|
Originally published In Press as doi:10.1074/jbc.M100916200 on February 22, 2001
J. Biol. Chem., Vol. 276, Issue 20, 17603-17609, May 18, 2001
Role of Intronic E- and N-box Motifs in the Transcriptional
Induction of the Acetylcholinesterase Gene during Myogenic
Differentiation*
Lindsay M.
Angus ,
Roxanne Y. Y.
Chan, and
Bernard J.
Jasmin§
From the Department of Cellular and Molecular Medicine and Centre
for Neuromuscular Disease, Faculty of Medicine, University of Ottawa,
Ottawa, Ontario, Canada K1H 8M5
Received for publication, January 31, 2001, and in revised form, February 15, 2001
 |
ABSTRACT |
In this study, we examined whether an intronic
N-box motif is involved in the expression of acetylcholinesterase
(AChE) during myogenesis. We determined that AChE transcripts are
barely detectable in cultured myoblasts and that their levels increase
dramatically in myotubes. Nuclear run-on assays revealed that this
increase was accompanied by a parallel induction in the transcriptional activity of the AChE gene. These changes in transcription
were also observed in transfection experiments using AChE
promoter-reporter gene constructs. Mutation of the intronic N-box at
position +755 base pairs (bp) reduced by more than 70% expression of
the reporter gene in myotubes. Disruption of an adjacent E-box, at
position +767 bp, also reduced expression of the reporter gene
following myogenic differentiation. Co-transfection experiments using
AChE promoter-reporter gene constructs and a myogenin expression vector showed that expression of this regulatory factor increased expression of the reporter gene in myotubes. Although the AChE promoter contains multiple E-boxes, mutation of this intronic one was sufficient to
prevent the myogenin-induced increase in reporter gene expression. Together, these results indicate that changes in AChE gene
transcription occur during myogenesis and highlight the contribution of
the intronic N- and E-box motifs in the developmental regulation of the
AChE gene in skeletal muscle.
 |
INTRODUCTION |
Acetylcholinesterase
(AChE)1 is widely recognized
as an essential component of cholinergic synapses. In both the central
and peripheral nervous systems, it is responsible for the hydrolysis of
acetylcholine released from nerve terminals thereby ensuring the
efficiency of synaptic transmission. Although a single gene encodes
AChE, several molecular forms can be generated as a result of
alternative splicing and distinct post-translational processing (for
reviews, see Refs. 1-3). It has been previously suggested that this
polymorphism allows for the expression of AChE catalytic subunits in
different cell types and at various subcellular locations where
specific molecular forms may perform site-specific functions (4).
In skeletal muscle, AChE expression is known to be markedly influenced
by the state of differentiation and innervation of the muscle fibers.
Numerous studies have indeed reported dramatic changes in the
expression of the enzyme during myo- and synapto-genesis as well as in
mature muscles following alterations in their normal levels of
neuromuscular activity and/or in their basic supply of trophic factors.
Given that AChE is an excellent marker of synaptic differentiation,
several groups have recently begun to decipher the molecular basis
underlying these changes in AChE expression. For example, increases in
AChE mRNA expression have previously been reported during myogenic
differentiation (5-9). Moreover, activity-induced changes in AChE
transcript levels have been observed in both cultured myotubes as well
as in skeletal muscle in vivo (10-14).
Despite these recent advances in our understanding of some of the
biosynthetic events regulating AChE expression in skeletal muscle, our
knowledge of the specific molecular mechanisms that account for these
changes in mRNA expression remains largely unknown. Nonetheless,
alterations in the stability of pre-synthesized AChE transcripts have
been suggested to account for at least a portion of the changes in
mRNA levels seen during myogenic differentiation (5, 9) and
following muscle denervation (13). On the other hand, the contribution
of transcriptional regulatory mechanisms has also been documented in
several studies that examined expression of the AChE gene by
nuclear run-on assays (13, 15) and promoter analyses (16-18).
Together, these studies indicate therefore, that both transcriptional
control mechanisms as well as post-transcriptional events contribute to
the regulation of AChE mRNA levels in skeletal muscle cells.
In this context, we have recently begun to examine the mechanisms
underlying the preferential accumulation of AChE transcripts within the
postsynaptic sarcoplasm of muscle fibers (see Refs. 11, 17, 19). In
these studies, we showed that the synaptic accumulation of AChE
transcripts results, at least partially, from the local transcriptional
activation of the AChE gene (17). By mutation/deletion
analysis, we further demonstrated the key role of the first intron in
regulating both the muscle-specific expression of the AChE
gene as well as its preferential synaptic expression. In particular,
our studies have shown the contribution of an intronic N-box motif and
of the ets-related transcription factor GABP (see Refs.
20-24) in the synaptic regulation of the AChE gene in
muscle fibers (17). Given the key role of this intronic N-box in the
regulation of AChE in adult skeletal muscle, we sought in the present
study to determine whether this DNA element also participates in the
control of the AChE gene during myogenic differentiation. In
addition, we also examined whether other sites, located within the
first intron, are also important in controlling AChE expression by
focusing on an adjacent E-box motif.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture--
Mouse C2C12 cells (ATCC, Manassas, VA) were
cultured on Matrigel (Collaborative Biomedical Products, Bedford,
MA)-coated 60-mm culture dishes in Dulbecco's modified Eagle's medium
(Life Sciences/Life Technologies, Inc., Burlington, Ontario)
supplemented with 10% fetal bovine serum, 292 ng/ml
L-glutamine, and 100 units/ml penicillin-streptomycin, in a
humidified chamber at 37 °C containing 5% CO2.
Confluent myoblasts were induced to differentiate and fuse into
myotubes by replacing the growth media with differentiation media that contained low serum (5% horse serum). Culture media were changed every
48 h.
RNA Extraction and Reverse-transcription and Polymerase Chain
Reaction (RT-PCR)--
Total RNA was isolated from myoblasts and
myotubes by using 1.0 ml of the TriPure Isolation Reagent (Life
Sciences/Life Technologies, Inc.) per 60-mm culture dish according to
the manufacturer's instructions. Briefly, following cell lysis with
the TriPure reagent, chloroform was added and the solution was mixed
vigorously prior to centrifugation at 12,000 × g for
15 min at 4 °C. The RNA contained in the resulting aqueous layer was
precipitated with isopropanol, and the pellet was washed several times
with 70% ethanol. The RNA was then resuspended in RNase-free water and
stored at 80 °C.
Quantitation of the amount of total RNA in each sample was performed
using the Amersham Pharmacia Biotech Gene Quant II RNA/DNA spectrophotometer. Each sample was adjusted to a final concentration of
80 ng/µl. Semi-quantitative RT-PCR was carried out as previously described in detail elsewhere (11, 13, 19, 25). Reverse transcription,
using random hexamers, was performed for 45 min at 42 °C, followed
by a 5-min incubation at 99 °C. PCR was then used to amplify
cDNAs corresponding to AChE and 12 S rRNA. Primers that
amplify AChE T transcripts were synthesized according to a previous
report (8). These were located in exons 4 (5'-3': CTGGGGTGCGGATCGGTGTACCCC) and 6 (5'-3': TCACAGGTCTGAGCAGCGTTCCTG) in
the AChE gene and gave rise to a 670-bp PCR product. The PCR cycling parameters included 1-min denaturation at 94 °C followed by
a 3-min primer annealing and extension at 70 °C (11, 13, 25). The
rRNA primers were synthesized based on available sequences (26). The 5'
(5'-3': GGAAGGCATAGCTGCTGG) and 3' (5'-3': CCTCGATGACATCCTTGG) primers
amplified a 368-bp target. The cycling parameters for rRNA were 1-min
denaturation at 94 °C, 1-min primer annealing at 54 °C, and 2-min
extension at 72 °C. For each reaction, a final 10-min elongation
step was carried out at 72 °C following the last cycle of
amplification. Quantitation of the relative abundance of the PCR
products was performed following agarose gel electrophoresis and
visualization of the amplified cDNAs using the fluorescent dye
VistraGreen (Amersham Pharmacia Biotech, Arlington Heights, IL). The
analysis was performed using a Storm PhosphorImager and the
accompanying ImageQuaNT software (Molecular Dynamics, Inc., Sunnyvale,
CA). The values obtained for AChE were standardized relative to the
corresponding level of rRNA in the same sample. In these experiments,
negative controls consisted of reactions in which total RNA was
replaced by RNase-free water as well as reactions in which the reverse
transcriptase was omitted.
All RT-PCR measurements aimed at determining the relative abundance of
AChE mRNA and rRNA were performed during the linear range of
amplification (see Refs. 11, 13, 19, 25). Typically, the cycle numbers
were 32 for AChE and 28 for rRNA. RT-PCR conditions (primer
concentrations, input RNA, choice of RT primer, cycling conditions)
were initially optimized, and these were identical for all samples.
Appropriate precautions were taken to avoid contamination and RNA
degradation. All samples as well as negative controls were prepared
using common master mixes containing the same RT and PCR reagents, and
they were always run in parallel. In all experiments, PCR products were
never detected for the negative controls.
Nuclear Run-on Assay--
Nuclear run-on assays were performed
as previously described in detail (13, 25, 27). Briefly, nuclei from
myoblasts or myotubes were first isolated and resuspended in a
transcription buffer that contained GTP, ATP, CTP, and
[ -32P]UTP. RNA was transcribed for 30 min at 30 °C
in the presence of an RNase inhibitor (Promega, Madison, WI). Following
RQ1 DNase (Promega) treatment, the nascent radiolabeled RNA was
isolated using the TriPure method (see above) and hybridized for
48 h to 10 µg each of linearized AChE and myogenin cDNAs
immobilized on a GeneScreen Plus nylon membrane. Following
hybridization, the membranes were thoroughly washed at 42 °C with a
1× saline-sodium citrate, 0.1% sodium dodecyl sulfate (SSC) solution
and subjected to autoradiography. The intensity of the resulting
signals was quantified using the Storm PhosphorImager and the
accompanying ImageQuaNT software (Molecular Dynamics). The signals
corresponding to AChE and myogenin were standardized relative to the
signals obtained for genomic DNA.
In Vivo and In Vitro Analyses of Rat AChE Promoter-reporter Gene
Expression--
The 1.9-kb rat AChE promoter fragment termed NRAP
(N-box-containing rat AChE
promoter) was used in the present studies. This promoter
fragment has been described in detail recently (see Ref. 17). Briefly,
it is located ~600 bp from the translation start site and contains
807 bp upstream of the initiator element and 1075 bp of intron 1. For
the current studies, NRAP was inserted into a luciferase reporter
construct (pGL3-Basic vector from Promega). Mutagenesis of putative
regulatory regions within NRAP was performed using the Altered Sites II
in vitro mutagenesis system (Promega). Briefly, the first
intronic N-box (positioned in a reverse orientation), located at
position +755 bp (17), was mutated from the wild-type CCGGAA to CTTGAA,
and the resulting mutant promoter fragment was termed mN-NRAP. In
addition, the intronic E-box element adjacent to this N-box motif and
located at position +767 bp, was mutated from the wild-type CAGCTG to
CCTAGG, and designated as mE-NRAP. Each mutant promoter fragment was
inserted into the luciferase reporter vector. Finally, a third mutant,
in which the E- and N-box motifs were both mutated, was also used in
our studies (mNmE-NRAP).
Plasmid DNA was prepared using the Qiagen (Chatsworth, CA) mega- or
midi-prep procedure. Pellets were resuspended in sterile phosphate-buffered saline (PBS). Transfection of cultured myogenic cells was performed using the LipofectAMINE reagent kit (Life Sciences/Life Technologies, Inc.). Myoblasts, at 50-60% confluence, were transfected with the appropriate promoter-reporter gene construct. They were subsequently either maintained as myoblasts for 2 days, or
induced to differentiate into myotubes. Myoblasts or myotubes were then
washed with ice-cold PBS and lysed in Reporter Lysis buffer (Promega)
following two cycles of freeze-thaw. The solution was then centrifuged
at 15,000 × g, and the resulting supernatant was
assayed for luciferase activity as described elsewhere (28).
Direct gene transfer into mouse skeletal muscle was performed as
previously described (13, 17, 29). 25 µl of the appropriate promoter-reporter constructs, diluted at a final concentration of 2 µg/µl, were injected into mouse tibialis anterior (TA) muscle. Seven days later, muscles were excised, quickly frozen in liquid nitrogen, and stored at 80 °C for subsequent analysis. For
detection of luciferase activity, muscles were homogenized in Reporter
lysis buffer (Promega) using a Polytron set at maximum speed. Following centrifugation at 15,000 × g, the supernatant was
assayed for luciferase activity.
For both direct injection and transfection experiments, a
chloramphenicol acetyltransferase (CAT) plasmid driven by the SV40 promoter, was used to control for the efficiency of
transduction/transfection. The luciferase activity obtained in each
sample was therefore normalized to CAT activity.
Nuclear Protein Extraction--
Nuclear proteins were extracted
from myoblasts and myotubes as previously described (30). Briefly,
myoblasts and myotubes were scraped into ice-cold PBS and collected by
centrifugation at 200 × g for 5 min. The cells were
resuspended and washed once in 1 ml of ice-cold PBS and centrifuged as
above. The cells were resuspended in 1 ml of buffer A (10 mM Hepes, pH 7.9; 10 mM KCl; 1.5 mM
MgCl2; 1.5 mM DTT; and 0.5 mM
phenylmethylsulfonyl fluoride (PMSF)) and centrifuged at 200 × g for 5 min at 4 °C. The cells were then lysed in 300 µl of buffer A containing 0.1% Nonidet P-40 for 20 min on ice. The
homogenate was spun at 15,000 × g for 10 min at
4 °C. The supernatant was discarded, and the pellet containing the
nuclei was resuspended in 35 µl of buffer B (20 mM Hepes,
pH 7.9, 420 mM NaCl, 1.5 mM MgCl2,
0.2 mM EDTA, 25% glycerol, 0.5 mM DTT, 0.5 mM PMSF, and the protease inhibitors spermidine, spermine,
aprotinin, leupeptin, and pepstatin) for 45 min on ice to extract
nuclear proteins. The nuclear extract was then obtained following
centrifugation at 15,000 × g for 15 min at 4 °C. An
equal volume of buffer C (20 mM Hepes, pH 7.9, 50 mM KCl, 1.0 mM EDTA, 0.1 mM EGTA,
20% glycerol, 0.5 mM DTT, and 0.5 mM PMSF) was
subsequently added to the nuclear extract, which was then stored at
80 °C. Protein concentration was determined using the Bradford
Assay (Bio-Rad, Hercules, CA).
Electrophoretic Mobility Shift Assay (EMSA)--
Equal amounts
of nuclear proteins (5 µg) were incubated in a reaction mixture
containing 17 mM Hepes, 0.2 mM EDTA, 0.04 mM EGTA, 0.7 mM DTT, 140 mM NaCl,
0.5 mM MgCl2, 36 mM KCl,
16% glycerol, and 5.0 µg of poly(dI-dC) for 10 min at room
temperature. The reaction mixtures were then incubated with 0.2 ng of
32P-labeled double-stranded oligonucleotides corresponding
to either the intronic N- or E-box motifs for 20 min at room
temperature. 5 µl of loading buffer containing 20 mM
Hepes, 100 mM KCl, 60% glycerol, 0.5 mM EDTA,
0.5 mM EGTA, and 0.125% bromphenol blue, was added to the
reaction mixture prior to electrophoresis on a 5% native
polyacrylamide gel. The gels were run in Tris-glycine solution for
2.5 h at 200 V. They were then dried between filter paper and
cellophane for 1 h at 80 °C under a vacuum, exposed to x-ray
films for up to 2 days at 80 °C. For competition assays, the
reaction mixture was incubated with a 250-fold excess of unlabeled probe for 20 min at room temperature prior to the addition of the
labeled oligonucleotides. The sequence of the synthetic
oligonucleotides used for EMSAs were (all in 5' 3' orientation)
CTGGAGAAGCCGGAACTACAGCAG (sense) and CTGCTGTAGTTCCGGCTTCTCCAG
(antisense) for the intronic N-box;
CTGGAGAAGCTTGAACTACAGCAG (sense) and
CTGCTGTAGTTCAAGCTTCTCCAG (antisense) for the mutant intronic N-box
(mutations are underlined); AACTACAGCAGCTGTTGCCCCCAA
(sense) and TTGATGTCGTCGACAACGGGGGTT (antisense) for the E-box; and
AACTACAGCCTAGGTTGCCCCCAA (sense) and
TTGATGTCGGATCCAACGGGGGTT (antisense) for the mutant E-box (mutations
are underlined). For labeling, double-stranded
oligonucleotides (20 ng), T4 Polynucleotide kinase and
[ -32P]ATP (60 µCi) were mixed in a kinase buffer (50 mM Tris-HCl, pH 7.6, 10 mM MgCl2,
5% glycerol, and 5 mM DTT) and incubated at 37 °C for
1 h. Labeled oligonucleotides were isolated by centrifugation through a Sephadex G-50 column (Amersham Pharmacia Biotech) at 3000 × g for 5 min.
 |
RESULTS |
Expression of the AChE Gene during Myogenic
Differentiation--
In a first series of experiments, we examined
expression of the AChE gene during myogenic differentiation
of mouse C2C12 cells grown in culture. Specifically, we first compared
the relative abundance of AChE mRNAs in undifferentiated myoblasts
(50% confluent), confluent myoblasts, and differentiated myotubes. As
observed previously (see Refs. 5, 7), levels of AChE transcripts increased dramatically during myogenic differentiation. Fig.
1A shows that AChE mRNAs
were barely detectable in undifferentiated myoblasts (50% confluent)
and became more expressed, albeit still at low levels, in 100%
confluent myoblasts. Upon differentiation and fusion of confluent
myoblasts into multinucleated myotubes, AChE mRNA levels increased
significantly (p < 0.05) and by ~3- to 4-fold in
myotubes exposed to differentiation media for 2 days (Fig.
1B). In 4-day-old myotubes, AChE mRNA levels were
further increased reaching, in this case, more than 10-fold as compared with the levels seen in 100% confluent myoblasts.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 1.
Increased expression of AChE mRNAs during
myogenic differentiation. Semi-quantitative RT-PCR analysis was
performed using total RNA isolated from myoblasts (MB) at
50% or 100% confluence, and from myotubes (MT) following
exposure to differentiation media for 2 or 4 days. A,
representative ethidium bromide-stained agarose gels containing RT-PCR
products corresponding to AChE mRNA and 12 S rRNA.
B, the relative abundance of AChE transcripts in muscle
cells at different stages of myogenic differentiation, expressed as a
percentage of AChE transcripts in myoblasts (100%). In this analysis,
levels of AChE mRNA were normalized according to the levels of 12 S
rRNA seen in the same samples. Note the progressive increase in AChE
transcript levels as differentiation proceeds. Mean ± S.E. is
shown; a minimum of three independent experiments were performed.
|
|
We next examined whether this increase in AChE mRNA expression
during myogenic differentiation could be attributed to changes in the
transcriptional activity of the AChE gene. To this end, we
performed nuclear run-on assays using myonuclei isolated from cultured
C2C12 cells at various stages of myogenic differentiation (Fig.
2A). As expected (see for
example Ref. 5), we observed an increase in the transcriptional
activity of myogenin during myogenesis. Similarly, we also detected a
gradual increase in the transcriptional rate of the AChE
gene in muscle cells undergoing myogenic differentiation. This increase
was transient, because in 4-day-old myotubes, the rate of transcription
appeared to decrease toward levels seen in 100% confluent myoblasts.
These results show, therefore, that the initial increase in AChE
mRNA levels seen during myogenic differentiation was accompanied by
an induction in the transcriptional activity of the AChE
gene, thereby indicating that changes in transcription account for some
of the increase in AChE expression.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 2.
Transcription of the AChE
gene increases during myogenic differentiation. Nuclear
run-on assays were performed with nuclei isolated from myoblasts
(MB) at 50% or 100% confluence, and from myotubes
(MT) following exposure to differentiation media for 2 or 4 days. A, shows representative autoradiograms corresponding
to the transcriptional activity of the AChE and myogenin genes during
myogenic differentiation. Genomic DNA was used in these assays as a
control. B, represents the quantitative analysis. Signals
for AChE and myogenin were normalized to that observed for genomic
DNA.
|
|
The Transcriptional Induction of the AChE Gene during Myogenic
Differentiation Depends on Intronic E- and N-boxes--
In a
subsequent series of experiments, we assessed the contribution of
cis- and trans-acting elements in the
transcriptional regulation of AChE during myogenic differentiation. Rat
AChE promoter-reporter gene constructs were transfected into C2C12
myoblasts at ~50-60% confluence (see "Experimental
Procedures"). The cells were subsequently harvested when myoblasts
became confluent or following myogenic differentiation. For these
experiments, a rat AChE promoter fragment, termed NRAP (17), was linked
to a luciferase reporter gene (Fig. 3).
Additionally, several mutated NRAP fragments were also used in these
studies (see Fig. 3, A and B), including one in
which both the intronic E- and N-boxes had been mutated.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 3.
Intronic N-and E-box motifs are involved in
the transcriptional induction of the AChE gene during
myogenic differentiation. Myoblasts were transfected with the
appropriate AChE constructs (wild-type NRAP, mutated mN-NRAP
(A), mutated mE-NRAP (B), or double mutant
mNmE-NRAP) and with a constitutively expressed CAT plasmid. Cells were
harvested when they were still myoblasts or when they became myotubes.
C, the activity of luciferase in proteins extracted from the
muscle cells following transfection with the different constructs.
Luciferase activity was normalized to that seen with CAT.
Asterisks indicate significant differences
(p < 0.05 versus NRAP). Mean ± S.E.
is shown; a minimum of three independent experiments were performed in
triplicate.
|
|
In myoblasts, NRAP appeared active since we were able to detect some
luciferase activity (Fig. 3C). Mutations of the intronic E-
(mE-NRAP) and N- (mN-NRAP) boxes at position +767 and +755 bp (see Ref.
17), respectively, had no effect on expression of the reporter gene in
these confluent myoblasts. By contrast, NRAP appeared very active in
differentiated myotubes, because the activity of luciferase was
significantly (p < 0.05) higher (~6-fold).
Furthermore, mutations of the intronic E- and N-boxes markedly reduced
expression of the reporter gene. Specifically, mutation of the N-box at
position +755 bp led to a decrease of ~75% (p < 0.05) in luciferase activity. Mutation of the adjacent intronic E-box
essentially abolished the transcriptional activation of NRAP in
differentiated myotubes, because the levels of luciferase were reduced
by ~90%. Due to this pronounced effect however, we were not able to
demonstrate cooperativity between the adjacent E- and N-box motifs,
because disruption of both DNA elements (mNmE-NRAP) reduced expression
of the reporter gene to a comparable extent in differentiated myotubes.
Given that both the intronic E- and N-box motifs appeared necessary for
the transcriptional induction of the AChE gene during myogenic differentiation, we next investigated the contribution of
trans-acting elements. To this end, we performed a series of EMSAs using radioactive oligonucleotides encompassing the AChE intronic
N-box motif at position +755 bp (17) and the intronic E-box motif at
position +767 bp. As expected (31, 32), we detected a relative increase
in the binding activity to the E-box with nuclear proteins extracted
from myotubes versus myoblasts (Fig.
4).

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 4.
The E-box binding activity increases during
myogenic differentiation. A, binding activity to the
E-box motif in nuclear extracts from myoblasts (MB) and
myotubes (MT). The specific bands are indicated by the
arrows whereas an arrowhead points to the unbound
probe. B, specificity of the signals since the bands were
essentially eliminated by competition with a 250× molar excess of wild
type unlabeled (WT) probe. Note also that the bands remained
unaffected by a competition assay using the mutant oligonucleotide. The
oligonucleotide used in this assay contains an E-box binding site but
does not encompass an N-box binding site.
|
|
Analysis of the N-box binding activity revealed a single and specific
band following incubation of the appropriate radiolabeled oligonucleotides with nuclear proteins isolated from C2C12 cells (Fig.
5A). This protein complex was
effectively competed by the addition of a 250-fold excess of unlabeled
wild-type probe, whereas an excess of unlabeled mutant probe,
encompassing the same mutation as used to generate the mN-NRAP
construct, failed to compete with this protein complex (Fig.
5A). In addition, this band was also supershifted when the
extracts and oligonucleotides were incubated together with antibodies
directed against GABP and (kindly provided by Dr. Laurent
Schaeffer) thereby confirming the identity of the proteins present in
this complex (Fig. 5B). The binding activity of GABP to the
N-box motif appeared slightly elevated in nuclear extracts isolated
from myotubes as compared with myoblasts (Fig. 5C). The
slight increase in GABP expression in myotubes was confirmed by Western
blot analysis (data not shown; see also Ref. 53).

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 5.
Binding activity to the N-box motif during
myogenic differentiation. A, shows that a single
complex is seen when nuclear extracts from myoblasts (MB)
are incubated with an oligonucleotide encompassing the N-box motif. The
complex is competed with a 250× molar excess of wild type unlabeled
probe. Note also that the signal is unaffected by competition with the
mutant oligonucleotide. B, the result of a supershift
experiment using antibodies against GABP and , which confirms
the identity of the trans-acting factors binding to the
N-box motif. Supershifted complexes are indicated by the white
arrow. C, the relative abundance of the binding
activity in myoblasts (MB) versus myotubes
(MT).
|
|
Myogenin Increases Expression of AChE via the Intronic E-box
Motif--
In a separate series of studies, we further ascertained the
role of myogenic factors and the intronic E-box at position +755 bp in
the regulation of the AChE gene during myogenic
differentiation. To this end, we co-transfected into myoblasts a
myogenin expression vector (33) along with a specific AChE
promoter-reporter gene construct and harvested the cells after exposure
to the differentiation media for 4 days. Fig.
6 shows that overexpression of myogenin increased by almost 2-fold (p < 0.05) the activity of
luciferase in differentiated myotubes. As suggested by the experiments
presented above, this increase in luciferase activity is dependent upon a single E-box motif, because co-transfection of the myogenin expression vector with the mE-NRAP construct, in which the single intronic E-box is mutated (at position +767 bp), totally prevented the
increase seen with co-transfection of the wild type NRAP construct (Fig. 6).

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 6.
Myogenin increases expression of
AChE-promoter-reporter gene constructs. Myoblasts were
co-transfected with vectors expressing myogenin and CAT, and with
either the wild-type NRAP or the mE-NRAP construct (see Fig.
3B). The cells were harvested at the myotube stage.
Expression of luciferase and CAT in the transfected cells was assessed
in protein extracts. All luciferase activity data were normalized to
CAT. The asterisks indicate a significant difference
(p < 0.05) versus NRAP, and indicates a
difference (p < 0.05) versus NRAP + myogenin. Mean ± S.E. is shown; a minimum of three independent
experiments were performed in triplicate.
|
|
The Intronic E-box and N-box Regulate Expression of the AChE Gene
in Vivo--
In a final series of experiments, we assessed the
contribution of these cis-acting elements in vivo
by directly injecting into mouse TA muscles, the various
promoter-reporter gene constructs and by monitoring 7 days later the
activity of luciferase normalized to a co-injected constitutively
expressed CAT plasmid. As previously observed (17), the NRAP fragment
is very active in vivo and mutation of the intronic N-box at
position +755 bp, reduced significantly (p < 0.05) the
expression of the reporter gene (Fig. 7).
In agreement with our data obtained from cultured myogenic cells,
functional disruption of the adjacent E-box (see Fig. 5B) in
NRAP eliminated completely expression of the reporter gene further
highlighting the crucial role of this DNA element in regulating
expression of the AChE gene in muscle cells.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 7.
The intronic E- and N-box motifs are
essential for in vivo expression of the
AChE gene. Mouse TA muscles were directly
injected with the plasmids containing the wild type NRAP promoter
fragment, mN-NRAP and mE-NRAP (see Fig. 3, A and
B) and with a constitutively active CAT plasmid. Luciferase
activity was then assayed and corrected to the activity seen for CAT.
The asterisks indicate p < 0.05 versus NRAP. Mean ± S.E. is shown; a minimum of four
muscles were analyzed per construct.
|
|
 |
DISCUSSION |
Myogenic differentiation is a developmentally regulated process
characterized by a series of coordinated biochemical and morphological changes accompanied by the fusion of mononucleated myoblasts into multinucleated myotubes. Together with cytoskeletal and contractile proteins, expression of several synaptic proteins, including AChR, N-CAM, utrophin, and AChE, is also enhanced to varying degrees during
myogenesis. In this context, previous studies have shown that, in the
case of AChR (34-37) and utrophin (38), the increased expression of
mRNAs can partially be attributed to an increase in the rate of
transcription of these genes. Here, we show that transcription of the
AChE gene is also increased during the early phases of
myogenic differentiation. In fact, it appears that during the initial
stages of muscle cell development, the rate of transcription of the
AChE gene correlates well with the pattern of mRNA
expression (compare undifferentiated myoblasts, confluent myoblasts,
and 2-day-old myotubes in Figs. 1 and 2). In agreement with our
findings, Rossi et al. (39) and R. L. Rotundo2 have also reported
recently an increase in the expression of the AChE gene that
parallels the induction in AChE mRNA at early stages of chick
muscle cell development. Thus, as originally suggested by Merlie and
Sanes (40) as well as by Klarsfeld (41), expression of genes encoding
key synaptic proteins in muscle may indeed be coordinately regulated
during myogenic differentiation.
Together with the recent data obtained by Rossi et al. (39)
and Rotundo,2 our results appear in contrast to the earlier
findings of Taylor and colleagues (5, 9). In their previous work, these
investigators failed to detect an increase in the transcriptional
activity of the AChE gene, thereby concluding that
post-transcriptional mechanisms operating at the level of mRNA
stability accounted for the increased AChE expression seen
during myogenic differentiation. However, this discrepancy may be
reconciled if we consider that, in their experimental approach, Taylor
and co-workers focused on more advanced stages of myogenic
differentiation during which maturational events are likely taking
place. In support of this, it is important to note that we (present
study) and Rossi et al. (39) and Rotundo2 all
observed a decrease in the transcriptional activity of the AChE gene in older myotubes, an observation entirely
consistent with the results of Taylor and colleagues who also detected
a slight reduction in the expression of the AChE gene in
fully differentiated myotubes (5). Taken together, these results
indicate therefore that transcriptional mechanisms participate in the
regulation of AChE mRNA expression during myogenic differentiation
but only at the earliest stages.
As stated above, the increase in AChE mRNA expression that occurred
in confluent myoblasts and 2-day-old myotubes can be solely explained
by an increase in the transcriptional activity of the AChE
gene. This increase in transcription appeared transient, because it
returned toward control levels in older myotubes. At that stage
however, AChE mRNA levels were further increased indicating, therefore, that post-transcriptional mechanisms likely account for this
sustained increase. In this context, Taylor and colleagues have also
implied an important contribution for post-transcriptional mechanisms
during the later stages of muscle differentiation (5, 9). In agreement
with this view, it is relevant to note that recent studies performed in
our laboratory have also illustrated the key role of the AChE
3'-untranslated repeat and of distinct RNA-binding proteins in
regulating the stability of AChE transcripts in mature myotubes (42).
Together, these results indicate, therefore, that during the early
stages of myogenic differentiation, transcriptional regulatory
mechanisms play a predominant role in the control of AChE expression
whereas the contribution of post-transcriptional events becomes more
important at later stages. The concerted effects of these various
mechanisms are likely important for the rapid increase in AChE
expression in developing muscle cells and to ensure that this induction
is well maintained in mature myotubes as to prepare them for the
arrival of exploratory motor axons.
Recently, a DNA element termed an N-box motif was identified (20) and
shown to be critical for directing the preferential synaptic expression
of genes encoding the acetylcholine receptor - (20, 22) and
- (21) subunits as well as the utrophin (24) and AChE
(17) genes. Interestingly, in the case of the AChE gene, we
noted that, although four N-boxes are located within 800 bp of the
initiator element (two in the promoter region and two in the first
intron; see Ref. 17), the one located in the first intron at position
+755 bp was critical for controlling the synapse-specific expression of
the reporter gene. Given our results showing the transcriptional
induction of the AChE gene during myogenic differentiation,
we therefore became interested in determining whether this N-box also
participated in the regulation of AChE expression in developing muscle
cells. Our transfection experiments showed, in agreement with our
nuclear run-on data, that indeed expression of the AChE gene
is increased during myogenic differentiation. Furthermore, these
experiments revealed the key role played by the intronic N-box in
controlling expression of the AChE gene during
differentiation of muscle cells. To our knowledge, this is the first
report demonstrating the importance of the N-box motif during myogenic differentiation.
Several recent studies have shown that the ets-related
transcription factors GABP and can bind to the N-box motif to
transactivate genes encoding synaptic proteins (17, 22-24, 43).
Therefore, we sought to determine whether expression of GABP was
affected during myogenic differentiation. Electrophoretic mobility
shift assays revealed that GABP-binding activity to the N-box was
slightly increased in nuclear extracts from myotubes versus
myoblasts, and this was confirmed by Western blot analysis. Although
the increase appears rather modest, it is important to note that the transactivation potential of GABP is also influenced by its
phosphorylation status with stronger transcriptional activation
occurring in the absence of an increase in DNA binding activity (22).
These results, together with the promoter analysis, further highlight
the importance of the trans-acting element GABP and its
corresponding cis-acting element, i.e. the N-box
motif, in the expression of AChE during myogenic differentiation.
The ets-related transcription factors often cooperate with
other transcription factors (for reviews, see Refs. 44, 45), including
AP-1 (46), or with cofactors such as the CREB-binding protein also
known as CBP/p300 (47), to exert their effects. Because
ets-related factors, including GABP, may also possess a
conserved domain with homology to basic helix-loop-helix
transcription factors such as myogenic factors (48), it appeared
possible that GABP could in fact interact with myogenic factors to
regulate expression of the AChE gene. This view appeared
particularly attractive given the presence of an E-box in the immediate
vicinity of the N-box motif at position +755 bp in the first intron of
the AChE gene. Promoter analysis showed that indeed this
E-box is crucial in regulating expression of the AChE gene
during myogenic differentiation, because its mutation reduced by more
than 90% expression of the reporter gene in transfected myotubes.
Consistent with these findings, we further showed by co-transfection of
AChE promoter-reporter gene constructs and a myogenin expression
vector, that myogenin increases the expression of luciferase in
myotubes. Remarkably, this effect was dependent upon a single E-box,
because mutation of the intronic E-box prevented the myogenin-induced
increase in reporter gene expression despite the presence of numerous
E-boxes throughout the promoter region of the AChE gene (see
Ref. 17). Our findings are therefore in agreement with the well-known
effects of myogenic factors on expression of genes in differentiating muscle cells (for reviews, see Refs. 49-51). In addition, our direct plasmid injection in mouse TA muscles also showed that this E-box plays
a critical role in regulating the basal level of expression of the
AChE gene in vivo. Taken together with our
previous study (17), these data clearly illustrate the importance of
elements located within the first intron of the AChE gene in
the control of its expression in skeletal muscle (see also Ref.
52).
 |
ACKNOWLEDGEMENT |
We thank Dr. Laurent Schaeffer for the gift of
GABP antibodies.
 |
FOOTNOTES |
*
This work was supported in part by operating grants from the
Canadian Institutes of Health Research (CIHR) (to B. J. J.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Recipient of the William T. McEachern Fellowship for Doctoral students.
§
An Investigator of the CIHR. To whom correspondence should be
addressed: Dept. of Cellular and Molecular Medicine, Faculty of
Medicine, University of Ottawa, 451 Smyth Rd., Ottawa, Ontario K1H 8M5,
Canada. Tel.: 613-562-5800 (ext. 8383); Fax: 613-562-5636; E-mail:
jasmin@uottawa.ca.
Published, JBC Papers in Press, February 22, 2001, DOI 10.1074/jbc.M100916200
2
R. L. Rotundo, personal communication.
 |
ABBREVIATIONS |
The abbreviations used are:
AChE, acetylcholinesterase;
GABP, GA-binding protein;
RT-PCR, reverse
transcription-polymerase chain reaction;
bp, base pair(s);
kb, kilobase(s);
NRAP, N-box-containing rat AChE promoter;
PBS, phosphate-buffered saline;
TA, tibialis anterior;
CAT, chloramphenicol
acetyltransferase;
DTT, dithiothreitol;
PMSF, phenylmethylsulfonyl
fluoride;
EMSA, electrophoretic mobility shift assay.
 |
REFERENCES |
| 1.
|
Massoulié, J.,
Pezzementi, L.,
Bon, S.,
Krejci, E.,
and Vallette, F.-M.
(1993)
Prog. Neurobiol.
41,
31-91
|
| 2.
|
Taylor, P.,
and Radic, Z.
(1994)
Ann. Rev. Pharmacol. Toxicol.
34,
281-320
|
| 3.
|
Legay, C.
(2000)
Microsc. Res. Tech.
49,
56-72
|
| 4.
|
Toutant, J. P.,
and Massoulié, J.
(1987)
in
Mammalian Ectoenzymes
(Kenney, A. J.
, and Turner, A. J., eds)
, pp. 289-328, Elsevier, Amsterdam
|
| 5.
|
Fuentes, M. E.,
and Taylor, P.
(1993)
Neuron
10,
679-687
|
| 6.
|
Jbilo, O.,
L'Hermite, Y.,
Talesa, V.,
Toutant, J. P.,
and Chatonnet, A.
(1994)
Eur. J. Biochem.
225,
115-124
|
| 7.
|
Grubic, Z.,
Komel, R.,
Walker, W. F.,
and Miranda, A. F.
(1995)
Neuron
14,
317-327
|
| 8.
|
Legay, C.,
Huchet, M.,
Massoulié, J.,
and Changeux, J. P.
(1995)
Eur. J. Neurosci.
7,
1803-1809
|
| 9.
|
Luo, Z. D.,
Wang, Y.,
Werlen, G.,
Camp, S.,
Chien, K. R.,
and Taylor, P.
(1999)
Mol. Pharmacol.
56,
886-894
|
| 10.
|
Cresnar, B.,
Crne-Finderle, N.,
Breskvar, K.,
and Sketelj, J.
(1994)
J. Neurosci. Res.
38,
294-299
|
| 11.
|
Michel, R. N.,
Vu, C. Q.,
Tetzlaff, W.,
and Jasmin, B. J.
(1994)
J. Cell Biol.
127,
1061-1069
|
| 12.
|
Sveistrup, H.,
Chan, R.,
and Jasmin, B. J.
(1995)
Am. J. Physiol.
269,
C856-C862
|
| 13.
|
Boudreau-Larivière, C.,
Chan, R. Y. Y.,
and Jasmin, B. J.
(2000)
J. Neurochem.
74,
2250-2258
|
| 14.
|
Rossi, S. G.,
Vasquez, A. E.,
and Rotundo, R. L.
(2000)
J. Neurosci.
20,
919-928
|
| 15.
|
Rimer, M.,
and Randall, W. R.
(1999)
Biochem. Biophys. Res. Commun.
260,
251-255
|
| 16.
|
Mutero, A.,
Camp, S.,
and Taylor, P.
(1995)
J. Biol. Chem.
270,
1866-1872
|
| 17.
|
Chan, R. Y.,
Boudreau-Larivière, C.,
Angus, L. M.,
Mankal, F. A.,
and Jasmin, B. J.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
4627-4632
|
| 18.
|
Culetto, E.,
Combes, D.,
Fedon, Y.,
Roig, A.,
Toutant, J. P.,
and Arpagaus, M.
(1999)
J. Mol. Biol.
290,
951-966
|
| 19.
|
Jasmin, B. J.,
Lee, R. K.,
and Rotundo, R. L.
(1993)
Neuron
11,
467-477
|
| 20.
|
Koike, S.,
Schaeffer, L.,
and Changeux, J. P.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
10624-10628
|
| 21.
|
Duclert, A.,
Savatier, N.,
Schaeffer, L.,
and Changeux, J.-P.
(1996)
J. Biol. Chem.
217,
17433-17438
|
| 22.
|
Fromm, L.,
and Burden, S. J.
(1998)
Genes Dev.
12,
3074-3083
|
| 23.
|
Schaeffer, L.,
Duclert, N.,
Huchet-Dymanus, M.,
and Changeux, J.-P.
(1998)
EMBO
17,
3078-3090
|
| 24.
|
Gramolini, A. O.,
Angus, L. M.,
Schaeffer, L.,
Burton, E. A.,
Tinsley, J. M.,
Davies, K. E.,
Changeux, J. P.,
and Jasmin, B. J.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
3223-3227
|
| 25.
|
Chan, R. Y. Y.,
Adatia, F. A.,
Krupa, A. M.,
and Jasmin, B. J.
(1998)
J. Biol. Chem.
273,
9727-9733
|
| 26.
|
Forster, E.,
Otten, U.,
and Frotscher, M.
(1993)
Neurosci. Lett.
155,
216-219
|
| 27.
|
Ray, A.,
Kyselovic, J.,
Leddy, J. L.,
Wigle, J. T.,
Jasmin, B. J.,
and Tuana, B. S.
(1995)
J. Biol. Chem.
270,
25837-25844
|
| 28.
|
Ou, X. M.,
Jafar-Nejad, H.,
Storring, J. M.,
Meng, J. H.,
Lemonde, S.,
and Albert, P. R.
(2000)
J. Biol. Chem.
275,
8161-8168
|
| 29.
|
Gramolini, A. O.,
Burton, E. A.,
Tinsley, J. M.,
Ferns, M. J.,
Cartaud, A.,
Cartaud, J.,
Davies, K. E.,
Lunde, J. A.,
and Jasmin, B. J.
(1998)
J. Biol. Chem.
273,
736-743
|
| 30.
|
Dignam, J. D.,
Lebovitz, R. M.,
and Roeder, R. G.
(1983)
Nucleic Acids Res.
11,
1475-1489
|
| 31.
|
Puri, P. L.,
Avantaggiati, M. L.,
Balsano, C.,
Sang, N.,
Graessmann, A.,
Giordano, A.,
and Levrero, M.
(1997)
EMBO J.
16,
369-383
|
| 32.
|
Biederer, C. H.,
Ries, S. J.,
Moser, M.,
Florio, M.,
Israel, M. A.,
McCormick, F.,
and Buettner, R.
(2000)
J. Biol. Chem.
275,
26245-26251
|
| 33.
|
Edmondson, D. G.,
Brennan, T. J.,
and Olson, E. N.
(1991)
J. Biol. Chem.
266,
21343-21346
|
| 34.
|
Buonanno, A.,
and Merlie, J. P.
(1986)
J. Biol. Chem.
261,
11452-11455
|
| 35.
|
Evans, S.,
Goldman, D.,
Heinemann, S.,
and Patrick, J.
(1987)
J. Biol. Chem.
262,
4911-4916
|
| 36.
|
Baldwin, T. J.,
and Burden, S. J.
(1988)
J. Cell Biol.
107,
2271-2279
|
| 37.
|
Fontaine, B.,
and Changeux, J. P.
(1989)
J. Cell Biol.
108,
1025-1037
|
| 38.
|
Gramolini, A. O.,
and Jasmin, B. J.
(1999)
Nucleic Acids Res.
27,
3603-3609
|
| 39.
|
Rossi, S. G.,
Vazquez, A.,
and Rotundo, R. L.
(2000)
Soc. Neurosci. Abstr.
26,
1090
|
| 40.
|
Merlie, J. P.,
and Sanes, J. R.
(1985)
Nature
317,
66-68
|
| 41.
|
Klarsfeld, A.
(1987)
Biochimie (Paris)
69,
433-437
|
| 42.
|
Bélanger, G.,
Chan, R. Y. Y.,
and Jasmin, B. J.
(2000)
Soc. Neurosci. Abstr.
26,
1089
|
| 43.
|
Khurana, T. S.,
Rosmarin, A. G.,
Shang, J.,
Krag, T. O.,
Das, S.,
and Gammeltoft, S.
(1999)
Mol. Biol. Cell
10,
2075-2086
|
| 44.
|
Wasylyk, B.,
Hahn, S. L.,
and Giovane, A.
(1993)
FEBS Lett.
211,
7-18
|
| 45.
|
Janknecht, R.,
and Nordheim, A.
(1993)
Biochim. Biophys. Acta
1155,
346-356
|
| 46.
|
Wasylyk, B.,
Wasylyk, C.,
Flores, P.,
Begue, A.,
Leprince, D.,
and Stehelin, D.
(1990)
Nature
346,
191-193
|
| 47.
|
Bannert, N.,
Avots, A.,
Baier, M.,
Serfling, E.,
and Kurth, R.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
1541-1546
|
| 48.
|
Seth, A.,
and Papas, T. S.
(1990)
Oncogene
5,
1761-1767
|
| 49.
|
Buckingham, M.
(1996)
Biochem. Soc. Trans.
24,
506-509
|
| 50.
|
Arnold, H. H.,
and Winter, B.
(1998)
Curr. Opin. Genet. Dev.
8,
539-544
|
| 51.
|
Black, B. L.,
and Olson, E. N.
(1998)
Annu. Rev. Dev. Biol.
14,
167-196
|
| 52.
|
Luo, Z. D.,
Camp, S.,
Mutero, A.,
and Taylor, P.
(1998)
J. Biol. Chem.
273,
28486-28495
|
| 53.
|
Curcic, D.,
Glibetic, M.,
Larson, D. E.,
and Sells, B. H.
(1997)
J. Cell. Biochem.
65,
287-307
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Camp, A. De Jaco, L. Zhang, M. Marquez, B. De La Torre, and P. Taylor
Acetylcholinesterase Expression in Muscle Is Specifically Controlled by a Promoter-Selective Enhancesome in the First Intron
J. Neurosci.,
March 5, 2008;
28(10):
2459 - 2470.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Q. Xie, R. C. Y. Choi, K. W. Leung, N. L. Siow, L. W. Kong, F. T. C. Lau, H. B. Peng, and K. W. K. Tsim
Regulation of a Transcript Encoding the Proline-rich Membrane Anchor of Globular Muscle Acetylcholinesterase: THE SUPPRESSIVE ROLES OF MYOGENESIS AND INNERVATING NERVES
J. Biol. Chem.,
April 20, 2007;
282(16):
11765 - 11775.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Deschenes-Furry, K. Mousavi, F. Bolognani, R. L. Neve, R. J. Parks, N. I. Perrone-Bizzozero, and B. J. Jasmin
The RNA-Binding Protein HuD Binds Acetylcholinesterase mRNA in Neurons and Regulates its Expression after Axotomy
J. Neurosci.,
January 17, 2007;
27(3):
665 - 675.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Deschenes-Furry, G. Belanger, J. Mwanjewe, J. A. Lunde, R. J. Parks, N. Perrone-Bizzozero, and B. J. Jasmin
The RNA-binding Protein HuR Binds to Acetylcholinesterase Transcripts and Regulates Their Expression in Differentiating Skeletal Muscle Cells
J. Biol. Chem.,
July 8, 2005;
280(27):
25361 - 25368.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. H. C. Lee, R. C. Y. Choi, A. K. L. Ting, N. L. Siow, J. X. S. Jiang, J. Massoulie, and K. W. K. Tsim
Transcriptional Regulation of Acetylcholinesterase-associated Collagen ColQ: DIFFERENTIAL EXPRESSION IN FAST AND SLOW TWITCH MUSCLE FIBERS IS DRIVEN BY DISTINCT PROMOTERS
J. Biol. Chem.,
June 25, 2004;
279(26):
27098 - 27107.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. V. Chakkalakal, M. A. Stocksley, M.-A. Harrison, L. M. Angus, J. Deschenes-Furry, S. St-Pierre, L. A. Megeney, E. R. Chin, R. N. Michel, and B. J. Jasmin
Expression of utrophin A mRNA correlates with the oxidative capacity of skeletal muscle fiber types and is regulated by calcineurin/NFAT signaling
PNAS,
June 24, 2003;
100(13):
7791 - 7796.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. C. Y. Choi, N. L. Siow, A. W. M. Cheng, K. K. Y. Ling, E. K. K. Tung, J. Simon, E. A. Barnard, and K. W. K. Tsim
ATP Acts via P2Y1 Receptors to Stimulate Acetylcholinesterase and Acetylcholine Receptor Expression: Transduction and Transcription Control
J. Neurosci.,
June 1, 2003;
23(11):
4445 - 4456.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Lacazette, S. Le Calvez, N. Gajendran, and H. R. Brenner
A novel pathway for MuSK to induce key genes in neuromuscular synapse formation
J. Cell Biol.,
May 26, 2003;
161(4):
727 - 736.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Ohno, M. Sadeh, I. Blatt, J. M. Brengman, and A. G. Engel
E-box mutations in the RAPSN promoter region in eight cases with congenital myasthenic syndrome
Hum. Mol. Genet.,
April 1, 2003;
12(7):
739 - 748.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Deschenes-Furry, G. Belanger, N. Perrone-Bizzozero, and B. J. Jasmin
Post-transcriptional Regulation of Acetylcholinesterase mRNAs in Nerve Growth Factor-treated PC12 Cells by the RNA-binding Protein HuD
J. Biol. Chem.,
February 14, 2003;
278(8):
5710 - 5717.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. L. Siow, R. C. Y. Choi, A. W. M. Cheng, J. X. S. Jiang, D. C. C. Wan, S. Q. Zhu, and K. W. K. Tsim
A Cyclic AMP-dependent Pathway Regulates the Expression of Acetylcholinesterase during Myogenic Differentiation of C2C12 Cells
J. Biol. Chem.,
September 20, 2002;
277(39):
36129 - 36136.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. O. Gramolini, G. Belanger, J. M. Thompson, J. V. Chakkalakal, and B. J. Jasmin
Increased expression of utrophin in a slow vs. a fast muscle involves posttranscriptional events
Am J Physiol Cell Physiol,
October 1, 2001;
281(4):
C1300 - C1309.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|