|
Originally published In Press as doi:10.1074/jbc.M008048200 on February 26, 2001
J. Biol. Chem., Vol. 276, Issue 20, 16952-16959, May 18, 2001
Regulation of von Willebrand Factor Binding to the Platelet
Glycoprotein Ib-IX by a Membrane Skeleton-dependent
Inside-out Signal*
Graham D.
Englund §,
Richard J.
Bodnar §,
Zhenyu
Li ,
Zaverio M.
Ruggeri¶, and
Xiaoping
Du
From the Department of Pharmacology, University of
Illinois, College of Medicine, Chicago, Illinois 60612 and the
¶ Departments of Molecular and Experimental Medicine and of
Vascular Biology, The Scripps Research Institute,
La Jolla, California 92037
Received for publication, September 1, 2000, and in revised form, February 16, 2001
 |
ABSTRACT |
The platelet receptor for von Willebrand factor
(vWF), glycoprotein Ib-IX (GPIb-IX), mediates initial platelet adhesion
and activation. We show here that the receptor function of GPIb-IX is
regulated intracellularly via its link to the filamin-associated membrane skeleton. Deletion of the filamin binding site in GPIb markedly enhances ristocetin- (or botrocetin)-induced vWF binding and
allows GPIb-IX-expressing cells to adhere to immobilized vWF under both
static and flow conditions. Cytochalasin D (CD) that depolymerizes
actin also enhances vWF binding to wild type GPIb-IX. Thus, vWF binding
to GPIb-IX is negatively regulated by the filamin-associated membrane
skeleton. In contrast to native vWF, binding of the isolated recombinant vWF A1 domain to wild type and filamin binding-deficient mutants of GPIb-IX is comparable, suggesting that the membrane skeleton-associated GPIb-IX is in a state that prevents access to the
A1 domain in macromolecular vWF. In platelets, there is a balance of
membrane skeleton-associated and free forms of GPIb-IX. Treatment of
platelets with CD increases the free form and enhances vWF binding. CD
also reverses the inhibitory effects of prostaglandin E1 on vWF binding
to GPIb-IX. Thus, GPIb-IX-dependent platelet adhesion is doubly
controlled by vWF conformation and a membrane skeleton-dependent inside-out signal.
 |
INTRODUCTION |
Platelet adhesion plays a critical role in thrombosis and
hemostasis. Under the influence of shear forces created by blood flow,
initial platelet adhesion is dependent on the interaction between a
platelet receptor for von Willebrand factor
(vWF),1 the glycoprotein
Ib-IX complex (GPIb-IX), and matrix-bound vWF (1-5). GPIb-IX consists
of three subunits: GPIb , GPIb , and GPIX. GPIb-IX is associated
with glycoprotein V. The N-terminal domain of GPIb contains binding
sites for vWF and -thrombin (for reviews, see Refs. 6 and 7). The
cytoplasmic domain of GPIb contains a binding site for filamin (also
called actin-binding protein or ABP-280), which links GPIb-IX to
cross-linked actin filamental structures underlining the plasma
membrane (the membrane skeleton) (8, 9). An intracellular signaling
molecule, 14-3-3 , is associated with GPIb-IX (10), and a
phosphorylation-dependent binding site for 14-3-3 is
located at the C terminus of GPIb (11, 12), distinct from the
binding site for filamin, which is located between residues 536-568
(13).
In the normal circulation, GPIb-IX does not interact with soluble vWF.
At sites of vascular injury, the interaction between platelet GPIb-IX
and vWF occurs when GPIb-IX is exposed to subendothelium-bound vWF.
Interaction of vWF with the subendothelium is thought to induce a
conformational change in vWF (14) and thus allow GPIb-IX binding (for
reviews, see Refs. 6, 7, and 15). In vitro, the change in
vWF can be mimicked by surface immobilization of vWF (16), or by the
binding of vWF modulators such as ristocetin and botrocetin (17-22).
In this study, we found that vWF binding to GPIb-IX is also regulated
by changes in the cytoskeletal association of GPIb-IX. GPIb-IX
molecules that are associated with the filamin-linked membrane skeleton
are in a "resting" state that inhibits vWF binding function.
Dissociation of GPIb-IX from the membrane skeleton or disruption of the
membrane skeleton activates vWF binding to GPIb-IX by increasing the
accessibility of the binding site in GPIb . Thus,
GPIb-IX-dependent platelet adhesion and activation is
likely to be dynamically controlled by a 2-fold regulatory mechanism: exposure of vWF bound to the subendothelial matrix and a membrane skeleton-dependent inside-out signal.
 |
EXPERIMENTAL PROCEDURES |
Reagents--
Botrocetin and monoclonal antibodies AK2
and WM23 against GPIb were kindly provided by Dr. Michael Berndt
(Baker Medical Institute, Melbourne, Australia) (19). Human vWF was
either kindly provided by Dr. Michael Berndt or purified from
cryoprecipitates using the method described previously (23).
Recombinant A1 domain fragment of vWF has been described previously
(22). The monoclonal antibody against GPIb , LJ-P3 (24), and
monoclonal antibody against A1 domain of vWF, NMC-4 (25), have been
previously described. Monoclonal antibodies, SZ29 against vWF (26) and
SZ2 against GPIb (27), were generous gifts from Dr. Changgeng Ruan
(Suzhou Medical College, Suzhou, China); cDNA clones encoding wild
type GPIb , GPIb , and GPIX were kindly provided by Dr. Jose Lopez (28-30).
Cell Lines Expressing Recombinant Proteins--
Transfection of
cDNA into Chinese hamster ovary (CHO) cells were performed
according to the previously described methods using LipofectAMINE (Life
Technologies, Inc.) (31). Stably transfected cell lines were selected
using selection media containing 0.5 mg/ml G418 and/or 0.2 mg/ml
hygromycin and further selected by cell sorting using antibodies
recognizing GPIb . The following cell lines were used: cells
expressing wild type GPIb-IX complex (1b9); cells expressing GPIb-IX
mutants with truncated GPIb cytoplasmic domains at residues 591 ( 591), 559 ( 559), and 551 ( 551); cells expressing GPIb-IX
containing a filamin binding-deficient mutant of GPIb with deletion
between residues 551 and 570 in the cytoplasmic domain ( 551-570);
cells co-expressing GPIb-IX and IIb 3 (123 cells); and cells co-expressing integrin
IIb 3 and GPIb-IX mutants 591
( 591/2b3a) and 559 ( 559/2b3a) (11, 31, 32). For construction
of GPIb mutants 551 and 551-570, DNA fragments were
synthesized by PCR using wild type GPIb cDNA (in PGEM3Z(+) vector) as a template, oligonucleotides
ACAGTGCCCCGGGCCTGACTGCTCTT ( 551) and
GTGCCCCGGGTACGGCCTAATGGCCGT ( 551-570) as forward primers, and
TTGGATCCTTCTCTCAAGGTCCCCAAAC as the reverse primer. These fragments were digested with SmaI and BamHI and
then ligated with GPIb cDNA in pcDNA3.1( ) vector digested
with the same enzymes. Cells expressing comparable levels of GPIb-IX
and/or integrin were selected by cell sorting and monitored by flow cytometry.
Flow Cytometry Analysis of vWF Binding to GPIb-IX-expressing
Cells and Platelets--
CHO cells expressing wild type and mutant
GPIb-IX were detached from the tissue culture plates using 0.5 mM EDTA in phosphate-buffered saline (PBS) solution, pH
7.4. The cells were then either resuspended in PBS containing 1%
bovine serum albumin or in modified Tyrode's buffer (2.5 × 106/ml). Cell suspensions were incubated with ristocetin
(1.25 mg/ml) and purified human vWF (20 µg/ml) at 22 °C for 30 min
and washed once. In some experiments, botrocetin (2 µg/ml) was used
to replace ristocetin. The cells were further incubated in Tyrode's
buffer or PBS containing 1% bovine serum albumin and 10 µg/ml
FITC-labeled monoclonal antibody SZ29 directed against vWF in the dark
at 22 °C for 30 min and then analyzed by flow cytometry. As negative controls, the cells were either incubated with vWF in the absence of
ristocetin or incubated with ristocetin in the absence of vWF and then
incubated with FITC-labeled SZ29. Nonspecific fluorescence intensity
detected from either treatment was identical (not shown), indicating
that SZ29 specifically detects ristocetin-dependent vWF
binding. Binding of the recombinant A1 domain fragment of vWF
was similarly detected using a fluorescently labeled anti-A1 domain
monoclonal antibody, NMC-4.
The preparation of washed platelets was described previously (33, 34).
The washed platelets were resuspended in the modified Tyrode's
solution. Resting washed platelets were treated with various
concentrations of cytochalasin D and/or PGE1. Me2SO was used as a control for cytochalasin D, 70% ethanol was used as a
control for PGE1. After adding botrocetin (2 µg/ml) and 1 mM RGDS (an integrin inhibitor), platelets were incubated
with or without vWF for 30 min at room temperature. Detection of vWF
binding was performed as described above.
Static Cell Adhesion Assay--
Microtiter wells were coated
with 10 µg/ml vWF in PBS at 4 °C overnight. Cells in modified
Tyrode's solution were incubated in ligand-coated microtiter wells for
30 min at 37 °C. After three washes, 50 µl of 0.3%
p-nitrophenyl phosphate in 1% Triton X-100, 50 mM sodium acetate, pH 5.0, were added to microtiter wells
and incubated at 37 °C for 1 h. The reaction was stopped by
adding 50 µl of 1 M NaOH. Results were determined by
reading optical density (OD) at 405-nm wave length. The standard curve
of acid phosphatase reaction was established by adding the acid
phosphatase substrate to various known numbers of the same cells in
parallel wells. The acid phosphatase assay of the standards indicates
that OD value is proportional to cell numbers. The rate of cell
adhesion was estimated by the ratio of the number of adherent cells to number of total cells.
Cell Adhesion under Flow--
CHO cells expressing human
platelet receptors (0.5 or 1 × 107/ml) were added to
a reconstituted suspension of platelet-depleted human red cells in
divalent cation-free Hepes-Tyrode buffer (10 mM Hepes, 140 mM NaCl, 2.7 mM KCl, 0.4 mM
NaH2PO4, 10 mM NaHCO3, and 5 mM dextrose), pH 7.4, containing 5% bovine serum
albumin with a normal hematocrit value (40%), as previously described (22). Cell interaction with immobilized vWF under flow conditions was
observed in real time by means of epifluorescence videomicroscopy in a
modified Hele-Shaw flow chamber (35), as described previously (4).
Purified human vWF was diluted to a final concentration of 20 µg/ml
with 2 mM ammonium acetate, pH 7.0, and 200 µl of the
protein solution was spread evenly onto a glass coverslip (No. 1, 24 × 50 mm; Corning) that was then incubated in a humid environment at 22 °C for 1 h. After rinsing, the protein-coated surface of the glass coverslip was assembled as the bottom of the flow chamber, and a flow path height of 125 µm was determined by
a silicon rubber gasket. The entire flow path of the chamber, mounted
on the stage of an inverted epifluorescence microscope (Axiovert 135M,
Carl Zeiss Inc.), was kept at 37 °C with a thermostatic air bath.
Heterologous cells were visualized by adding mepacrine (quinacrine
dihydrochloride; 10 µM, final concentration) or
hydroethitine. Reconstituted blood, considered to have the same
viscosity of 4 centipoise as native blood, was aspirated through
the chamber by a syringe pump (Harvard Apparatus Inc.) for the desired
time, and all experiments were continuously recorded on videotape using a video cassette recorder (model 9500, Sony). The number of individual cells interacting at any given time with immobilized native vWF was
measured on images obtained at different positions in the flow path of
the chamber, corresponding to selected wall shear rates.
Sedimentation Analysis of GPIb-IX Distribution--
Washed
platelets (1 × 109/ml) resuspended in modified
Tyrode's solution were incubated with or without 10 µM
cytochalasin D for 10 min at 22 °C and then solubilized by adding an
equal volume of solubilization buffer (0.1 M Tris, 0.01 M EGTA, 0.15 M sodium chloride, and 2% Triton
X-100, pH 7.4) containing 0.2 mM E64 (Sigma) and 1 mM phenylmethylsulfonyl fluoride. The lysates were
centrifuged at 15,000 × g for 4 min and then
100,000 × g for 3 h at 4 °C to precipitate the
Triton X-100-insoluble cytoskeleton-associated proteins. For CHO cells,
the cells were detached from the tissue culture plate with 0.5 mM EDTA in PBS and resuspended in Tyrode's solution. The
cell suspensions were solubilized by adding the above described
solubilization buffer containing 20 mM benzamidine, 0.5 mg/ml leupeptin, 0.3 units/ml aprotinin, 2 mM
phenylmethylsulfonyl fluoride, 0.4 mM E64, and 2 mM calpain inhibitor I. After centrifugation at 2,000 × g for 5 min, the cell lysates were centrifuged at
100,000 × g for 3 h at 4 °C to precipitate the
cytoskeleton-associated proteins. The insoluble pellets and
supernatants were dissolved in SDS-sample buffer (0.075 M
Tris, pH 6.8, 12.5% (v/v) glycerol, 2.5% SDS, and 0.002% bromphenol
blue) to equal volumes and analyzed by SDS-polyacrylamide gel
electrophoresis followed by Western blotting with a monoclonal
antibody, SZ2 or WM23 (5 µg/ml), against GPIb .
 |
RESULTS |
GPIb-IX Mutants with Deletions in the Cytoplasmic Domain of
GPIb --
To examine the roles of the GPIb cytoplasmic domain in
regulating the receptor function of GPIb-IX, wild type GPIb or
cytoplasmic domain deletion mutants of GPIb were coexpressed in CHO
cells with GPIb and GPIX as previously described (11, 31). The mutants 559 and 551 lack the C-terminal residues 560-610 and 552-610, respectively, and thus lack the binding sites for filamin and
14-3-3 (11, 32). Both 559 (Fig. 1) and
551 (not shown) are not associated with the Triton X-100-insoluble
membrane skeleton and do not bind 14-3-3 (11). The mutant 591 lacks
the binding sites for 14-3-3 but retains the filamin binding site and
has been previously shown to bind to the membrane skeleton but not 14-3-3 (11, 32). The mutant 551-570 lacks a critical region in the
filamin binding site (32) and thus is not associated with the Triton
X-100-insoluble membrane skeleton (Fig. 1). This mutant, however,
retains a functional 14-3-3 binding site (Fig. 1).

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 1.
Deletion mutants of GPIb-IX.
A, a schematic depicting various cytoplasmic domain deletion
mutants of GPIb . B, CHO cells expressing wild type
GPIb-IX (1b9). Cells expressing the deletion mutants 559 or
551-570 were solubilized as described under "Experimental
Procedures." The Triton X-100-soluble (S) and insoluble
(P) proteins were separated by ultracentrifugation at
100,000 × g and then immunoblotted with a monoclonal
anti-GPIb antibody, WM23. Note that wild type GPIb-IX is associated
with Triton X-100-insoluble fraction, but the 559 and 551-570
were Triton X-100-soluble. C, mutant 551-570 was
solubilized and incubated with 14-3-3-conjugated beads as previously
described (34). The bead-bound GPIb-IX was detected by immunoblotting
with anti-GPIb monoclonal antibody SZ-2. The binding of wild type
and other mutants of GPIb-IX to 14-3-3 has been previously described
(11).
|
|
Regulation of vWF Binding to GPIb-IX by the Filamin-associated
Membrane Skeleton--
Wild type and the 559 mutant GPIb-IX
expressed in CHO cells were allowed to bind soluble vWF in the presence
of a vWF modulator, ristocetin, which is known to mimic the effect of
subendothelial matrix to induce vWF binding to GPIb-IX.
Ristocetin-induced binding of vWF to cells expressing wild type GPIb-IX
(1b9 cells) is detectable but very low (Fig.
2A). In contrast,
ristocetin-induced vWF binding to 559 mutant cells is about 10 times
higher than to 1b9 cells (Fig. 2A). The difference in vWF
binding to 1b9 cells and 559 cells is not due to a difference in the
expression levels of GPIb-IX, since expression levels had been adjusted
to comparable levels by cell sorting using anti-GPIb monoclonal
antibodies (Fig. 2B). A different truncation mutant, 551
(deleting residues 552-610), similarly had an enhanced vWF binding
(not shown). These data indicate that only a small percentage of wild
type GPIb-IX binds to vWF, and deletion of the filamin and 14-3-3 binding sites of GPIb enhances vWF binding function of GPIb-IX.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 2.
Effects of GPIb
cytoplasmic domain deletion on vWF binding function of
GPIb-IX. A, CHO cells expressing wild type GPIb-IX
(1b9) or cells expressing the deletion mutant 559 (lacking
C-terminal residues 559-610) were incubated at 22 °C in the
presence of 1.25 mg/ml ristocetin and increasing concentrations of
purified vWF for 30 min. The bound vWF was detected by flow cytometry
analysis of the binding of FITC-labeled monoclonal antibody against
human vWF, SZ29, as described under "Experimental Procedures." The
fluorescence intensity (geomean) of vWF binding was corrected by the
ratio of GPIb-IX levels between two cell lines (1b9/ 559 = 1/1.18) as determined in B. B, cells expressing
wild type GPIb-IX (1b9) and the 559 mutant were incubated with 20 µg/ml of anti-GPIb monoclonal antibody SZ2 and then FITC-labeled
goat-anti-mouse IgG to detect surface-expressed GPIb-IX levels.
|
|
Although the 559 mutant lacks both the filamin and 14-3-3 binding
sites in the cytoplasmic domain of GPIb , the increase in vWF binding
to 559 is unlikely to be caused by the lack of 14-3-3 binding site,
since cells expressing the mutant 591, lacking the GPIb
C-terminal 14-3-3 binding sites (residues 591-610) but retaining the
filamin binding site, showed no dramatic increase in vWF binding
compared with wild type GPIb-IX (Fig.
3A). Furthermore, cells
expressing a GPIb deletion mutant 551-570, lacking the residues
required for filamin binding but retaining a functional 14-3-3 binding
site, showed a significantly enhanced vWF binding (Fig. 3B).
Thus, a lack of the filamin binding site of GPIb is responsible for
the enhanced vWF binding function.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 3.
The 14-3-3 binding site in
GPIb is not responsible for regulating vWF
binding function. A, cells expressing wild type GPIb-IX
(WT), mutant 591 (lacking 14-3-3 binding site but
retaining a functional filamin binding site), and mutant 559 were
allowed to incubate with or without 10 µg/ml vWF in the presence of
ristocetin (1.25 mg/ml). Binding of vWF was then detected by flow
cytometry analysis of the binding of FITC-labeled SZ29. The cells were
also incubated with 20 µg/ml anti-GPIb monoclonal antibody SZ2 and
then FITC-labeled goat anti-mouse IgG to detect surface-expressed
GPIb-IX levels. B, CHO cells expressing wild type GPIb-IX
(WT) or mutant 551-570 (lacking the filamin binding site but
retaining a functional 14-3-3 binding site) were allowed to bind to vWF
as described for A. Expression levels of GPIb-IX were also
examined as described for A.
|
|
To exclude the possibility that deletion mutation of GPIb caused a
conformational change unrelated to GPIb-IX association with the
filamin-linked membrane skeleton actin filaments, cells expressing wild
type GPIb-IX were treated with cytochalasin D to disrupt actin
filamental structures. This treatment induces a significant increase in
vWF binding to GPIb-IX (Fig. 4). Taken together, these data indicate that either disruption of filamin interaction with the cytoplasmic domain of GPIb or disruption of
actin filamental structure enhances vWF binding function of GPIb-IX.
Thus, vWF binding to GPIb-IX is negatively regulated by the
filamin-linked membrane skeleton.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 4.
Cytochalasin D enhances vWF binding to wild
type GPIb-IX in CHO cells. CHO cells expressing wild type GPIb-IX
were incubated with 1 µM cytochalasin D (CD)
or Me2SO vehicle (DMSO) for 5 min. vWF binding
to these cells was then determined as described in the legend to Fig.
2. Note the increased vWF binding following cytochalasin D
treatment.
|
|
Binding of Wild Type and Mutant GPIb-IX to Recombinant A1 Domain of
vWF--
It is known that the GPIb binding site in vWF is located in
the A1 domain (36-38). Thus, it is possible that the inability of a
majority of the wild type GPIb-IX molecules to bind vWF either results
from a lack of A1 domain recognition by the wild type GPIb-IX or from a
negative regulation that reduces the accessibility of the A1 domain in
vWF macromolecules to the binding sites in GPIb-IX. To differentiate
these possibilities, we examined ristocetin-induced (Fig.
5) or botrocetin-induced (not shown)
GPIb-IX binding to a small recombinant A1 domain fragment of vWF
containing the GPIb-IX binding site (residues 445-733) (22). Similar
results were obtained either with ristocetin or botrocetin as an
inducer. While the binding of the purified native vWF to wild type
GPIb-IX is significantly lower than vWF binding to 559 mutant cells,
the small recombinant A1 domain fragment of vWF showed comparable
binding to wild type GPIb-IX and 559 mutant (Fig. 5). Thus,
association of GPIb-IX with the membrane skeleton negatively regulates
the accessibility of the A1 domain in native vWF macromolecules to its
binding site in GPIb .

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 5.
Binding of recombinant A1 domain fragment of
vWF to wild type and a deletion mutant of GPIb-IX. CHO cells
expressing wild type (WT) or 559 mutant GPIb-IX were
incubated with purified human native vWF in either the presence
(vWF) or absence (Control) of ristocetin. These
cells were also incubated with the recombinant A1 domain of vWF in the
presence (A1) or absence (Control) of ristocetin.
The binding of vWF was detected using SZ29 as in Fig. 2. The binding of
A1 domain was detected using the FITC-labeled anti-A1 domain monoclonal
antibody NMC-4.
|
|
Deletion of Filamin Binding Sites of GPIb Enhances
GPIb-IX-mediated Static Cell Adhesion to vWF--
The above results
show that ristocetin- or botrocetin-induced binding of soluble vWF to
GPIb-IX is regulated by the interaction of the membrane skeleton with
the cytoplasmic domain of GPIb . To examine whether
ristocetin-induced vWF binding appropriately reflects the function of
GPIb-IX to mediate cell adhesion to immobilized vWF, cells expressing
wild type GPIb-IX or the mutants were allowed to adhere to vWF-coated
microtiter wells at 37 °C for 30 min. As shown in Fig.
6A, cells expressing wild type
GPIb-IX (1b9 cells) poorly adhered to immobilized vWF in
the absence of vWF modulators. In contrast, adhesion of the
559 mutant-expressing cells to immobilized vWF was significantly
enhanced. The mutant 551-570 cells also showed enhanced adhesion to
vWF. These results indicate that filamin-dependent membrane
skeleton association regulates the function of GPIb-IX to mediate cell
adhesion to immobilized vWF.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 6.
Deletion of filamin-binding sites enhances
GPIb-IX-mediated cell adhesion to vWF under static and flow
conditions. A, cell adhesion to immobilized vWF under
static conditions. CHO cells expressing wild type GPIb-IX (1b9) or
GPIb-IX mutants, 559 or 551-570, lacking the filamin binding
site in the cytoplasmic domain of GPIb were incubated in vWF-coated
microtiter wells for 30 min at 37 °C. After three washes, the
adherent cells were quantitated by an acid phosphatase assay as
described under "Experimental Procedures." Shown are results from
three samples (mean ± S.D.). B, quantitative
evaluation of cell adhesion to immobilized vWF in a flow field at the
indicated shear rates. Adhesion of CHO cells expressing either wild
type GP Ib-IX (1b9) or the mutant 559 was evaluated on single frames
randomly selected from a real time recording of flowing cells. The
image acquisition rate was 30 frames/s. The results shown are the
mean ± S.E. of cell counts/mm2 from 15 separate
frames. At least two experiments were performed for each experimental
condition, with reproducible results. C, the four
panels provide a representation of selected single frames
(area = 65,536 µm2) for each experimental condition.
The sharper images obtained with 559 cells at 200 s 1 reflect their slower rolling velocity. All
adhesion events observed with the GPIb-IX-expressing cells, whether
wild type or 559, were transient.
|
|
Deletion of the Filamin Binding Site of GPIb Enables Cell
Adhesion to vWF under Flow--
An important function of GPIb-IX is to
mediate initial cell adhesion and rolling under flow conditions. Thus,
we examined whether deletion of the filamin-binding site of GPIb
also affects GPIb-IX-mediated cell adhesion under flow. The difference
between wild type and mutant GPIb-IX in mediating cell adhesion to
immobilized vWF is dramatic under flow conditions (Fig. 6, B
and C). Even at a low shear rate of 200 s 1, very few 1b9 cells (wild type) attached
or rolled on vWF-coated surfaces. With the increase in shear rate to
>500 s 1, almost no 1b9 cells were seen to
roll on vWF-coated surfaces. In contrast, when an equal number of
559 cells was perfused through the vWF-coated flow chamber,
significant cell adhesion and rolling were observed even at a high
shear rate of 1500 s 1, suggesting that the
mutant GPIb-IX lacking the filamin binding site is able to mediate
efficient cell adhesion and rolling on immobilized vWF under high shear
rate flow conditions. Thus, GPIb-IX-mediated cell adhesion to vWF under
both low and high shear rate conditions is significantly enhanced by
disruption of GPIb-IX interaction with the filamin-associated membrane skeleton.
vWF Binding to CHO Cells Coexpressing GPIb-IX and Integrin
IIb 3--
Although platelets have two
major receptors for vWF, GPIb-IX and the integrin
IIb 3 (39), it is known that
ristocetin-induced vWF binding to platelets is
GPIb-IX-dependent and unaffected by anti-integrin
antibodies (39). However, binding of vWF to GIb-IX has been shown to
induce fibrinogen binding to integrin
IIb 3 (31, 40). Also, the GPIb mutant
559 enhanced integrin-dependent CHO cell spreading on
vWF (31). Thus, to study whether the membrane skeleton regulates vWF
binding function of GPIb-IX in platelets, we first examined whether the
ristocetin-induced vWF binding to cells expressing wild type GPIb-IX or
the filamin binding-deficient mutant ( 559) can be influenced by the
presence of the integrin IIb 3 in our
assay system. To do this, two CHO cells lines coexpressing wild type
GPIb-IX (123 cells) and the mutant ( 559/2b3a) with the integrin
IIb 3 were examined for ristocetin-induced
vWF binding. Similar to cells expressing GPIb-IX alone,
ristocetin-induced vWF binding is significantly enhanced in 559/2b3a
cells compared with 123 cells (wild type) (Fig.
7). Ristocetin-induced vWF binding to 123 or 559/2b3a cells was unaffected by the integrin inhibitor RGDS
peptides (Fig. 7). Thus, ristocetin-induced soluble vWF binding either
in wild type or mutant GPIb-IX cells is not significantly influenced by
the presence of integrin IIb 3. This
finding, together with the data obtained with
IIb 3-deficient cells (Fig. 2), suggests that the enhanced vWF binding in the cytoplasmic domain deletion mutant
results from the enhanced ligand binding function of GPIb-IX but not
that of GPIb-IX-induced integrin activation.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 7.
Ristocetin-induced vWF binding to CHO cells
coexpressing integrin
IIb 3
with wild type or mutant GPIb-IX. Cells coexpressing integrin
IIb 3 with wild type GPIb-IX (123) or the
mutant GPIb-IX ( 559/2b3a) were analyzed for vWF binding as described
under "Experimental Procedures." The binding of 123 cells and
559/2b3a cells were incubated with ristocetin and vWF in the
presence (+RGDS) or absence ( RGDS) of 1 mM RGDS. Cells
were then detected for vWF binding using FITC-labeled SZ-29.
|
|
Disruption of the Membrane Skeleton Actin Filaments Enhances vWF
Binding to Platelets--
To determine whether the regulation of vWF
binding function of GPIb-IX by the membrane skeleton also occurs in
platelets, washed resting platelets were pretreated with or without
cytochalasin D, which depolymerizes actin filaments. To determine
whether cytochalasin D treatment affects GPIb-IX-associated actin
filaments, cytochalasin D-treated platelets were solubilized in Triton
X-100-containing buffer. Platelet lysates were centrifuged to
precipitate Triton X-100-insoluble proteins. Both the Triton
X-100-soluble and -insoluble proteins were analyzed by
SDS-polyacrylamide gel electrophoresis and Western blot with an
anti-GPIb antibody, SZ2. As shown in Fig.
8A, cytochalasin D treatment
increases the amounts of GPIb-IX in Triton X-100-soluble supernatant,
indicating that cytochalasin D treatment disrupted the
GPIb-IX-associated actin filamental network.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 8.
Effects of cytochalasin D on
GPIb-IX-associated membrane skeleton and on vWF binding to GPIb-IX in
platelets. A, washed resting platelets (1.5 × 109/ml) in modified Tyrode's buffer were treated with
Me2SO (DMSO) or cytochalasin D (CD)
and then solubilized in Triton X-100-containing buffer as previously
described (9). Platelet lysates were centrifuged at 14,000 × g for 4 min and then ultracentrifuged at 100,000 × g for 3 h. The Triton X-100-insoluble pellets and
supernatant were immunoblotted with a monoclonal antibody against
GPIb , SZ2. The reaction was detected by peroxidase-conjugated
secondary antibody and enhanced chemical luminescence (Amersham
Pharmacia Biotech). The intensities of GPIb bands were scanned and
quantitated using NIH Image software. Results (mean ± S.D.) from
three experiments are shown. B-D, washed resting platelets
(5 × 106/ml) in modified Tyrode's solution were
incubated with or without 0.5 µM cytochalasin D
(CD) for 5 min. The platelets were then further incubated
for 30 min in the presence of ristocetin (1 mg/ml) and RGDS (1 mM) with or without the addition of 10 µg/ml vWF
(B). FITC-labeled SZ-29 was used to detect vWF binding. The
cytochalasin D-treated platelets were also allowed to bind vWF in the
presence of either control IgG (C) or the inhibitory
anti-GPIb antibody AK2 (D) in the absence of RGDS. The
cytochalasin D-treated platelets were also allowed to bind vWF in the
presence of RGDS (D). E, washed resting platelets
were treated with or without cytochalasin D for 5 min. These platelets
were then further incubated in the presence of PGE1 for 15 min. vWF
binding to these platelets was measured as described for
B.
|
|
To determine whether cytochalasin D also affects vWF binding to
platelets, control or cytochalasin D-treated platelets were allowed to
bind vWF in the presence of botrocetin (Fig. 8B) or ristocetin (not shown). Integrin inhibitor RGDS was added to the reaction to exclude possible vWF binding to integrins (Fig.
8B). Cytochalasin D treatment significantly enhanced vWF
binding to platelets under these conditions. In fact,
botrocetin-induced vWF binding to cytochalasin-treated platelets was
not affected with or without the addition of RGDS peptides, indicating
that integrins did not contribute to cytochalasin-enhanced vWF binding to platelets (Fig. 8, C and D). In contrast,
anti-GPIb monoclonal antibody AK2 but not control IgG abolished vWF
binding, indicating that botrocetin or ristocetin-induced vWF binding
is mediated by GPIb-IX (Fig. 8, C and D). Thus,
disruption of GPIb-IX-associated actin filaments enhances the vWF
binding function of GPIb-IX. Consistent with a previous report that
prostaglandin E1 (PGE1) inhibited ristocetin-induced platelet
aggregation and this inhibition was reversed by cytochalasin D (41), we
found that PGE1 reduced botrocetin-induced vWF binding to resting
platelets, and this inhibitory effect was reversed by cytochalasin
D (Fig. 8E). Taken together, these results suggest that
GPIb-IX-associated membrane skeleton is likely to regulate vWF binding
function of GPIb-IX in platelets.
 |
DISCUSSION |
Platelets contain a membrane-associated actin filamental network,
the membrane skeleton (42). The membrane skeleton interacts with
filamin and is anchored to the membrane via the interaction between
GPIb-IX and filamin (8). The link between the membrane skeleton and
GPIb-IX is important to the discoid shape of resting platelets, since
Bernard-Soulier platelets, which are deficient in GPIb-IX, fail to
maintain discoid shape (for reviews, see Refs. 6 and 7). Here, we
conclude that the link between GPIb-IX and the membrane skeleton is
also important in negatively regulating ligand binding function of
GPIb-IX. This conclusion is supported by data indicating that wild type
GPIb-IX expressed in CHO cells (which is associated with the
filamin-dependent membrane skeleton (32)) poorly mediated
cell adhesion to immobilized human vWF under both static and flow
conditions and showed poor ristocetin-induced (and
botrocetin-induced) vWF binding. In contrast, GPIb mutants that lack the filamin binding site mediated a markedly enhanced cell
adhesion to immobilized vWF under both static and high shear rate flow
conditions and showed a 10-fold increase in ristocetin-induced vWF
binding compared with wild type GPIb-IX (Figs. 2-6). The results obtained in static and flow adhesion assays and the ristocetin-induced soluble vWF binding assay are highly consistent. This indicates that
ristocetin-induced vWF binding to GPIb-IX may appropriately reflect the
receptor function of GPIb-IX in mediating cell adhesion to immobilized
vWF, at least with respect to the process of receptor-ligand recognition. The enhancing effect on vWF binding function of GPIb is
unlikely to result from nonspecific conformational effects in the
mutant molecules because vWF binding to wild type GPIb-IX either in
resting platelets or in CHO cells was also enhanced by cytochalasin D,
which depolymerizes actin filaments (Figs. 4 and 8). Thus, dissociation
of GPIb-IX from the filamin-linked membrane skeleton or disruption of
the membrane skeleton activates the vWF binding function of
GPIb-IX.
We have shown here that nearly all CHO cells expressing wild type
GPIb-IX poorly bound vWF (Figs. 2, 3, and 5). In a previous study by
Cunningham et al. (32), wild type GPIb-IX-expressing cells
appeared to contain two populations with respect to vWF binding levels,
and half of the cells poorly bound vWF. Although the reason for this
difference is not clear, it is possible that two different vWF-binding
levels of wild type GPIb-IX-expressing cells under the conditions used
by Cunningham et al. (32) reflect two different states of
GPIb-IX-associated membrane skeleton in different cell populations. Our
data are consistent with the finding of Cunningham et
al. (32) that nearly all CHO cells expressing filamin
binding-deficient GPIb-IX mutants showed high levels of vWF binding.
Our data are also consistent with the finding of Cranmer et
al. (43) that CHO cells expressing wild type GPIb-IX poorly
adhered to human vWF. Cranmer et al. (43) reported that adhesion and rolling of wild type GPIb-IX-expressing CHO cells on
bovine vWF were similar to those of cells expressing a filamin binding-deficient GPIb-IX mutant under shear rates up to 1500 s 1, and were slower in rolling velocity at
3000 s 1. However, it is known that bovine vWF
is different from human vWF in that it can bind to human platelet
GPIb-IX without requiring any vWF modulation (such as immobilization or
ristocetin) (44, 45). This difference indicates that binding of bovine
vWF to human platelets is not regulated by the physiological regulatory mechanisms in human. Thus, the data obtained using bovine vWF, although
useful in characterizing ligand binding function of GPIb-IX, cannot be
applied to elucidate the regulatory mechanism of vWF-GPIb-IX interaction in humans.
Platelets have two major receptors for vWF, GPIb-IX and integrin
IIb 3 (39). It has been shown that vWF
binding to GPIb-IX activates integrin
IIb 3 and facilitates
integrin-dependent cell spreading on vWF (31, 40, 46). Here
we show that the levels of ristocetin-induced soluble vWF binding to
platelets and CHO cells expressing both integrin and GPIb-IX were not
significantly influenced by the integrin
IIb 3 (Figs. 7 and 8). This result is
consistent with the published findings that ristocetin-induced vWF to
platelets is completely inhibited by anti-GPIb antibodies but
unaffected by anti-integrin antibodies (39). Since vWF molecules are
very large multimers that are likely to hinder the access of other vWF
molecules to nearby membrane surface, and a single vWF molecule
contains multiple distinct binding sites for GPIb-IX and integrin
IIb 3, these results suggest a possibility
that vWF binding to GPIb-IX preferably stimulates the interaction
between the integrin and vWF already bound to GPIb-IX, resulting in no significant increase in the total amounts of bound vWF. Thus, disruption of GPIb-IX-association with the membrane skeleton enhances vWF binding by up-regulating ligand binding function of GPIb-IX but not
that of integrins.
The filamin-associated membrane skeleton appears to regulate the vWF
binding function of GPIb-IX by controlling ligand access to the binding
site of the receptor. This conclusion is supported by the observation
that while the binding of native macromolecular vWF to wild type
GPIb-IX is minimal, binding of the small recombinant A1 domain of vWF
to wild type GPIb-IX is comparable with that seen with filamin-binding
deficient GPIb-IX mutants (Fig. 5). Also, the difference in vWF binding
between wild type and the mutants is unlikely to result from the
difference in amounts of GPIb-IX molecules exposed on the cell surface
as the monoclonal anti-GPIb antibodies bind to wild type and mutant
GPIb-IX at comparable levels (Figs. 2 and 3). Thus, the association of
GPIb-IX with the membrane skeleton maintains GPIb-IX in a "resting"
state that hinders the access of the A1 domain in the native vWF
macromolecules to the ligand binding site of GPIb . While the
structural basis of this inside-out regulation is unclear, it is
possible that the association with the membrane skeleton has a
conformational effect on the extracellular ligand binding domain of
GPIb . It is also possible that the membrane skeleton association
affects the lateral mobility (47) and/or interaction between GPIb-IX molecules (clustering). It is known that vWF binding to GPIb-IX is
regulated by conformational changes in vWF induced by immobilization to
subendothelial matrix and affected by shear forces (14). Moreover,
conformational changes affecting receptor binding may also occur in the
A1 domain of vWF and may be mimicked by the action of the functional
modulators, botrocetin or ristocetin (22). Our results indicate that
vWF-GPIb-IX interaction can be modulated not only by changes in vWF but
also by changes in the ligand binding function of GPIb-IX. The latter
may be induced by the membrane skeleton-derived signals that control
the access of the A1 domain in macromolecular vWF to the binding site
in GPIb . This suggests that even when vWF is activated by
immobilization, its interaction with GPIb-IX can still be a regulated
event controlled by the platelet membrane
skeleton-dependent signals. This 2-fold control mechanism
of vWF-GPIb-IX interaction may reflect a need to strictly regulate
GPIb-IX-dependent platelet adhesion and activation in
circulation in order to prevent thrombosis.
While the mechanism is not clear, the GPIb-IX-associated membrane
skeleton is likely to be regulated in platelets. In resting platelets,
the association between GPIb-IX and the membrane skeleton is dynamic as
resting platelets maintain a balance of membrane skeleton-associated
(75%) and dissociated forms of GPIb-IX (25%) (Fig. 8) (9). This is in
contrast to CHO cells, where almost all expressed wild type GPIb-IX
molecules are associated with the Triton X-100-insoluble actin
filaments under similar conditions (Fig. 1) (32). The difference
between platelets and CHO cells suggests the possibility that a
mechanism in platelets that dynamically regulates GPIb-IX association
with the membrane skeleton is absent or inhibited in CHO cells and
explains why wild type GPIb-IX in platelets but not in CHO cells is
able to mediate cell adhesion to immobilized human vWF without the
addition of vWF modulators such as botrocetin. Since we show here that
association of GPIb-IX with the membrane skeleton negatively affects
vWF binding, it is possible that regulation of the ratio between
membrane skeleton-associated and -dissociated forms of GPIb-IX is a
potential mechanism for regulating the adhesion function of resting
platelets. Consistent with this hypothesis is a previous finding that
cytochalasin D abolished the inhibitory effect of PGE1 on
ristocetin-induced platelet aggregation (41). We further show here that
cytochalasin D reverses the inhibitory effect of PGE1 on
ristocetin-induced vWF binding to GPIb-IX in resting platelets (Fig.
8), suggesting that the inhibitory role of PGE1 on ligand binding
function of GPIb-IX is affected by the disruption of membrane skeleton
actin filaments. However, since PGE1 may affect multiple aspects of platelet signaling, it remains to be investigated whether the effect of
PGE1 can be mediated via the membrane skeleton-dependent signals.
The GPIb-IX-associated membrane skeleton is also likely to be regulated
during platelet activation. This contention is supported by the well
known fact that platelets lose discoid shape during platelet
activation. Interestingly, it was reported that vWF binding function of
GPIb-IX was inhibited following thrombin-induced platelet activation
(48). Thrombin-induced inhibition of vWF binding to GPIb-IX was
reversed by cytochalasin D treatment and was not caused by GPIb-IX
internalization (48). Since thrombin induces increased incorporation of
GPIb-IX into the Triton X-100-insoluble cytoskeleton (49), these data
suggest that thrombin may negatively regulate ligand binding function
of GPIb-IX via the membrane skeleton-dependent pathway. It
is possible that this regulatory mechanism may prevent thrombin-stimulated platelets (if still circulating) from adhering to
the vascular wall in places other than the site of original vascular
injury. It will be interesting to investigate further how the
association of GPIb-IX with the membrane skeleton and the membrane
skeleton organization is regulated in platelets.
 |
ACKNOWLEDGEMENTS |
We thank Drs. Michael Berndt, Changgeng Ruan,
Jose Lopez, and Joan Fox for providing reagents.
 |
FOOTNOTES |
*
This work was supported in part by National Institutes of
Health Grants HL52547 and HL62350 (to X. D.) and HL31950, HL42846, and
HL48728 (to Z. M. R.) and by a grant-in-aid from the American Heart
Association.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Both authors contributed equally to this work.
An Established Investigator of the American Heart Association.
To whom correspondence should be addressed: Dept. of Pharmacology, University of Illinois, College of Medicine, 835 S. Wolcott Ave., Chicago, IL 60612. Tel.: 312-355-0237; Fax: 312-996-1225; E-mail: xdu@uic.edu.
Published, JBC Papers in Press, February 26, 2001, DOI 10.1074/jbc.M008048200
 |
ABBREVIATIONS |
The abbreviations used are:
vWF, von Willebrand
factor;
GPIb-IX, glycoprotein Ib-IX;
CHO, Chinese hamster ovary;
PBS, phosphate-buffered saline;
FITC, fluorescein isothiocyanate;
PGE1, prostaglandin E1.
 |
REFERENCES |
| 1.
|
Weiss, H. J.,
Tschopp, T. B.,
Baumgartner, H. R.,
Sussman, I. I.,
Johnson, M. M.,
and Egan, J. J.
(1974)
Am. J. Med.
57,
920-925
|
| 2.
|
Sakariassen, K. S.,
Bolhuis, P. A.,
and Sixma, J. J.
(1979)
Nature
279,
636-638
|
| 3.
|
Sakariassen, K. S.,
Nievelstein, P. F.,
Coller, B. S.,
and Sixma, J. J.
(1986)
Br. J. Haematol.
63,
681-691
|
| 4.
|
Savage, B.,
Saldivar, E.,
and Ruggeri, Z. M.
(1996)
Cell
84,
289-297
|
| 5.
|
Savage, B.,
Almus-Jacobs, F.,
and Ruggeri, Z. M.
(1998)
Cell
94,
657-666
|
| 6.
|
Ware, J.
(1998)
Thromb. Haemost.
79,
466-478
|
| 7.
|
Lopez, J. A.,
Andrews, R. K.,
Afshar-Kharghan, V.,
and Berndt, M. C.
(1998)
Blood
91,
4397-4418
|
| 8.
|
Fox, J. E. B.
(1985)
J. Biol. Chem.
260,
11970-11977
|
| 9.
|
Fox, J. E. B.
(1985)
J. Clin. Invest.
76,
1673-1683
|
| 10.
|
Du, X.,
Harris, S. J.,
Tetaz, T. J.,
Ginsberg, M. H.,
and Berndt, M. C.
(1994)
J. Biol. Chem.
269,
18287-18290
|
| 11.
|
Du, X.,
Fox, J. E.,
and Pei, S.
(1996)
J. Biol. Chem.
271,
7362-7367
|
| 12.
|
Bodnar, R. J.,
Gu, M.,
Li, Z.,
Englund, G. D.,
and Du, X.
(1999)
J. Biol. Chem.
274,
33474-33479
|
| 13.
|
Andrews, R. K.,
and Fox, J. E.
(1992)
J. Biol. Chem.
267,
18605-18611
|
| 14.
|
Siediecki, C. A.,
Lestini, B. J.,
Kottke-Marchant, K. K.,
Eppell, S. J.,
Wilson, D. L.,
and Marchant, R. E.
(1996)
Blood
88,
2939-2950
|
| 15.
|
Ward, C.,
and Berndt, M. C.
(2000)
in
Platelets, Thrombosis and the Vessel Wall
(Berndt, M. C., ed)
, pp. 41-64, Harwood Academic Publishers, Amsterdam
|
| 16.
|
Savage, B.,
Shattil, S. J.,
and Ruggeri, Z. M.
(1992)
J. Biol. Chem.
267,
11300-11306
|
| 17.
|
Read, M. S.,
Shermer, R. W.,
and Brinkhous, K. M.
(1978)
Proc. Natl. Acad. Sci. U. S. A.
75,
4514-4518
|
| 18.
|
Howard, M. A.,
and Firkin, B. G.
(1971)
Thromb. Diath. Haemorrh.
26,
362-369
|
| 19.
|
Berndt, M. C.,
Du, X. P.,
and Booth, W. J.
(1988)
Biochemistry
27,
633-640
|
| 20.
|
Vicente, V.,
Kostel, P. J.,
and Ruggeri, Z. M.
(1988)
J. Biol. Chem.
263,
18473-18479
|
| 21.
|
Andrews, R. K.,
Booth, W. J.,
Gorman, J. J.,
Castaldi, P. A.,
and Berndt, M. C.
(1989)
Biochemistry
28,
8317-8326
|
| 22.
|
Miyata, S.,
and Ruggeri, Z. M.
(1999)
J. Biol. Chem.
274,
6586-6593
|
| 23.
|
Booth, W. J.,
Furby, F. H.,
Berndt, M. C.,
and Castaldi, P. A.
(1984)
Biochem. Biophys. Res. Commun.
118,
495-501
|
| 24.
|
Handa, M.,
Titani, K.,
Holland, L. Z.,
Roberts, J. R.,
and Ruggeri, Z. M.
(1986)
J. Biol. Chem.
261,
12579-12585
|
| 25.
|
Celikel, R.,
Madhusudan,
Varughese, K. I.,
Shima, M.,
Yoshioka, A.,
Ware, J.,
and Ruggeri, Z. M.
(1997)
Blood Cells Mol. Dis.
23,
123-134
|
| 26.
|
Ruan, C. G.,
Xi, X. D.,
and Gu, J. M.
(1986)
Chung Hua Nei Ko Tsa Chih
25,
547-550
|
| 27.
|
Ruan, C. G.,
Du, X. P.,
Xi, X. D.,
Castaldi, P. A.,
and Berndt, M. C.
(1987)
Blood
69,
570-577
|
| 28.
|
Lopez, J. A.,
Chung, D. W.,
Fujikawa, K.,
Hagen, F. S.,
Papayannopoulou, T.,
and Roth, G. J.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
5615-5619
|
| 29.
|
Lopez, J. A.,
Chung, D. W.,
Fujikawa, K.,
Hagen, F. S.,
Davie, E. W.,
and Roth, G. J.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
2135-2139
|
| 30.
|
Hickey, M. J.,
Williams, S. A.,
and Roth, G. J.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
6773-6777
|
| 31.
|
Gu, M.,
Xi, X.,
Englund, G. D.,
Berndt, M. C.,
and Du, X.
(1999)
J. Cell Biol.
147,
1085-1096
|
| 32.
|
Cunningham, J. G.,
Meyer, S. C.,
and Fox, J. E.
(1996)
J. Biol. Chem.
271,
11581-11587
|
| 33.
|
Du, X. P.,
Plow, E. F.,
Frelinger, A. L. I.,
O'Toole, T. E.,
Loftus, J. C.,
and Ginsberg, M. H.
(1991)
Cell
65,
409-416
|
| 34.
|
Gu, M.,
and Du, X.
(1998)
J. Biol. Chem.
273,
33465-33471
|
| 35.
|
Usami, S.,
Chen, H. H.,
Zhao, Y.,
Chien, S.,
and Skalak, R.
(1993)
Ann. Biomed. Eng.
21,
77-83
|
| 36.
|
Sixma, J. J.,
Sakariassen, K. S.,
Stel, H. V.,
Houdijk, W. P.,
In der Maur, D. W.,
Hamer, R. J.,
de Groot, P. G.,
and van Mourik, J. A.
(1984)
J. Clin. Invest.
74,
736-744
|
| 37.
|
Fujimura, Y.,
Titani, K.,
Holland, L. Z.,
Russell, S. R.,
Roberts, J. R.,
Elder, J. H.,
Ruggeri, Z. M.,
and Zimmerman, T. S.
(1986)
J. Biol. Chem.
261,
381-385
|
| 38.
|
Fujimura, Y.,
Holland, L. Z.,
Ruggeri, Z. M.,
and Zimmerman, T. S.
(1987)
Blood
70,
985-988
|
| 39.
|
Ruggeri, Z. M.,
De Marco, L.,
Gatti, L.,
Bader, R.,
and Montgomery, R. R.
(1983)
J. Clin. Invest.
72,
1-12
|
| 40.
|
De Marco, L.,
Girolami, A.,
Russell, S.,
and Ruggeri, Z. M.
(1985)
J. Clin. Invest.
75,
1198-1203
|
| 41.
|
Coller, B. S.
(1981)
Blood
57,
846-855
|
| 42.
|
Fox, J. E.,
Boyles, J. K.,
Berndt, M. C.,
Steffen, P. K.,
and Anderson, L. K.
(1988)
J. Cell Biol.
106,
1525-1538
|
| 43.
|
Cranmer, S. L.,
Ulsemer, P.,
Cooke, B. M.,
Salem, H. H.,
de la Salle, C.,
Lanza, F.,
and Jackson, S. P.
(1999)
J. Biol. Chem.
274,
6097-6106
|
| 44.
|
Griggs, T. R.,
Cooper, H. A.,
Webster, W. P.,
Wagner, R. H.,
and Brinkhous, K. M.
(1973)
Proc. Natl. Acad. Sci. U. S. A.
70,
2814-2818
|
| 45.
|
Puszkin, E. G.,
Mauss, E. A.,
and Zucker, M. B.
(1990)
Blood
76,
1572-1579
|
| 46.
|
Zaffran, Y.,
Meyer, S. C.,
Negrescu, E.,
Reddy, K. B.,
and Fox, J. E.
(2000)
J. Biol. Chem.
275,
16779-16787
|
| 47.
|
Dong, J. F.,
Li, C. Q.,
Sae, T. G.,
Hyun, W.,
Afshar, K. V.,
and Lopez, J. A.
(1997)
Biochemistry
36,
12421-12427
|
| 48.
|
George, J. N.,
and Torres, M. M.
(1988)
Blood
71,
1253-1259
|
| 49.
|
Fox, J. E.
(1993)
Thromb. Haemost.
70,
884-893
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
H. Yin, A. Stojanovic, N. Hay, and X. Du
The role of Akt in the signaling pathway of the glycoprotein Ib-IX induced platelet activation
Blood,
January 15, 2008;
111(2):
658 - 665.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Clemetson
How complex is the platelet GP Ib complex?
Blood,
January 15, 2007;
109(2):
393 - 394.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-Z. Luo, X. Mo, V. Afshar-Kharghan, S. Srinivasan, J. A. Lopez, and R. Li
Glycoprotein Ib{alpha} forms disulfide bonds with 2 glycoprotein Ib{beta} subunits in the resting platelet
Blood,
January 15, 2007;
109(2):
603 - 609.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Mo, N. Lu, A. Padilla, J. A. Lopez, and R. Li
The Transmembrane Domain of Glycoprotein Ibbeta Is Critical to Efficient Expression of Glycoprotein Ib-IX Complex in the Plasma Membrane
J. Biol. Chem.,
August 11, 2006;
281(32):
23050 - 23059.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Reininger, H. F. G. Heijnen, H. Schumann, H. M. Specht, W. Schramm, and Z. M. Ruggeri
Mechanism of platelet adhesion to von Willebrand factor and microparticle formation under high shear stress
Blood,
May 1, 2006;
107(9):
3537 - 3545.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Weeterings, J. Adelmeijer, T. Myles, P. G. de Groot, and T. Lisman
Glycoprotein Ib{alpha}-Mediated Platelet Adhesion and Aggregation to Immobilized Thrombin Under Conditions of Flow
Arterioscler. Thromb. Vasc. Biol.,
March 1, 2006;
26(3):
670 - 675.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Dai, R. Bodnar, M. C. Berndt, and X. Du
A critical role for 14-3-3{zeta} protein in regulating the VWF binding function of platelet glycoprotein Ib-IX and its therapeutic implications
Blood,
September 15, 2005;
106(6):
1975 - 1981.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Guerrini, D. Mei, S. Sisodiya, F. Sicca, B. Harding, Y. Takahashi, T. Dorn, A. Yoshida, J. Campistol, G. Kramer, et al.
Germline and mosaic mutations of FLN1 in men with periventricular heterotopia
Neurology,
July 13, 2004;
63(1):
51 - 56.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Cranmer and S. P. Jackson
GPIb, filamin, and platelet activation: a view from within
Blood,
September 15, 2003;
102(6):
1937 - 1937.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Feng, J. C. Resendiz, X. Lu, and M. H. Kroll
Filamin A binding to the cytoplasmic tail of glycoprotein Ib{alpha} regulates von Willebrand factor-induced platelet activation
Blood,
September 15, 2003;
102(6):
2122 - 2129.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Dyson, A. D. Munday, A. M. Kong, R. D. Huysmans, M. Matzaris, M. J. Layton, H. H. Nandurkar, M. C. Berndt, and C. A. Mitchell
SHIP-2 forms a tetrameric complex with filamin, actin, and GPIb-IX-V: localization of SHIP-2 to the activated platelet actin cytoskeleton
Blood,
August 1, 2003;
102(3):
940 - 948.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Xi, R. J. Bodnar, Z. Li, S. C.-T. Lam, and X. Du
Critical roles for the COOH-terminal NITY and RGT sequences of the integrin {beta}3 cytoplasmic domain in inside-out and outside-in signaling
J. Cell Biol.,
July 21, 2003;
162(2):
329 - 339.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Li, J. Ajdic, M. Eigenthaler, and X. Du
A predominant role for cAMP-dependent protein kinase in the cGMP-induced phosphorylation of vasodilator-stimulated phosphoprotein and platelet inhibition in humans
Blood,
June 1, 2003;
101(11):
4423 - 4429.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Bodnar, X. Xi, Z. Li, M. C. Berndt, and X. Du
Regulation of Glycoprotein Ib-IX-von Willebrand Factor Interaction by cAMP-dependent Protein Kinase-mediated Phosphorylation at Ser 166 of Glycoprotein Ibbeta
J. Biol. Chem.,
November 27, 2002;
277(49):
47080 - 47087.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Navdaev and K. J. Clemetson
Glycoprotein Ib Cross-linking/Ligation on Echicetin-coated Surfaces or Echicetin-IgMkappa in Stirred Suspension Activates Platelets by Cytoskeleton Modulated Calcium Release
J. Biol. Chem.,
November 22, 2002;
277(48):
45928 - 45934.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kanaji, S. Russell, and J. Ware
Amelioration of the macrothrombocytopenia associated with the murine Bernard-Soulier syndrome
Blood,
August 28, 2002;
100(6):
2102 - 2107.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Kasirer-Friede, J. Ware, L. Leng, P. Marchese, Z. M. Ruggeri, and S. J. Shattil
Lateral Clustering of Platelet GP Ib-IX Complexes Leads to Up-regulation of the Adhesive Function of Integrin alpha IIbbeta 3
J. Biol. Chem.,
March 29, 2002;
277(14):
11949 - 11956.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Williamson, I. Pikovski, S. L. Cranmer, P. Mangin, N. Mistry, T. Domagala, S. Chehab, F. Lanza, H. H. Salem, and S. P. Jackson
Interaction between Platelet Glycoprotein Ibalpha and Filamin-1 Is Essential for Glycoprotein Ib/IX Receptor Anchorage at High Shear
J. Biol. Chem.,
January 11, 2002;
277(3):
2151 - 2159.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|