Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M010983200 on February 5, 2001

J. Biol. Chem., Vol. 276, Issue 20, 17206-17212, May 18, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/20/17206    most recent
M010983200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chang, P. S.
Right arrow Articles by Olson, E. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chang, P. S.
Right arrow Articles by Olson, E. N.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Muscle Specificity Encoded by Specific Serum Response Factor-binding Sites*

Priscilla S. ChangDagger §, Li LiDagger , John McAnallyDagger , and Eric N. OlsonDagger ||

From the Dagger  Department of Molecular Biology, University of Texas, Southwestern Medical Center, Dallas, Texas 75390-9148 and  Wayne State University School of Medicine, Detroit, Michigan 48201

Received for publication, December 6, 2000, and in revised form, January 17, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Serum response factor (SRF) is a MADS box transcription factor that regulates muscle-specific and growth factor-inducible genes by binding the consensus sequence CC(A/T)6GG, known as a CArG box. Because SRF expression is not restricted solely to muscle, its expression alone cannot account for the muscle specificity of some of its target genes. To understand further the role of SRF in muscle-specific transcription, we created transgenic mice harboring lacZ transgenes linked to tandem copies of different CArG boxes with flanking sequences. CArG boxes from the SM22 and skeletal alpha -actin promoters directed highly restricted expression in developing smooth, cardiac, and skeletal muscle cells during early embryogenesis. In contrast, the CArG box and flanking sequences from the c-fos promoter directed expression throughout the embryo, with no preference for muscle cells. Systematic swapping of the core and flanking sequences of the SM22 and c-fos CArG boxes revealed that cell type specificity was dictated in large part by sequences immediately flanking the CArG box core. Sequences that directed widespread embryonic expression bound SRF more strongly than those that directed muscle-restricted expression. We conclude that sequence variations among CArG boxes influence cell type specificity of expression and account, at least in part, for the ability of SRF to distinguish between growth factor-inducible and muscle-specific genes in vivo.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The MADS box transcription factor, serum response factor (SRF),1 was first identified on the basis of its ability to confer serum inducibility to the c-fos gene through a sequence known as the serum response element (SRE) (reviewed in Ref. 1). Paradoxically, SRF also regulates muscle-specific genes, which are expressed specifically in post-mitotic muscle cells, thus representing a gene regulatory program incompatible with expression of growth-regulated genes. Several mechanisms have been shown to regulate SRF activity, including association with positive and negative cofactors (reviewed in Ref. 2), phosphorylation-dependent changes in DNA binding (3), alternative RNA splicing (4, 5), and regulated nuclear translocation (6). However, the exact mechanisms that enable SRF to distinguish between growth factor-inducible and muscle-specific genes have not been fully explained.

SRF binds as a homodimer to the DNA consensus sequence CC(A/T)6GG, referred to as a CArG box (7, 8). CArG boxes are essential for expression of numerous cardiac, skeletal, and smooth muscle-specific genes (9-24). During embryogenesis, SRF is highly expressed in muscle cell lineages (25-27), but it is not muscle-specific. Thus, SRF expression alone cannot account for the muscle specificity of certain of its target genes. The possibility that cell specificity might be encoded in the sequence of the CArG box itself has been suggested by transfection assays in which CArG boxes from muscle-specific genes were shown to be preferentially active in muscle cells, whereas the c-fos SRE was active in a wider range of cell types (28). However, other studies have concluded that CArG boxes from muscle-specific and serum-inducible genes were functionally interchangeable (29, 30).

We and others have examined the role of SRF in the regulation of the SM22 gene. SM22, which encodes a structural protein related to troponin, is expressed specifically in developing smooth, skeletal, and cardiac muscle during embryogenesis, before becoming restricted to smooth muscle postnatally (31-33). Transcription of SM22 is controlled by a proximal promoter region that contains two CArG boxes; the more 3' CArG box (referred to as CArG-near) is essential for promoter activity in transgenic mice (17, 18, 34).

To understand further the mechanism whereby SRF regulates muscle-specific transcription, we investigated whether CArG boxes from the SM22 and skeletal alpha -actin promoters and their immediate flanking sequences were sufficient to direct muscle-specific expression of a lacZ reporter gene in transgenic mouse embryos. We show that these transgenes are expressed specifically in smooth, cardiac, and skeletal muscle during early embryogenesis, in a pattern similar to that of the endogenous SM22 and skeletal alpha -actin genes. In contrast, a lacZ transgene linked to tandem copies of the c-fos SRE showed widespread embryonic expression. Through creation of chimeric CArG boxes containing different combinations of the SM22 and c-fos core and flanking sequences, we found that sequences immediately surrounding the CArG box specify the expression pattern and that CArG boxes with muscle specificity bind SRF with reduced affinity compared with those that direct ubiquitous expression. These results are consistent with a model in which sequence variations among CArG boxes account for differences in gene expression patterns.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Construction of CArG Box Multimer Constructs-- Oligonucleotides containing the appropriate CArG box core (10 bp) and flanking sequences (15 bp each side) with HindIII sites on both ends were phosphorylated, phenol-extracted, and annealed. Correct multimers were subcloned into the hsp68lacZ vector (35) for generation of transgenic mice. The number and orientations of the CArG repeats were determined by DNA sequencing. Sequences of top strand oligonucleotides containing HindIII sites (with CArG boxes underlined) were as follows: SM22, AGCTTACTTGGTGTCTTTCCCCAAATATGGAGCCTGTGTGGAGTGA; skeletal alpha -actin, AGCTTTCTAGTGCCCGACACCCAAATATGGCTTGGGAAGGGCAGCA; c-fos, AGCTTCTTTACACAGGATGTCCATATTAGGACATCTGCGTCAGCAA; SFS, AGCTTACTTGGTGTCTTTCCCCATATTAGGAGCCTGTGTGGAGTGA; FSF, AGCTTCTTTACACAGGATGTCCAAATATGGACATCTGCGTCAGCAA; FFS, AGCTTCTTTACACAGGATGTCCATATTAGGAGCCTGTGTGGAGTGA; SFF, AGCTTACTTGGTGTCTTTCCCCATATTAGGACATCTGCGTCAGCAA; FSS, AGCTTCTTTACACAGGATGTCCAAATATGGAGCCTGTGTGGAGTGA; and SSF, AGCTTACTTGGTGTCTTTCCCCAAATATGGACATCTGCGTCAGCAA.

Generation of Transgenic Mice-- DNA was gel-purified and eluted using a Nucleospin DNA purification kit (CLONTECH). Transgenic mice were created by pronuclear injection of DNA into fertilized oocytes, and LacZ expression was assayed in F0 embryos as described (36).

beta -Galactosidase Staining and Histology-- Embryos were fixed in 2% formaldehyde, 0.2% glutaraldehyde in PBS on ice for 1 h, washed twice with PBS, and stained overnight at room temperature in 5 mM ferricyanide, 5 mM ferrocyanide, 2 mM MgCl2, 1 mg/ml 5-bromo-4-chloro-3-indolyl beta -D-galactopyranoside (X-Gal) in dimethylformamide in PBS. Embryos were postfixed overnight in 4% formaldehyde after two washes in PBS. Embryos were then successively dehydrated (30, 50, 70, 90, and 100% (v/v) methanol solutions) for 1 h each and left in 100% methanol overnight. Embryos were cleared for 2 h in 2:1 benzyl benzoate/benzyl alcohol, embedded in paraffin, sectioned at 5 µm, rehydrated, and stained with Nuclear Fast Red (37).

Gel Mobility Shift Assays-- SRF was translated in vitro with a TNT T7-coupled reticulocyte lysate system (Promega). The same SM22, c-fos, and skeletal alpha -actin CArG box oligonucleotides used for the construction of the CArG box-dependent transgenes were used as probes in gel mobility shift assays. Sequences of the top strand oligonucleotides (with CArG boxes underlined) for the egr (38) and MCK (39) genes were as follows: egr-1, AGCTTGCCGACCCGGAAACGCCATATAAGGAGCAGGAAGGATCCCA; MCK, AGCTTACGGGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGGGA.

Complementary oligonucleotides were annealed and labeled with Klenow polymerase and [alpha -32P]dCTP. 5 × 104 cpm of labeled probe was incubated for 20 min at room temperature with in vitro translated SRF and poly(dI-dC) in gel shift buffer, as described (40). Antibody supershift experiments were performed with rabbit anti-SRF antiserum (Santa Cruz Biotechnology, sc-335X). DNA-protein complexes were separated by gel electrophoresis on a 5% nondenaturing polyacrylamide gel in 0.5× TBE. Unlabeled competitor DNA was added at 25-, 50-, and 100-fold excess over labeled probe. Relative DNA binding was determined by visualizing the shifted probe with a PhosphorImager and quantified using ImageQuant Program (Molecular Dynamics).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Muscle Specificity of Multimerized SM22 CArG Elements in Transgenic Mouse Embryos-- The 1343-bp SM22 promoter is sufficient to direct expression of a lacZ reporter in developing smooth, cardiac, and skeletal muscle cells during mouse embryogenesis (Fig. 1A, 34). Previous studies showed that a CArG box in the proximal SM22 promoter, referred to as CArG-near, is essential for muscle-specific expression of SM22 (17). To determine whether this CArG box might be sufficient to confer muscle specificity, we created a transgene (4xSM22-lacZ) containing four tandem copies of CArG-near with 15 nucleotides of flanking sequence on each side. The CArG boxes were linked in a head-to-tail orientation upstream of a lacZ reporter under control of the heat shock protein (hsp)-68 basal promoter, which is transcriptionally silent in mouse embryos (35).


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 1.   LacZ expression patterns directed by the 1343-bp SM22 reporter and a multimerized SM22 CArG box. E11.5 transgenic mouse embryos harboring lacZ transgenes controlled by the 1343-bp SM22 promoter (A) or synthetic multimers of SM22 CArG-near upstream of the hsp68 basal promoter (B) were stained for LacZ expression. Strong expression of LacZ can be seen specifically in the heart (h) and somite myotomes (m), as well as the dorsal aorta (da), cranial vasculature (cv), and other vascular structures in A and B. The multimerized SM22 CArG box also directed expression in the neural tube (nt). Three representative F0 embryos harboring 4xSM22-lacZ are shown. The expression patterns were similar in all embryos, except that the intensity of LacZ expression varied.

The multimerized SM22 CArG-near element directed LacZ expression in a highly restricted pattern in F0 transgenic mouse embryos at E11.5 (Fig. 1B). Similar expression patterns were observed in 9 transgenic F0 embryos harboring this transgene. Three representative embryos are shown in Fig. 1B. As observed with the native SM22 promoter (Fig. 1A), LacZ expression directed by the multimerized SM22 CArG box was observed throughout the dorsal aorta and cranial vasculature, as well as in the heart and somite myotomes. Expression in the vasculature and somites appeared to mimic that of the 1343-bp SM22 promoter. The multimerized SM22 CArG box directed LacZ expression at very high levels throughout the atrial and ventricular chambers of the heart at E11.5. This is in contrast to the native SM22 promoter, which is active specifically in the future right ventricle following looping morphogenesis (34). The 4xSM22-lacZ transgene was also expressed in the ventral region of the neural tube, where the 1343-bp promoter is not expressed. There was virtually no expression of the transgene outside of these cell types. The expression pattern of the multimerized CArG-near transgene is similar to that of SRF, which is enriched in muscle cells and the ventral neural tube during embryogenesis (25-27).

Lack of Muscle Specificity of the c-fos CArG Box in Transgenic Mouse Embryos-- To determine if the muscle-restricted activity of the SM22 CArG box reflected a general property of CArG boxes, we examined the expression pattern of the hsp68-lacZ transgene linked to four copies of the CArG boxes from the skeletal alpha -actin and c-fos promoters. Like the 4xSM22-lacZ transgene, the skeletal alpha -actin CArG box transgene (4x-Actin-lacZ)-directed LacZ expression in cardiac, skeletal, and smooth muscle cell lineages, as well as in the ventral neural tube, at E11.5 (Fig. 2A).


View larger version (59K):
[in this window]
[in a new window]
 
Fig. 2.   LacZ expression patterns directed by multimerized skeletal alpha -actin CArG and c-fos CArG boxes. E11.5 transgenic mouse embryos harboring 4xActin-lacZ (A-C) and 4xfos-lacZ (D-F) transgenes were stained for LacZ expression. In the embryos harboring 4xActin-lacZ, strong expression can be seen specifically in the heart (h), somite myotomes (m), the dorsal aorta (da), cranial vasculature (cv), and other vascular structures, as well as in the neural tube (nt). In the embryo harboring 4xfos-lacZ, LacZ expression was widespread without specificity for myogenic cell types. Three representative F0 embryos harboring each transgene are shown. The expression patterns for 4xActin-lacZ were similar in all embryos, except that the intensity of LacZ expression varied. The 4xfos-lacZ transgene showed much more widespread and variable expression.

In contrast to the highly specific expression patterns of the SM22 and skeletal alpha -actin CArG boxes, the c-fos CArG box directed widespread embryonic expression (Fig. 2B). This transgene was expressed in the heart, somites, and aorta, but there was also extensive staining throughout the embryo, suggesting that the c-fos CArG element was active in a wider range of cell types than the SM22 and skeletal alpha -actin CArG boxes. The broad expression pattern of the 4xfos-lacZ transgene suggests that the c-fos CArG box is active in cells that express SRF at relatively low levels.

Transverse sections of transgenic embryos harboring the multimerized SM22 CArG and c-fos CArG box transgenes confirmed the differences in their expression patterns. LacZ was expressed specifically in the heart, somites, dorsal aorta, and ventral neural tube in embryos harboring the 4xSM22-lacZ transgene, whereas LacZ expression was observed throughout the entire embryo with the 4xfos-lacZ transgene (Fig. 3).


View larger version (86K):
[in this window]
[in a new window]
 
Fig. 3.   Sections of transgenic embryos harboring lacZ transgenes linked to multimerized SM22 and c-fos CArG boxes. E11.5 transgenic mouse embryos harboring the 4xSM22-lacZ (A) or 4xfos-lacZ (B) transgenes were stained for LacZ expression, sectioned at the level of the heart, and stained with Nuclear Fast Red. A, LacZ expression can be seen in the atria (a) and right and left ventricles (rv and lv) of the heart, the myotome portion of the somites (m), the paired dorsal aorta (da), and in a subset of cells in the ventral neural tube (nt). B, staining can be seen throughout the embryo.

Analysis of Chimeric CArG Elements in Transgenic Embryos Demonstrates Specificity of Expression Based on Flanking Sequences-- We next sought to identify the DNA sequences responsible for the distinctly different patterns of transgene expression directed by the SM22 and c-fos CArG boxes. We therefore created chimeric CArG elements by systematically swapping the core sequences and surrounding nucleotides of the two CArG boxes. Tandem copies of these chimeric CArG elements were linked to the hsp68-lacZ reporter and tested in F0 transgenic embryos at E11.5. As with the multimerized SM22, c-fos, and skeletal alpha -actin CArG constructs, all of the CArG elements were organized in a head-to-tail orientation. Each CArG box was named according to the identity of the 5'-flanking, core (CC(A/T)6GG), and 3'-flanking nucleotides, with S referring to SM22 and F referring to c-fos (Fig. 4). The number of CArG boxes contained in each transgene is shown in Table I. At least three independent transgenic embryos were examined with each construct. As shown for the parental constructs in Fig. 1, the overall expression pattern was similar in different embryos harboring a given construct, but the intensity of expression varied, presumably because of differences in transgene copy number or sites of integration. We also examined the expression of multiple different transgenes containing between 3 and 6 tandem copies of the different CArG boxes, but we saw no significant differences in expression pattern for a given transgene, indicating that the number of copies of CArG boxes did not influence the pattern of expression. Representative embryos with each transgene are shown in Fig. 5.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 4.   Diagram of chimeric CArG elements. Sequences of the CArG boxes and flanking regions of the SM22 CArG, c-fos CArG, and chimeric CArG elements. Each CArG element contains the 10-nucleotide CArG box and 15 nucleotides of flanking sequence both 5' and 3' of the core CArG box. SM22 sequences are shaded in black.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Summary of CArG box-containing transgenes
Embryos harboring the indicated chimeric CArG boxes upstream of hsp68-lacZ were stained for lacZ expression at E11.5. Forty two total transgenic embryos were analyzed. The number of copies of each CArG box in each transgene construct and the number of transgenic embryos examined are indicated.


View larger version (53K):
[in this window]
[in a new window]
 
Fig. 5.   Expression patterns of lacZ transgenes linked to multimerized chimeric CArG elements. E11.5 transgenic mouse embryos harboring hsp68-lacZ transgenes linked to the indicated multimerized CArG boxes were stained for LacZ expression. Sequences of the CArG boxes are shown in Fig. 4. The numbers of tandem copies of the each CArG box are shown in Table I, along with the number of transgenic embryos analyzed. da, dorsal aorta; h, heart; m, myotome; nt, neural tube; v, umbilical vessel.

The CArG box element SFS, containing the SM22-flanking sequences and the c-fos core sequence, directed expression in a pattern similar to that of the SM22 CArG box (SSS) (Fig. 5, compare A and B), except that the level of expression was weaker. This result suggested that the core CArG sequence was not responsible for the specificity of the SM22 CArG box expression pattern. Conversely, the CArG box FSF, containing the c-fos flanking sequences and the SM22 core sequence, showed a widespread expression pattern, reminiscent of the c-fos CArG box (FFF) (Fig. 5, compare G and H)). High background staining with FSF and FFF was especially pronounced in the head. The other four chimeric CArGs (FSS, SSF, SFF, and FFS) directed expression in patterns that appeared to be intermediate between the highly specific pattern seen with the SM22 CArG and the widespread pattern seen with the c-fos CArG (Fig. 5, C-F). Together, these data suggest that the differences in expression pattern of different CArG element multimers are determined primarily by the 15 flanking nucleotides on both sides of the core CArG boxes.

High Affinity Binding of SRF to CArG Boxes Correlates with Widespread Transgene Expression-- To determine whether there might be a correlation between DNA binding affinity and expression pattern, we performed gel mobility shift assays with in vitro translated SRF and the different chimeric CArG elements. As shown in Fig. 6A, the c-fos CArG element bound SRF more avidly than the SM22 CArG element (compare lanes 1 and 2). This difference in SRF binding appeared to be attributable to the flanking sequences of these CArG boxes, because the chimeric CArG SFS (lane 3) bound SRF with a reduced affinity similar to that of the SM22 CArG, whereas FSF (lane 4) bound SRF very strongly, like the c-fos CArG box. The CArGs with mixed flanking sequences (FSS, SSF, SFF, and FFS) showed SRF binding intermediate between that of the other CArG elements. The single major complex observed in gel mobility shift assays was confirmed to contain SRF by supershift with SRF antibody (lane 9).


View larger version (67K):
[in this window]
[in a new window]
 
Fig. 6.   Gel mobility shift assays of SRF binding to different CArG boxes. A, oligonucleotide probes corresponding to the indicated CArG elements (see Fig. 4) were used as probes in gel mobility shift assays with in vitro translated SRF. The SM22 CArG and SFS (lanes 1 and 3) bound SRF relatively weakly, whereas the c-fos CArG and FSF (lanes 2 and 4) bound SRF most strongly. SSF, FSS, SFF, and FFS (lanes 5-8) had intermediate affinities for SRF. Note that the SRF-containing complex was specifically supershifted with SRF antibody (lane 9). B, oligonucleotide probes corresponding to the indicated CArG boxes were used as probes in gel mobility shift assays with in vitro translated SRF. SRF bound strongly to the CArG elements from c-fos and egr1 and weakly to CArG boxes from skeletal alpha -actin, MCK, and SM22. The position of the SRF-DNA complex is shown with an arrowhead to the left of each panel. All assays contained equal amounts of labeled probe, as described under "Materials and Methods."

To compare further the relative affinities of SRF for the SM22 and c-fos CArG boxes, we performed competition experiments with each of the chimeric CArG sequences and 32P-labeled probes for the SM22 and c-fos CArG elements (Fig. 7A). Results from competition experiments are plotted in Fig. 7B. Binding of SRF to the SM22 CArG probe was competed most effectively by the FSF and FFF sequences. The SFS and SSS sequences were the least effective competitors, and other chimeric CArG sequences showed intermediate abilities to compete for SRF binding. A similar order of effectiveness in competition for SRF DNA binding by the different CArG sequences was observed with the c-fos CArG probe. Thus, those CArG sequences that contained the c-fos-flanking regions and directed widespread expression in vivo showed the strongest binding of SRF. Conversely, those CArG sequences that contained the SM22 flanking regions and directed muscle-restricted expression in vivo showed relatively weak binding of SRF.


View larger version (55K):
[in this window]
[in a new window]
 
Fig. 7.   Competition assays for SRF binding to the SM22 and c-fos CArG boxes. A, oligonucleotide probes corresponding to the SM22 (upper panels) and c-fos (lower panels) CArG boxes were used as probes in gel mobility shift assays with in vitro translated SRF. Each of the CArG sequences shown in Fig. 4 were used as unlabeled competitors at 25-, 50-, and 100-fold excess over labeled probe. The increasing concentrations are indicated by the black triangles. CArG boxes containing the c-fos flanking sequences competed for SRF binding more effectively than those containing the SM22 flanking sequences. B, relative binding of SRF to the SM22 (left panel) and c-fos (right panel) probes in A was quantitated by PhosphorImager and plotted as percent of maximal SRF binding in the absence of competitor.

Comparison of SRF Binding to Different CArG Boxes-- The above findings revealed a correlation between strength of SRF binding and specificity of expression. As a further test of this correlation, we examined the binding of SRF to CArG boxes from other muscle-specific and ubiquitously expressed genes (Fig. 6B). The skeletal alpha -actin CArG box, which directed a muscle expression pattern similar to that of SM22 CArG, bound SRF relatively weakly. Similarly, the CArG box in the skeletal muscle-specific enhancer of the muscle creatine kinase (MCK) gene also bound SRF weakly. In contrast, SRF bound strongly to the CArG box from egr-1, which, like c-fos, is widely expressed.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

SRF is an important regulator of both growth factor-inducible and muscle-specific genes, but the mechanisms whereby SRF distinguishes between these two sets of genes, which show entirely different expression patterns, are not fully resolved. Our results demonstrate that different CArG boxes with flanking sequences can direct distinct temporospatial expression patterns during mouse embryogenesis. Whereas CArG boxes from the SM22 and skeletal alpha -actin promoters can direct muscle-restricted transcription, the c-fos SRE directs widespread embryonic expression. The different activities of these CArG boxes correlate with their relative affinities for SRF; CArG boxes that direct muscle-restricted expression bind SRF relatively weakly compared with those, such as the c-fos SRE, that direct widespread expression.

Differential Cellular Responsiveness of CArG Boxes-- How might different CArG boxes encode differential information for cell type specificity? One mechanism consistent with our results is that CArG boxes with relatively high affinity for SRF are able to detect low levels of SRF in a wide range of cell types, whereas muscle-specific CArG boxes, which exhibit reduced affinity for SRF, are only able to detect the higher levels of SRF that exist in muscle cells (as well as in certain neural cell types). According to this model, the transgenes with multimerized CArG boxes respond to endogenous SRF levels with different sensitivities, resulting in different cellular expression patterns. Consistent with this interpretation, SRF expression is highly enriched in developing muscle cell lineages and in a subset of neuroectodermal derivatives during embryogenesis (25-27), resembling the expression patterns of the SM22 and skeletal alpha -actin CArG-containing transgenes.

The possibility that the multimerized CArG boxes contained in our transgenes "read" SRF levels in vivo is also suggested by the similarity in expression pattern seen with the SM22 and skeletal alpha -actin CArG multimers. During embryogenesis, the endogenous SM22 and skeletal alpha -actin genes show different temporospatial expression patterns in developing muscle cell lineages (32, 33, 41, 42). The fact that the multimerized SM22 and skeletal alpha -actin CArG boxes direct the same expression patterns in skeletal, cardiac, and smooth muscle cells in vivo also indicates that SRF is not solely responsible for the normal expression patterns of those genes.

This is, to our knowledge, the first analysis of the potential interchangeability of CArG boxes in transgenic mice. However, previous studies of other CArG boxes in transfection assays have suggested a correlation between low affinity DNA binding of SRF and muscle-restricted activity. Replacement of the most proximal CArG box in the skeletal alpha -actin promoter with the c-fos SRE resulted in constitutive expression of the promoter in transfected nonmuscle cells (28). Similarly, replacement of two CArG boxes from the smooth muscle alpha -actin promoter with the c-fos SRE caused a relaxation in cell-specific expression in transfected cells (43).

Regulation of SRF Activity by Cofactor Interactions-- Although our results indicate that different CArG boxes confer cell specificity through differences in affinity for SRF, this does not discount the potential importance of SRF cofactors in SRF-dependent transcription. Indeed, there are numerous examples of positive and negative cofactors for SRF. SRF activates transcription through the c-fos SRE by recruiting ternary complex factor (TCF), an ETS domain transcription factor that recognizes the CAGGA motif immediately 5' of the CArG box (44, 45). TCF binding may contribute to the widespread expression seen with multimers of the c-fos SRE. However, since the SM22 and skeletal alpha -actin CArG boxes are not flanked by TCF consensus binding sites, it is unlikely that TCF plays a positive role in muscle-specific expression from these sequences.

Several myogenic cofactors for SRF have also been described. For example, the cardiac homeodomain protein Nkx2.5 and the zinc finger transcription factor GATA4 interact with SRF to activate certain cardiac-specific genes (46, 47), and myogenic basic helix-loop-helix proteins have been reported to interact with SRF to regulate skeletal muscle genes (48). Because these cofactors can associate with SRF without binding to DNA, they would not be expected to distinguish between different CArG box sequences. However, it is conceivable that binding of SRF to specific CArG boxes might influence its interactions with such factors.

The homeodomain protein phox/MHox also interacts with SRF to increase its affinity for certain CArG boxes (49, 50) and has been proposed to confer smooth muscle specificity to a CArG box from the smooth muscle alpha -actin gene (51). This type of interaction may contribute to the specificity of CArG box-dependent expression in certain cell types, but because phox is expressed predominantly in mesenchymal cells within the branchial arches and limb buds (52), it cannot account for the muscle-restricted expression of the multimerized SM22 and skeletal alpha -actin CArG sequences observed in our studies.

Simplified Regulation of CArG Multimers-- Our approach in the present study was to investigate the activity of isolated CArG boxes and adjacent sequences outside the context of their native promoters. This is, of course, an over-simplification of the actual regulatory events that govern the activity of these sequences in vivo and does not discount the potential importance of other regulatory factors that bind sites surrounding the CArG boxes in their native promoters. There is also evidence for complex interactions among distant CArG boxes associated with the smooth muscle alpha -actin gene that result in selective activation of transcription in specific muscle cell types (23).2 The artificial transgenes analyzed in the present study would be independent of this type of regulation, which may involve long range alterations in chromatin structure. In this regard, it is interesting to note that SRF interacts with the high mobility group protein, SSRP1, implicated in chromatin remodeling (53).

Whereas the SM22 and skeletal alpha -actin CArG multimers direct a highly restricted expression pattern at E11.5 and earlier in embryogenesis, these sequences direct more widespread expression during late fetal development and postnatally (data not shown). Thus, the mechanisms that regulate the activity of these sequences appear to change during development. This may explain why previous studies concluded that the cardiac alpha -actin CArG and c-fos SRE were functionally interchangeable in injected Xenopus embryos (29).

Previously, we generated transgenic mice harboring multimerized binding sites for the MADS box transcription factor MEF2, which shares homology with the DNA binding and dimerization domains of SRF (54). During embryogenesis, these "MEF2 sensor" mice showed highly specific expression of LacZ in developing muscle and neural cell lineages (54); the same cell types in which MEF2 is expressed at highest levels. After birth, the MEF2-lacZ transgene was down-regulated in skeletal and cardiac muscle, despite high levels of MEF2 protein in these tissues, but it could be activated in response to various calcium-dependent signal transduction pathways (55, 56). Multimerized MEF2-binding sites from the desmin enhancer, which is muscle-specific, or the c-jun promoter, which is growth factor-inducible, direct similar expression patterns in vivo (54). Together, these findings suggest that SRF and MEF2 use different mechanisms to confer cell type specificity through their target sequences.

In summary, the results of the present study demonstrate that SRF can discriminate between different target genes based on differential affinity for CArG boxes. Such differential binding is likely to contribute to the specificity of expression of SRF-dependent genes in vivo and is likely to be profoundly influenced by cofactor interactions and intracellular signals.

    ACKNOWLEDGEMENTS

We thank R. Schwartz for reagents and M. Parmacek for sharing results prior to publication. We also thank A. Tizenor for graphics, J. Richardson and members of his lab for assistance with histology, and members of our lab for input and support.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Supported by a Medical Science Training Program grant from the National Institutes of Health.

|| Supported by grants from the National Institutes of Health and the American Heart Association. To whom correspondence should be addressed: Dept. of Molecular Biology, University of Texas, Southwestern Medical Center, 6000 Harry Hines Blvd., Dallas, TX 75390-9148. Tel.: 214-648-1187; Fax: 214-648-1196; E-mail: eolson@hamon.swmed.edu.

Published, JBC Papers in Press, February 5, 2001, DOI 10.1074/jbc.M010983200

2 J. Spencer and E. N. Olson, manuscript in preparation.

    ABBREVIATIONS

The abbreviations used are: SRF, serum response factor; MCK, muscle creatine kinase; SRE, serum response element; TCF, ternary complex factor; PBS, phosphate-buffered saline; bp, base pair.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Treisman, R. (1995) EMBO J. 14, 4905-4913
2. Treisman, R. (1994) Curr. Opin. Genet. & Dev. 4, 96-101
3. Manak, J. R., and Prywes, R. (1991) Mol. Cell. Biol. 11, 3652-3659
4. Belaguli, N. S., Zhou, W., Trinh, T.-H. T., Majesky, M. W., and Schwartz, R. J. (1999) Mol. Cell. Biol. 19, 4582-4591
5. Kemp, P. R., and Metcalfe, J. C. (2000) Biochem. J. 345, 445-451
6. Camoretti-Mercado, B., Liu, H. W., Halayko, A. J., Forsythe, S. M., Kyle, J. W., Li, B., Fu, Y., McConville, J., Kogut, P., Vieira, J. E., Patel, N. M., Hershenson, M. B., Fuchs, E., Sinha, S., Miano, J. M., Parmacek, M. S., Burkhardt, S. K., and Solway, J. (2000) J. Biol. Chem. 275, 30387-30393
7. Minty, A., and Kedes, L. (1986) Mol. Cell. Biol. 6, 2125-2136
8. Grichnik, J. M., Bergsma, D. J., and Schwartz, R. J. (1987) Trans. Contr. Mech. , pp. 57-69, Alan R. Liss, Inc., New York
9. Mohun, T., Taylor, M., Garrett, N., and Gurdon, J. B. (1989) EMBO J. 8, 1153-1161
10. Walsh, K. (1989) Mol. Cell. Biol. 9, 2191-2201
11. Chow, K. L., and Schwartz, R. J. (1990) Mol. Cell. Biol. 10, 528-538
12. Boxer, L. M., Prywes, R., Roeder, R. G., and Kedes, L. (1989) Mol. Cell. Biol. 9, 515-522
13. Lee, T., Chow, C., Fang, K. L., and Schwartz, R. J. (1991) Mol. Cell. Biol. 11, 5090-5100
14. Miwa, T., and Kedes, L. (1987) Mol. Cell. Biol. 7, 2803-2813
15. Bergsma, D. J., Grichnik, J. M., Gossett, L. M. A., and Schwartz, R. J. (1986) Mol. Cell. Biol. 6, 2462-2475
16. Grichnik, J. M., French, B. A., and Schwartz, R. J. (1988) Mol. Cell. Biol. 8, 4587-4597
17. Li, L., Liu, Z.-C., Mercer, B., Overbeek, P., and Olson, E. N. (1997) Dev. Biol. 187, 311-321
18. Kim, S., Ip, H. S., Lu, M. M., Clendenin, C., and Parmacek, M. S. (1997) Mol. Cell. Biol. 17, 2266-2278
19. Katoh, Y., Loukianov, E., Kopras, E., Zilberman, A., and Periasamy, M. (1994) J. Biol. Chem. 269, 30538-30545
20. Obata, H., Hayashi, K., Nishida, W., Momiyama, T., Uchida, A., Ochi, T., and Sobue, K. (1997) J. Biol. Chem. 272, 26643-26651
21. Herring, B. P., and Smith, A. F. (1997) Am. J. Physiol. 272, C1394-C1404
22. Blank, R. S., McQuinn, T. C., Yin, K. C., Thompson, M. M., Takeyasu, K., Schwartz, R. J., and Owens, G. K. (1992) J. Biol. Chem. 267, 984-989
23. Mack, C. P., and Owens, G. K. (1999) Circ. Res. 84, 852-861
24. Miano, J. M., Carlson, M. J., Spencer, J. A., and Misra, R. P. (2000) J. Biol. Chem. 275, 9814-9882
25. Croissant, J. D., Kim, J. H., Eichele, G., Goering, L., Lough, J., Prywes, R., and Schwartz, R. J. (1996) Dev. Biol. 177, 250-264
26. Belaguli, N. S., Schildmeyer, L. A., and Schwartz, R. J. (1997) J. Biol. Chem. 272, 18222-18231
27. Vogel, A. M., and Gerster, T. (1999) Mech. Dev. 81, 217-221
28. Santoro, I. M., and Walsh, K. (1991) Mol. Cell. Biol. 11, 6296-6305
29. Taylor, M., Treisman, R., Garrett, N., and Mohun, T. (1989) Development 106, 67-78
30. Tuil, D., Clergue, N., Montarras, D., Pinset, C., Kahn, A., and Tuy, F. P.-D. (1990) J. Mol. Biol. 213, 677-686
31. Takahashi, K., and Nadal-Ginard, B. (1991) J. Biol. Chem. 266, 13284-13288
32. Solway, J., Seltzer, J., Samaha, F. F., Kim, S., Alger, L. E., Niu, Q., Morrisey, E. E., Ip, H. S., and Parmacek, M. S. (1995) J. Biol. Chem. 270, 13460-13469
33. Li, L., Miano, J. M., Cserjesi, P., and Olson, E. N. (1996) Circ. Res. 78, 188-195
34. Li, L., Miano, J. M., Mercer, B., and Olson, E. N. (1996) J. Cell Biol. 132, 849-859
35. Kothary, R., Clapoff, S., Darling, S., Perry, M. D., Moran, L. A., and Rossant, J. (1989) Development 105, 707-714
36. Cheng, T.-C., Hanley, T. A., Mudd, J., Merlie, J. P., and Olson, E. N. (1992) J. Cell Biol. 119, 1649-1656
37. Moller, W., and Moller, G. (1994) Biotechnol. Histochem. 69, 289-290
38. Tsai-Morris, C. H., Cao, X. M., and Sukhatme, V. P. (1988) Nucleic Acids Res. 16, 8835-8846
39. Sternberg, E. A., Spizz, G., Perry, M. W., Vizard, D., Weil, T., and Olson, E. N. (1988) Mol. Cell. Biol. 8, 2896-2909
40. Brennan, T. J., and Olson, E. N. (1990) Genes Dev. 4, 582-595
41. Ruzicka, D. L., and Schwartz, R. J. (1988) J. Cell Biol. 107, 2575-2586
42. Lyons, G. E., Buckingham, M. E., and Mannherz, H. G. (1991) Development 111, 451-454
43. Hautmann, M. B., Madsen, C. S., Mack, C. P., and Owens, G. K. (1998) J. Biol. Chem. 273, 8398-8406
44. Hipskind, R. A., Rao, V. N., Mueller, C. G. F., Reddy, E. S. P., and Nordheim, A. (1991) Nature 354, 531-534
45. Gille, H., Sharrocks, A. D., and Shaw, P. E. (1992) Nature 358, 414-417
46. Chen, C. Y., and Schwartz, R. J. (1996) Mol. Cell. Biol. 16, 6372-6384
47. Sepulveda, J. L., Belaguli, N., Nigam, V., Chen, C. Y., Nemer, M., and Schwartz, R. J. (1998) Mol. Cell. Biol. 18, 3405-3415
48. Groisman, R., Masutani, H., Leibovitch, M. P., Robin, P., Soudant, I., Trouche, D., and Harel-Bellan, A. (1996) J. Biol. Chem. 271, 5258-5264
49. Grueneberg, D. A., Natesan, S., Alexandre, C., and Gilman, M. Z. (1992) Science 257, 1089-1095
50. Gruenberg, D. A., Simon, K. J., Brennan, K., and Gilman, M. (1995) Mol. Cell. Biol. 15, 3318-3326
51. Hautmann, M. B., Thompson, M. M., Swartz, E. A., Olson, E. N., and Owens, G. K. (1997) Circ. Res. 81, 600-610
52. Cserjesi, P., Lilly, B., Bryson, L., Wang, Y., Sassoon, D. A., and Olson, E. N. (1992) Development 115, 1087-1101
53. Spencer, J., Baron, M. H., and Olson, E. N. (1999) J. Biol. Chem. 274, 15686-15693
54. Naya, F. J., Wu, C., Richardson, J. A., Overbeek, P., and Olson, E. N. (1999) Development 126, 2045-2052
55. Passier, R., Zeng, H., Frey, N., Naya, F. J., Nicol, R. L., McKinsey, T. A., Overbeek, P., Richardson, J. A., Grant, S. R., and Olson, E. N. (2000) J. Clin. Invest. 105, 1395-1406
56. Wu, H., Naya, F. J., McKinsey, T., Mercer, B., Bassel-Duby, R., Olson, E. N., and Williams, R. S. (2000) EMBO J. 19, 1963-1973


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
J.-R. Kim, H. J. Kee, J.-Y. Kim, H. Joung, K.-I. Nam, G. H. Eom, N. Choe, H.-S. Kim, J. C. Kim, H. Kook, et al.
Enhancer of Polycomb1 Acts on Serum Response Factor to Regulate Skeletal Muscle Differentiation
J. Biol. Chem., June 12, 2009; 284(24): 16308 - 16316.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. Camp, A. De Jaco, L. Zhang, M. Marquez, B. De La Torre, and P. Taylor
Acetylcholinesterase Expression in Muscle Is Specifically Controlled by a Promoter-Selective Enhancesome in the First Intron
J. Neurosci., March 5, 2008; 28(10): 2459 - 2470.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. H. Hong, H. Sun, C. H. Jin, M. Chapman, J. Hu, W. Chang, K. Burnett, J. Rosen, A. Negro-Vilar, and J. N. Miner
Cell-Specific Activation of the Human Skeletal {alpha}-Actin by Androgens
Endocrinology, March 1, 2008; 149(3): 1103 - 1112.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. J. Potthoff, M. A. Arnold, J. McAnally, J. A. Richardson, R. Bassel-Duby, and E. N. Olson
Regulation of Skeletal Muscle Sarcomere Integrity and Postnatal Muscle Function by Mef2c
Mol. Cell. Biol., December 1, 2007; 27(23): 8143 - 8151.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. W. Majesky
Developmental Basis of Vascular Smooth Muscle Diversity
Arterioscler. Thromb. Vasc. Biol., June 1, 2007; 27(6): 1248 - 1258.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Dogra, S. L. Hall, N. Wedhas, T. A. Linkhart, and A. Kumar
Fibroblast Growth Factor Inducible 14 (Fn14) Is Required for the Expression of Myogenic Regulatory Factors and Differentiation of Myoblasts into Myotubes: EVIDENCE FOR TWEAK-INDEPENDENT FUNCTIONS OF Fn14 DURING MYOGENESIS
J. Biol. Chem., May 18, 2007; 282(20): 15000 - 15010.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. Kawai-Kowase and G. K. Owens
Multiple repressor pathways contribute to phenotypic switching of vascular smooth muscle cells
Am J Physiol Cell Physiol, January 1, 2007; 292(1): C59 - C69.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
G.C. T. Pipes, E. E. Creemers, and E. N. Olson
The myocardin family of transcriptional coactivators: versatile regulators of cell growth, migration, and myogenesis.
Genes & Dev., June 15, 2006; 20(12): 1545 - 1556.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
T. E. Callis, D. Cao, and D.-Z. Wang
Bone Morphogenetic Protein Signaling Modulates Myocardin Transactivation of Cardiac Genes
Circ. Res., November 11, 2005; 97(10): 992 - 1000.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. V. G. Bosc, J. J. Layne, M. T. Nelson, and D. C. Hill-Eubanks
Nuclear Factor of Activated T Cells and Serum Response Factor Cooperatively Regulate the Activity of an {alpha}-Actin Intronic Enhancer
J. Biol. Chem., July 15, 2005; 280(28): 26113 - 26120.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Zhou and B. P. Herring
Mechanisms Responsible for the Promoter-specific Effects of Myocardin
J. Biol. Chem., March 18, 2005; 280(11): 10861 - 10869.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Proweller, W. S. Pear, and M. S. Parmacek
Notch Signaling Represses Myocardin-induced Smooth Muscle Cell Differentiation
J. Biol. Chem., March 11, 2005; 280(10): 8994 - 9004.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Vlahopoulos, W. E. Zimmer, G. Jenster, N. S. Belaguli, S. P. Balk, A. O. Brinkmann, R. B. Lanz, V. C. Zoumpourlis, and R. J. Schwartz
Recruitment of the Androgen Receptor via Serum Response Factor Facilitates Expression of a Myogenic Gene
J. Biol. Chem., March 4, 2005; 280(9): 7786 - 7792.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
J.-r. Kim-Kaneyama, W. Suzuki, K. Ichikawa, T. Ohki, Y. Kohno, M. Sata, K. Nose, and M. Shibanuma
Uni-axial stretching regulates intracellular localization of Hic-5 expressed in smooth-muscle cells in vivo
J. Cell Sci., March 1, 2005; 118(5): 937 - 949.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-X. Wang, P. K. Elder, Y. Zheng, A. R. Strauch, and R. J. Kelm Jr.
Cell Cycle-mediated Regulation of Smooth Muscle {alpha}-Actin Gene Transcription in Fibroblasts and Vascular Smooth Muscle Cells Involves Multiple Adenovirus E1A-interacting Cofactors
J. Biol. Chem., February 18, 2005; 280(7): 6204 - 6214.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. W. Streb and J. M. Miano
AKAP12{alpha}, an Atypical Serum Response Factor-dependent Target Gene
J. Biol. Chem., February 11, 2005; 280(6): 4125 - 4134.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. Cao, Z. Wang, C.-L. Zhang, J. Oh, W. Xing, S. Li, J. A. Richardson, D.-Z. Wang, and E. N. Olson
Modulation of Smooth Muscle Gene Expression by Association of Histone Acetyltransferases and Deacetylases with Myocardin
Mol. Cell. Biol., January 1, 2005; 25(1): 364 - 376.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Oh, Z. Wang, D.-Z. Wang, C.-L. Lien, W. Xing, and E. N. Olson
Target Gene-Specific Modulation of Myocardin Activity by GATA Transcription Factors
Mol. Cell. Biol., October 1, 2004; 24(19): 8519 - 8528.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Boopathi, N. Lenka, S. K. Prabu, J.-K. Fang, F. Wilkinson, M. Atchison, A. Giallongo, and N. G. Avadhani
Regulation of Murine Cytochrome c Oxidase Vb Gene Expression during Myogenesis: YY-1 AND HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN D-LIKE PROTEIN (JKTBP1) RECIPROCALLY REGULATE TRANSCRIPTION ACTIVITY BY PHYSICAL INTERACTION WITH THE BERF-1/ZBP-89 FACTOR
J. Biol. Chem., August 20, 2004; 279(34): 35242 - 35254.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Kawai-Kowase, H. Sato, Y. Oyama, H. Kanai, M. Sato, H. Doi, and M. Kurabayashi
Basic Fibroblast Growth Factor Antagonizes Transforming Growth Factor-{beta}1-Induced Smooth Muscle Gene Expression Through Extracellular Signal-Regulated Kinase 1/2 Signaling Pathway Activation
Arterioscler. Thromb. Vasc. Biol., August 1, 2004; 24(8): 1384 - 1390.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
G. K. Owens, M. S. Kumar, and B. R. Wamhoff
Molecular Regulation of Vascular Smooth Muscle Cell Differentiation in Development and Disease
Physiol Rev, July 1, 2004; 84(3): 767 - 801.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. P. Anderson, E. Dodou, A. B. Heidt, S. J. De Val, E. J. Jaehnig, S. B. Greene, E. N. Olson, and B. L. Black
HRC Is a Direct Transcriptional Target of MEF2 during Cardiac, Skeletal, and Arterial Smooth Muscle Development In Vivo
Mol. Cell. Biol., May 1, 2004; 24(9): 3757 - 3768.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Selvaraj and R. Prywes
Megakaryoblastic Leukemia-1/2, a Transcriptional Co-activator of Serum Response Factor, Is Required for Skeletal Myogenic Differentiation
J. Biol. Chem., October 24, 2003; 278(43): 41977 - 41987.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
N. Kaplan-Albuquerque, C. Garat, V. Van Putten, and R. A. Nemenoff
Regulation of SM22{alpha} expression by arginine vasopressin and PDGF-BB in vascular smooth muscle cells
Am J Physiol Heart Circ Physiol, October 1, 2003; 285(4): H1444 - H1452.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Y.-F. Chang, J. Wei, X. Liu, Y.-H. Chen, M. D. Layne, and S.-F. Yet
Identification of a CArG-independent region of the cysteine-rich protein 2 promoter that directs expression in the developing vasculature
Am J Physiol Heart Circ Physiol, October 1, 2003; 285(4): H1675 - H1683.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
N. Karasseva, G. Tsika, J. Ji, A. Zhang, X. Mao, and R. Tsika
Transcription Enhancer Factor 1 Binds Multiple Muscle MEF2 and A/T-Rich Elements during Fast-to-Slow Skeletal Muscle Fiber Type Transitions
Mol. Cell. Biol., August 1, 2003; 23(15): 5143 - 5164.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
S. Nelander, P. Mostad, and P. Lindahl
Prediction of Cell Type-Specific Gene Modules: Identification and Initial Characterization of a Core Set of Smooth Muscle-Specific Genes
Genome Res., August 1, 2003; 13(8): 1838 - 1854.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. S. Kumar and G. K. Owens
Combinatorial Control of Smooth Muscle-Specific Gene Expression
Arterioscler. Thromb. Vasc. Biol., May 1, 2003; 23(5): 737 - 747.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
A. L'honore, N. J. Lamb, M. Vandromme, P. Turowski, G. Carnac, and A. Fernandez
MyoD Distal Regulatory Region Contains an SRF Binding CArG Element Required for MyoD Expression in Skeletal Myoblasts and during Muscle Regeneration
Mol. Biol. Cell, May 1, 2003; 14(5): 2151 - 2162.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. L. Du, H. S. Ip, J. Li, M. Chen, F. Dandre, W. Yu, M. M. Lu, G. K. Owens, and M. S. Parmacek
Myocardin Is a Critical Serum Response Factor Cofactor in the Transcriptional Program Regulating Smooth Muscle Cell Differentiation
Mol. Cell. Biol., April 1, 2003; 23(7): 2425 - 2437.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. Xu, Y.-S. Ho, R. P. Ritchie, and L. Li
Human SM22alpha BAC encompasses regulatory sequences for expression in vascular and visceral smooth muscles at fetal and adult stages
Am J Physiol Heart Circ Physiol, April 1, 2003; 284(4): H1398 - H1407.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. M. Hoggatt, G. M. Simon, and B. P. Herring
Cell-Specific Regulatory Modules Control Expression of Genes in Vascular and Visceral Smooth Muscle Tissues
Circ. Res., December 13, 2002; 91(12): 1151 - 1159.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D.-Z. Wang, S. Li, D. Hockemeyer, L. Sutherland, Z. Wang, G. Schratt, J. A. Richardson, A. Nordheim, and E. N. Olson
Potentiation of serum response factor activity by a family of myocardin-related transcription factors
PNAS, November 12, 2002; 99(23): 14855 - 14860.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Bidder, J.-S. Shao, N. Charlton-Kachigian, A. P. Loewy, C. F. Semenkovich, and D. A. Towler
Osteopontin Transcription in Aortic Vascular Smooth Muscle Cells Is Controlled by Glucose-regulated Upstream Stimulatory Factor and Activator Protein-1 Activities
J. Biol. Chem., November 8, 2002; 277(46): 44485 - 44496.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. L. Sepulveda, S. Vlahopoulos, D. Iyer, N. Belaguli, and R. J. Schwartz
Combinatorial Expression of GATA4, Nkx2-5, and Serum Response Factor Directs Early Cardiac Gene Activity
J. Biol. Chem., July 5, 2002; 277(28): 25775 - 25782.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Arai, J. A. Spencer, and E. N. Olson
STARS, a Striated Muscle Activator of Rho Signaling and Serum Response Factor-dependent Transcription
J. Biol. Chem., June 28, 2002; 277(27): 24453 - 24459.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. D. Layne, S.-F. Yet, K. Maemura, C.-M. Hsieh, X. Liu, B. Ith, M.-E. Lee, and M. A. Perrella
Characterization of the Mouse Aortic Carboxypeptidase-Like Protein Promoter Reveals Activity in Differentiated and Dedifferentiated Vascular Smooth Muscle Cells
Circ. Res., April 5, 2002; 90(6): 728 - 736.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
A. D. Eckhart, T. Ozaki, H. Tevaearai, H. A. Rockman, and W. J. Koch
Vascular-Targeted Overexpression of G Protein-Coupled Receptor Kinase-2 in Transgenic Mice Attenuates beta -Adrenergic Receptor Signaling and Increases Resting Blood Pressure
Mol. Pharmacol., April 1, 2002; 61(4): 749 - 758.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
B. G. Bruneau
Transcriptional Regulation of Vertebrate Cardiac Morphogenesis
Circ. Res., March 22, 2002; 90(5): 509 - 519.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. L. Allen, C. A. Sartorius, L. K. Sycuro, and L. A. Leinwand
Different Pathways Regulate Expression of the Skeletal Myosin Heavy Chain Genes
J. Biol. Chem., November 16, 2001; 276(47): 43524 - 43533.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. D. Layne, S.-F. Yet, K. Maemura, C.-M. Hsieh, X. Liu, B. Ith, M.-E. Lee, and M. A. Perrella
Characterization of the Mouse Aortic Carboxypeptidase-Like Protein Promoter Reveals Activity in Differentiated and Dedifferentiated Vascular Smooth Muscle Cells
Circ. Res., April 5, 2002; 90(6): 728 - 736.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/20/17206    most recent
M010983200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chang, P. S.
Right arrow Articles by Olson, E. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chang, P. S.
Right arrow Articles by Olson, E. N.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement