|
Originally published In Press as doi:10.1074/jbc.M010609200 on February 5, 2001
J. Biol. Chem., Vol. 276, Issue 20, 17413-17419, May 18, 2001
The CGM1a (CEACAM3/CD66d)-mediated Phagocytic
Pathway of Neisseria gonorrhoeae Expressing Opacity
Proteins Is Also the Pathway to Cell Death*
Tie
Chen §,
Silvia
Bolland¶,
Ines
Chen ,
James
Parker ,
Milica
Pantelic ,
Fritz
Grunert**, and
Wolfgang
Zimmermann**
From the Department of Microbiology, Immunology and
Medicine, Walther Oncology Center, Indiana University School of
Medicine, Indianapolis, Indiana 46202, the Laboratory of
Bacterial Pathogenesis and Immunology, the ¶ Laboratory of
Molecular Genetics and Immunology, The Rockefeller University, New
York, New York 10021, and the ** Institute of Molecular Medicine and
Cell Research, University of Freiburg, D-79104 Freiburg, Germany
Received for publication, November 26, 2000
 |
ABSTRACT |
Phagocytosis of Opa+
Neisseria gonorrhoeae (gonococcus, GC) by
neutrophils is in part dependent on the interaction of Opa proteins with CGM1a (CEACAM3/CD66d) antigens, a neutrophil-specific receptor. However, the signaling pathways leading to phagocytosis have not been
characterized. Here we show that interaction of OpaI bacteria with
neutrophils or CGM1a-transfected DT40 cells induces calcium flux, which correlates with phagocytosis of bacteria. We identified an
immunoreceptor tyrosine-based activation motif (ITAM) in CGM1a, and
showed that the ability of CGM1a to transduce signals and mediate
phagocytosis was abolished by mutation of the ITAM tyrosines. We
also demonstrated that CGM1a-ITAM-mediated bacterial phagocytosis is
dependent on Syk and phospholipase C activity in DT40 cells. Unexpectedly, the activation of the CGM1a-ITAM phagocytic pathway by
Opa+ GC results in induction of cell death.
 |
INTRODUCTION |
Gonorrhea is one of the most frequently reported sexually
transmitted diseases (1). Neisseria gonorrhoeae (gonococcus, GC),1 the etiologic agent of
gonorrhea, can adhere to and penetrate mucosal cells (2, 3) and attain
access to submucosal sites. Among the GC surface proteins that mediate
this process is the opacity (Opa) protein family. This family consists
of 11 unlinked opa genes, whose sequences are known (4). In
addition, each Opa protein is able to switch its expression on and off,
resulting in the unavoidable tendency of GC to alter their phenotypes
by antigenic variation. Opa-expressing GC and Escherichia
coli (Opa+ GC or E. coli) can attach to and
invade human fallopian tube epithelium (5), indicating that Opa
proteins alone are sufficient to promote adherence to and invasion of
human cells. Furthermore human challenge experiments (6, 7) strongly
suggest that in vivo expression of Opa proteins plays an
important role in gonococcal pathogenesis on the mucosal surface.
It is well recognized that Opa proteins have the ability to stimulate
adherence and phagocytosis of the Opa+ bacteria by
polymorphonuclear leukocytes (PMN). This interaction with PMN occurs in
an opsonin-independent manner (8-12). In addition, Opa+
bacteria stimulate a chemiluminescent response in human neutrophils as
a result of oxidative burst activity. Furthermore, recent studies demonstrated that members of the carcinoembryonic antigen (CEA) or CD66
family serve as receptors mediating adherence and possibly phagocytosis
of Opa+ bacteria (13-16). These findings were mainly
obtained with HeLa transfectants expressing individual CEA family
members. However, neither the nature of the signals nor the pathways
that are involved in phagocytosis of the bacteria are clear.
The CEA gene is a member of a family of 18 expressible
closely related genes (17) that belong to the immunoglobulin (Ig) gene
superfamily (18). Recently, the nomenclature of the CEA family has been
revised to be CEACAM (CEA-related cell adhesion molecules) family (19).
The human CEA family includes BGP (biliary glycoprotein), CGM6 (CEA
gene family member 6), NCA (nonspecific cross-reacting antigens), CGM1,
CEA and PSG (pregnancy-specific glycoproteins), which are also
designated CD66a (CEACAM1), CD66b (CEACAM8), CD66c (CEACAM6), CD66d
(CEACAM3), CD66e (CEACAM5), and CD66f, respectively. CEACAM
(CEA-related cell adhesion molecules) was renamed from the CEA family
(19) recently. It is noteworthy that CGM1a (CD66d), which promotes the
strongest phagocytosis of Opa+ bacteria, is only expressed
in human neutrophils (20).
Various components of the B cell receptors (BCR), T cell receptors
(TCR), and Fc receptors (FcR) contain common sequence motifs in their
cytoplasmic tails, called the immunoreceptor tyrosine-based activation
motif (ITAM; Ref. 21). The phosphorylated tyrosine residues within
ITAMs can recruit protein-tyrosine kinases (PTK), e.g. Syk,
whereupon these become activated. Recruitment of substrates such as
phospholipase C- (PLC- ) by these kinases leads to
stimulation of calcium flux from intracellular stores (22-25). This
calcium flux reflects an early event after activation of PTK.
In this study, we demonstrate that CGM1a bears a functional ITAM in its
cytoplasmic tail, which mediates phagocytosis of Opa+
bacteria followed by cell death.
 |
EXPERIMENTAL PROCEDURES |
Bacterial Strains, Cell Culture, and Antibodies--
GC strain
MS11 was cultured and maintained as previously described (26). Only
pilus GC and LOSb
(lacto-N-neotetraose) phenotype were used (27). Recombinant
opa genes from GC MS11 were constructed and expressed in
E. coli HB101 as described previously (28). The designations of Opa proteins of both GC and E. coli are based on Swanson
et al. (6) and Belland et al. (28). The
Opa+ bacteria used in this study are Opa ,
OpaC, OpaD, OpaF, and OpaI GC or Opa and OpaI E. coli.
The wild-type chicken B-cells DT40, their mutants DT40-Syk
(Syk / ) and DT40-PLC- (PLC- / ) (29,
30) and transfectants were maintained in RPMI 1640 medium supplemented
with 10% fetal bovine serum, 1% chicken serum, 50 µM 2-mercaptoethanol and 2 mM
L-glutamine.
COL-1 monoclonal antibody (MAb), specific for CGM1 and CEA, was
purchased from Zymed Laboratories Inc. Laboratories
INC., California. B1.1 antibody, which reacts with BGP, NCA, CGM1, and CEA, was generously provided by Dr. Jeffrey Schlom, NCI, National Institutes of Health. The YTH71.3. antibody, which recognizes BGP, NCA,
and CGM1, was purchased from Harlan Bioproducts (Indianapolis, IN).
Anti-Fc antibody 2.4G2 was purchased from PharMingen (San Diego, CA).
Preparation of Neutrophils--
Neutrophils from human blood
were purified by centrifugation through Polymorphprep (Life
Technologies, Inc.). The purified PMN were suspended either in RPMI or
Hanks' balanced salt solution (HBSS; Cellgro, Herndon, VA) at a
concentration of 2 × 106/ml.
Transfections--
CGM1a cDNA and its mutants were
cloned into pBEH expression vector, and NCA and BGPa were cloned into
pRC/CMV vector. 10 µg of expression plasmids were co-transfected with
1 µg of pBabe-puror vector (31) into 5 × 106 DT40 cells by electroporation at 250 V and 960 µF in 0.5 ml. Stable transfectants were selected in 0.5 µg/ml puromycin 24 h after electroporation. The presence of CD66
antigens in individual clones was determined by flow cytometry analysis
using FACScan (Becton Dickinson, Mountain View, CA) analysis with
COL-1, YTH71.3., and secondary antibodies conjugated with FITC.
Generation of CGM1a Mutants--
The CGM1a cDNA cloned
in pBEH has been previously described (20). The tyrosine residues
Tyr-196 and Tyr-207 (position 1 corresponds to the first amino acid of
the mature protein after removal of the leader peptide) in the
wild-type cytoplasmic domain of CGM1a were changed to phenylalanine
residues, giving rise to three different mutants: Y196F, Y207F, and
Y196F/Y207F (Fig. 1B). Site-directed mutagenesis was
achieved with the QuickChange Site-Directed Mutagenesis Kit (from
Stratagene, San Diego, CA). Three primer pairs were designed for
obtaining the mutants Y196F, Y207F, and Y196F/Y207F: TyrI5',
5'-GCAGCTTCCATCTTTGAGGAATTGC and TyrI3', 5'-GACATTCCTCAAAGATGGAAGCTGC, TyrII5', 5'-GACACAAACATTTTCTGCCGGATGGACC and TyrII3', 5'GGTCCATCCGGCAGAAAATGTTTGTGTC,and TyrI-II5',
5'-GCTTCCATCTTTGAGGAATTGCTAAAACATGACACAAACATTTTCTGCCG, and TyrI-II3',
5'-CCGGCAGAAAATGTTTGTGTCATGTTTTAGCAATTCCTCAAAGATGGAAGC. The mutated
sequences of CGM1a were confirmed by DNA sequencing using the primers
CGM1a5' (5'-TCCTGGAGCCCAGCCTCTTTT) and CGM1a3' (5'-AGGCTGTCGAGGTCTCCA).
Calcium Measurements--
DT40 cells or neutrophils (4 × 106) were suspended in 3 ml of RPMI medium. 6 fl of 1 µM Fura-2AM (Molecular Probe, Eugene, OR)
dissolved in Me2SO were added to the suspension, which was then incubated in the dark at 37 °C for 30 min with occasional shaking. Cells were washed twice with HBSS and resuspended in 3 ml of
HBSS. 0.5 ml of cell suspension was mixed with 1 ml of phosphate-buffered saline containing 1 mM CaCl2
and 1 mM MgCl2. For activation assays, 0.1 ml
of the bacterial suspensions at a concentration of 4 × 108 was added to the labeled cells. The cytosolic calcium
concentration was determined with a fluorescence spectrophotometer
(LB50B, Perkin Elmer, Foster City, California) at an excitation
wavelength of 340 and 360 nm, and an emission wavelength of 510 nm.
Calculation of the calcium concentration was performed using the FL
WinLab software (Perkin Elmer). We should state here that we usually test three (at least two) different transfectants of each mutant to
make sure that they behave equally. It should be noted that anti-receptor antibodies are often used to stimulate the activation of
receptors such as BCR and TCR. However, none of the anti-CEA antibodies
we tested (COL-1, B1.1, 4-12-5, and YTH71.3) was able to stimulate
calcium flux in DT40-CGM1a, even when cross-linked with secondary antibodies.
Phagocytosis Assays--
DT40 cells transfected with CGM1a
(DT40-CGM1a) and control DT40 cells were suspended in RPMI with 2%
fetal calf serum at the concentration of 2-4 × 105/ml. 0.5 ml each of these cell suspensions was added to
24-well plates and after addition of 50 µl of bacterial suspensions
in RPMI at the concentration of 8 × 107, the cells
were allowed to incubate for 3 h at 37 °C in the presence of
5% CO2. Then gentamicin was added into each well to the
final concentration of 100 µg/ml and incubated for another 90 min.
The cells were washed three times with RPMI and lysed in
phosphate-buffered saline containing 0.5% saponin (CalBiochem Corp.),
and dilutions were plated on LB-agar or CG-agar. The level of
internalization of bacteria into cells was calculated by determining
the colony-forming units (cfu) recovered from the DT40 cell lysates.
Detection of Cell Death--
Annexin V-FITC binding to
phosphatidylserine (PS) was used as the cell death assay according to
the manufacturer's recommendations (PharMingen, San Diego, CA).
Annexin V-FITC was used in conjunction with propidium iodide (PI) to
distinguish apoptotic cells (annexin V-FITC positive, PI negative) from
necrotic cells (annexin V-FITC positive, PI positive). Cells exhibited
apoptotic cell-specific phosphatidylserine on their surface and,
therefore, bound annexin V-FITC or took up PI, which cannot penetrate
live cells. However, in our experiment, the cells that were either
annexin V-FITC positive or PI positive were classified as dead cells
(see Fig. 6). Neutrophils or DT40 cells (1 × 105)
were suspended in 0.1 ml of 2% fetal calf serum in RPMI containing 1.5 × 106 bacteria (GC) and incubated at 37 °C for
6 h with occasional shaking. 50 µl of binding buffer (10 mM Hepes/NaOH, pH 7.4, 140 mM NaCl, and 2.5 mM CaCl2), 7.5 µl of Annexin V-FITC and 15 µl of PI were added in each vial. The cell suspensions were gently mixed and incubated for 15 min at room temperature in the dark. Finally, after addition of 550 µl of binding buffer, samples were analyzed immediately by flow cytometry.
 |
RESULTS |
Opa+ GC Stimulates Calcium Flux in Neutrophils and
DT40-CGM1a but Not in DT40-BGPa or DT40-NCA--
Studies have
indicated that Opa protein-mediated binding and phagocytosis of GC by
PMN occurs through the CEA family members on PMN (13, 14, 16). Both
BGPa and CGM1a contain possible ITAM-like motifs (Fig.
1A). NCA, which is membrane
anchored by a glycosylphosphatidyl inositol (GPI) moiety, is expressed
on granulocytes and has also been shown to bind to Opa proteins. To
examine whether the interaction between GC and neutrophils results in
any signaling in the PMNs, measurement of calcium flux was performed.
OpaI GC were used to stimulate neutrophils. As shown in Fig.
2A, OpaI GC but not
Opa GC induced calcium flux in neutrophils, suggesting
that at least one of the three CEA family members in question conveys
these signals, possibly by an ITAM.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic representation of putative ITAM and
ITIM present in the cytoplasmic domain of CGM1a/BGPa
(A) and CGM1a (B). A,
the putative ITAM and ITIM present in the cytoplasmic domain of CGM1a
and BGPa. The cytoplasmic sequences of CGM1a and BGPa are aligned with
consensus sequences for the immunoreceptor tyrosine-based activation
motif and immunoreceptor tyrosine-based inhibition motif (ITAM,
YX2LX7YX2(L/I)
and ITIM, (V/I)XXYXXL/V, where X
represents any amino acid). The numbers indicate the position of the
tyrosine residues in the mature protein (after removal of the leader
peptide). B, CGM1a (WT, Y196F, Y207F, and Y196F/Y207F)
comprises an extracellular domain, a transmembrane region, and a
cytoplasmic tail. In the mutants, tyrosines at position 196 and/or 207 of CGM1a have been altered to phenylalanines.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 2.
Opa+ GC stimulates calcium flux
in neutrophils and DT40-CGM1a cells. A, intracellular
calcium flux in neutrophils was triggered by addition of OpaI GC
(blue line) but not by Opa GC (red
line). Arrows indicate the time points when bacteria
were added. B, stimulation of calcium flux in DT40
transfectants expressing different CEA antigens. Intracellular calcium
flux in DT40-CGM1a was triggered by addition of OpaI GC but not by
Opa GC (* , red line). On the other hand, OpaI
GC could not stimulate calcium flux in DT40-BGPa and DT40-NCA cells.
The expression levels of CGM1a (Fig. 3), BGPa, and NCA in stable DT40 B
cell transfectants were determined by flow cytometry with anti-CD66
antibodies, COL-1, and YTH71.3. Untransfected DT40 B cells were used as
negative controls (filled-in curve). x axis, time
in seconds.
|
|
To determine which of the three CEA-related receptors is responsible
for the calcium flux in neutrophils induced by Opa+ GC
(Fig. 2A), the DT40 B cell line was chosen to perform
functional studies. There are several reasons why we chose this cell
line. First, the ITAM, which could be responsible for the signaling through the CEA-related molecules, was originally identified in the
Ig /Ig heterodimer of the BCR (32, 33), and DT40 B cells have
proven to be suitable for studying the functionality of presumed ITAMs
(34, 35) e.g. by induction of calcium flux as observed after
BCR activation. Furthermore, human neutrophils are terminally differentiated cells and cannot be genetically manipulated.
Manipulation of established myeloid lines of human origin such as HL60
cells cannot be performed readily either because endogenous CD66
antigen expression changes during induction of maturation by retinoic acid4. Finally, no Opa+ GC were found to
interact exclusively with individual CEA antigens like CGM1a (36, 37).
In short, a cellular system that lacks endogenous human CEA antigens
and can be manipulated, like the DT40 cell line, is needed to
understand the behavior of CEA-related molecules in neutrophils. We
believe that the DT40 cell line is the best model available.
CGM1a, BGPa (both represent splice variants that code for
tyrosine-containing cytoplasmic tails) and NCA cDNAs were cloned into pBEH or pRc/CMV expression vectors, and the resulting plasmids were stably transfected into the DT40 B cell line, generating the
DT40-CGM1a, DT40-BGPa, and DT40-NCA transfectants. All three cell lines
expressed similar levels of the respective CEA-related antigens (Figs.
2B and 3). When OpaI GC were
added to these three cell lines, calcium flux was only observed in the
DT40-CGM1a transfectant (Fig. 2B). In contrast,
Opa GC could not stimulate any calcium flux. Likewise, no
calcium flux was detected in untransfected DT40 cells treated with OpaI GC. These results show that only CGM1a is able to convey the calcium flux and suggest that it contains a functional ITAM.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 3.
Mutation of Tyr-196 from CGM1a abolished the
calcium flux in DT-CGM1a. The calcium flux response was measured
as described in the legend to Fig. 2 in DT40 B cells, DT40-CGM1a,
DT40-CGM1a-Y196F, DT40-CGM1a-Y207F, and DT40-CGM1a-Y196F/Y207F cells
upon addition of OpaI GC. The expression level of the different
chimeric molecules in stable DT40 B cell transfectants was determined
by flow cytometry (right panel) using anti-CGM1a COL-1
antibody. Untransfected DT40 B cells were used as a negative
control.
|
|
Mutation of Tyrosine Residue Tyr-196 in CGM1a Abolishes Its
Signaling Capability--
Phosphorylation of tyrosine residues within
an ITAM is a key step for its activation. The cytoplasmic domain of
CGM1a contains two tyrosine residues in its potential ITAM. To test
whether these tyrosine residues were required for activation of the
calcium flux, we substituted them with phenylalanine. Three different tyrosine mutants, CGM1a-Y196F, CGM1a-Y207F, and CGM1a-Y196F/Y207F (Fig.
1B), were constructed and the resulting expression plasmids were transfected into DT40 cells. Transfectants that expressed similar
levels of the mutated molecules were selected for the calcium flux
experiments (Fig. 3). As depicted in Fig. 3, mutation of tyrosine
residue 196 (Y196F) or mutation of both tyrosines in the cytoplasmic
tail of CGM1a (Y196F/Y207F) completely abolished its signaling ability
as measured by calcium flux. On the other hand, OpaI GC were able to
stimulate a low level of calcium flux in the Y207F CGM1a mutant. These
results indicate that both tyrosines are necessary to constitute a
fully functional ITAM with Tyr-196 being the essential one. This
mutation analysis of the cytoplasmic tyrosines of CGM1a confirms
that the motif surrounding these tyrosines (YX2LX7YX2M)
is a functional ITAM.
The ITAM in CGM1a Mediates Phagocytosis of Opa+
Bacteria--
CGM1a promotes strong phagocytosis of Opa+
bacteria. We wanted to know whether signaling through the ITAM in the
cytoplasmic domain of CGM1a is involved in this process. First, using a
colony-forming assay to quantify the number of internalized bacteria,
we demonstrated that DT40-CGM1a cells are also capable of phagocytosing
OpaI GC or E. coli but not Opa GC or E. coli (Fig. 4A). This
result was confirmed by electron microscopy analysis (Fig. 4,
B and C). To elucidate the importance of the
tyrosines in this process, the tyrosine mutants were tested in the
phagocytosis assay. As in the calcium flux experiments, mutation of
Tyr-196 or mutation of Tyr-196 and Tyr-207 in the ITAM severely
impaired or abolished, respectively, the ability of CGM1a to confer
phagocytosis of OpaI E. coli (Fig. 4D). However, some capacity to phagocytose OpaI E. coli was still
preserved in DT40 cells expressing CGM1a-Y207F. From these results, we
conclude that the ITAM in CGM1a mediates both calcium flux and the
phagocytosis of Opa+ bacteria.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 4.
DT40-CGM1a-mediated phagocytosis of OpaI GC
and OpaI E. coli is dependent on CGM1a ITAM.
A, DT40-CGM1a and control DT40 were plated onto 24-well
plates. OpaI and Opa bacteria were added to the cultures
and incubated for 3 h. The extracellular bacteria were killed by
addition of 100 µg/ml (final concentration) of gentamicin. The number
of phagocytosed bacteria was determined by counting CFUs recovered
following gentamicin treatment. Transmission electron micrograph shows
internalization of OpaI GC (B) and OpaI E. coli
(C) by DT40-CGM1a cells. The large numbers of internalized
Opa+ GC and OpaI E. coli enclosed within
vesicles are clearly visible as indicated with arrows.
D, mutation of either of the tyrosine residues on ITAM
impaired the ability of CGM1a to phagocytose OpaI GC.
|
|
Syk and PLC- Enzymes Participate in Phagocytosis of
Opa+ Bacteria--
We tested the ability of DT40-CGM1a
cells lacking Syk and PLC- activity to mediate calcium flux and
phagocytosis, because the downstream pathway of ITAM activation
involves Syk, whose activation in turn leads to PLC- stimulation.
DT40-Syk-CGM1a or DT40-PLC- -CGM1a cells are CGM1a-transfected DT40
cells in which the Syk or PLC- genes have been inactivated. As
depicted in Fig. 5A and
B, DT40-Syk-CGM1a cells cannot be induced to generate a
calcium flux or to phagocytose OpaI bacteria. However,
DT40-PLC- -CGM1a cells can still phagocytose OpaI E. coli
at low level although stimulation of calcium flux could not be detected
(Fig. 5). This suggests that an increased intracellular
Ca2+ concentration is not essential for phagocytosis. These
data demonstrate that both Syk and PLC participate in the pathways
leading to phagocytosis of Opa+ bacteria, but Syk is
essential for this process.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 5.
Syk and PLC-
participate in CGM1a-mediated calcium flux, phagocytosis, and
cell death. DT40, DT40-CGM1a, DT40-Syk-CGM1a and
DT40-PLC- -CGM1a cells were tested for their ability to generate
calcium flux (A), phagocytosis (B), and to be
induced cell death (C) by interaction with Opa. The same
procedures as for calcium flux in Fig. 2, bacterial phagocytosis in
Fig. 4 and cell death in Fig. 6 were followed, respectively.
DT40-Syk-CGM1a lost all these abilities, whereas DT40-PLC- -CGM1a
preserved some capacity to phagocytose bacteria.
|
|
Activation of the ITAM in CGM1a (CEACAM3/CD66d) Results in Cell
Death in DT-40 Cells--
Signal transduction via BCR activation
results very complicated consequences. However, one of them leads to
apoptosis of B cells (38). We examined whether activation of CGM1a ITAM
had a similar effect on DT-40 cells. As shown in Fig.
6, OpaI GC stimulated substantially more
cell death in DT40-CGM1a as measured by both phosphatidylserine
exposure and uptake of propidium iodine than Opa GC did.
Untransfected DT40 B cells, used as a control, could not be killed by
OpaI or Opa GC (Fig. 6). The observed cell death is
dependent on ITAM activation because CGM1a-Y196F and CGM1a-Y196F/Y207F
mutants (Fig. 1) lost the ability to promote cell death (Fig. 6). Some
cell death was observed in DT40-CGM1a with Opa GC, which
might be because of low numbers of Opa+ GC in the
Opa GC suspension because GC are able to switch Opa gene
expression on and off. Alternatively, CGM1a might be activated by other
components on GC, which are still unidentified. It should be noted that
the anti-CGM1a specific antibody COL-1, which was unable to induce calcium flux, could not stimulate the death DT40-CGM1a either (data not
shown).

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 6.
Opa+ GC-induced cell death in
DT40-CGM1a cells depends on the ITAM. DT40, DT40-CGM1a,
DT40-CGM1a-Y196F, DT40-CGM1a-Y207F, and DT40-CGM1a-Y196F/Y207F cells
were incubated with OpaI or Opa GC and without GC
(Control panel) for 6 h. Cells that bound annexin
V-FITC or took up PI were counted as dead cells. The percentage of dead
cells is indicated on the y axis.
|
|
To further validate the effects of the CGM1a-ITAM activation pathway,
DT40-Syk-CGM1a and DT40-PLC- -CGM1a cells were tested for cell death.
As shown in Fig. 5, OpaI GC was not able to promote death of cells
lacking Syk, but still killed a significant fraction of
DT40-PLC- -CGM1a cells. The similarity between the patterns of
bacterial phagocytosis and cell death suggests that these two processes
share the same initiating events.
Killing of Neutrophils by GC Depends on Expression of Individual
Opa Proteins--
We showed that activation of the phagocytic pathway
via CGM1a led to cell death in DT40 cells. Thus, the question arises
whether the CGM1a-ITAM pathway to cell death can also be observed in
neutrophils, which are the only cells naturally expressing CGM1a.
However, neutrophils cannot be genetically manipulated and so far none of the myeloid cell lines currently available fully resemble
neutrophils and thus can convincingly replace PMNs. Furthermore,
antibodies specific for CGM1a do not activate neutrophils.
Fortunately, recent data did show that various Opa proteins interacted
differently with CGM1a and BGPa. For example, OpaC or OpaI interact
with both CGM1a and BGPa, and OpaD or OpaF interact with BGPa only (36,
37). Thus, the rational is that if the CGM1a-ITAM pathway, demonstrated
in DT40 cells, also applies to neutrophils, only GC-expressing Opa
proteins that interact with CGM1a (such as OpaC or OpaI) should
stimulate the death of neutrophils, as opposed to OpaD or
OpaF-expressing GC. Opa , OpaC, D, F, and I GC were used
to perform similar experiments with neutrophils as done with the B cell
lines in Fig. 6. As shown in Fig. 7, OpaC
and I GC killed many more neutrophils than Opa and OpaD
or OpaF GC did. It should be noted that GC expressing these different
Opa proteins have the similar ability to associate with neutrophils
(39). These results suggest that activation of the ITAM in CGM1a also
stimulates cell death in neutrophils.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 7.
OpaC and OpaI GC kill more neutrophils
than OpaD, OpaF, and Opa GC. Purified
neutrophils were incubated with variable GC expressing different Opa
proteins for 6 h. The measurements for Opa-stimulated neutrophil
death were described in the legend to Fig. 6.
|
|
 |
DISCUSSION |
Internalization of microorganisms into either professional or
non-professional phagocytic cells requires the interaction of phagocytosis-promoting receptors on the cell surface with ligands on
the surface of the microorganisms. In the present study, we demonstrated that the neutrophil-specific receptor, CGM1a contains an
ITAM, which is essential for CGM1a-mediated phagocytosis of Opa+ bacteria. This conclusion is further validated by
showing that CGM1a-transfected, Syk-deleted DT40 cells are no longer
able to promote effectively either calcium ion influx or phagocytosis of OpaI bacteria. Finally, we showed that CGM1a-mediated phagocytosis of opacity (Opa) proteins-expressing Neisseria gonorrhoeae
leads to cell death.
Because CGM1a is only expressed in PMNs, it is a concern whether
CGM1a-mediated signaling data obtained from the B cell line DT40
reflects its biological properties in neutrophils. ITAM-containing receptors have nearly exclusively been identified in cells from immune
system. Despite the differences in the structures they recognize and
the effector functions they carry out, BCRs, TCRs, and several FcRs
utilize remarkably similar signal transduction components to initiate
and propagate their signaling responses. They use components that
contain distinct recognition (ITAM) and signal transduction subunits
such as Syk, with which the ITAM in CGM1a may be also associated (Fig.
5). This type of receptors is crucial for transmission of activation
signals in immune cells. Here, we show that the human CGM1a, although
ectopically expressed in a chicken B cell line, exhibits the ITAM
characteristics of BCRs, supporting the notion that ITAMs are highly
conserved motifs, and that the CGM1a ITAM might play a similar role in neutrophils.
Opa+ Neisseria interact with BGP and CGM1 on neutrophils
during in vitro infection, and both antigens promote
phagocytosis of Opa+ bacteria in HeLa transfectants (13,
14, 16). Do CGM1a and BGPa work independently or do they collaborate
during phagocytosis of GC by neutrophils? What kind of collaboration
could be envisaged? BGPa can deliver inhibitory signals through its
ITIM in the cytoplasmic tail to counteract ITAM-mediated positive
signals, which requires SHP-1 and
SHP-2.2 The protein-tyrosine
phosphatases SHP-1 and SHP-2, which are typically involved in negative
signaling, bind to the ITIM-like motif in the cytoplasmic tail of BGPa
(40, 41). Indeed, it has recently been shown that interaction of
Opa+ GC with BGPa antigens down-regulates the activity of
SHP-1 (42). Therefore, BGPa may be co-ligated with CGM1a on the surface
of neutrophils when they interact with Opa+ bacteria.
Cross-linkage of the two molecules might regulate the phagocytosis
process. Opa+ GC-stimulated signal transduction events in
neutrophils might consequently be analogous to the positive (ITAM)
versus negative (ITIM) signaling seen with lymphocyte
receptors such as BCR and FcRIIB, respectively (43).
In addition, this study raises an interesting issue. This is the first
report of phagocytosis of bacteria by B cells. Antigen-immunoreceptor interaction is an important step for the establishment of the immune
response, because there is signaling from the receptor to activate
different cellular functions. Internalization of antigen-bound receptors by B cells is critical for antigen processing and
presentation to T lymphocytes. Here we show that DT40-CGM1a B cells
were able to phagocytose Opa+ bacteria (either GC or
E. coli) in a very efficient manner. Although the cell line
we used was manipulated to express CGM1a antigen, our data,
nevertheless, suggest that B cells possess the machinery to phagocytose
whole bacteria. Demonstration of the ability of B cells to phagocytose
bacteria is a new information with a potential.
What is the biological fate of Opa+ GC after phagocytosis
by PMN? It is generally thought that the phagocytosed gonococci are killed. However, neutrophils are often packed with intact, seemingly viable, intracellular GC (44). Thus, the possibility exists that these
Opa+ GC may be protected from bactericidal attack by the
granulocytes and instead use these cells as an intracellular niche or
as vehicles to reach the next host. Alternatively, they could simply
kill the PMNs. In fact, it was recently found that the ITAM activation pathway also induces cell apoptosis in immune cells (23, 38, 45-49).
For example, activation of the ITAM in the BCR of DT40 B cells results
in apoptosis (38, 48). In this context it is interesting to note that
OpaI and OpaC GC but not OpaD and OpaF GC stimulate the death of
neutrophils (Fig. 7) although the level of interaction of OpaC, D, F,
and I GC with neutrophils is similar (39). Perhaps, phagocytosis of
Opa+ GC by neutrophils through CGM1a leads in part to
apoptosis of these cells. In addition, compared with other cells from
immune system, there is not much known of the mechanisms of cell death in PMNs, even though these cells are noted for their death fate. In
humans, PMNs succumb to apoptosis within 72 h. Thus, finding that
expression of ITAM-containing CGM1a, a specific PMN antigen, mediated
the death in B-cell and possibly in neutrophils is very significant.
Whether BGPa mediated internalization of Opa+ GC in
neutrophils could reduce apoptosis of neutrophils remains to be
determined, because BGPa contains an ITIM to counteract the activated
ITAM.2
It may seem to a paradox that host cells phagocytosing microorganisms
kill them and also may be killed by microorganisms. However, the two
aspects might in reality represent two separate battlefields in the
interaction between bacteria (GC) and host cells (PMNs). This
phenomenon also occurs in interaction between other pathogenic bacteria
and host cells. For example, whether the outcome of macrophages
phagocytosing Shigella or Salmonella is the
killing of the microorganisms or the death of the host cell (50, 51)
remains to be defined in vivo. The study of the interaction
of Opa+ bacteria with host cells through CEA (CEACAM/CD66)
antigens addresses two facets of phagocytosis of GC by PMNs, which are
critical for the understanding of the pathogenesis of gonococcal infection.
 |
ACKNOWLEDGEMENTS |
We thank Dr. M. Kuroki for generously
providing the cDNA of BGPa. We are indebted to John Swanson and Bob
Belland for supplying the Opa+ bacteria. We also thank Dr.
Stanley Spinola for useful suggestions and editorial comments. We
always thank Emil Gotschlich for insightful scientific advice.
 |
FOOTNOTES |
*
This work was supported by Public Health Service Grants AI
47736 (to T. C.) and AI 26558 (to E. G.) and a grant from the
Deutsche Forschungsgemeinschaft (to W. Z.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Dept. of Microbiology,
Immunology, and Medicine, Indiana University School of Medicine, MS
252, 635 Barnhill Dr., Indianapolis, IN 46202-5120. Tel.: 317-274-0519;
Fax: 317-274-4090; E-mail: tiechen@iupui.edu.
Published, JBC Papers in Press, February 5, 2001, DOI 10.1074/jbc.M010609200
2
Chen, T., Zimmerman, W., Chen, I., Parker, J.,
Grunert, F., Maeda, A., and Bolland, S. (2001) in press.
 |
ABBREVIATIONS |
The abbreviations used are:
GC, gonococcus or N. gonorrhoeae;
Opa, opacity protein;
PMN, polymorphonuclear leukocytes;
DT40-CGM1a, DT40 B cell line expressing
human CGM1a antigen;
Opa E. coli, E.
coli HB101 containing the vector pGEM-3Z;
OpaI E. coli, E. coli HB101-expressing OpaI protein;
BGP (CD66a), biliary
glycoprotein;
CEA (CD66e), carcinoembryonic antigen;
CEACAM, CEA-related cell adhesion molecule;
ITAM, immunoreceptor tyrosine-based
activation motif;
ITIM, immunoreceptor tyrosine-based inhibition motif;
Syk, Syk protein-tyrosine kinase;
PLC- , phospholipase C- ;
BCR, B
cell receptor;
TCR, T cell receptor;
FcR, Fc receptor;
PI, propidium
iodide;
PS, phosphatidylserine;
FITC, fluorescein isothiocyanate.
 |
REFERENCES |
| 1.
|
Centers for Disease Control.
(1993)
Morbid. Mortal. Weekly Rep.
42,
55-63
|
| 2.
|
Evans, B. A.
(1977)
J. Infect. Dis.
136,
248-255
|
| 3.
|
Ward, M. E.,
and Watt, P. J.
(1972)
J. Infect. Dis.
126,
601-605
|
| 4.
|
Bhat, K. S.,
Gibbs, C. P.,
Barrera, O.,
Morrison, S. G.,
Jahnig, F.,
Stern, A.,
Kupsch, E.-M.,
Meyer, T. F.,
and Swanson, J.
(1991)
Mol. Microbiol.
5,
1889-1901
|
| 5.
|
Gorby, G.,
Simon, D.,
and Rest, R.
(1994)
Ann. New York Acad. Sci.
730,
286-289
|
| 6.
|
Swanson, J.,
Barrera, O.,
Sola, J.,
and Boslego, J.
(1988)
J. Exp. Med.
168,
2121-2129
|
| 7.
|
Jerse, A. E.,
Cohen, M. S.,
Drown, P. M.,
Whicker, L. G.,
Isbey, S. F.,
Seifert, H. S.,
and Cannon, J. G.
(1994)
J. Exp. Med.
179,
911-920
|
| 8.
|
Swanson, J.,
Sparks, E.,
Young, D.,
and King, G.
(1975)
Infect. Immun.
11,
1352-1361
|
| 9.
|
Swanson, J.,
King, G.,
and Zeligs, B.
(1975)
Infect. Immun.
11,
65-68
|
| 10.
|
Virji, M.,
and Everson, J. S.
(1981)
Infect. Immun.
31,
965-970
|
| 11.
|
Virji, M.,
and Heckels, J. E.
(1986)
J. Gen. Microbiol.
132,
503-512
|
| 12.
|
Fischer, S. H.,
and Rest, R. F.
(1988)
Infect. Immun.
56,
1574-1579
|
| 13.
|
Virji, M.,
Makepeace, K.,
Ferguson, D. J. P.,
and Watt, M.
(1996)
Mol. Microbiol.
22,
941-950
|
| 14.
|
Chen, T.,
and Gotschlich, E.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
14851-14856
|
| 15.
|
Chen, T.,
Grunert, F.,
Medina-Marino, A.,
and Gotschlich, E.
(1997)
J. Exp. Med.
185,
1557-1564
|
| 16.
|
Gray-Owen, S.,
Dehio, C.,
Haude, A.,
Grunert, F.,
and Meyer, T.
(1997)
EMBO J.
16,
3435-3445
|
| 17.
|
Hammarstrom, S.
(1999)
Semin. Cancer Biol.
9,
67-81
|
| 18.
|
Paxton, R.,
Mooser, G.,
Pande, H.,
Lee, T. D.,
and Shively, J. E.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
920-924
|
| 19.
|
Beauchemin, N.,
others,
and Zimmermann, W.
(1999)
Exp. Cell Res.
252,
243-249
|
| 20.
|
Nagel, G.,
Grunert, F.,
Kuijpers, T.,
Watt, S.,
Thompson, J.,
and Zimmermann, W.
(1993)
Eur. J. Biochem.
214,
27-35
|
| 21.
|
Cambier, J.
(1995)
J. Immunol.
155,
3281-3285
|
| 22.
|
Bijsterbosch, M.,
Meade, C.,
Turner, G.,
and Klaus, G.
(1985)
Cell
41,
999-1006
|
| 23.
|
Takata, M.,
Homma, Y.,
and Kurosaki, T.
(1995)
J. Exp. Med.
182,
907-914
|
| 24.
|
Tuveson, D. A.,
Carter, R. H.,
Soltoff, S. P.,
and Fearon, D. T.
(1993)
Science
260,
986-989
|
| 25.
|
Buhl, A. M.,
Pleiman, C. M.,
Rickert, R. C.,
and Cambier, J. C.
(1997)
J. Exp. Med.
186,
1897-1910
|
| 26.
|
Swanson, J.,
and Barrera, O.
(1983)
J. Exp. Med.
157,
1405-1420
|
| 27.
|
Swanson, J.
(1991)
in
Proceedings of the Seventh International Pathogenic Neisseria Conference
(Achtman, M.
, Kohl, P.
, Marchal, C.
, Morelli, G.
, Seiler, A.
, and Thiesen, B., eds)
, pp. 391-396, Walter de Gruyter & Co., Berlin
|
| 28.
|
Belland, R. J.,
Chen, T.,
Swanson, J.,
and Fischer, S. H.
(1992)
Mol. Microbiol.
6,
1729-1737
|
| 29.
|
Takata, M.,
Sabe, H.,
Hata, A.,
Inazu, T.,
Homma, Y.,
Nukada, T.,
Yamamura, H.,
and Kurosaki, T.
(1994)
EMBO J.
13,
1341-1349
|
| 30.
|
Takata, M.,
and Kurosaki, T.
(1996)
J. Exp. Med.
184,
31-40
|
| 31.
|
Morgenstern, J.,
and Land, H.
(1990)
Nucleic Acids Res.
18,
3587-3596
|
| 32.
|
Reth, M.
(1989)
Nature
338,
383-384
|
| 33.
|
Reth, M.
(1995)
Seminars in Immunol.
7,
21-27
|
| 34.
|
Cox, D.,
Chang, P.,
Kurosaki, T.,
and Greenberg, S.
(1996)
J. Biol. Chem.
271,
16597-16602
|
| 35.
|
Maeda, A.,
Kurosaki, M.,
and Kurosaki, T.
(1998)
J. Exp. Med.
188,
991-995
|
| 36.
|
Bos, M.,
Grunert, F.,
and Belland, R.
(1997)
Infect. Immun.
65,
2353-2361
|
| 37.
|
Gray-Owen, S.,
Lorenzen, D.,
Haude, A.,
Meyer, T.,
and Dehio, C.
(1997)
Mol. Microbiol.
26,
971-980
|
| 38.
|
Ono, M.,
Okada, H.,
Bolland, S.,
Yanagi, S.,
Kurosaki, T.,
and Ravetch, J.
(1997)
Cell
90,
293-301
|
| 39.
|
Kupsch, E. M.,
Knepper, B.,
Kuroki, T.,
Heuer, I.,
and Meyer, T. F.
(1993)
EMBO J.
12,
641-650
|
| 40.
|
Beauchemin, N.,
Kunath, T.,
Robitaille, J.,
Chow, B.,
Turbide, C.,
Daniels, E.,
and Veillette, A.
(1997)
Oncogene
14,
783-790
|
| 41.
|
Huber, M.,
Izzi, L.,
Grondin, P.,
Houde, C.,
Kunath, T.,
Veillette, A.,
and Beauchemin, N.
(1999)
J. Biol. Chem.
274,
335-344
|
| 42.
|
Hauck, C.,
Gulbins, E.,
Lang, F.,
and Meyer, T.
(1999)
Infect. Immun.
67,
5490-5494
|
| 43.
|
Healy, J. I.,
and Goodnow, C. C.
(1998)
Annu. Rev. Immunol.
16,
645-670
|
| 44.
|
Shafer, W. M.,
and Rest, R. F.
(1989)
Annu. Rev. Microbiol.
43,
121-145
|
| 45.
|
Combadiere, B.,
Freedman, M.,
Chen, L.,
Shores, E. W.,
Love, P.,
and Lenardo, M. J.
(1996)
J. Exp. Med.
183,
2109-2117
|
| 46.
|
Yao, X. R.,
Flaswinkel, H.,
Reth, M.,
and Scott, D. W.
(1995)
J. Immunol.
155,
652-661
|
| 47.
|
Tseng, J.,
Eisfelder, B. J.,
and Clark, M. R.
(1997)
Blood
89,
1513-1520
|
| 48.
|
Sugawara, H.,
Kurosaki, M.,
Takata, M.,
and Kurosaki, T.
(1997)
EMBO J.
16,
3078-3088
|
| 49.
|
de Aos, I.,
Metzger, M. H.,
Exley, M.,
Dahl, C. E.,
Misra, S.,
Zheng, D.,
Varticovski, L.,
Terhorst, C.,
and Sancho, J.
(1997)
J. Biol. Chem.
272,
25310-25318
|
| 50.
|
Zychlinsky, A.,
Prevost, M.,
and Sansonetti, P.
(1992)
Nature
358,
167-169
|
| 51.
|
Monack, D.,
Raupach, B.,
Hromockyj, A.,
and Falkow, S.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
9833-9838
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S.-s. Zhang, C. G. Park, P. Zhang, S. S. Bartra, G. V. Plano, J. D. Klena, M. Skurnik, B. J. Hinnebusch, and T. Chen
Plasminogen Activator Pla of Yersinia pestis Utilizes Murine DEC-205 (CD205) as a Receptor to Promote Dissemination
J. Biol. Chem.,
November 14, 2008;
283(46):
31511 - 31521.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Zhang, M. Skurnik, S.-S. Zhang, O. Schwartz, R. Kalyanasundaram, S. Bulgheresi, J. J. He, J. D. Klena, B. J. Hinnebusch, and T. Chen
Human Dendritic Cell-Specific Intercellular Adhesion Molecule-Grabbing Nonintegrin (CD209) Is a Receptor for Yersinia pestis That Promotes Phagocytosis by Dendritic Cells
Infect. Immun.,
May 1, 2008;
76(5):
2070 - 2079.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Schmitter, S. Pils, S. Weibel, F. Agerer, L. Peterson, A. Buntru, K. Kopp, and C. R. Hauck
Opa Proteins of Pathogenic Neisseriae Initiate Src Kinase-Dependent or Lipid Raft-Mediated Uptake via Distinct Human Carcinoembryonic Antigen-Related Cell Adhesion Molecule Isoforms
Infect. Immun.,
August 1, 2007;
75(8):
4116 - 4126.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Zhang, S. Snyder, P. Feng, P. Azadi, S. Zhang, S. Bulgheresi, K. E. Sanderson, J. He, J. Klena, and T. Chen
Role of N-Acetylglucosamine within Core Lipopolysaccharide of Several Species of Gram-Negative Bacteria in Targeting the DC-SIGN (CD209)
J. Immunol.,
September 15, 2006;
177(6):
4002 - 4011.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Kuhlewein, C. Rechner, T. F. Meyer, and T. Rudel
Low-Phosphate-Dependent Invasion Resembles a General Way for Neisseria gonorrhoeae To Enter Host Cells
Infect. Immun.,
July 1, 2006;
74(7):
4266 - 4273.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Zhang, O. Schwartz, M. Pantelic, G. Li, Q. Knazze, C. Nobile, M. Radovich, J. He, S.-C. Hong, J. Klena, et al.
DC-SIGN (CD209) recognition of Neisseria gonorrhoeae is circumvented by lipooligosaccharide variation
J. Leukoc. Biol.,
April 1, 2006;
79(4):
731 - 738.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Pantelic, Y.-J. Kim, S. Bolland, I. Chen, J. Shively, and T. Chen
Neisseria gonorrhoeae Kills Carcinoembryonic Antigen-Related Cellular Adhesion Molecule 1 (CD66a)-Expressing Human B Cells and Inhibits Antibody Production
Infect. Immun.,
July 1, 2005;
73(7):
4171 - 4179.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zhang, G. Li, A. Bafica, M. Pantelic, P. Zhang, H. Broxmeyer, Y. Liu, L. Wetzler, J. J. He, and T. Chen
Neisseria gonorrhoeae Enhances Infection of Dendritic Cells by HIV Type 1
J. Immunol.,
June 15, 2005;
174(12):
7995 - 8002.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Klena, P. Zhang, O. Schwartz, S. Hull, and T. Chen
The Core Lipopolysaccharide of Escherichia coli Is a Ligand for the Dendritic-Cell-Specific Intercellular Adhesion Molecule Nonintegrin CD209 Receptor
J. Bacteriol.,
March 1, 2005;
187(5):
1710 - 1715.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. McCaw, E. H. Liao, and S. D. Gray-Owen
Engulfment of Neisseria gonorrhoeae: Revealing Distinct Processes of Bacterial Entry by Individual Carcinoembryonic Antigen-Related Cellular Adhesion Molecule Family Receptors
Infect. Immun.,
May 1, 2004;
72(5):
2742 - 2752.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W. Booth, D. Telio, E. H. Liao, S. E. McCaw, T. Matsuo, S. Grinstein, and S. D. Gray-Owen
Phosphatidylinositol 3-Kinases in Carcinoembryonic Antigen-related Cellular Adhesion Molecule-mediated Internalization of Neisseria gonorrhoeae
J. Biol. Chem.,
April 11, 2003;
278(16):
14037 - 14045.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. P. Bos, D. Kao, D. M. Hogan, C. C. R. Grant, and R. J. Belland
Carcinoembryonic Antigen Family Receptor Recognition by Gonococcal Opa Proteins Requires Distinct Combinations of Hypervariable Opa Protein Domains
Infect. Immun.,
April 1, 2002;
70(4):
1715 - 1723.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Chen, W. Zimmermann, J. Parker, I. Chen, A. Maeda, and S. Bolland
Biliary glycoprotein (BGPa, CD66a, CEACAM1) mediates inhibitory signals
J. Leukoc. Biol.,
August 1, 2001;
70(2):
335 - 340.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|