., Vol. 1 , pp. 158-166, American Society for Microbiology, Washington, D. C.
5. Pettijohn, D. E. (1988) J. Biol. Chem. 263, 12793-12796
6. Schmidt, M. B. (1988) Trends Biochem. Sci. 13, 131-135
7. Azam, T. A., and Ishihama, A. (1999) J. Biol. Chem. 274, 33105-33113
8. Kano, Y., Yoshino, S., Wada, M., Yokoyama, K., Nobuhara, M., and Imamoto, F. (1985) Mol. Gen. Genet. 201, 360-362
9. Kano, Y., Wada, M., Nagase, T., and Imamoto, F. (1986) Gene 45, 37-44
10. Kano, Y., Osato, K., Wada, M., and Imamoto, F. (1987) Mol. Gen. Genet. 209, 408-410
11. Kano, Y., Wada, M., and Imamoto, F. (1988) Gene 69, 331-335
12. Craig, N. L., and Nash, H. A. (1984) Cell 39, 707-716
13. Goodrich, J. A., Schwartz, M. L., and McClure, W. R. (1990) Nucleic Acids Res. 18, 4993-5000
14. Rouviere-Yaniv, J., and Kjeldgaard, N. O. (1979) FEBS Lett. 106, 297-300
15. Claret, L., and Rouviere-Yaniv, J. (1997) J. Mol. Biol. 273, 93-104
16. Pinson, V., Takahashi, M., and Rouviere-Yaniv, J. (1999) J. Mol. Biol. 287, 485-497
17. Wada, M., Kano, Y., Ogawa, T., Okazaki, T., and Imamoto, F. (1988) J. Mol. Biol. 204, 581-591
18. Huisman, O., Faelen, M., Girard, D., Jaffe, A., Toussaint, A., and Rouviere-Yaniv, J. (1989) J. Bacteriol. 171, 3704-3712
19. Boubrik, F., and Rouvière-Yaniv, J. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 3958-3962
20. Li, S., and Waters, R. (1998) J. Bacteriol. 180, 3750-3756
21. Oberto, J., and Rouviere-Yaniv, J. (1996) J. Bacteriol. 178, 293-297
22. Micka, B., and Marahiel, M. A. (1992) Biochimie (Paris) 74, 641-650
23. Chaudhry, G. R., and Chapalamadugu, S. (1991) Microbiol. Rev. 55, 59-79
24. Williams, P. A., and Sayers, J. R. (1994) Biodegradation 5, 195-217
25. Shingler, V., Bartilson, M., and Moore, T. (1993) J. Bacteriol. 175, 1596-1604
26. Ramos, J. L., Marques, S., and Timmis, K. N. (1997) Annu. Rev. Microbiol. 51, 341-373
27. Haima, P., Bron, S., and Venema, G. (1987) Mol. Gen. Genet. 209, 335-342
28. De Lorenzo, V., Eltis, L., Kessler, B., and Timmis, K. N. (1993) Gene 123, 17-24
29. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
30. Stein, D. C. (1992) Gene 117, 157-158
31. Padas, P. M., Wilson, K. S., and Vorgias, C. E. (1992) Gene 117, 39-44
32. Franklin, F. C. H., Bagdasarian, M., Bagdasarian, M. M., and Timmis, K. N. (1981) Proc. Natl. Acad. Sci. U. S. A. 78, 7458-7462
33. Schägger, H., and von Jagow, G. (1987) Anal. Biochem. 166, 368-379
34. Maiorino, M., Roche, C., Kiess, M., Koenig, K., Gawlik, D., Matthes, M., Naldini, E., Pierce, R., and Flohe, L. (1996) Eur. J. Biochem. 238, 838-844
35. Alonso, J. C., Weise, F., and Rojo, F. (1995) J. Biol. Chem. 270, 2938-2945
36. Rojo, F., and Alonso, J. C. (1994) J. Mol. Biol. 238, 159-172
37. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (eds) (1989) Current Protocols in Molecular Biology , John Wiley and Sons, Inc., New York
38. Abril, M. A., Michan, C., Timmis, K. N., and Ramos, J. L. (1989) J. Bacteriol. 171, 6782-6790
39. Perez-Martin, J., and de Lorenzo, V. (1995) J. Bacteriol. 177, 3758-3763
40. De Lorenzo, V., Herrero, M., Jakubzik, U., and Timmis, K. N. (1990) J. Bacteriol. 172, 6568-6572
41. Sanchez-Romero, J. M., Diaz-Orejas, R., and De Lorenzo, V. (1998) Appl. Environ. Microbiol. 64, 4040-4046
42. De Lorenzo, V., and Timmis, K. N. (1994) Methods Enzymol. 235, 386-405
43. Fernández, S., de Lorenzo, V., and Pérez-Martín, J. (1995) Mol. Microbiol. 16, 205-213
44. Holtel, A., Marques, S., Möhler, I., Jakubzik, U., and Timmis, K. N. (1994) J. Bacteriol. 176, 1773-1776
45. Herrero, M., de Lorenzo, V., and Timmis, K. N. (1990) J. Bacteriol. 172, 6557-6567
46. de Lorenzo, V., Herrero, M., Sánchez, J. M., and Timmis, K. N. (1998) FEMS Microbiol. Ecol. 27, 211-224
47. Kaniga, K., Delor, I., and Cornelis, G. R. (1991) Gene 109, 137-141
48. Felsenstein, J. (1985) Evolution 39, 783-791
49. Stover, C. K., Pham, X. Q., Erwin, A. L., Mizoguchi, S. D., Warrener, P., Hickey, M. J., Brinkman, F. S. L., Hufnagle, W. O., Kowalik, D. J., Lagrou, M., Garber, R. L., Goltry, L., Tolentino, E., Westbrock-Wadman, S., Yuan, Y., Brody, L. L., Coulter, S. N., Folger, K. R., Kas, A., Larbig, K., Lim, R., Smith, K., Spencer, D., Wong, G. K.-S., Wu, Z., Paulsen, I. T., Reizer, J., Saier, M. H., Hancock, R. E. W., Lory, S., and Olson, M. V. (2000) Nature 406, 959-964
50. Delic-Attree, I., Toussaint, B., and Vignais, P. M. (1995) Gene 154, 61-64
51. Giladi, H., Wang, W. X., and Oppenheim, A. B. (1992) Nucleic Acids Res. 20, 4092
52. Micka, B., Groch, N., Heinemann, U., and Marahiel, M. A. (1991) J. Bacteriol. 173, 3191-3198
53. Fernandez, S., Rojo, F., and Alonso, J. C. (1997) Mol. Microbiol. 23, 1169-1179
54. Grasser, K. D., Ritt, C., Krieg, M., Fernandez, S., Alonso, J. C., and Grimm, R. (1997) Eur. J. Biochem. 249, 70-76
55. Assinder, S. J., and Williams, P. A. (1990) Adv. Microb. Physiol. 31, 1-69
56. Su, W., Porter, S., Kustu, S., and Echols, H. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5504-5508
57. Murray, K., and Williams, P. A. (1974) J. Bacteriol. 117, 1153-1157
58. Hawkins, A. R., and Wootton, J. C. (1981) FEBS Lett. 130, 275-278
59. Toussaint, B., Delic-Attree, I., and Vignais, P. M. (1993) Biochem. Biophys. Res. Commun. 196, 416-421
60. Nash, H. A., and Robertson, C. A. (1981) J. Biol. Chem. 256, 9246-9253
61. Nash, H. A., Robertson, C. A., Flamm, E., Weisberg, R. A., and Miller, H. I. (1987) J. Bacteriol. 169, 4124-4127
62. Mendelson, I., Gottesman, M., and Oppenheim, A. B. (1991) J. Bacteriol. 173, 1670-1676
63. Cases, I., and de Lorenzo, V. (2001) EMBO J. 20, 1-11
64. Miller, J. H. (1972) Experiments in Molecular Genetics , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.


This article has been cited by other articles: