|
Originally published In Press as doi:10.1074/jbc.M010983200 on February 5, 2001
J. Biol. Chem., Vol. 276, Issue 20, 17206-17212, May 18, 2001
Muscle Specificity Encoded by Specific
Serum Response Factor-binding Sites*
Priscilla S.
Chang §,
Li
Li ¶,
John
McAnally , and
Eric N.
Olson
From the Department of Molecular Biology, University
of Texas, Southwestern Medical Center, Dallas, Texas 75390-9148 and
¶ Wayne State University School of Medicine,
Detroit, Michigan 48201
Received for publication, December 6, 2000, and in revised form, January 17, 2001
 |
ABSTRACT |
Serum response factor (SRF) is a MADS box
transcription factor that regulates muscle-specific and growth
factor-inducible genes by binding the consensus sequence
CC(A/T)6GG, known as a CArG box. Because SRF
expression is not restricted solely to muscle, its expression alone
cannot account for the muscle specificity of some of its target genes.
To understand further the role of SRF in muscle-specific transcription,
we created transgenic mice harboring lacZ transgenes linked
to tandem copies of different CArG boxes with flanking sequences. CArG
boxes from the SM22 and skeletal
-actin promoters directed highly restricted
expression in developing smooth, cardiac, and skeletal muscle cells
during early embryogenesis. In contrast, the CArG box and flanking
sequences from the c-fos promoter directed expression
throughout the embryo, with no preference for muscle cells. Systematic
swapping of the core and flanking sequences of the SM22 and
c-fos CArG boxes revealed that cell type specificity was
dictated in large part by sequences immediately flanking the CArG box
core. Sequences that directed widespread embryonic expression bound SRF
more strongly than those that directed muscle-restricted expression. We
conclude that sequence variations among CArG boxes influence cell type
specificity of expression and account, at least in part, for the
ability of SRF to distinguish between growth factor-inducible and
muscle-specific genes in vivo.
 |
INTRODUCTION |
The MADS box transcription factor, serum response factor
(SRF),1 was first identified
on the basis of its ability to confer serum inducibility to the
c-fos gene through a sequence known as the serum response
element (SRE) (reviewed in Ref. 1). Paradoxically, SRF also regulates
muscle-specific genes, which are expressed specifically in post-mitotic
muscle cells, thus representing a gene regulatory program incompatible
with expression of growth-regulated genes. Several mechanisms have been
shown to regulate SRF activity, including association with positive and
negative cofactors (reviewed in Ref. 2), phosphorylation-dependent
changes in DNA binding (3), alternative RNA splicing (4, 5), and
regulated nuclear translocation (6). However, the exact mechanisms that
enable SRF to distinguish between growth factor-inducible and
muscle-specific genes have not been fully explained.
SRF binds as a homodimer to the DNA consensus sequence
CC(A/T)6GG, referred to as a CArG box (7, 8). CArG boxes
are essential for expression of numerous cardiac, skeletal, and smooth muscle-specific genes (9-24). During embryogenesis, SRF is highly expressed in muscle cell lineages (25-27), but it is not
muscle-specific. Thus, SRF expression alone cannot account for the
muscle specificity of certain of its target genes. The possibility that
cell specificity might be encoded in the sequence of the CArG box
itself has been suggested by transfection assays in which CArG boxes
from muscle-specific genes were shown to be preferentially active in
muscle cells, whereas the c-fos SRE was active in a wider
range of cell types (28). However, other studies have concluded that
CArG boxes from muscle-specific and serum-inducible genes were
functionally interchangeable (29, 30).
We and others have examined the role of SRF in the regulation of the
SM22 gene. SM22, which encodes a structural
protein related to troponin, is expressed specifically in developing
smooth, skeletal, and cardiac muscle during embryogenesis, before
becoming restricted to smooth muscle postnatally (31-33).
Transcription of SM22 is controlled by a proximal promoter
region that contains two CArG boxes; the more 3' CArG box (referred to
as CArG-near) is essential for promoter activity in transgenic mice
(17, 18, 34).
To understand further the mechanism whereby SRF regulates
muscle-specific transcription, we investigated whether CArG boxes from
the SM22 and skeletal -actin
promoters and their immediate flanking sequences were sufficient to
direct muscle-specific expression of a lacZ reporter gene in
transgenic mouse embryos. We show that these transgenes are expressed
specifically in smooth, cardiac, and skeletal muscle during early
embryogenesis, in a pattern similar to that of the endogenous
SM22 and skeletal -actin genes. In contrast, a lacZ transgene linked to tandem copies of the
c-fos SRE showed widespread embryonic expression. Through
creation of chimeric CArG boxes containing different combinations of
the SM22 and c-fos core and flanking sequences,
we found that sequences immediately surrounding the CArG box specify
the expression pattern and that CArG boxes with muscle specificity bind
SRF with reduced affinity compared with those that direct ubiquitous
expression. These results are consistent with a model in which sequence
variations among CArG boxes account for differences in gene expression patterns.
 |
MATERIALS AND METHODS |
Construction of CArG Box Multimer
Constructs--
Oligonucleotides containing the appropriate CArG box
core (10 bp) and flanking sequences (15 bp each side) with
HindIII sites on both ends were phosphorylated,
phenol-extracted, and annealed. Correct multimers were subcloned into
the hsp68lacZ vector (35) for generation of transgenic mice. The number
and orientations of the CArG repeats were determined by DNA sequencing.
Sequences of top strand oligonucleotides containing HindIII
sites (with CArG boxes underlined) were as follows: SM22,
AGCTTACTTGGTGTCTTTCCCCAAATATGGAGCCTGTGTGGAGTGA; skeletal -actin,
AGCTTTCTAGTGCCCGACACCCAAATATGGCTTGGGAAGGGCAGCA; c-fos,
AGCTTCTTTACACAGGATGTCCATATTAGGACATCTGCGTCAGCAA; SFS,
AGCTTACTTGGTGTCTTTCCCCATATTAGGAGCCTGTGTGGAGTGA; FSF,
AGCTTCTTTACACAGGATGTCCAAATATGGACATCTGCGTCAGCAA; FFS,
AGCTTCTTTACACAGGATGTCCATATTAGGAGCCTGTGTGGAGTGA; SFF,
AGCTTACTTGGTGTCTTTCCCCATATTAGGACATCTGCGTCAGCAA; FSS,
AGCTTCTTTACACAGGATGTCCAAATATGGAGCCTGTGTGGAGTGA; and SSF,
AGCTTACTTGGTGTCTTTCCCCAAATATGGACATCTGCGTCAGCAA.
Generation of Transgenic Mice--
DNA was gel-purified and
eluted using a Nucleospin DNA purification kit
(CLONTECH). Transgenic mice were created by
pronuclear injection of DNA into fertilized oocytes, and LacZ
expression was assayed in F0 embryos as described (36).
-Galactosidase Staining and Histology--
Embryos were fixed
in 2% formaldehyde, 0.2% glutaraldehyde in PBS on ice for 1 h,
washed twice with PBS, and stained overnight at room temperature in 5 mM ferricyanide, 5 mM ferrocyanide, 2 mM MgCl2, 1 mg/ml 5-bromo-4-chloro-3-indolyl
-D-galactopyranoside (X-Gal) in dimethylformamide in
PBS. Embryos were postfixed overnight in 4% formaldehyde after two
washes in PBS. Embryos were then successively dehydrated (30, 50, 70, 90, and 100% (v/v) methanol solutions) for 1 h each and left in
100% methanol overnight. Embryos were cleared for 2 h in 2:1
benzyl benzoate/benzyl alcohol, embedded in paraffin, sectioned at 5 µm, rehydrated, and stained with Nuclear Fast Red (37).
Gel Mobility Shift Assays--
SRF was translated in
vitro with a TNT T7-coupled reticulocyte lysate system (Promega).
The same SM22, c-fos, and skeletal -actin CArG box oligonucleotides used for the
construction of the CArG box-dependent transgenes were used
as probes in gel mobility shift assays. Sequences of the top strand
oligonucleotides (with CArG boxes underlined) for the egr
(38) and MCK (39) genes were as follows:
egr-1,
AGCTTGCCGACCCGGAAACGCCATATAAGGAGCAGGAAGGATCCCA; MCK,
AGCTTACGGGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGGGA.
Complementary oligonucleotides were annealed and labeled with Klenow
polymerase and [ -32P]dCTP. 5 × 104
cpm of labeled probe was incubated for 20 min at room temperature with
in vitro translated SRF and poly(dI-dC) in gel shift buffer, as described (40). Antibody supershift experiments were performed with
rabbit anti-SRF antiserum (Santa Cruz Biotechnology, sc-335X). DNA-protein complexes were separated by gel electrophoresis on a 5%
nondenaturing polyacrylamide gel in 0.5× TBE. Unlabeled competitor DNA
was added at 25-, 50-, and 100-fold excess over labeled probe. Relative
DNA binding was determined by visualizing the shifted probe with a
PhosphorImager and quantified using ImageQuant Program (Molecular Dynamics).
 |
RESULTS |
Muscle Specificity of Multimerized SM22 CArG Elements in Transgenic
Mouse Embryos--
The 1343-bp SM22 promoter is sufficient
to direct expression of a lacZ reporter in developing
smooth, cardiac, and skeletal muscle cells during mouse embryogenesis
(Fig. 1A, 34). Previous studies showed that a CArG box in the proximal SM22
promoter, referred to as CArG-near, is essential for muscle-specific
expression of SM22 (17). To determine whether this CArG box
might be sufficient to confer muscle specificity, we created a
transgene (4xSM22-lacZ) containing four tandem copies of
CArG-near with 15 nucleotides of flanking sequence on each side. The
CArG boxes were linked in a head-to-tail orientation upstream of a
lacZ reporter under control of the heat shock protein
(hsp)-68 basal promoter, which is transcriptionally silent in mouse
embryos (35).

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 1.
LacZ expression patterns directed by the
1343-bp SM22 reporter and a multimerized
SM22 CArG box. E11.5 transgenic mouse embryos
harboring lacZ transgenes controlled by the 1343-bp
SM22 promoter (A) or synthetic multimers of
SM22 CArG-near upstream of the hsp68 basal
promoter (B) were stained for LacZ expression. Strong
expression of LacZ can be seen specifically in the heart (h)
and somite myotomes (m), as well as the dorsal aorta
(da), cranial vasculature (cv), and other
vascular structures in A and B. The multimerized
SM22 CArG box also directed expression in the neural tube
(nt). Three representative F0 embryos harboring
4xSM22-lacZ are shown. The expression patterns were
similar in all embryos, except that the intensity of LacZ expression
varied.
|
|
The multimerized SM22 CArG-near element directed LacZ
expression in a highly restricted pattern in F0 transgenic mouse
embryos at E11.5 (Fig. 1B). Similar expression patterns were
observed in 9 transgenic F0 embryos harboring this transgene. Three
representative embryos are shown in Fig. 1B. As observed
with the native SM22 promoter (Fig. 1A), LacZ
expression directed by the multimerized SM22 CArG box was
observed throughout the dorsal aorta and cranial vasculature, as well
as in the heart and somite myotomes. Expression in the vasculature and
somites appeared to mimic that of the 1343-bp SM22 promoter.
The multimerized SM22 CArG box directed LacZ expression at
very high levels throughout the atrial and ventricular chambers of the
heart at E11.5. This is in contrast to the native SM22 promoter, which is active specifically in the future right ventricle following looping morphogenesis (34). The 4xSM22-lacZ
transgene was also expressed in the ventral region of the neural tube,
where the 1343-bp promoter is not expressed. There was virtually no expression of the transgene outside of these cell types. The expression pattern of the multimerized CArG-near transgene is similar to that of
SRF, which is enriched in muscle cells and the ventral neural tube
during embryogenesis (25-27).
Lack of Muscle Specificity of the c-fos CArG Box in Transgenic
Mouse Embryos--
To determine if the muscle-restricted activity of
the SM22 CArG box reflected a general property of CArG
boxes, we examined the expression pattern of the hsp68-lacZ
transgene linked to four copies of the CArG boxes from the skeletal
-actin and c-fos promoters. Like
the 4xSM22-lacZ transgene, the skeletal
-actin CArG box transgene
(4x-Actin-lacZ)-directed LacZ expression in cardiac, skeletal, and smooth muscle cell lineages, as well as in the ventral neural tube, at E11.5 (Fig.
2A).

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 2.
LacZ expression patterns directed by
multimerized skeletal -actin CArG and c-fos
CArG boxes. E11.5 transgenic mouse embryos harboring
4xActin-lacZ (A-C) and 4xfos-lacZ
(D-F) transgenes were stained for LacZ expression. In the
embryos harboring 4xActin-lacZ, strong expression can
be seen specifically in the heart (h), somite myotomes
(m), the dorsal aorta (da), cranial vasculature
(cv), and other vascular structures, as well as in the
neural tube (nt). In the embryo harboring
4xfos-lacZ, LacZ expression was widespread without
specificity for myogenic cell types. Three representative F0 embryos
harboring each transgene are shown. The expression patterns for
4xActin-lacZ were similar in all embryos, except that
the intensity of LacZ expression varied. The 4xfos-lacZ
transgene showed much more widespread and variable expression.
|
|
In contrast to the highly specific expression patterns of the
SM22 and skeletal -actin CArG boxes, the
c-fos CArG box directed widespread embryonic expression
(Fig. 2B). This transgene was expressed in the heart,
somites, and aorta, but there was also extensive staining throughout
the embryo, suggesting that the c-fos CArG element was
active in a wider range of cell types than the SM22 and
skeletal -actin CArG boxes. The broad expression pattern
of the 4xfos-lacZ transgene suggests that the
c-fos CArG box is active in cells that express SRF at
relatively low levels.
Transverse sections of transgenic embryos harboring the multimerized
SM22 CArG and c-fos CArG box transgenes confirmed
the differences in their expression patterns. LacZ was expressed
specifically in the heart, somites, dorsal aorta, and ventral neural
tube in embryos harboring the 4xSM22-lacZ transgene, whereas
LacZ expression was observed throughout the entire embryo with the
4xfos-lacZ transgene (Fig.
3).

View larger version (86K):
[in this window]
[in a new window]
|
Fig. 3.
Sections of transgenic embryos harboring
lacZ transgenes linked to multimerized SM22
and c-fos CArG boxes. E11.5 transgenic
mouse embryos harboring the 4xSM22-lacZ (A) or
4xfos-lacZ (B) transgenes were stained for LacZ
expression, sectioned at the level of the heart, and stained with
Nuclear Fast Red. A, LacZ expression can be seen in the
atria (a) and right and left
ventricles (rv and lv) of the heart, the myotome
portion of the somites (m), the paired dorsal aorta
(da), and in a subset of cells in the ventral neural tube
(nt). B, staining can be seen throughout the
embryo.
|
|
Analysis of Chimeric CArG Elements in Transgenic Embryos
Demonstrates Specificity of Expression Based on Flanking
Sequences--
We next sought to identify the DNA sequences
responsible for the distinctly different patterns of transgene
expression directed by the SM22 and c-fos CArG
boxes. We therefore created chimeric CArG elements by systematically
swapping the core sequences and surrounding nucleotides of the two CArG
boxes. Tandem copies of these chimeric CArG elements were linked to the
hsp68-lacZ reporter and tested in F0 transgenic embryos at
E11.5. As with the multimerized SM22, c-fos, and
skeletal -actin CArG constructs, all of the CArG elements
were organized in a head-to-tail orientation. Each CArG box was named
according to the identity of the 5'-flanking, core
(CC(A/T)6GG), and 3'-flanking nucleotides, with S referring to SM22 and F referring to c-fos (Fig.
4). The number of CArG boxes contained in
each transgene is shown in Table I. At
least three independent transgenic embryos were examined with each
construct. As shown for the parental constructs in Fig. 1, the overall
expression pattern was similar in different embryos harboring a given
construct, but the intensity of expression varied, presumably because
of differences in transgene copy number or sites of integration. We
also examined the expression of multiple different transgenes containing between 3 and 6 tandem copies of the different CArG boxes,
but we saw no significant differences in expression pattern for a given
transgene, indicating that the number of copies of CArG boxes did not
influence the pattern of expression. Representative embryos with each
transgene are shown in Fig. 5.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 4.
Diagram of chimeric CArG elements.
Sequences of the CArG boxes and flanking regions of the SM22
CArG, c-fos CArG, and chimeric CArG elements. Each CArG
element contains the 10-nucleotide CArG box and 15 nucleotides of
flanking sequence both 5' and 3' of the core CArG box. SM22
sequences are shaded in black.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Summary of CArG box-containing transgenes
Embryos harboring the indicated chimeric CArG boxes upstream of
hsp68-lacZ were stained for lacZ expression at
E11.5. Forty two total transgenic embryos were analyzed. The number of
copies of each CArG box in each transgene construct and the number of
transgenic embryos examined are indicated.
|
|

View larger version (53K):
[in this window]
[in a new window]
|
Fig. 5.
Expression patterns of lacZ
transgenes linked to multimerized chimeric CArG elements.
E11.5 transgenic mouse embryos harboring hsp68-lacZ
transgenes linked to the indicated multimerized CArG boxes were stained
for LacZ expression. Sequences of the CArG boxes are shown in Fig.
4. The numbers of tandem copies of the each CArG box are shown in Table
I, along with the number of transgenic embryos analyzed. da,
dorsal aorta; h, heart; m, myotome;
nt, neural tube; v, umbilical vessel.
|
|
The CArG box element SFS, containing the SM22-flanking
sequences and the c-fos core sequence, directed expression
in a pattern similar to that of the SM22 CArG box (SSS)
(Fig. 5, compare A and B), except that the level
of expression was weaker. This result suggested that the core CArG
sequence was not responsible for the specificity of the SM22
CArG box expression pattern. Conversely, the CArG box FSF, containing
the c-fos flanking sequences and the SM22 core
sequence, showed a widespread expression pattern, reminiscent of the
c-fos CArG box (FFF) (Fig. 5, compare G and H)). High background staining with FSF and FFF was
especially pronounced in the head. The other four chimeric CArGs (FSS,
SSF, SFF, and FFS) directed expression in patterns that appeared to be
intermediate between the highly specific pattern seen with the
SM22 CArG and the widespread pattern seen with the
c-fos CArG (Fig. 5, C-F). Together, these data
suggest that the differences in expression pattern of different CArG
element multimers are determined primarily by the 15 flanking
nucleotides on both sides of the core CArG boxes.
High Affinity Binding of SRF to CArG Boxes Correlates with
Widespread Transgene Expression--
To determine whether there might
be a correlation between DNA binding affinity and expression pattern,
we performed gel mobility shift assays with in vitro
translated SRF and the different chimeric CArG elements. As shown in
Fig. 6A, the c-fos
CArG element bound SRF more avidly than the SM22 CArG
element (compare lanes 1 and 2). This difference
in SRF binding appeared to be attributable to the flanking sequences of
these CArG boxes, because the chimeric CArG SFS (lane 3)
bound SRF with a reduced affinity similar to that of the
SM22 CArG, whereas FSF (lane 4) bound SRF very
strongly, like the c-fos CArG box. The CArGs with mixed
flanking sequences (FSS, SSF, SFF, and FFS) showed SRF binding
intermediate between that of the other CArG elements. The single major
complex observed in gel mobility shift assays was confirmed to contain
SRF by supershift with SRF antibody (lane 9).

View larger version (67K):
[in this window]
[in a new window]
|
Fig. 6.
Gel mobility shift assays of SRF binding to
different CArG boxes. A, oligonucleotide probes
corresponding to the indicated CArG elements (see Fig. 4) were used as
probes in gel mobility shift assays with in vitro translated
SRF. The SM22 CArG and SFS (lanes 1 and
3) bound SRF relatively weakly, whereas the c-fos
CArG and FSF (lanes 2 and 4) bound SRF most
strongly. SSF, FSS, SFF, and FFS (lanes 5-8) had
intermediate affinities for SRF. Note that the SRF-containing complex
was specifically supershifted with SRF antibody (lane 9).
B, oligonucleotide probes corresponding to the indicated
CArG boxes were used as probes in gel mobility shift assays with
in vitro translated SRF. SRF bound strongly to the CArG
elements from c-fos and egr1 and weakly to CArG
boxes from skeletal -actin, MCK, and
SM22. The position of the SRF-DNA complex is shown with an
arrowhead to the left of each panel. All assays
contained equal amounts of labeled probe, as described under
"Materials and Methods."
|
|
To compare further the relative affinities of SRF for the
SM22 and c-fos CArG boxes, we performed
competition experiments with each of the chimeric CArG sequences and
32P-labeled probes for the SM22 and
c-fos CArG elements (Fig.
7A). Results from competition
experiments are plotted in Fig. 7B. Binding of SRF to the
SM22 CArG probe was competed most effectively by the FSF and
FFF sequences. The SFS and SSS sequences were the least effective
competitors, and other chimeric CArG sequences showed intermediate
abilities to compete for SRF binding. A similar order of effectiveness
in competition for SRF DNA binding by the different CArG sequences was
observed with the c-fos CArG probe. Thus, those CArG
sequences that contained the c-fos-flanking regions and
directed widespread expression in vivo showed the strongest binding of SRF. Conversely, those CArG sequences that contained the
SM22 flanking regions and directed muscle-restricted
expression in vivo showed relatively weak binding of
SRF.

View larger version (55K):
[in this window]
[in a new window]
|
Fig. 7.
Competition assays for SRF binding to
the SM22 and c-fos CArG boxes.
A, oligonucleotide probes corresponding to the
SM22 (upper panels) and c-fos
(lower panels) CArG boxes were used as probes in gel
mobility shift assays with in vitro translated SRF. Each of
the CArG sequences shown in Fig. 4 were used as unlabeled competitors
at 25-, 50-, and 100-fold excess over labeled probe. The increasing
concentrations are indicated by the black triangles. CArG
boxes containing the c-fos flanking sequences competed for
SRF binding more effectively than those containing the SM22
flanking sequences. B, relative binding of SRF to the
SM22 (left panel) and c-fos
(right panel) probes in A was quantitated by
PhosphorImager and plotted as percent of maximal SRF binding in the
absence of competitor.
|
|
Comparison of SRF Binding to Different CArG Boxes--
The above
findings revealed a correlation between strength of SRF binding and
specificity of expression. As a further test of this correlation, we
examined the binding of SRF to CArG boxes from other muscle-specific
and ubiquitously expressed genes (Fig. 6B). The
skeletal -actin CArG box, which directed a muscle
expression pattern similar to that of SM22 CArG, bound SRF
relatively weakly. Similarly, the CArG box in the skeletal
muscle-specific enhancer of the muscle creatine kinase
(MCK) gene also bound SRF weakly. In contrast, SRF bound
strongly to the CArG box from egr-1, which, like
c-fos, is widely expressed.
 |
DISCUSSION |
SRF is an important regulator of both growth factor-inducible and
muscle-specific genes, but the mechanisms whereby SRF distinguishes between these two sets of genes, which show entirely different expression patterns, are not fully resolved. Our results demonstrate that different CArG boxes with flanking sequences can direct distinct temporospatial expression patterns during mouse embryogenesis. Whereas
CArG boxes from the SM22 and skeletal
-actin promoters can direct muscle-restricted
transcription, the c-fos SRE directs widespread embryonic
expression. The different activities of these CArG boxes correlate with
their relative affinities for SRF; CArG boxes that direct
muscle-restricted expression bind SRF relatively weakly compared with
those, such as the c-fos SRE, that direct widespread expression.
Differential Cellular Responsiveness of CArG Boxes--
How might
different CArG boxes encode differential information for cell type
specificity? One mechanism consistent with our results is that CArG
boxes with relatively high affinity for SRF are able to detect low
levels of SRF in a wide range of cell types, whereas muscle-specific
CArG boxes, which exhibit reduced affinity for SRF, are only able to
detect the higher levels of SRF that exist in muscle cells (as well as
in certain neural cell types). According to this model, the transgenes
with multimerized CArG boxes respond to endogenous SRF levels with
different sensitivities, resulting in different cellular expression
patterns. Consistent with this interpretation, SRF expression is highly
enriched in developing muscle cell lineages and in a subset of
neuroectodermal derivatives during embryogenesis (25-27), resembling
the expression patterns of the SM22 and skeletal
-actin CArG-containing transgenes.
The possibility that the multimerized CArG boxes contained in our
transgenes "read" SRF levels in vivo is also suggested
by the similarity in expression pattern seen with the SM22
and skeletal -actin CArG multimers. During embryogenesis,
the endogenous SM22 and skeletal -actin genes
show different temporospatial expression patterns in developing muscle
cell lineages (32, 33, 41, 42). The fact that the multimerized
SM22 and skeletal -actin CArG boxes direct the
same expression patterns in skeletal, cardiac, and smooth muscle cells
in vivo also indicates that SRF is not solely responsible
for the normal expression patterns of those genes.
This is, to our knowledge, the first analysis of the potential
interchangeability of CArG boxes in transgenic mice. However, previous
studies of other CArG boxes in transfection assays have suggested a
correlation between low affinity DNA binding of SRF and
muscle-restricted activity. Replacement of the most proximal CArG box
in the skeletal -actin promoter with the c-fos
SRE resulted in constitutive expression of the promoter in transfected
nonmuscle cells (28). Similarly, replacement of two CArG boxes from the smooth muscle -actin promoter with the c-fos
SRE caused a relaxation in cell-specific expression in transfected
cells (43).
Regulation of SRF Activity by Cofactor Interactions--
Although
our results indicate that different CArG boxes confer cell specificity
through differences in affinity for SRF, this does not discount the
potential importance of SRF cofactors in SRF-dependent
transcription. Indeed, there are numerous examples of positive and
negative cofactors for SRF. SRF activates transcription through the
c-fos SRE by recruiting ternary complex factor (TCF), an ETS
domain transcription factor that recognizes the CAGGA motif immediately
5' of the CArG box (44, 45). TCF binding may contribute to the
widespread expression seen with multimers of the c-fos SRE.
However, since the SM22 and skeletal -actin
CArG boxes are not flanked by TCF consensus binding sites, it is
unlikely that TCF plays a positive role in muscle-specific expression
from these sequences.
Several myogenic cofactors for SRF have also been described. For
example, the cardiac homeodomain protein Nkx2.5 and the zinc finger
transcription factor GATA4 interact with SRF to activate certain
cardiac-specific genes (46, 47), and myogenic basic helix-loop-helix
proteins have been reported to interact with SRF to regulate skeletal
muscle genes (48). Because these cofactors can associate with SRF
without binding to DNA, they would not be expected to distinguish
between different CArG box sequences. However, it is conceivable that
binding of SRF to specific CArG boxes might influence its interactions
with such factors.
The homeodomain protein phox/MHox also interacts with SRF to increase
its affinity for certain CArG boxes (49, 50) and has been proposed to
confer smooth muscle specificity to a CArG box from the smooth
muscle -actin gene (51). This type of interaction may
contribute to the specificity of CArG box-dependent
expression in certain cell types, but because phox is expressed
predominantly in mesenchymal cells within the branchial arches and limb
buds (52), it cannot account for the muscle-restricted expression of
the multimerized SM22 and skeletal -actin CArG
sequences observed in our studies.
Simplified Regulation of CArG Multimers--
Our approach in the
present study was to investigate the activity of isolated CArG boxes
and adjacent sequences outside the context of their native promoters.
This is, of course, an over-simplification of the actual regulatory
events that govern the activity of these sequences in vivo
and does not discount the potential importance of other regulatory
factors that bind sites surrounding the CArG boxes in their native
promoters. There is also evidence for complex interactions among
distant CArG boxes associated with the smooth muscle
-actin gene that result in selective activation of
transcription in specific muscle cell types
(23).2 The artificial
transgenes analyzed in the present study would be independent of
this type of regulation, which may involve long range alterations in
chromatin structure. In this regard, it is interesting to note that SRF
interacts with the high mobility group protein, SSRP1, implicated in
chromatin remodeling (53).
Whereas the SM22 and skeletal -actin CArG
multimers direct a highly restricted expression pattern at E11.5 and
earlier in embryogenesis, these sequences direct more widespread
expression during late fetal development and postnatally (data not
shown). Thus, the mechanisms that regulate the activity of these
sequences appear to change during development. This may explain why
previous studies concluded that the cardiac -actin CArG
and c-fos SRE were functionally interchangeable in injected
Xenopus embryos (29).
Previously, we generated transgenic mice harboring multimerized binding
sites for the MADS box transcription factor MEF2, which shares homology
with the DNA binding and dimerization domains of SRF (54). During
embryogenesis, these "MEF2 sensor" mice showed highly specific
expression of LacZ in developing muscle and neural cell lineages (54);
the same cell types in which MEF2 is expressed at highest levels. After
birth, the MEF2-lacZ transgene was down-regulated in
skeletal and cardiac muscle, despite high levels of MEF2 protein in
these tissues, but it could be activated in response to various
calcium-dependent signal transduction pathways (55, 56).
Multimerized MEF2-binding sites from the desmin enhancer,
which is muscle-specific, or the c-jun promoter, which is
growth factor-inducible, direct similar expression patterns in
vivo (54). Together, these findings suggest that SRF and MEF2 use
different mechanisms to confer cell type specificity through their
target sequences.
In summary, the results of the present study demonstrate that SRF can
discriminate between different target genes based on differential
affinity for CArG boxes. Such differential binding is likely to
contribute to the specificity of expression of
SRF-dependent genes in vivo and is likely to be
profoundly influenced by cofactor interactions and intracellular signals.
 |
ACKNOWLEDGEMENTS |
We thank R. Schwartz for reagents and M. Parmacek for sharing results prior to publication. We also
thank A. Tizenor for graphics, J. Richardson and members of his lab for
assistance with histology, and members of our lab for input and support.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Supported by a Medical Science Training Program grant from the
National Institutes of Health.
Supported by grants from the National Institutes of Health and
the American Heart Association. To whom correspondence should be
addressed: Dept. of Molecular Biology, University of Texas, Southwestern Medical Center, 6000 Harry Hines Blvd., Dallas, TX 75390-9148. Tel.: 214-648-1187; Fax: 214-648-1196; E-mail:
eolson@hamon.swmed.edu.
Published, JBC Papers in Press, February 5, 2001, DOI 10.1074/jbc.M010983200
2
J. Spencer and E. N. Olson, manuscript in preparation.
 |
ABBREVIATIONS |
The abbreviations used are:
SRF, serum response
factor;
MCK, muscle creatine kinase;
SRE, serum response element;
TCF, ternary complex factor;
PBS, phosphate-buffered saline;
bp, base
pair.
 |
REFERENCES |
| 1.
|
Treisman, R.
(1995)
EMBO J.
14,
4905-4913
|
| 2.
|
Treisman, R.
(1994)
Curr. Opin. Genet. & Dev.
4,
96-101
|
| 3.
|
Manak, J. R.,
and Prywes, R.
(1991)
Mol. Cell. Biol.
11,
3652-3659
|
| 4.
|
Belaguli, N. S.,
Zhou, W.,
Trinh, T.-H. T.,
Majesky, M. W.,
and Schwartz, R. J.
(1999)
Mol. Cell. Biol.
19,
4582-4591
|
| 5.
|
Kemp, P. R.,
and Metcalfe, J. C.
(2000)
Biochem. J.
345,
445-451
|
| 6.
|
Camoretti-Mercado, B.,
Liu, H. W.,
Halayko, A. J.,
Forsythe, S. M.,
Kyle, J. W.,
Li, B.,
Fu, Y.,
McConville, J.,
Kogut, P.,
Vieira, J. E.,
Patel, N. M.,
Hershenson, M. B.,
Fuchs, E.,
Sinha, S.,
Miano, J. M.,
Parmacek, M. S.,
Burkhardt, S. K.,
and Solway, J.
(2000)
J. Biol. Chem.
275,
30387-30393
|
| 7.
|
Minty, A.,
and Kedes, L.
(1986)
Mol. Cell. Biol.
6,
2125-2136
|
| 8.
|
Grichnik, J. M.,
Bergsma, D. J.,
and Schwartz, R. J.
(1987)
Trans. Contr. Mech.
, pp. 57-69, Alan R. Liss, Inc., New York
|
| 9.
|
Mohun, T.,
Taylor, M.,
Garrett, N.,
and Gurdon, J. B.
(1989)
EMBO J.
8,
1153-1161
|
| 10.
|
Walsh, K.
(1989)
Mol. Cell. Biol.
9,
2191-2201
|
| 11.
|
Chow, K. L.,
and Schwartz, R. J.
(1990)
Mol. Cell. Biol.
10,
528-538
|
| 12.
|
Boxer, L. M.,
Prywes, R.,
Roeder, R. G.,
and Kedes, L.
(1989)
Mol. Cell. Biol.
9,
515-522
|
| 13.
|
Lee, T.,
Chow, C.,
Fang, K. L.,
and Schwartz, R. J.
(1991)
Mol. Cell. Biol.
11,
5090-5100
|
| 14.
|
Miwa, T.,
and Kedes, L.
(1987)
Mol. Cell. Biol.
7,
2803-2813
|
| 15.
|
Bergsma, D. J.,
Grichnik, J. M.,
Gossett, L. M. A.,
and Schwartz, R. J.
(1986)
Mol. Cell. Biol.
6,
2462-2475
|
| 16.
|
Grichnik, J. M.,
French, B. A.,
and Schwartz, R. J.
(1988)
Mol. Cell. Biol.
8,
4587-4597
|
| 17.
|
Li, L.,
Liu, Z.-C.,
Mercer, B.,
Overbeek, P.,
and Olson, E. N.
(1997)
Dev. Biol.
187,
311-321
|
| 18.
|
Kim, S.,
Ip, H. S.,
Lu, M. M.,
Clendenin, C.,
and Parmacek, M. S.
(1997)
Mol. Cell. Biol.
17,
2266-2278
|
| 19.
|
Katoh, Y.,
Loukianov, E.,
Kopras, E.,
Zilberman, A.,
and Periasamy, M.
(1994)
J. Biol. Chem.
269,
30538-30545
|
| 20.
|
Obata, H.,
Hayashi, K.,
Nishida, W.,
Momiyama, T.,
Uchida, A.,
Ochi, T.,
and Sobue, K.
(1997)
J. Biol. Chem.
272,
26643-26651
|
| 21.
|
Herring, B. P.,
and Smith, A. F.
(1997)
Am. J. Physiol.
272,
C1394-C1404
|
| 22.
|
Blank, R. S.,
McQuinn, T. C.,
Yin, K. C.,
Thompson, M. M.,
Takeyasu, K.,
Schwartz, R. J.,
and Owens, G. K.
(1992)
J. Biol. Chem.
267,
984-989
|
| 23.
|
Mack, C. P.,
and Owens, G. K.
(1999)
Circ. Res.
84,
852-861
|
| 24.
|
Miano, J. M.,
Carlson, M. J.,
Spencer, J. A.,
and Misra, R. P.
(2000)
J. Biol. Chem.
275,
9814-9882
|
| 25.
|
Croissant, J. D.,
Kim, J. H.,
Eichele, G.,
Goering, L.,
Lough, J.,
Prywes, R.,
and Schwartz, R. J.
(1996)
Dev. Biol.
177,
250-264
|
| 26.
|
Belaguli, N. S.,
Schildmeyer, L. A.,
and Schwartz, R. J.
(1997)
J. Biol. Chem.
272,
18222-18231
|
| 27.
|
Vogel, A. M.,
and Gerster, T.
(1999)
Mech. Dev.
81,
217-221
|
| 28.
|
Santoro, I. M.,
and Walsh, K.
(1991)
Mol. Cell. Biol.
11,
6296-6305
|
| 29.
|
Taylor, M.,
Treisman, R.,
Garrett, N.,
and Mohun, T.
(1989)
Development
106,
67-78
|
| 30.
|
Tuil, D.,
Clergue, N.,
Montarras, D.,
Pinset, C.,
Kahn, A.,
and Tuy, F. P.-D.
(1990)
J. Mol. Biol.
213,
677-686
|
| 31.
|
Takahashi, K.,
and Nadal-Ginard, B.
(1991)
J. Biol. Chem.
266,
13284-13288
|
| 32.
|
Solway, J.,
Seltzer, J.,
Samaha, F. F.,
Kim, S.,
Alger, L. E.,
Niu, Q.,
Morrisey, E. E.,
Ip, H. S.,
and Parmacek, M. S.
(1995)
J. Biol. Chem.
270,
13460-13469
|
| 33.
|
Li, L.,
Miano, J. M.,
Cserjesi, P.,
and Olson, E. N.
(1996)
Circ. Res.
78,
188-195
|
| 34.
|
Li, L.,
Miano, J. M.,
Mercer, B.,
and Olson, E. N.
(1996)
J. Cell Biol.
132,
849-859
|
| 35.
|
Kothary, R.,
Clapoff, S.,
Darling, S.,
Perry, M. D.,
Moran, L. A.,
and Rossant, J.
(1989)
Development
105,
707-714
|
| 36.
|
Cheng, T.-C.,
Hanley, T. A.,
Mudd, J.,
Merlie, J. P.,
and Olson, E. N.
(1992)
J. Cell Biol.
119,
1649-1656
|
| 37.
|
Moller, W.,
and Moller, G.
(1994)
Biotechnol. Histochem.
69,
289-290
|
| 38.
|
Tsai-Morris, C. H.,
Cao, X. M.,
and Sukhatme, V. P.
(1988)
Nucleic Acids Res.
16,
8835-8846
|
| 39.
|
Sternberg, E. A.,
Spizz, G.,
Perry, M. W.,
Vizard, D.,
Weil, T.,
and Olson, E. N.
(1988)
Mol. Cell. Biol.
8,
2896-2909
|
| 40.
|
Brennan, T. J.,
and Olson, E. N.
(1990)
Genes Dev.
4,
582-595
|
| 41.
|
Ruzicka, D. L.,
and Schwartz, R. J.
(1988)
J. Cell Biol.
107,
2575-2586
|
| 42.
|
Lyons, G. E.,
Buckingham, M. E.,
and Mannherz, H. G.
(1991)
Development
111,
451-454
|
| 43.
|
Hautmann, M. B.,
Madsen, C. S.,
Mack, C. P.,
and Owens, G. K.
(1998)
J. Biol. Chem.
273,
8398-8406
|
| 44.
|
Hipskind, R. A.,
Rao, V. N.,
Mueller, C. G. F.,
Reddy, E. S. P.,
and Nordheim, A.
(1991)
Nature
354,
531-534
|
| 45.
|
Gille, H.,
Sharrocks, A. D.,
and Shaw, P. E.
(1992)
Nature
358,
414-417
|
| 46.
|
Chen, C. Y.,
and Schwartz, R. J.
(1996)
Mol. Cell. Biol.
16,
6372-6384
|
| 47.
|
Sepulveda, J. L.,
Belaguli, N.,
Nigam, V.,
Chen, C. Y.,
Nemer, M.,
and Schwartz, R. J.
(1998)
Mol. Cell. Biol.
18,
3405-3415
|
| 48.
|
Groisman, R.,
Masutani, H.,
Leibovitch, M. P.,
Robin, P.,
Soudant, I.,
Trouche, D.,
and Harel-Bellan, A.
(1996)
J. Biol. Chem.
271,
5258-5264
|
| 49.
|
Grueneberg, D. A.,
Natesan, S.,
Alexandre, C.,
and Gilman, M. Z.
(1992)
Science
257,
1089-1095
|
| 50.
|
Gruenberg, D. A.,
Simon, K. J.,
Brennan, K.,
and Gilman, M.
(1995)
Mol. Cell. Biol.
15,
3318-3326
|
| 51.
|
Hautmann, M. B.,
Thompson, M. M.,
Swartz, E. A.,
Olson, E. N.,
and Owens, G. K.
(1997)
Circ. Res.
81,
600-610
|
| 52.
|
Cserjesi, P.,
Lilly, B.,
Bryson, L.,
Wang, Y.,
Sassoon, D. A.,
and Olson, E. N.
(1992)
Development
115,
1087-1101
|
| 53.
|
Spencer, J.,
Baron, M. H.,
and Olson, E. N.
(1999)
J. Biol. Chem.
274,
15686-15693
|
| 54.
|
Naya, F. J.,
Wu, C.,
Richardson, J. A.,
Overbeek, P.,
and Olson, E. N.
(1999)
Development
126,
2045-2052
|
| 55.
|
Passier, R.,
Zeng, H.,
Frey, N.,
Naya, F. J.,
Nicol, R. L.,
McKinsey, T. A.,
Overbeek, P.,
Richardson, J. A.,
Grant, S. R.,
and Olson, E. N.
(2000)
J. Clin. Invest.
105,
1395-1406
|
| 56.
|
Wu, H.,
Naya, F. J.,
McKinsey, T.,
Mercer, B.,
Bassel-Duby, R.,
Olson, E. N.,
and Williams, R. S.
(2000)
EMBO J.
19,
1963-1973
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J.-R. Kim, H. J. Kee, J.-Y. Kim, H. Joung, K.-I. Nam, G. H. Eom, N. Choe, H.-S. Kim, J. C. Kim, H. Kook, et al.
Enhancer of Polycomb1 Acts on Serum Response Factor to Regulate Skeletal Muscle Differentiation
J. Biol. Chem.,
June 12, 2009;
284(24):
16308 - 16316.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Camp, A. De Jaco, L. Zhang, M. Marquez, B. De La Torre, and P. Taylor
Acetylcholinesterase Expression in Muscle Is Specifically Controlled by a Promoter-Selective Enhancesome in the First Intron
J. Neurosci.,
March 5, 2008;
28(10):
2459 - 2470.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. H. Hong, H. Sun, C. H. Jin, M. Chapman, J. Hu, W. Chang, K. Burnett, J. Rosen, A. Negro-Vilar, and J. N. Miner
Cell-Specific Activation of the Human Skeletal {alpha}-Actin by Androgens
Endocrinology,
March 1, 2008;
149(3):
1103 - 1112.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Potthoff, M. A. Arnold, J. McAnally, J. A. Richardson, R. Bassel-Duby, and E. N. Olson
Regulation of Skeletal Muscle Sarcomere Integrity and Postnatal Muscle Function by Mef2c
Mol. Cell. Biol.,
December 1, 2007;
27(23):
8143 - 8151.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. W. Majesky
Developmental Basis of Vascular Smooth Muscle Diversity
Arterioscler. Thromb. Vasc. Biol.,
June 1, 2007;
27(6):
1248 - 1258.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Dogra, S. L. Hall, N. Wedhas, T. A. Linkhart, and A. Kumar
Fibroblast Growth Factor Inducible 14 (Fn14) Is Required for the Expression of Myogenic Regulatory Factors and Differentiation of Myoblasts into Myotubes: EVIDENCE FOR TWEAK-INDEPENDENT FUNCTIONS OF Fn14 DURING MYOGENESIS
J. Biol. Chem.,
May 18, 2007;
282(20):
15000 - 15010.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kawai-Kowase and G. K. Owens
Multiple repressor pathways contribute to phenotypic switching of vascular smooth muscle cells
Am J Physiol Cell Physiol,
January 1, 2007;
292(1):
C59 - C69.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G.C. T. Pipes, E. E. Creemers, and E. N. Olson
The myocardin family of transcriptional coactivators: versatile regulators of cell growth, migration, and myogenesis.
Genes & Dev.,
June 15, 2006;
20(12):
1545 - 1556.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. E. Callis, D. Cao, and D.-Z. Wang
Bone Morphogenetic Protein Signaling Modulates Myocardin Transactivation of Cardiac Genes
Circ. Res.,
November 11, 2005;
97(10):
992 - 1000.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. V. G. Bosc, J. J. Layne, M. T. Nelson, and D. C. Hill-Eubanks
Nuclear Factor of Activated T Cells and Serum Response Factor Cooperatively Regulate the Activity of an {alpha}-Actin Intronic Enhancer
J. Biol. Chem.,
July 15, 2005;
280(28):
26113 - 26120.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zhou and B. P. Herring
Mechanisms Responsible for the Promoter-specific Effects of Myocardin
J. Biol. Chem.,
March 18, 2005;
280(11):
10861 - 10869.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Proweller, W. S. Pear, and M. S. Parmacek
Notch Signaling Represses Myocardin-induced Smooth Muscle Cell Differentiation
J. Biol. Chem.,
March 11, 2005;
280(10):
8994 - 9004.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Vlahopoulos, W. E. Zimmer, G. Jenster, N. S. Belaguli, S. P. Balk, A. O. Brinkmann, R. B. Lanz, V. C. Zoumpourlis, and R. J. Schwartz
Recruitment of the Androgen Receptor via Serum Response Factor Facilitates Expression of a Myogenic Gene
J. Biol. Chem.,
March 4, 2005;
280(9):
7786 - 7792.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-r. Kim-Kaneyama, W. Suzuki, K. Ichikawa, T. Ohki, Y. Kohno, M. Sata, K. Nose, and M. Shibanuma
Uni-axial stretching regulates intracellular localization of Hic-5 expressed in smooth-muscle cells in vivo
J. Cell Sci.,
March 1, 2005;
118(5):
937 - 949.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-X. Wang, P. K. Elder, Y. Zheng, A. R. Strauch, and R. J. Kelm Jr.
Cell Cycle-mediated Regulation of Smooth Muscle {alpha}-Actin Gene Transcription in Fibroblasts and Vascular Smooth Muscle Cells Involves Multiple Adenovirus E1A-interacting Cofactors
J. Biol. Chem.,
February 18, 2005;
280(7):
6204 - 6214.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W. Streb and J. M. Miano
AKAP12{alpha}, an Atypical Serum Response Factor-dependent Target Gene
J. Biol. Chem.,
February 11, 2005;
280(6):
4125 - 4134.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Cao, Z. Wang, C.-L. Zhang, J. Oh, W. Xing, S. Li, J. A. Richardson, D.-Z. Wang, and E. N. Olson
Modulation of Smooth Muscle Gene Expression by Association of Histone Acetyltransferases and Deacetylases with Myocardin
Mol. Cell. Biol.,
January 1, 2005;
25(1):
364 - 376.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Oh, Z. Wang, D.-Z. Wang, C.-L. Lien, W. Xing, and E. N. Olson
Target Gene-Specific Modulation of Myocardin Activity by GATA Transcription Factors
Mol. Cell. Biol.,
October 1, 2004;
24(19):
8519 - 8528.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Boopathi, N. Lenka, S. K. Prabu, J.-K. Fang, F. Wilkinson, M. Atchison, A. Giallongo, and N. G. Avadhani
Regulation of Murine Cytochrome c Oxidase Vb Gene Expression during Myogenesis: YY-1 AND HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN D-LIKE PROTEIN (JKTBP1) RECIPROCALLY REGULATE TRANSCRIPTION ACTIVITY BY PHYSICAL INTERACTION WITH THE BERF-1/ZBP-89 FACTOR
J. Biol. Chem.,
August 20, 2004;
279(34):
35242 - 35254.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kawai-Kowase, H. Sato, Y. Oyama, H. Kanai, M. Sato, H. Doi, and M. Kurabayashi
Basic Fibroblast Growth Factor Antagonizes Transforming Growth Factor-{beta}1-Induced Smooth Muscle Gene Expression Through Extracellular Signal-Regulated Kinase 1/2 Signaling Pathway Activation
Arterioscler. Thromb. Vasc. Biol.,
August 1, 2004;
24(8):
1384 - 1390.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. K. Owens, M. S. Kumar, and B. R. Wamhoff
Molecular Regulation of Vascular Smooth Muscle Cell Differentiation in Development and Disease
Physiol Rev,
July 1, 2004;
84(3):
767 - 801.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. P. Anderson, E. Dodou, A. B. Heidt, S. J. De Val, E. J. Jaehnig, S. B. Greene, E. N. Olson, and B. L. Black
HRC Is a Direct Transcriptional Target of MEF2 during Cardiac, Skeletal, and Arterial Smooth Muscle Development In Vivo
Mol. Cell. Biol.,
May 1, 2004;
24(9):
3757 - 3768.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Selvaraj and R. Prywes
Megakaryoblastic Leukemia-1/2, a Transcriptional Co-activator of Serum Response Factor, Is Required for Skeletal Myogenic Differentiation
J. Biol. Chem.,
October 24, 2003;
278(43):
41977 - 41987.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Kaplan-Albuquerque, C. Garat, V. Van Putten, and R. A. Nemenoff
Regulation of SM22{alpha} expression by arginine vasopressin and PDGF-BB in vascular smooth muscle cells
Am J Physiol Heart Circ Physiol,
October 1, 2003;
285(4):
H1444 - H1452.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-F. Chang, J. Wei, X. Liu, Y.-H. Chen, M. D. Layne, and S.-F. Yet
Identification of a CArG-independent region of the cysteine-rich protein 2 promoter that directs expression in the developing vasculature
Am J Physiol Heart Circ Physiol,
October 1, 2003;
285(4):
H1675 - H1683.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Karasseva, G. Tsika, J. Ji, A. Zhang, X. Mao, and R. Tsika
Transcription Enhancer Factor 1 Binds Multiple Muscle MEF2 and A/T-Rich Elements during Fast-to-Slow Skeletal Muscle Fiber Type Transitions
Mol. Cell. Biol.,
August 1, 2003;
23(15):
5143 - 5164.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Nelander, P. Mostad, and P. Lindahl
Prediction of Cell Type-Specific Gene Modules: Identification and Initial Characterization of a Core Set of Smooth Muscle-Specific Genes
Genome Res.,
August 1, 2003;
13(8):
1838 - 1854.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. S. Kumar and G. K. Owens
Combinatorial Control of Smooth Muscle-Specific Gene Expression
Arterioscler. Thromb. Vasc. Biol.,
May 1, 2003;
23(5):
737 - 747.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. L'honore, N. J. Lamb, M. Vandromme, P. Turowski, G. Carnac, and A. Fernandez
MyoD Distal Regulatory Region Contains an SRF Binding CArG Element Required for MyoD Expression in Skeletal Myoblasts and during Muscle Regeneration
Mol. Biol. Cell,
May 1, 2003;
14(5):
2151 - 2162.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. L. Du, H. S. Ip, J. Li, M. Chen, F. Dandre, W. Yu, M. M. Lu, G. K. Owens, and M. S. Parmacek
Myocardin Is a Critical Serum Response Factor Cofactor in the Transcriptional Program Regulating Smooth Muscle Cell Differentiation
Mol. Cell. Biol.,
April 1, 2003;
23(7):
2425 - 2437.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Xu, Y.-S. Ho, R. P. Ritchie, and L. Li
Human SM22alpha BAC encompasses regulatory sequences for expression in vascular and visceral smooth muscles at fetal and adult stages
Am J Physiol Heart Circ Physiol,
April 1, 2003;
284(4):
H1398 - H1407.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Hoggatt, G. M. Simon, and B. P. Herring
Cell-Specific Regulatory Modules Control Expression of Genes in Vascular and Visceral Smooth Muscle Tissues
Circ. Res.,
December 13, 2002;
91(12):
1151 - 1159.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D.-Z. Wang, S. Li, D. Hockemeyer, L. Sutherland, Z. Wang, G. Schratt, J. A. Richardson, A. Nordheim, and E. N. Olson
Potentiation of serum response factor activity by a family of myocardin-related transcription factors
PNAS,
November 12, 2002;
99(23):
14855 - 14860.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Bidder, J.-S. Shao, N. Charlton-Kachigian, A. P. Loewy, C. F. Semenkovich, and D. A. Towler
Osteopontin Transcription in Aortic Vascular Smooth Muscle Cells Is Controlled by Glucose-regulated Upstream Stimulatory Factor and Activator Protein-1 Activities
J. Biol. Chem.,
November 8, 2002;
277(46):
44485 - 44496.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Sepulveda, S. Vlahopoulos, D. Iyer, N. Belaguli, and R. J. Schwartz
Combinatorial Expression of GATA4, Nkx2-5, and Serum Response Factor Directs Early Cardiac Gene Activity
J. Biol. Chem.,
July 5, 2002;
277(28):
25775 - 25782.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Arai, J. A. Spencer, and E. N. Olson
STARS, a Striated Muscle Activator of Rho Signaling and Serum Response Factor-dependent Transcription
J. Biol. Chem.,
June 28, 2002;
277(27):
24453 - 24459.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. Layne, S.-F. Yet, K. Maemura, C.-M. Hsieh, X. Liu, B. Ith, M.-E. Lee, and M. A. Perrella
Characterization of the Mouse Aortic Carboxypeptidase-Like Protein Promoter Reveals Activity in Differentiated and Dedifferentiated Vascular Smooth Muscle Cells
Circ. Res.,
April 5, 2002;
90(6):
728 - 736.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. D. Eckhart, T. Ozaki, H. Tevaearai, H. A. Rockman, and W. J. Koch
Vascular-Targeted Overexpression of G Protein-Coupled Receptor Kinase-2 in Transgenic Mice Attenuates beta -Adrenergic Receptor Signaling and Increases Resting Blood Pressure
Mol. Pharmacol.,
April 1, 2002;
61(4):
749 - 758.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. G. Bruneau
Transcriptional Regulation of Vertebrate Cardiac Morphogenesis
Circ. Res.,
March 22, 2002;
90(5):
509 - 519.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. L. Allen, C. A. Sartorius, L. K. Sycuro, and L. A. Leinwand
Different Pathways Regulate Expression of the Skeletal Myosin Heavy Chain Genes
J. Biol. Chem.,
November 16, 2001;
276(47):
43524 - 43533.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. Layne, S.-F. Yet, K. Maemura, C.-M. Hsieh, X. Liu, B. Ith, M.-E. Lee, and M. A. Perrella
Characterization of the Mouse Aortic Carboxypeptidase-Like Protein Promoter Reveals Activity in Differentiated and Dedifferentiated Vascular Smooth Muscle Cells
Circ. Res.,
April 5, 2002;
90(6):
728 - 736.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|