Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M010609200 on February 5, 2001

J. Biol. Chem., Vol. 276, Issue 20, 17413-17419, May 18, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/20/17413    most recent
M010609200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, T.
Right arrow Articles by Zimmermann, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, T.
Right arrow Articles by Zimmermann, W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The CGM1a (CEACAM3/CD66d)-mediated Phagocytic Pathway of Neisseria gonorrhoeae Expressing Opacity Proteins Is Also the Pathway to Cell Death*

Tie ChenDagger §, Silvia Bolland, Ines Chen||, James Parker||, Milica PantelicDagger , Fritz Grunert**, and Wolfgang Zimmermann**

From the Dagger  Department of Microbiology, Immunology and Medicine, Walther Oncology Center, Indiana University School of Medicine, Indianapolis, Indiana 46202, the || Laboratory of Bacterial Pathogenesis and Immunology, the  Laboratory of Molecular Genetics and Immunology, The Rockefeller University, New York, New York 10021, and the ** Institute of Molecular Medicine and Cell Research, University of Freiburg, D-79104 Freiburg, Germany

Received for publication, November 26, 2000


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Phagocytosis of Opa+ Neisseria gonorrhoeae (gonococcus, GC) by neutrophils is in part dependent on the interaction of Opa proteins with CGM1a (CEACAM3/CD66d) antigens, a neutrophil-specific receptor. However, the signaling pathways leading to phagocytosis have not been characterized. Here we show that interaction of OpaI bacteria with neutrophils or CGM1a-transfected DT40 cells induces calcium flux, which correlates with phagocytosis of bacteria. We identified an immunoreceptor tyrosine-based activation motif (ITAM) in CGM1a, and showed that the ability of CGM1a to transduce signals and mediate phagocytosis was abolished by mutation of the ITAM tyrosines. We also demonstrated that CGM1a-ITAM-mediated bacterial phagocytosis is dependent on Syk and phospholipase C activity in DT40 cells. Unexpectedly, the activation of the CGM1a-ITAM phagocytic pathway by Opa+ GC results in induction of cell death.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Gonorrhea is one of the most frequently reported sexually transmitted diseases (1). Neisseria gonorrhoeae (gonococcus, GC),1 the etiologic agent of gonorrhea, can adhere to and penetrate mucosal cells (2, 3) and attain access to submucosal sites. Among the GC surface proteins that mediate this process is the opacity (Opa) protein family. This family consists of 11 unlinked opa genes, whose sequences are known (4). In addition, each Opa protein is able to switch its expression on and off, resulting in the unavoidable tendency of GC to alter their phenotypes by antigenic variation. Opa-expressing GC and Escherichia coli (Opa+ GC or E. coli) can attach to and invade human fallopian tube epithelium (5), indicating that Opa proteins alone are sufficient to promote adherence to and invasion of human cells. Furthermore human challenge experiments (6, 7) strongly suggest that in vivo expression of Opa proteins plays an important role in gonococcal pathogenesis on the mucosal surface.

It is well recognized that Opa proteins have the ability to stimulate adherence and phagocytosis of the Opa+ bacteria by polymorphonuclear leukocytes (PMN). This interaction with PMN occurs in an opsonin-independent manner (8-12). In addition, Opa+ bacteria stimulate a chemiluminescent response in human neutrophils as a result of oxidative burst activity. Furthermore, recent studies demonstrated that members of the carcinoembryonic antigen (CEA) or CD66 family serve as receptors mediating adherence and possibly phagocytosis of Opa+ bacteria (13-16). These findings were mainly obtained with HeLa transfectants expressing individual CEA family members. However, neither the nature of the signals nor the pathways that are involved in phagocytosis of the bacteria are clear.

The CEA gene is a member of a family of 18 expressible closely related genes (17) that belong to the immunoglobulin (Ig) gene superfamily (18). Recently, the nomenclature of the CEA family has been revised to be CEACAM (CEA-related cell adhesion molecules) family (19). The human CEA family includes BGP (biliary glycoprotein), CGM6 (CEA gene family member 6), NCA (nonspecific cross-reacting antigens), CGM1, CEA and PSG (pregnancy-specific glycoproteins), which are also designated CD66a (CEACAM1), CD66b (CEACAM8), CD66c (CEACAM6), CD66d (CEACAM3), CD66e (CEACAM5), and CD66f, respectively. CEACAM (CEA-related cell adhesion molecules) was renamed from the CEA family (19) recently. It is noteworthy that CGM1a (CD66d), which promotes the strongest phagocytosis of Opa+ bacteria, is only expressed in human neutrophils (20).

Various components of the B cell receptors (BCR), T cell receptors (TCR), and Fc receptors (FcR) contain common sequence motifs in their cytoplasmic tails, called the immunoreceptor tyrosine-based activation motif (ITAM; Ref. 21). The phosphorylated tyrosine residues within ITAMs can recruit protein-tyrosine kinases (PTK), e.g. Syk, whereupon these become activated. Recruitment of substrates such as phospholipase C-gamma (PLC-gamma ) by these kinases leads to stimulation of calcium flux from intracellular stores (22-25). This calcium flux reflects an early event after activation of PTK.

In this study, we demonstrate that CGM1a bears a functional ITAM in its cytoplasmic tail, which mediates phagocytosis of Opa+ bacteria followed by cell death.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Bacterial Strains, Cell Culture, and Antibodies-- GC strain MS11 was cultured and maintained as previously described (26). Only pilus- GC and LOSb (lacto-N-neotetraose) phenotype were used (27). Recombinant opa genes from GC MS11 were constructed and expressed in E. coli HB101 as described previously (28). The designations of Opa proteins of both GC and E. coli are based on Swanson et al. (6) and Belland et al. (28). The Opa+ bacteria used in this study are Opa-, OpaC, OpaD, OpaF, and OpaI GC or Opa- and OpaI E. coli.

The wild-type chicken B-cells DT40, their mutants DT40-Syk (Syk-/-) and DT40-PLC-gamma (PLC-gamma -/-) (29, 30) and transfectants were maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum, 1% chicken serum, 50 µM 2-mercaptoethanol and 2 mM L-glutamine.

COL-1 monoclonal antibody (MAb), specific for CGM1 and CEA, was purchased from Zymed Laboratories Inc. Laboratories INC., California. B1.1 antibody, which reacts with BGP, NCA, CGM1, and CEA, was generously provided by Dr. Jeffrey Schlom, NCI, National Institutes of Health. The YTH71.3. antibody, which recognizes BGP, NCA, and CGM1, was purchased from Harlan Bioproducts (Indianapolis, IN). Anti-Fc antibody 2.4G2 was purchased from PharMingen (San Diego, CA).

Preparation of Neutrophils-- Neutrophils from human blood were purified by centrifugation through Polymorphprep (Life Technologies, Inc.). The purified PMN were suspended either in RPMI or Hanks' balanced salt solution (HBSS; Cellgro, Herndon, VA) at a concentration of 2 × 106/ml.

Transfections-- CGM1a cDNA and its mutants were cloned into pBEH expression vector, and NCA and BGPa were cloned into pRC/CMV vector. 10 µg of expression plasmids were co-transfected with 1 µg of pBabe-puror vector (31) into 5 × 106 DT40 cells by electroporation at 250 V and 960 µF in 0.5 ml. Stable transfectants were selected in 0.5 µg/ml puromycin 24 h after electroporation. The presence of CD66 antigens in individual clones was determined by flow cytometry analysis using FACScan (Becton Dickinson, Mountain View, CA) analysis with COL-1, YTH71.3., and secondary antibodies conjugated with FITC.

Generation of CGM1a Mutants-- The CGM1a cDNA cloned in pBEH has been previously described (20). The tyrosine residues Tyr-196 and Tyr-207 (position 1 corresponds to the first amino acid of the mature protein after removal of the leader peptide) in the wild-type cytoplasmic domain of CGM1a were changed to phenylalanine residues, giving rise to three different mutants: Y196F, Y207F, and Y196F/Y207F (Fig. 1B). Site-directed mutagenesis was achieved with the QuickChange Site-Directed Mutagenesis Kit (from Stratagene, San Diego, CA). Three primer pairs were designed for obtaining the mutants Y196F, Y207F, and Y196F/Y207F: TyrI5', 5'-GCAGCTTCCATCTTTGAGGAATTGC and TyrI3', 5'-GACATTCCTCAAAGATGGAAGCTGC, TyrII5', 5'-GACACAAACATTTTCTGCCGGATGGACC and TyrII3', 5'GGTCCATCCGGCAGAAAATGTTTGTGTC,and TyrI-II5', 5'-GCTTCCATCTTTGAGGAATTGCTAAAACATGACACAAACATTTTCTGCCG, and TyrI-II3', 5'-CCGGCAGAAAATGTTTGTGTCATGTTTTAGCAATTCCTCAAAGATGGAAGC. The mutated sequences of CGM1a were confirmed by DNA sequencing using the primers CGM1a5' (5'-TCCTGGAGCCCAGCCTCTTTT) and CGM1a3' (5'-AGGCTGTCGAGGTCTCCA).

Calcium Measurements-- DT40 cells or neutrophils (4 × 106) were suspended in 3 ml of RPMI medium. 6 fl of 1 µM Fura-2AM (Molecular Probe, Eugene, OR) dissolved in Me2SO were added to the suspension, which was then incubated in the dark at 37 °C for 30 min with occasional shaking. Cells were washed twice with HBSS and resuspended in 3 ml of HBSS. 0.5 ml of cell suspension was mixed with 1 ml of phosphate-buffered saline containing 1 mM CaCl2 and 1 mM MgCl2. For activation assays, 0.1 ml of the bacterial suspensions at a concentration of 4 × 108 was added to the labeled cells. The cytosolic calcium concentration was determined with a fluorescence spectrophotometer (LB50B, Perkin Elmer, Foster City, California) at an excitation wavelength of 340 and 360 nm, and an emission wavelength of 510 nm. Calculation of the calcium concentration was performed using the FL WinLab software (Perkin Elmer). We should state here that we usually test three (at least two) different transfectants of each mutant to make sure that they behave equally. It should be noted that anti-receptor antibodies are often used to stimulate the activation of receptors such as BCR and TCR. However, none of the anti-CEA antibodies we tested (COL-1, B1.1, 4-12-5, and YTH71.3) was able to stimulate calcium flux in DT40-CGM1a, even when cross-linked with secondary antibodies.

Phagocytosis Assays-- DT40 cells transfected with CGM1a (DT40-CGM1a) and control DT40 cells were suspended in RPMI with 2% fetal calf serum at the concentration of 2-4 × 105/ml. 0.5 ml each of these cell suspensions was added to 24-well plates and after addition of 50 µl of bacterial suspensions in RPMI at the concentration of 8 × 107, the cells were allowed to incubate for 3 h at 37 °C in the presence of 5% CO2. Then gentamicin was added into each well to the final concentration of 100 µg/ml and incubated for another 90 min. The cells were washed three times with RPMI and lysed in phosphate-buffered saline containing 0.5% saponin (CalBiochem Corp.), and dilutions were plated on LB-agar or CG-agar. The level of internalization of bacteria into cells was calculated by determining the colony-forming units (cfu) recovered from the DT40 cell lysates.

Detection of Cell Death-- Annexin V-FITC binding to phosphatidylserine (PS) was used as the cell death assay according to the manufacturer's recommendations (PharMingen, San Diego, CA). Annexin V-FITC was used in conjunction with propidium iodide (PI) to distinguish apoptotic cells (annexin V-FITC positive, PI negative) from necrotic cells (annexin V-FITC positive, PI positive). Cells exhibited apoptotic cell-specific phosphatidylserine on their surface and, therefore, bound annexin V-FITC or took up PI, which cannot penetrate live cells. However, in our experiment, the cells that were either annexin V-FITC positive or PI positive were classified as dead cells (see Fig. 6). Neutrophils or DT40 cells (1 × 105) were suspended in 0.1 ml of 2% fetal calf serum in RPMI containing 1.5 × 106 bacteria (GC) and incubated at 37 °C for 6 h with occasional shaking. 50 µl of binding buffer (10 mM Hepes/NaOH, pH 7.4, 140 mM NaCl, and 2.5 mM CaCl2), 7.5 µl of Annexin V-FITC and 15 µl of PI were added in each vial. The cell suspensions were gently mixed and incubated for 15 min at room temperature in the dark. Finally, after addition of 550 µl of binding buffer, samples were analyzed immediately by flow cytometry.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Opa+ GC Stimulates Calcium Flux in Neutrophils and DT40-CGM1a but Not in DT40-BGPa or DT40-NCA-- Studies have indicated that Opa protein-mediated binding and phagocytosis of GC by PMN occurs through the CEA family members on PMN (13, 14, 16). Both BGPa and CGM1a contain possible ITAM-like motifs (Fig. 1A). NCA, which is membrane anchored by a glycosylphosphatidyl inositol (GPI) moiety, is expressed on granulocytes and has also been shown to bind to Opa proteins. To examine whether the interaction between GC and neutrophils results in any signaling in the PMNs, measurement of calcium flux was performed. OpaI GC were used to stimulate neutrophils. As shown in Fig. 2A, OpaI GC but not Opa- GC induced calcium flux in neutrophils, suggesting that at least one of the three CEA family members in question conveys these signals, possibly by an ITAM.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 1.   Schematic representation of putative ITAM and ITIM present in the cytoplasmic domain of CGM1a/BGPa (A) and CGM1a (B). A, the putative ITAM and ITIM present in the cytoplasmic domain of CGM1a and BGPa. The cytoplasmic sequences of CGM1a and BGPa are aligned with consensus sequences for the immunoreceptor tyrosine-based activation motif and immunoreceptor tyrosine-based inhibition motif (ITAM, YX2LX7YX2(L/I) and ITIM, (V/I)XXYXXL/V, where X represents any amino acid). The numbers indicate the position of the tyrosine residues in the mature protein (after removal of the leader peptide). B, CGM1a (WT, Y196F, Y207F, and Y196F/Y207F) comprises an extracellular domain, a transmembrane region, and a cytoplasmic tail. In the mutants, tyrosines at position 196 and/or 207 of CGM1a have been altered to phenylalanines.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2.   Opa+ GC stimulates calcium flux in neutrophils and DT40-CGM1a cells. A, intracellular calcium flux in neutrophils was triggered by addition of OpaI GC (blue line) but not by Opa- GC (red line). Arrows indicate the time points when bacteria were added. B, stimulation of calcium flux in DT40 transfectants expressing different CEA antigens. Intracellular calcium flux in DT40-CGM1a was triggered by addition of OpaI GC but not by Opa- GC (* , red line). On the other hand, OpaI GC could not stimulate calcium flux in DT40-BGPa and DT40-NCA cells. The expression levels of CGM1a (Fig. 3), BGPa, and NCA in stable DT40 B cell transfectants were determined by flow cytometry with anti-CD66 antibodies, COL-1, and YTH71.3. Untransfected DT40 B cells were used as negative controls (filled-in curve). x axis, time in seconds.

To determine which of the three CEA-related receptors is responsible for the calcium flux in neutrophils induced by Opa+ GC (Fig. 2A), the DT40 B cell line was chosen to perform functional studies. There are several reasons why we chose this cell line. First, the ITAM, which could be responsible for the signaling through the CEA-related molecules, was originally identified in the Igalpha /Igbeta heterodimer of the BCR (32, 33), and DT40 B cells have proven to be suitable for studying the functionality of presumed ITAMs (34, 35) e.g. by induction of calcium flux as observed after BCR activation. Furthermore, human neutrophils are terminally differentiated cells and cannot be genetically manipulated. Manipulation of established myeloid lines of human origin such as HL60 cells cannot be performed readily either because endogenous CD66 antigen expression changes during induction of maturation by retinoic acid4. Finally, no Opa+ GC were found to interact exclusively with individual CEA antigens like CGM1a (36, 37). In short, a cellular system that lacks endogenous human CEA antigens and can be manipulated, like the DT40 cell line, is needed to understand the behavior of CEA-related molecules in neutrophils. We believe that the DT40 cell line is the best model available.

CGM1a, BGPa (both represent splice variants that code for tyrosine-containing cytoplasmic tails) and NCA cDNAs were cloned into pBEH or pRc/CMV expression vectors, and the resulting plasmids were stably transfected into the DT40 B cell line, generating the DT40-CGM1a, DT40-BGPa, and DT40-NCA transfectants. All three cell lines expressed similar levels of the respective CEA-related antigens (Figs. 2B and 3). When OpaI GC were added to these three cell lines, calcium flux was only observed in the DT40-CGM1a transfectant (Fig. 2B). In contrast, Opa- GC could not stimulate any calcium flux. Likewise, no calcium flux was detected in untransfected DT40 cells treated with OpaI GC. These results show that only CGM1a is able to convey the calcium flux and suggest that it contains a functional ITAM.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 3.   Mutation of Tyr-196 from CGM1a abolished the calcium flux in DT-CGM1a. The calcium flux response was measured as described in the legend to Fig. 2 in DT40 B cells, DT40-CGM1a, DT40-CGM1a-Y196F, DT40-CGM1a-Y207F, and DT40-CGM1a-Y196F/Y207F cells upon addition of OpaI GC. The expression level of the different chimeric molecules in stable DT40 B cell transfectants was determined by flow cytometry (right panel) using anti-CGM1a COL-1 antibody. Untransfected DT40 B cells were used as a negative control.

Mutation of Tyrosine Residue Tyr-196 in CGM1a Abolishes Its Signaling Capability-- Phosphorylation of tyrosine residues within an ITAM is a key step for its activation. The cytoplasmic domain of CGM1a contains two tyrosine residues in its potential ITAM. To test whether these tyrosine residues were required for activation of the calcium flux, we substituted them with phenylalanine. Three different tyrosine mutants, CGM1a-Y196F, CGM1a-Y207F, and CGM1a-Y196F/Y207F (Fig. 1B), were constructed and the resulting expression plasmids were transfected into DT40 cells. Transfectants that expressed similar levels of the mutated molecules were selected for the calcium flux experiments (Fig. 3). As depicted in Fig. 3, mutation of tyrosine residue 196 (Y196F) or mutation of both tyrosines in the cytoplasmic tail of CGM1a (Y196F/Y207F) completely abolished its signaling ability as measured by calcium flux. On the other hand, OpaI GC were able to stimulate a low level of calcium flux in the Y207F CGM1a mutant. These results indicate that both tyrosines are necessary to constitute a fully functional ITAM with Tyr-196 being the essential one. This mutation analysis of the cytoplasmic tyrosines of CGM1a confirms that the motif surrounding these tyrosines (YX2LX7YX2M) is a functional ITAM.

The ITAM in CGM1a Mediates Phagocytosis of Opa+ Bacteria-- CGM1a promotes strong phagocytosis of Opa+ bacteria. We wanted to know whether signaling through the ITAM in the cytoplasmic domain of CGM1a is involved in this process. First, using a colony-forming assay to quantify the number of internalized bacteria, we demonstrated that DT40-CGM1a cells are also capable of phagocytosing OpaI GC or E. coli but not Opa- GC or E. coli (Fig. 4A). This result was confirmed by electron microscopy analysis (Fig. 4, B and C). To elucidate the importance of the tyrosines in this process, the tyrosine mutants were tested in the phagocytosis assay. As in the calcium flux experiments, mutation of Tyr-196 or mutation of Tyr-196 and Tyr-207 in the ITAM severely impaired or abolished, respectively, the ability of CGM1a to confer phagocytosis of OpaI E. coli (Fig. 4D). However, some capacity to phagocytose OpaI E. coli was still preserved in DT40 cells expressing CGM1a-Y207F. From these results, we conclude that the ITAM in CGM1a mediates both calcium flux and the phagocytosis of Opa+ bacteria.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 4.   DT40-CGM1a-mediated phagocytosis of OpaI GC and OpaI E. coli is dependent on CGM1a ITAM. A, DT40-CGM1a and control DT40 were plated onto 24-well plates. OpaI and Opa- bacteria were added to the cultures and incubated for 3 h. The extracellular bacteria were killed by addition of 100 µg/ml (final concentration) of gentamicin. The number of phagocytosed bacteria was determined by counting CFUs recovered following gentamicin treatment. Transmission electron micrograph shows internalization of OpaI GC (B) and OpaI E. coli (C) by DT40-CGM1a cells. The large numbers of internalized Opa+ GC and OpaI E. coli enclosed within vesicles are clearly visible as indicated with arrows. D, mutation of either of the tyrosine residues on ITAM impaired the ability of CGM1a to phagocytose OpaI GC.

Syk and PLC-gamma Enzymes Participate in Phagocytosis of Opa+ Bacteria-- We tested the ability of DT40-CGM1a cells lacking Syk and PLC-gamma activity to mediate calcium flux and phagocytosis, because the downstream pathway of ITAM activation involves Syk, whose activation in turn leads to PLC-gamma stimulation. DT40-Syk-CGM1a or DT40-PLC-gamma -CGM1a cells are CGM1a-transfected DT40 cells in which the Syk or PLC-gamma genes have been inactivated. As depicted in Fig. 5A and B, DT40-Syk-CGM1a cells cannot be induced to generate a calcium flux or to phagocytose OpaI bacteria. However, DT40-PLC-gamma -CGM1a cells can still phagocytose OpaI E. coli at low level although stimulation of calcium flux could not be detected (Fig. 5). This suggests that an increased intracellular Ca2+ concentration is not essential for phagocytosis. These data demonstrate that both Syk and PLC participate in the pathways leading to phagocytosis of Opa+ bacteria, but Syk is essential for this process.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5.   Syk and PLC-gamma participate in CGM1a-mediated calcium flux, phagocytosis, and cell death. DT40, DT40-CGM1a, DT40-Syk-CGM1a and DT40-PLC-gamma -CGM1a cells were tested for their ability to generate calcium flux (A), phagocytosis (B), and to be induced cell death (C) by interaction with Opa. The same procedures as for calcium flux in Fig. 2, bacterial phagocytosis in Fig. 4 and cell death in Fig. 6 were followed, respectively. DT40-Syk-CGM1a lost all these abilities, whereas DT40-PLC-gamma -CGM1a preserved some capacity to phagocytose bacteria.

Activation of the ITAM in CGM1a (CEACAM3/CD66d) Results in Cell Death in DT-40 Cells-- Signal transduction via BCR activation results very complicated consequences. However, one of them leads to apoptosis of B cells (38). We examined whether activation of CGM1a ITAM had a similar effect on DT-40 cells. As shown in Fig. 6, OpaI GC stimulated substantially more cell death in DT40-CGM1a as measured by both phosphatidylserine exposure and uptake of propidium iodine than Opa- GC did. Untransfected DT40 B cells, used as a control, could not be killed by OpaI or Opa- GC (Fig. 6). The observed cell death is dependent on ITAM activation because CGM1a-Y196F and CGM1a-Y196F/Y207F mutants (Fig. 1) lost the ability to promote cell death (Fig. 6). Some cell death was observed in DT40-CGM1a with Opa- GC, which might be because of low numbers of Opa+ GC in the Opa- GC suspension because GC are able to switch Opa gene expression on and off. Alternatively, CGM1a might be activated by other components on GC, which are still unidentified. It should be noted that the anti-CGM1a specific antibody COL-1, which was unable to induce calcium flux, could not stimulate the death DT40-CGM1a either (data not shown).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 6.   Opa+ GC-induced cell death in DT40-CGM1a cells depends on the ITAM. DT40, DT40-CGM1a, DT40-CGM1a-Y196F, DT40-CGM1a-Y207F, and DT40-CGM1a-Y196F/Y207F cells were incubated with OpaI or Opa- GC and without GC (Control panel) for 6 h. Cells that bound annexin V-FITC or took up PI were counted as dead cells. The percentage of dead cells is indicated on the y axis.

To further validate the effects of the CGM1a-ITAM activation pathway, DT40-Syk-CGM1a and DT40-PLC-gamma -CGM1a cells were tested for cell death. As shown in Fig. 5, OpaI GC was not able to promote death of cells lacking Syk, but still killed a significant fraction of DT40-PLC-gamma -CGM1a cells. The similarity between the patterns of bacterial phagocytosis and cell death suggests that these two processes share the same initiating events.

Killing of Neutrophils by GC Depends on Expression of Individual Opa Proteins-- We showed that activation of the phagocytic pathway via CGM1a led to cell death in DT40 cells. Thus, the question arises whether the CGM1a-ITAM pathway to cell death can also be observed in neutrophils, which are the only cells naturally expressing CGM1a. However, neutrophils cannot be genetically manipulated and so far none of the myeloid cell lines currently available fully resemble neutrophils and thus can convincingly replace PMNs. Furthermore, antibodies specific for CGM1a do not activate neutrophils.

Fortunately, recent data did show that various Opa proteins interacted differently with CGM1a and BGPa. For example, OpaC or OpaI interact with both CGM1a and BGPa, and OpaD or OpaF interact with BGPa only (36, 37). Thus, the rational is that if the CGM1a-ITAM pathway, demonstrated in DT40 cells, also applies to neutrophils, only GC-expressing Opa proteins that interact with CGM1a (such as OpaC or OpaI) should stimulate the death of neutrophils, as opposed to OpaD or OpaF-expressing GC. Opa-, OpaC, D, F, and I GC were used to perform similar experiments with neutrophils as done with the B cell lines in Fig. 6. As shown in Fig. 7, OpaC and I GC killed many more neutrophils than Opa- and OpaD or OpaF GC did. It should be noted that GC expressing these different Opa proteins have the similar ability to associate with neutrophils (39). These results suggest that activation of the ITAM in CGM1a also stimulates cell death in neutrophils.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 7.   OpaC and OpaI GC kill more neutrophils than OpaD, OpaF, and Opa- GC. Purified neutrophils were incubated with variable GC expressing different Opa proteins for 6 h. The measurements for Opa-stimulated neutrophil death were described in the legend to Fig. 6.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Internalization of microorganisms into either professional or non-professional phagocytic cells requires the interaction of phagocytosis-promoting receptors on the cell surface with ligands on the surface of the microorganisms. In the present study, we demonstrated that the neutrophil-specific receptor, CGM1a contains an ITAM, which is essential for CGM1a-mediated phagocytosis of Opa+ bacteria. This conclusion is further validated by showing that CGM1a-transfected, Syk-deleted DT40 cells are no longer able to promote effectively either calcium ion influx or phagocytosis of OpaI bacteria. Finally, we showed that CGM1a-mediated phagocytosis of opacity (Opa) proteins-expressing Neisseria gonorrhoeae leads to cell death.

Because CGM1a is only expressed in PMNs, it is a concern whether CGM1a-mediated signaling data obtained from the B cell line DT40 reflects its biological properties in neutrophils. ITAM-containing receptors have nearly exclusively been identified in cells from immune system. Despite the differences in the structures they recognize and the effector functions they carry out, BCRs, TCRs, and several FcRs utilize remarkably similar signal transduction components to initiate and propagate their signaling responses. They use components that contain distinct recognition (ITAM) and signal transduction subunits such as Syk, with which the ITAM in CGM1a may be also associated (Fig. 5). This type of receptors is crucial for transmission of activation signals in immune cells. Here, we show that the human CGM1a, although ectopically expressed in a chicken B cell line, exhibits the ITAM characteristics of BCRs, supporting the notion that ITAMs are highly conserved motifs, and that the CGM1a ITAM might play a similar role in neutrophils.

Opa+ Neisseria interact with BGP and CGM1 on neutrophils during in vitro infection, and both antigens promote phagocytosis of Opa+ bacteria in HeLa transfectants (13, 14, 16). Do CGM1a and BGPa work independently or do they collaborate during phagocytosis of GC by neutrophils? What kind of collaboration could be envisaged? BGPa can deliver inhibitory signals through its ITIM in the cytoplasmic tail to counteract ITAM-mediated positive signals, which requires SHP-1 and SHP-2.2 The protein-tyrosine phosphatases SHP-1 and SHP-2, which are typically involved in negative signaling, bind to the ITIM-like motif in the cytoplasmic tail of BGPa (40, 41). Indeed, it has recently been shown that interaction of Opa+ GC with BGPa antigens down-regulates the activity of SHP-1 (42). Therefore, BGPa may be co-ligated with CGM1a on the surface of neutrophils when they interact with Opa+ bacteria. Cross-linkage of the two molecules might regulate the phagocytosis process. Opa+ GC-stimulated signal transduction events in neutrophils might consequently be analogous to the positive (ITAM) versus negative (ITIM) signaling seen with lymphocyte receptors such as BCR and FcRIIB, respectively (43).

In addition, this study raises an interesting issue. This is the first report of phagocytosis of bacteria by B cells. Antigen-immunoreceptor interaction is an important step for the establishment of the immune response, because there is signaling from the receptor to activate different cellular functions. Internalization of antigen-bound receptors by B cells is critical for antigen processing and presentation to T lymphocytes. Here we show that DT40-CGM1a B cells were able to phagocytose Opa+ bacteria (either GC or E. coli) in a very efficient manner. Although the cell line we used was manipulated to express CGM1a antigen, our data, nevertheless, suggest that B cells possess the machinery to phagocytose whole bacteria. Demonstration of the ability of B cells to phagocytose bacteria is a new information with a potential.

What is the biological fate of Opa+ GC after phagocytosis by PMN? It is generally thought that the phagocytosed gonococci are killed. However, neutrophils are often packed with intact, seemingly viable, intracellular GC (44). Thus, the possibility exists that these Opa+ GC may be protected from bactericidal attack by the granulocytes and instead use these cells as an intracellular niche or as vehicles to reach the next host. Alternatively, they could simply kill the PMNs. In fact, it was recently found that the ITAM activation pathway also induces cell apoptosis in immune cells (23, 38, 45-49). For example, activation of the ITAM in the BCR of DT40 B cells results in apoptosis (38, 48). In this context it is interesting to note that OpaI and OpaC GC but not OpaD and OpaF GC stimulate the death of neutrophils (Fig. 7) although the level of interaction of OpaC, D, F, and I GC with neutrophils is similar (39). Perhaps, phagocytosis of Opa+ GC by neutrophils through CGM1a leads in part to apoptosis of these cells. In addition, compared with other cells from immune system, there is not much known of the mechanisms of cell death in PMNs, even though these cells are noted for their death fate. In humans, PMNs succumb to apoptosis within 72 h. Thus, finding that expression of ITAM-containing CGM1a, a specific PMN antigen, mediated the death in B-cell and possibly in neutrophils is very significant. Whether BGPa mediated internalization of Opa+ GC in neutrophils could reduce apoptosis of neutrophils remains to be determined, because BGPa contains an ITIM to counteract the activated ITAM.2

It may seem to a paradox that host cells phagocytosing microorganisms kill them and also may be killed by microorganisms. However, the two aspects might in reality represent two separate battlefields in the interaction between bacteria (GC) and host cells (PMNs). This phenomenon also occurs in interaction between other pathogenic bacteria and host cells. For example, whether the outcome of macrophages phagocytosing Shigella or Salmonella is the killing of the microorganisms or the death of the host cell (50, 51) remains to be defined in vivo. The study of the interaction of Opa+ bacteria with host cells through CEA (CEACAM/CD66) antigens addresses two facets of phagocytosis of GC by PMNs, which are critical for the understanding of the pathogenesis of gonococcal infection.

    ACKNOWLEDGEMENTS

We thank Dr. M. Kuroki for generously providing the cDNA of BGPa. We are indebted to John Swanson and Bob Belland for supplying the Opa+ bacteria. We also thank Dr. Stanley Spinola for useful suggestions and editorial comments. We always thank Emil Gotschlich for insightful scientific advice.

    FOOTNOTES

* This work was supported by Public Health Service Grants AI 47736 (to T. C.) and AI 26558 (to E. G.) and a grant from the Deutsche Forschungsgemeinschaft (to W. Z.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ To whom correspondence should be addressed: Dept. of Microbiology, Immunology, and Medicine, Indiana University School of Medicine, MS 252, 635 Barnhill Dr., Indianapolis, IN 46202-5120. Tel.: 317-274-0519; Fax: 317-274-4090; E-mail: tiechen@iupui.edu.

Published, JBC Papers in Press, February 5, 2001, DOI 10.1074/jbc.M010609200

2 Chen, T., Zimmerman, W., Chen, I., Parker, J., Grunert, F., Maeda, A., and Bolland, S. (2001) in press.

    ABBREVIATIONS

The abbreviations used are: GC, gonococcus or N. gonorrhoeae; Opa, opacity protein; PMN, polymorphonuclear leukocytes; DT40-CGM1a, DT40 B cell line expressing human CGM1a antigen; Opa- E. coli, E. coli HB101 containing the vector pGEM-3Z; OpaI E. coli, E. coli HB101-expressing OpaI protein; BGP (CD66a), biliary glycoprotein; CEA (CD66e), carcinoembryonic antigen; CEACAM, CEA-related cell adhesion molecule; ITAM, immunoreceptor tyrosine-based activation motif; ITIM, immunoreceptor tyrosine-based inhibition motif; Syk, Syk protein-tyrosine kinase; PLC-gamma , phospholipase C-gamma ; BCR, B cell receptor; TCR, T cell receptor; FcR, Fc receptor; PI, propidium iodide; PS, phosphatidylserine; FITC, fluorescein isothiocyanate.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Centers for Disease Control. (1993) Morbid. Mortal. Weekly Rep. 42, 55-63
2. Evans, B. A. (1977) J. Infect. Dis. 136, 248-255
3. Ward, M. E., and Watt, P. J. (1972) J. Infect. Dis. 126, 601-605
4. Bhat, K. S., Gibbs, C. P., Barrera, O., Morrison, S. G., Jahnig, F., Stern, A., Kupsch, E.-M., Meyer, T. F., and Swanson, J. (1991) Mol. Microbiol. 5, 1889-1901
5. Gorby, G., Simon, D., and Rest, R. (1994) Ann. New York Acad. Sci. 730, 286-289
6. Swanson, J., Barrera, O., Sola, J., and Boslego, J. (1988) J. Exp. Med. 168, 2121-2129
7. Jerse, A. E., Cohen, M. S., Drown, P. M., Whicker, L. G., Isbey, S. F., Seifert, H. S., and Cannon, J. G. (1994) J. Exp. Med. 179, 911-920
8. Swanson, J., Sparks, E., Young, D., and King, G. (1975) Infect. Immun. 11, 1352-1361
9. Swanson, J., King, G., and Zeligs, B. (1975) Infect. Immun. 11, 65-68
10. Virji, M., and Everson, J. S. (1981) Infect. Immun. 31, 965-970
11. Virji, M., and Heckels, J. E. (1986) J. Gen. Microbiol. 132, 503-512
12. Fischer, S. H., and Rest, R. F. (1988) Infect. Immun. 56, 1574-1579
13. Virji, M., Makepeace, K., Ferguson, D. J. P., and Watt, M. (1996) Mol. Microbiol. 22, 941-950
14. Chen, T., and Gotschlich, E. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 14851-14856
15. Chen, T., Grunert, F., Medina-Marino, A., and Gotschlich, E. (1997) J. Exp. Med. 185, 1557-1564
16. Gray-Owen, S., Dehio, C., Haude, A., Grunert, F., and Meyer, T. (1997) EMBO J. 16, 3435-3445
17. Hammarstrom, S. (1999) Semin. Cancer Biol. 9, 67-81
18. Paxton, R., Mooser, G., Pande, H., Lee, T. D., and Shively, J. E. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 920-924
19. Beauchemin, N., others, and Zimmermann, W. (1999) Exp. Cell Res. 252, 243-249
20. Nagel, G., Grunert, F., Kuijpers, T., Watt, S., Thompson, J., and Zimmermann, W. (1993) Eur. J. Biochem. 214, 27-35
21. Cambier, J. (1995) J. Immunol. 155, 3281-3285
22. Bijsterbosch, M., Meade, C., Turner, G., and Klaus, G. (1985) Cell 41, 999-1006
23. Takata, M., Homma, Y., and Kurosaki, T. (1995) J. Exp. Med. 182, 907-914
24. Tuveson, D. A., Carter, R. H., Soltoff, S. P., and Fearon, D. T. (1993) Science 260, 986-989
25. Buhl, A. M., Pleiman, C. M., Rickert, R. C., and Cambier, J. C. (1997) J. Exp. Med. 186, 1897-1910
26. Swanson, J., and Barrera, O. (1983) J. Exp. Med. 157, 1405-1420
27. Swanson, J. (1991) in Proceedings of the Seventh International Pathogenic Neisseria Conference (Achtman, M. , Kohl, P. , Marchal, C. , Morelli, G. , Seiler, A. , and Thiesen, B., eds) , pp. 391-396, Walter de Gruyter & Co., Berlin
28. Belland, R. J., Chen, T., Swanson, J., and Fischer, S. H. (1992) Mol. Microbiol. 6, 1729-1737
29. Takata, M., Sabe, H., Hata, A., Inazu, T., Homma, Y., Nukada, T., Yamamura, H., and Kurosaki, T. (1994) EMBO J. 13, 1341-1349
30. Takata, M., and Kurosaki, T. (1996) J. Exp. Med. 184, 31-40
31. Morgenstern, J., and Land, H. (1990) Nucleic Acids Res. 18, 3587-3596
32. Reth, M. (1989) Nature 338, 383-384
33. Reth, M. (1995) Seminars in Immunol. 7, 21-27
34. Cox, D., Chang, P., Kurosaki, T., and Greenberg, S. (1996) J. Biol. Chem. 271, 16597-16602
35. Maeda, A., Kurosaki, M., and Kurosaki, T. (1998) J. Exp. Med. 188, 991-995
36. Bos, M., Grunert, F., and Belland, R. (1997) Infect. Immun. 65, 2353-2361
37. Gray-Owen, S., Lorenzen, D., Haude, A., Meyer, T., and Dehio, C. (1997) Mol. Microbiol. 26, 971-980
38. Ono, M., Okada, H., Bolland, S., Yanagi, S., Kurosaki, T., and Ravetch, J. (1997) Cell 90, 293-301
39. Kupsch, E. M., Knepper, B., Kuroki, T., Heuer, I., and Meyer, T. F. (1993) EMBO J. 12, 641-650
40. Beauchemin, N., Kunath, T., Robitaille, J., Chow, B., Turbide, C., Daniels, E., and Veillette, A. (1997) Oncogene 14, 783-790
41. Huber, M., Izzi, L., Grondin, P., Houde, C., Kunath, T., Veillette, A., and Beauchemin, N. (1999) J. Biol. Chem. 274, 335-344
42. Hauck, C., Gulbins, E., Lang, F., and Meyer, T. (1999) Infect. Immun. 67, 5490-5494
43. Healy, J. I., and Goodnow, C. C. (1998) Annu. Rev. Immunol. 16, 645-670
44. Shafer, W. M., and Rest, R. F. (1989) Annu. Rev. Microbiol. 43, 121-145
45. Combadiere, B., Freedman, M., Chen, L., Shores, E. W., Love, P., and Lenardo, M. J. (1996) J. Exp. Med. 183, 2109-2117
46. Yao, X. R., Flaswinkel, H., Reth, M., and Scott, D. W. (1995) J. Immunol. 155, 652-661
47. Tseng, J., Eisfelder, B. J., and Clark, M. R. (1997) Blood 89, 1513-1520
48. Sugawara, H., Kurosaki, M., Takata, M., and Kurosaki, T. (1997) EMBO J. 16, 3078-3088
49. de Aos, I., Metzger, M. H., Exley, M., Dahl, C. E., Misra, S., Zheng, D., Varticovski, L., Terhorst, C., and Sancho, J. (1997) J. Biol. Chem. 272, 25310-25318
50. Zychlinsky, A., Prevost, M., and Sansonetti, P. (1992) Nature 358, 167-169
51. Monack, D., Raupach, B., Hromockyj, A., and Falkow, S. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 9833-9838


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S.-s. Zhang, C. G. Park, P. Zhang, S. S. Bartra, G. V. Plano, J. D. Klena, M. Skurnik, B. J. Hinnebusch, and T. Chen
Plasminogen Activator Pla of Yersinia pestis Utilizes Murine DEC-205 (CD205) as a Receptor to Promote Dissemination
J. Biol. Chem., November 14, 2008; 283(46): 31511 - 31521.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
P. Zhang, M. Skurnik, S.-S. Zhang, O. Schwartz, R. Kalyanasundaram, S. Bulgheresi, J. J. He, J. D. Klena, B. J. Hinnebusch, and T. Chen
Human Dendritic Cell-Specific Intercellular Adhesion Molecule-Grabbing Nonintegrin (CD209) Is a Receptor for Yersinia pestis That Promotes Phagocytosis by Dendritic Cells
Infect. Immun., May 1, 2008; 76(5): 2070 - 2079.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
T. Schmitter, S. Pils, S. Weibel, F. Agerer, L. Peterson, A. Buntru, K. Kopp, and C. R. Hauck
Opa Proteins of Pathogenic Neisseriae Initiate Src Kinase-Dependent or Lipid Raft-Mediated Uptake via Distinct Human Carcinoembryonic Antigen-Related Cell Adhesion Molecule Isoforms
Infect. Immun., August 1, 2007; 75(8): 4116 - 4126.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Zhang, S. Snyder, P. Feng, P. Azadi, S. Zhang, S. Bulgheresi, K. E. Sanderson, J. He, J. Klena, and T. Chen
Role of N-Acetylglucosamine within Core Lipopolysaccharide of Several Species of Gram-Negative Bacteria in Targeting the DC-SIGN (CD209)
J. Immunol., September 15, 2006; 177(6): 4002 - 4011.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
C. Kuhlewein, C. Rechner, T. F. Meyer, and T. Rudel
Low-Phosphate-Dependent Invasion Resembles a General Way for Neisseria gonorrhoeae To Enter Host Cells
Infect. Immun., July 1, 2006; 74(7): 4266 - 4273.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
P. Zhang, O. Schwartz, M. Pantelic, G. Li, Q. Knazze, C. Nobile, M. Radovich, J. He, S.-C. Hong, J. Klena, et al.
DC-SIGN (CD209) recognition of Neisseria gonorrhoeae is circumvented by lipooligosaccharide variation
J. Leukoc. Biol., April 1, 2006; 79(4): 731 - 738.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. Pantelic, Y.-J. Kim, S. Bolland, I. Chen, J. Shively, and T. Chen
Neisseria gonorrhoeae Kills Carcinoembryonic Antigen-Related Cellular Adhesion Molecule 1 (CD66a)-Expressing Human B Cells and Inhibits Antibody Production
Infect. Immun., July 1, 2005; 73(7): 4171 - 4179.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Zhang, G. Li, A. Bafica, M. Pantelic, P. Zhang, H. Broxmeyer, Y. Liu, L. Wetzler, J. J. He, and T. Chen
Neisseria gonorrhoeae Enhances Infection of Dendritic Cells by HIV Type 1
J. Immunol., June 15, 2005; 174(12): 7995 - 8002.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
J. Klena, P. Zhang, O. Schwartz, S. Hull, and T. Chen
The Core Lipopolysaccharide of Escherichia coli Is a Ligand for the Dendritic-Cell-Specific Intercellular Adhesion Molecule Nonintegrin CD209 Receptor
J. Bacteriol., March 1, 2005; 187(5): 1710 - 1715.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. E. McCaw, E. H. Liao, and S. D. Gray-Owen
Engulfment of Neisseria gonorrhoeae: Revealing Distinct Processes of Bacterial Entry by Individual Carcinoembryonic Antigen-Related Cellular Adhesion Molecule Family Receptors
Infect. Immun., May 1, 2004; 72(5): 2742 - 2752.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. W. Booth, D. Telio, E. H. Liao, S. E. McCaw, T. Matsuo, S. Grinstein, and S. D. Gray-Owen
Phosphatidylinositol 3-Kinases in Carcinoembryonic Antigen-related Cellular Adhesion Molecule-mediated Internalization of Neisseria gonorrhoeae
J. Biol. Chem., April 11, 2003; 278(16): 14037 - 14045.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. P. Bos, D. Kao, D. M. Hogan, C. C. R. Grant, and R. J. Belland
Carcinoembryonic Antigen Family Receptor Recognition by Gonococcal Opa Proteins Requires Distinct Combinations of Hypervariable Opa Protein Domains
Infect. Immun., April 1, 2002; 70(4): 1715 - 1723.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
T. Chen, W. Zimmermann, J. Parker, I. Chen, A. Maeda, and S. Bolland
Biliary glycoprotein (BGPa, CD66a, CEACAM1) mediates inhibitory signals
J. Leukoc. Biol., August 1, 2001; 70(2): 335 - 340.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/20/17413    most recent
M010609200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, T.
Right arrow Articles by Zimmermann, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, T.
Right arrow Articles by Zimmermann, W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement