JBC Origene Your Gene Company

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M009128200 on March 8, 2001

J. Biol. Chem., Vol. 276, Issue 21, 17686-17692, May 25, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/21/17686    most recent
M009128200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dayanir, V.
Right arrow Articles by Rahimi, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dayanir, V.
Right arrow Articles by Rahimi, N.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Identification of Tyrosine Residues in Vascular Endothelial Growth Factor Receptor-2/FLK-1 Involved in Activation of Phosphatidylinositol 3-Kinase and Cell Proliferation*

Volkan DayanirDagger, Rosana D. Meyer§, Kameran Lashkari§, and Nader RahimiDagger||

From the Departments of Dagger  Ophthalmology and || Biochemistry, School of Medicine, Boston University, Boston, Massachusetts 02118 and the § Department of Ophthalmology, Schepens Eye Research Institute, Harvard Medical School, Boston, Massachusetts 02114

Received for publication, October 5, 2000, and in revised form, March 6, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Activation of vascular endothelial growth factor receptor-2 (VEGFR-2) plays a critical role in vasculogenesis and angiogenesis. However, the mechanism by which VEGFR-2 activation elicits these cellular events is not fully understood. We recently constructed a chimeric receptor containing the extracellular domain of human CSF-1R/c-fms, fused with the entire transmembrane and cytoplasmic domains of murine VEGFR-2 (Rahimi, N., Dayanir, V., and Lashkari, K. (2000) J. Biol. Chem. 275, 16986-16992). In this study we used VEGFR-2 chimera (herein named CKR) to elucidate the signal transduction relay of VEGFR-2 in porcine aortic endothelial (PAE) cells. Mutation of tyrosines 799 and 1173 individually on CKR resulted in partial loss of CKR's ability to stimulate cell growth. Double mutation of these sites caused total loss of CKR's ability to stimulate cell growth. Interestingly, mutation of these sites had no effect on the ability of CKR to stimulate cell migration. Further analysis revealed that tyrosines 799 and 1173 are docking sites for p85 of phosphatidylinositol 3-kinase (PI3K). Pretreatment of cells with wortmannin, an inhibitor of PI3K, and rapamycin, a potent inhibitor of S6 kinase, abrogated CKR-mediated cell growth. However, expression of a dominant negative form of ras (N17ras) and inhibition of the mitogen-activated protein kinase (MAPK) pathway by PD98059 did not attenuate CKR-stimulated cell growth. Altogether, these results demonstrate that activation of VEGFR-2 results in activation of PI3K and that activation of PI3K/S6kinase pathway, but not Ras/MAPK, is responsible for VEGFR-2-mediated cell growth.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Vascular endothelial growth factor receptor-1 (VEGFR-11/FLT-1) and VEGFR-2 (FLK-1/KDR) belong to a subfamily of receptor tyrosine kinases implicated in vasculogenesis and angiogenesis. The important contribution of VEGFR-2 in vasculogenesis and angiogenesis was initially underscored by the observation that homozygous knockout mice lacking VEGFR-2 exhibited severe deficiency in vessel formation (1). Furthermore, introduction of either a neutralizing antibody against VEGF or the dominant negative form of VEGFR-2 was able to block angiogenesis (2, 3). On the other hand, VEGFR-1 activation alone appears to play a less significant role in these cellular processes (4-6).

The mechanism by which VEGFR-2 activation evokes angiogenesis is not well understood. It is presumed that these events are initiated by binding of VEGF to VEGFR-2 leading to tyrosine phosphorylation of the dimerized VEGFR-2 and subsequent phosphorylation of SH2-containing intracellular signaling proteins, including phospholipase C-gamma 1 (PLCgamma 1), Src family tyrosine kinases, and phosphatidylinositol 3-kinase (PI3K), adaptor molecules, SHC, NCK, and Ras GTPase-activating protein (7-10). The contributions of individual signaling molecules to various aspects of angiogenesis and the tyrosine sites on VEGFR-2 that potentially mediate their recruitment and activation have not been fully investigated. Moreover, the data presented in the literature is often inconsistent. Waltenberger et al. (1994), Abedi and Zachary (1997), and Takahashi et al. (1997) have suggested that stimulation of endothelial cells with VEGF results in no PI3K activation (7, 8, 11), whereas others have shown that VEGFR-2 activation does indeed result in PI3K stimulation, which may stimulate endothelial cell growth and survival (12, 13).

The reason for the apparent inconsistency in the activation and association of signaling molecules with VEGFR-2 is not known. It may be due to the complexity of VEGFR-2-mediated signal transduction relay in endothelial cells such as expression of VEGFR-1 and neuropilin-1 and -2, which may modify or antagonize VEGFR-2-mediated signal transduction and its final biological responses (5, 14, 15). To circumvent these issues, we have recently constructed a chimeric receptor containing the extracellular domain of human CSF-1R/c-fms, fused with the transmembrane and the cytoplasmic domains of murine VEGFR-2. (5). This model permitted us to dissect the functions of VEGFR-2 in endothelial cells by selectively stimulating the receptor with CSF-1. In this study we used this chimeric receptor to elucidate the signal transduction relay induced by VEGFR-2 in PAE cells. We show that mutation of tyrosine sites 799 and 1173 individually on CKR result in partial loss of CKR's ability to stimulate cell growth, whereas double mutation of these tyrosine sites result in complete loss of CKR ability to stimulate endothelial cell growth. Mutation of these sites, however, had no effect on CKR's ability to stimulate cell migration. Further analysis showed that tyrosines 799 and 1173 are binding sites for p85 of PI3K and that activation of PI3K is responsible for CKR-mediated endothelial cell growth.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Reagents and Antibodies-- Mouse anti-phosphotyrosine (PY-20), anti-PLCgamma , anti-mouse, and anti-rabbit secondary antibodies were purchased from Transduction Laboratories (Lexington, KY). Rabbit anti-MAPK, anti-phospho-MAPK, anti-phospho-S6 kinase and anti-phospho-AKT antibodies were purchased from New England BioLabs (Boston, MA). Pan anti-Ras antibody was purchased from Oncogene Science (Boston, MA). Rabbit anti-phospho-PLCgamma antibody was purchased from BIOSOURCE (Camarillo, CA). Rabbit anti-VEGFR-2 antibody was made to amino acids corresponding to kinase insert of VEGFR-2. Wortmannin and rapamycin were purchased from Sigma Chemical Co. (St. Louis, MO). PD98059 was purchased from Calbiochem (San Diego, CA). GST-SH2 fusion proteins of p85 were purchased from Upstate Biotechnology Inc. (Lake Placid, NY).

Cell Lines-- Porcine aortic endothelial (PAE) cells expressing chimeric CKR and three mutants, CKR/F799, CKR/F1173, and CKR/F2, were established by a retroviral system as described previously (5). Briefly, cDNA encoding for CKR, CKR/F799, CKR/F1173, and CKR/F2 were cloned into retroviral vector, pLNCX2 and transfected into 293GPG cells. Viral supernatants were collected for 7 days, concentrated by centrifugation, and used as previously described (16).

Site-directed Mutagenesis-- The VEGFR-2 chimera (CKR) was used as a template to construct the mutations. CKR was subcloned into pGEMT cloning vector, and site-directed mutagenesis was carried out by using the Stratagene site-directed mutagenesis kit. Site-directed mutagenesis primers for replacement of tyrosines 799 and 1173 to phenylalanine were CTGAAGACAGGCTTCTTGTCTATTGTC and CCGGATTTCGTTCGAAAAGG, respectively. The resultant mutations were verified by sequencing and were subsequently cloned into pLNCX2 vector by NotI and SalI sites.

Immunoprecipitation and Western Blotting-- PAE cells expressing CKR and CKR mutants were grown in semi-confluent culture condition in DMEM containing 10% fetal bovine serum supplemented with glutamate, penicillin, and streptomycin, and serum-starved overnight in DMEM. Cells were left either resting or stimulated with 20 ng/ml CSF-1 for 10 min, at 37 °C. Cells were washed twice with H/S buffer (25 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM Na3VO4) and lysed in lysis (EB) buffer (10 mM Tris-HCl, 10% glycerol, pH 7.4, 5 mM EDTA, 50 mM NaCl, 50 mM NaF, 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, 2 mM Na3VO4, and 20 µg/ml aprotinin). Proteins were immunoprecipitated by using appropriate antibodies. Immunocomplexes were bound to protein A-Sepharose and washed three times with 1.0 ml of EB. Immunoprecipitates were resolved on a SDS-polyacrylamide gel electrophoresis gel, and the proteins were transferred to Immobilon membrane. For Western blot analysis, the membranes were incubated for 60 min in Block solution containing 10 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 mg/ml bovine serum albumin, 0.05% Tween 20. Membranes then were incubated in Primary antibodies diluted in Block for another 60 min. Membrane was washed three times in Western rinse, incubated with horseradish peroxidase-secondary antibody, washed, and developed with ECL (PerkinElmer Life Sciences). Finally, membranes were stripped by incubating them in a stripping buffer containing 6.25 mM Tris-HCl, pH 6.8, 2% SDS, and 100 mM beta -mercaptoethanol, at 50 °C for 30 min, washed in Western rinse, and reprobed with antibody of interest.

PI3K Assay-- PI3K activity was measured in immunoprecipitates using anti-phosphotyrosine antibody (PY20), as previously described (17). Briefly, immunoprecipitates were washed twice with 25 mM Hepes buffer, pH 7.4, containing 1% Nonidet P-40, two times with 100 mM Tris-HCl, pH 7.4, 500 mM LiCl, and 100 mM Na3VO4, and twice with 10 mM Tris-HCl, pH 7.4, 100 mM NaCl, 1 mM EDTA, and 100 mM Na3VO4. Finally, immunoprecipitates were resuspended in a final volume of 10 µl of assay buffer containing a mixture of phosphatidylinositol at a final concentration of 0.2 mg/ml, 0.88 mM ATP, and 10 µCi of [gamma -32P]ATP. After 15 min of incubation at 30 °C, the reaction was stopped by adding 20 µl of 6 N HCl and lipids were extracted by adding 160 µl of CH3OH:CHCl3 (1:1). The phospholipids in the organic phase were recovered and spotted onto silica gel TLC plate (Merk) precoated with 1% sodium tartarate. Migration was performed in CH3OH:CHCl3:H2O:25% NH4OH, (45:35:7:3). The TLC plate was dried and autoradiographed.

Cell Proliferation-- The proliferation assay was performed as described before (18). Briefly, cells were plated at 2 × 104 cells/ml in 24-well plates containing DMEM supplemented with 10% fetal bovine serum, and incubated at 37 °C for 12 h. Cells were then washed once with phosphate-buffered saline and serum-starved with DMEM containing 0.1% bovine serum albumin for 30 h. Cells were then given various concentrations of CSF-1 either immediately or after pretreatment with various concentrations of PD98059 or wortmannin as indicated in the text. At the last 4 h of incubation, cells were pulsed with [3H]thymidine (0.2 µCi/ml) and harvested. Results for each group were collected from four samples. Each experiment was repeated three times, and essentially the same results were obtained. The data are presented as -fold increase over control.

Migration Assay-- Migration of PAE cells expressing CKR and CKR mutants was assessed using the Boyden chamber (Neuro Probe, Gaithersburg, MD). CSF-1 was diluted in DMEM to a concentration of 5 ng/ml and placed in the bottom wells of the chamber. Polycarbonate filters with 8-µm pore size (Osmonics Inc., Westboro, MA) were preincubated in 4 ml of 0.02 N acetic acid containing 400 µl of 3.1 ng/ml, type I collagen (Collagen Biomaterials, Palo Alto, CA) for 30 min. Membranes were flipped several times during incubation, washed twice with phosphate-buffered saline, air dried, and placed between the upper and lower chambers of the Boyden chamber. Semi-confluent cells were trypsinized and re-suspended in DMEM to make a concentration of 1.5 × 106 cells/ml, and 50 µl of this suspension was loaded into each upper well. Chambers were incubated at 37 °C for 8 h. After incubation, the membranes were removed and fixed and stained with Quick Diff (Dade International, Miami, FL), washed with water, and mounted on 75- × 50-mm glass slides (Fisher Scientific, Pittsburgh, PA) bottom side down. The top cell layer was wiped off with a cotton-tipped applicator leaving only cells that had crossed through the membrane. Representative areas were counted at 20× magnification. Twelve wells were used for a given concentration of test substance in each independent experiment. The experiment was repeated three times and essentially the same results were obtained. The data are presented as mean of cells ± S.D.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Construction and Expression of the Tyrosine Mutant VEGFR-2 Chimeras-- To elucidate the signal transduction relay induced by VEGFR-2 in endothelial cells, we mutated tyrosines 799 and 1173 on the chimeric VEGFR-2 (CKR), either individually or together by replacing them with phenylalanine. These mutants were termed CKR/F799, CKR/F1173, and CKR/F2. Tyrosines 799 and 1173 are located in the juxtamembrane and C terminus of CKR, respectively (Fig. 1A). CKR and tyrosine mutant CKRs were expressed in PAE cells using a retroviral system. To avoid clonal variations, all experiments were performed on pooled G418-resistant clones rather than on isolated clones.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 1.   Schematic representation of the construction of the tyrosine mutant chimera VEGFR-2 and their expression and activation in PAE cells. The tyrosine residues and amino acids surrounding 799 and 1173 and replacement of these sites individually or together to phenylalanine are shown. CKR/F2, double mutations of 799 and 1173 (A). Semi-confluent PAE cells expressing pLNCX2, CKR, CKR/F799, CKR/F1173, and CKR/F2 were lysed and blotted with anti-VEGFR-2 antibody (B). Serum-starved semi-confluent PAE cells expressing CKR and tyrosine mutant CKRs were either non-stimulated or stimulated with 20 ng/ml CSF-1, lysed, and immunoprecipitated with anti-VEGFR-2 antibody. The immunoprecipitated proteins were collected, resolved on SDS-polyacrylamide gel electrophoresis, transferred to an Immobilon membrane, and immunoblotted with anti-pY antibody. The same membrane was reprobed with anti-VEGFR-2 antibody for protein level (D).

PAE cells expressing either empty vector (pLNCX2), CKR, CKR/799, CKR/F1173, and CKR/F2 were lysed, and equal amounts of protein of total cell lysates were subjected to Western blot analysis by using anti-VEGFR-2 antibody. Fig. 1B shows that all the mutant receptors are expressed at relatively comparable levels. Expression of CKR in PAE cells is relatively similar to the expression of VEGFR-2 in primary adrenal microvascular endothelial (ACE) cells (39). To ensure that all the G418-resistant cells were indeed are positive for CKRs, we also subjected PAE cells expressing CKR and tyrosine mutant CKRs to immunohistochemical analysis by using anti-VEGFR-2 antibody. The result showed that all the G418-resistant cells expressed CKR (data not shown). Next, we investigated the tyrosine phosphorylation of mutant receptors in response to CSF-1 stimulation. Serum-starved PAE cells expressing CKR and various mutant receptors were stimulated with CSF-1 (20 ng/ml) for 10 min, lysed, and immunoprecipitated with anti-VEGFR-2 antibody. The immunoprecipitated proteins were subjected to anti-phosphotyrosine (pY) Western blot analysis. Fig. 1C shows that CKR and as well as all mutant receptors were tyrosine-phosphorylated in a CSF-1-dependent manner, suggesting that mutant CKRs were active and that replacement of tyrosines 799 and 1173 to phenylalanine in CKR did not prevent it from responding to CSF-1 stimulation.

Tyrosines 799 and 1173 of CKR Are Required for CKR-mediated Cell Growth but Not Cell Migration-- To determine whether tyrosines 799 and 1173 are required for CKR-mediated biological responses in the endothelial cells, we subjected PAE cells expressing CKR and mutant CKRs to DNA synthesis and migration assays. As Fig. 2A shows, stimulation of PAE cells expressing CKR with CSF-1 induced their growth in a dose-dependent manner. The CSF-1 response in cells expressing CKR/F799 and CKR/F1173 was partially reduced, specifically in PAE cells expressing CKR/F799. Notably, CSF-1 response in cells expressing CKR/F2 was significantly reduced, and treatment of cells with higher concentrations of CSF-1 also did not augment their growth stimulation. Also, the ability of tyrosine mutant CKRs to stimulate cell growth was measured by proliferation assays other than [3H]thymidine incorporation by using bromodeoxyuridine-enzyme-linked immunosorbent assay or counting of cells under microscope by using trypan blue exclusion approach. Basically, similar results were obtained by using these assays (data not shown). These results suggest that tyrosines 799 and 1173 both are required for CKR-mediated cell growth. Surprisingly, CSF-1 stimulation of cells expressing mutant CKRs caused profound morphological changes consistent with their differentiation. This effect of CSF-1 was much more robust at higher concentrations of CSF-1, suggesting that tyrosines 799 and 1173 may suppress differentiation by either promoting cell proliferation or by other undetermined mechanisms.2


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 2.   Tyrosines 799 and 1173 are required for VEGFR-2-mediated cell growth but not cell migration. Serum-starved PAE cells expressing wild type CKR and tyrosine mutant CKRs were treated with different concentrations of CSF-1, and DNA synthesis was measured by [3H]thymidine uptake. The results are expressed as the mean of (cpm/well) ± S.D. of quadruplicates (A). The data are expressed as a ratio of stimulated over non-stimulated samples. The same group of cells was subjected to migration assay by plating the cells in top wells of a Boyden chamber. CSF-1 (5 ng/ml) or DMEM medium was placed in the bottom chambers and incubated at 37 °C for 8 h. Cells that crossed the membrane were fixed and stained, and one representing field was counted. The results are expressed as the mean of ± S.D. of 12 wells per each cell line (B).

Because VEGFR-2 activity is associated with endothelial cell migration (7), we also examined whether tyrosines 799 and 1173 on CKR was required for CKR-mediated cell migration. To this end, PAE cells expressing CKR and mutant CKRs were subjected to migration assay. The result showed that CSF-1 stimulation of PAE cells expressing CKR and mutant CKRs resulted in a significant motility response. As Fig. 2B shows, stimulation of PAE cells expressing CKR/F799, CKR/F1173, and CKR/F2 with CSF-1 resulted in similar migration responses. Thus, tyrosines 799 and 1173 on VEGFR-2 seem to be more involved in recruitment and activation signaling molecules concerned with cell proliferation than they are with cell migration in PAE cells.

Tyrosines 799 and 1173 of CKR Are Required for Activation of PI3K but Not PLCgamma 1-- To test whether PI3K is activated by CKR and whether tyrosines 799 and 1173 contribute to its recruitment by VEGFR-2, we first subjected PAE cells expressing CKR and mutant CKRs to an in vitro PI3K assay. Stimulation of PAE cells expressing CKR with CSF-1 resulted in strong activation of PI3K, as judged by PI3P production. However, PI3P production by CKR/799 and CKR/F1173 was significantly lower than by CKR. CKR/F2 was unable to stimulate PI3P production above baseline (Fig. 3A).


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 3.   Tyrosines 799 and 1173 of VEGFR-2 are required for PI3K activation and for its association with p85 of PI3K. Serum-starved PAE cells expressing wild type CKR and tyrosine mutant CKRs were treated with CSF-1, washed, and lysed, and cell extracts were normalized for protein and immunoprecipitated with anti-pY antibody. The immunoprecipitates were washed and subjected to in vitro PI3K assay. The products of the reaction were analyzed by thin layer chromatography and visualized by autoradiography. The origin and position of phosphatidylinositol 3-phosphate (PI3P) are indicated (A). Serum-starved PAE cells expressing wild type CKR and tyrosine mutant CKRs were treated with CSF-1 for 10 min, washed, and lysed, and cell extracts were normalized for protein and immunoprecipitated with anti-VEGFR-2 antibody. The immunoprecipitates were washed and subjected to Western blot using anti-p85 antibody (B). The same membrane was stripped and reprobed with anti-VEGFR-2 antibody (C). Serum-starved PAE cells expressing wild type CKR and tyrosine mutant CKRs were stimulated with CSF-1 for 10 min, washed, lysed, and incubated with Sepharose-bound GST alone, GST-N-SH2-p85, or GST-C-SH2-p85 fusion proteins. After extensive washing, the precipitated proteins were subjected to Western blot analysis using anti-VEGFR-2 antibody (D). Serum-starved PAE cells expressing wild type CKR were stimulated with CSF-1 for 5-30 min, washed, and lysed, and cell extracts were normalized for protein level and subjected to Western blot using anti-phospho-Akt antibody (E).

It is conceivable that the CKR-mediated PI3K activation is established by direct interaction between p85 of PI3K and CKR. To test this possibility, serum-starved PAE cells expressing CKR, CKR/F799, CKR/F1173, and CKR/F2 were stimulated with CSF-1, and cell lysates were immunoprecipitated with anti-VEGFR-2 antibody. Protein precipitates were electrophoresed and subjected to Western blotting using anti-p85 antibody. As shown in Fig. 3B, p85 was recovered from anti-VEGFR-2 immunoprecipitates of cell lysates derived from cells expressing CKR but not from those of CKR/F799, CKR/F1173, and CKR/F2. A long exposure of the blot showed trace evidence of p85 in CKR/F799 and CKR/F1173 but not in CKR/F2 (data not shown), suggesting that binding of p85 to CKR is not strong and both tyrosines 799 and 1173 may be acting as low affinity binding sites for p85. The inability to detect p85 in cells expressing CKR/F799, CKR/F1173, and CKR/F2 was not simply due to the absence of CKR itself, because CKR protein was detected equally in each group (Fig. 3C).

Previously it has been demonstrated that the SH2 domains of p85 are required for complex formation between p85 and other tyrosine phosphorylated proteins (19). To test the ability of the p85 SH2 domains to bind CKR, cell lysates derived from PAE cells expressing CKR were examined for their capacity to bind a GST-(N terminus) SH2 and GST-(C terminus) SH2. The complexed proteins were eluted, and CKR was detected by immunoblotting with an anti-VEGFR-2 antibody. In a lysate of CSF-1-stimulated CKR/PAE cells, both GST-SH2-NH2 and GST-SH2-COOH of p85 formed stable complexes with CKR but not in non-stimulated cells. In contrast, incubation of the protein extracts with GST alone did result in any binding to CKR (Fig. 3D). These data show that p85 binds to CKR in vivo and in vitro and that tyrosines 799 and 1173 play a role in this association. p85 binding occurred via both SH2 domains of p85, although the C-terminal SH2 domain exhibited stronger binding to CKR than that of the N terminus in a pull-down experiment (Fig. 3D). To analyze the role of the PI3K pathway in this system we evaluated phosphorylation of Akt, a known downstream target of PI3K. For this intention, serum-starved cells were stimulated with CSF-1 and total cell lysates were subjected to an anti-phospho-Akt Western blot analysis. The result showed that stimulation of cells expressing CKR results in activation of Akt in a time-dependent manner (Fig. 3E). Collectively, these results suggest that stimulation of VEGFR-2 results in PI3K activation and that tyrosines 799 and 1173 of VEGFR-2 are responsible for its association with p85 and activation of p110 of PI3K.

To further characterize activation of signaling molecules by VEGFR-2, we measured PLCgamma 1 activation. For this purpose, serum-starved cells were stimulated with CSF-1 and cell lysates were either immunoprecipitated with an anti-PLCgamma antibody and then subjected to anti-phosphotyrosine Western blot analysis, or total cell lysates were subjected to an anti-phospho-PLCgamma Western blot analysis. The results showed that CKR and the mutant CKRs were able to stimulate tyrosine phosphorylation of PLCgamma and no appreciable decrease in tyrosine phosphorylation of PLCgamma was observed among CKR/F799, CKR/F1173, or CKR/F2 in two different assays (Fig. 4, A and C). These results suggest that tyrosines 799 and 1173 are not required for activation of PLCgamma , and most likely other tyrosine sites on VEGFR-2 may act as docking sites for this molecule. Therefore, it appears that mutations of tyrosines 799 and 1173 on VEGFR-2 do not impair the ability of this receptor to activate PLCgamma , suggesting that these sites preferentially serve as binding sites for p85 of PI3K.


View larger version (60K):
[in this window]
[in a new window]
 
Fig. 4.   Tyrosines 799 and 1173 of VEGFR-2 are not required for PLCgamma 1 activation. Serum-starved PAE cells expressing wild type CKR and tyrosine mutant CKRs were stimulated with CSF-1 for 10 min, washed, and lysed, and cell extracts were normalized for protein level. Cells were immunoprecipitated with anti-PLCgamma 1 antibody and subjected to Western blot using anti-pY antibody (A). Total cell lysates were subjected to Western blot using anti-phosphoPLCgamma 1 antibody (C). The same membranes were stripped and reprobed with anti-PLCgamma 1 antibody (B and D).

PI3K/S6 Kinase Activation Is Required for CKR-mediated Cell Growth-- To evaluate the importance of PI3K further in CKR-mediated cell growth, we used an additional approach by using wortmannin, a specific inhibitor of PI3K (20). To this end, PAE cells expressing CKR, were pretreated with different concentrations of wortmannin, stimulated with CSF-1 and cells subjected to a proliferation assay. Fig. 5A shows that pretreatment of cells with wortmannin effectively inhibits CSF-1-stimulated cell growth in a dose-dependent manner. This result combined with the site-directed mutagenesis data (Fig. 2A) strongly suggests that PI3K activation plays a key role in VEGFR-2-stimulated endothelial cell proliferation.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 5.   Wortmannin and rapamycin inhibit CKR-mediated cell proliferation. Serum-starved PAE cells expressing wild type CKR pretreated with different concentrations of wortmannin (A) or rapamycin (C) and stimulated with 1 ng/ml CSF-1. DNA synthesis was measured by [3H]thymidine uptake as described in Fig. 2. The results are expressed as the mean of (cpm/well) ± S.D. of quadruplicates. The data are expressed as a ratio of stimulated over non-stimulated samples. Serum-starved PAE cells expressing wild type CKR and tyrosine mutant CKRs were stimulated with CSF-1, washed, and lysed, and cell extracts were normalized for protein level and subjected to Western blot using anti-phospho-S6 kinase (p70) antibody (B).

To further identify and define the involvement of PI3K-regulated pathways in this system in particular, endothelial cell proliferation, we investigated the role of p70 S6 kinase, a downstream target of PI3K. For this reason, serum-starved PAE cells expressing CKR and tyrosine mutant CKRs were stimulated with CSF-1, and total cell lysates were subjected to an anti-phospho-S6 kinase Western blot analysis. The results showed that CKR is able to stimulate phosphorylation of S6 kinase in a CSF-1-dependent manner. CKR/F799 and CKR/F1173 were partially able to stimulate S6 kinase activation, whereas CKR/F2 completely failed to stimulate S6 kinase phosphorylation in the same assay condition (Fig. 5B). To establish whether S6 kinase activity is required for CKR-mediated PAE cell proliferation, serum-starved CKR/PAE cells were pretreated with rapamycin, an inhibitor of RAFT1 and as a consequence downstream target of p70 S6 kinase (21). The result showed that rapamycin effectively blocks CKR-stimulated PAE cell growth (Fig. 5C), suggesting that the PI3K/S6 kinase pathway is responsible for VEGFR-2-mediated endothelial cell growth. Notably, treatment of PAE cells with rapamycin without CSF-1 stimulation also partly reduced basal growth of PAE cells, suggesting that S6 kinase activity is required for normal growth of PAE cells. This effect of rapamycin does not appear to be due to high concentration of rapamycin, because at 10-50 ng/ml it inhibited phosphorylation of S6 kinase approximately by 60-90% (data not shown). As it is true for most of pharmacological agents, rapamycin may also effect activation of signaling molecules other than S6 kinase that might be involved in growth of PAE cells.

Activation Ras/MAPK Pathway Is Not Required for CKR-mediated Cell Growth-- Next we tested the capability of these mutant receptors to stimulate MAPK activation. For this purpose, PAE cells expressing CKR and mutant CKRs were serum-starved, stimulated with CSF-1, and lysed, and equal amounts of proteins of total cell lysates were subjected to Western blot analysis using anti-phospho-MAPK antibody. The result shows that mutant CKRs are able to stimulate MAPK equally as compared with wild type CKR (Fig. 6A). In addition, phosphorylation of MAPK by mutant CKRs was not effected at least up to 30 min of stimulation with CSF-1 (data not shown).


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 6.   Activation of MAPK is not essential for CKR-mediated cell proliferation. Serum-starved PAE cells expressing wild type CKR and tyrosine mutant CKRs were stimulated with CSF-1 for 10 min, washed, and lysed, and cell extracts were normalized for protein level and total cell lysates were subjected to Western blot using anti-phospho-MAPK antibody (A). The same membrane was stripped and reprobed with anti-MAPK antibody (B). Serum-starved PAE cells expressing wild type CKR were pretreated with different concentrations of PD98059 and stimulated with 1 ng/ml CSF-1, and DNA synthesis was measured by [3H]thymidine uptake. The results are expressed as the mean of (cpm/well) ± S.D. of quadruplicates (C). The data are expressed as a ratio of stimulated over non-stimulated samples. Serum-starved PAE cells expressing wild type CKR were pretreated with different concentrations of PD98059 or left non-treated for 30 min, stimulated with CSF-1 for 10 min, washed, and lysed, and cell extracts were normalized for protein level and total cell lysates were subjected to Western blot using anti-phospho-MAPK antibody (D). The same membrane was stripped and reprobed with anti-MAPK antibody (E).

To test whether MAPK activation plays a role in CKR-mediated cell growth, we subjected PAE cells expressing CKR to proliferation assay in which cells were pretreated with PD98059, a potent and selective inhibitor of MAP kinase inhibitor (22). As Fig. 6C shows, PD98059 treatment of PAE cells expressing CKR did not inhibit CKR-mediated cell proliferation. Collectively, these data suggest that, although CKR activation results in robust MAPK activation, its activity may not be required for CKR-mediated cell growth in PAE cells. To assure that PD98059 at the concentration used in proliferation assay indeed is inhibiting MAPK activation, we measured MAPK phosphorylation. As Fig. 6D shows, pretreatment of cells with PD98059 (50 µM) effectively inhibited MAPK phosphorylation. Because MAPK activation is mainly mediated by Ras, finally we assessed its role in this process. For this purpose, we transiently overexpressed N17ras in CKR/PAE cells by a retrovirus system and subjected the cells to proliferation assay. The result showed that expression of the dominant negative form of ras (N17ras) only had a minor effect on the CSF-1-stimulated cell growth (Fig. 7A). Fig. 7B shows expression of N17ras in CKR/PAE cells. All together, these results suggest that activation of the Ras/MAPK pathway is not required for VEGFR-2-mediated PAE cell proliferation.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 7.   Activation of the Ras pathway is not necessary for CKR-mediated cell proliferation. PAE cells expressing wild type CKR were infected with retrovirus containing N17ras, cells were serum-starved for 24 h and stimulated with different concentrations of CSF-1, and DNA synthesis was measured by [3H]thymidine uptake. The results are expressed as the mean of (cpm/well) ± S.D. of quadruplicates (A). The data are expressed as a ratio of stimulated over non-stimulated samples. PAE cells expressing wild type CKR were infected with retrovirus-containing N17ras, as described in A; however, cells were lysed and subjected to Western blot analysis by using anti-Ras antibody (B).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Our study demonstrates that mutation of tyrosines 799 and 1173 on VEGFR-2 abolishes binding of P85 of PI3K to CKR without impairing CKR's ability to activate PLCgamma and Ras/MAPK pathways. A single mutation of 799 and 1173 on CKR partially inhibited PI3K activation and cell proliferation. Additionally, double mutation of tyrosines 799 and 1173 totally abolished CKR's ability to stimulate PI3K activation and endothelial cell growth but not cell migration. These results suggest that distinct signaling pathways are activated by VEGFR-2 and are responsible for the induction of endothelial cell growth and likely for VEGF-induced angiogenesis. Consistent with mutant CKRs, pretreatment of cells with wortmannin, a potent inhibitor of PI3K, blocked CKR's ability to stimulate cell growth. Activation of PI3K results in PIP3 production, which can activate protein kinase C-zeta (23), Akt (24), and stimulation of p70 S6 kinase (25). Our results show that rapamycin, a potent inhibitor of the S6 kinase pathway (21), abrogates CKR-mediated cell growth, suggesting that the PI3K/S6 kinase pathway is responsible for CKR-mediated cell growth. Interestingly, it appears that activation of the PLCgamma and Ras/MAPK pathways is not involved in VEGFR-2-stimulated growth of PAE cells. Nonetheless, activation of these enzymes by CKR strongly suggests that these molecules are likely to participate in the other VEGF-induced cellular processes such as cell migration and cell differentiation.

A number of groups have investigated the role PLCgamma 1 in VEGF-dependent signal relay. The initial observations suggested that PLCgamma activation is increased in VEGF-stimulated cells (8, 9, 26). Subsequent study showed that tyrosine 951 on the human VEGFR-2 is a major binding site for PLCgamma 1 (27). In agreement with this study, our results demonstrate that tyrosines 799 and 1173 of mouse VEGFR-2 are not required for PLCgamma 1 activation and likely tyrosine 951 is the primary binding site for PLCgamma 1. In addition, our results demonstrate that, although PLCgamma 1 is activated by VEGFR-2, its activation is not required for VEGF-mediated endothelial cell growth. Activation of PLCgamma 1 has been shown to stimulate cell growth and migration in a variety of cellular systems; however, its role in VEGFR-2-mediated signal transduction and endothelial cell function is largely unknown. Recently, it has been suggested that inhibition of PLCgamma 1 by pharmacological methods blocks VEGF-stimulated sinusoidal endothelial cell growth (28). Because sinusoidal cells express both VEGFR-1 and VEGFR-2, it is difficult to judge the contributions of each receptor to the observed PLCgamma 1 activation.

Thus, it seems that tyrosines 799 and 1173 are novel p85 docking sites for p85 of PI3K, although they may represent low affinity binding sites for P85. Amino acid residues surrounding tyrosine 799 (YLSIVM) and 1173 (YIVLPM) of VEGFR-2 do not correspond to conventional (Y(M/V/I/E)XM) p85 binding sites (29, 30). Although it is generally believed that SH2 domains of p85 preferentially bind to receptor tyrosine kinases through this motif, other binding sites for p85 of PI3K have been described. For instance, p85 binding to the hepatocyte growth factor receptor family, including c-Met, c-Ron, and c-Sea is mediated by the YVHV sequence (31, 32). Similarly, it has been demonstrated that amino acids YVNA on VEGFR-1 is a binding site for p85 (33).

Until now, little evidence existed for the involvement of PI3K in VEGFR-2-mediated signal transduction and angiogenesis. The possibility that PI3K may be involved could be inferred only from very indirect evidence. Initial studies about the activation of PI3K by VEGFR-2 suggested that PI3K is not activated by VEGFR-2 stimulation (7, 8, 11). However, subsequent studies suggested that VEGF stimulation of endothelial cells results in activation of PI3K and its activation may promote endothelial cell survival (12, 13). Furthermore, recently it has been shown that viral oncogenic PI3K stimulates angiogenesis in the CAM assay by stimulating VEGF expression (34). During angiogenesis VEGF induces endothelial cell migration, growth, and differentiation in a coordinated manner. Our current study suggests that specific activation of VEGFR-2 in endothelial cells activates a number of signaling molecules, including PI3K, Akt, PLCgamma 1, and MAPK. Altogether, this suggests that during angiogenesis stimulation of the PI3K/S6 kinase pathway by VEGFR-2 may influence endothelial cell growth and likely endothelial cell survival leading to formation of new blood vessels. Previous studies have suggested that activation of the PI3K/S6 kinase pathway is essential for serum and fibroblast growth factor-stimulated endothelial cell growth (35, 36), implying that activation of PI3K by a variety of factors in the endothelial cells serves as a molecular switch to control cell proliferation.

Regulation of angiogenesis is the most critical step in the development of tumors, ocular neovascularization, and in inflammation (37, 38). The results presented in this work identify tyrosine residues of VEGFR-2 responsible for recruiting and activation of PI3K and its role as a regulator of endothelial cell growth. These findings are important for understanding the different roles of signaling molecules and the different aspects of angiogenesis. Further studies will delineate the contributions of other signaling molecules to different cellular processes involved during angiogenesis.

    ACKNOWLEDGEMENT

We thank Cyrus Vaziri (Cancer Research Center, Boston University) for providing the N17ras construct.

    FOOTNOTES

* This work was supported in part by departmental grants from Research To Prevent Blindness, Inc., the Massachusetts Lions Eye Research Fund Inc., and the American Cancer Society, Massachusetts Division, Inc. (to N. R.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Funded by TUBITAK (the Scientific and Technical Research Council of Turkey) NATO Science Scholarship and Turkish Education Foundation Scholarship Programs.

|| To whom correspondence should be addressed: Depts. of Ophthalmology and Biochemistry, School of Medicine, Boston University, 715 Albany St.. Rm. L921, Boston, MA 02118. Tel.: 617-638-5011; Fax: 617-638-5337; E-mail: nrahimi@bu.edu.

Published, JBC Papers in Press, March 8, 2001, DOI 10.1074/jbc.M009128200

2 V. Dayanir, R. D. Meyer, K. Lashkari, and N. Rahimi, unpublished data.

    ABBREVIATIONS

The abbreviations used are: VEGFR, vascular endothelial growth factor receptor; PI3K, phosphatidylinositol 3-kinase; PLCgamma 1, phospholipase-Cgamma 1; VEGF, vascular endothelial growth factor; PAE, porcine aortic endothelial cells; CKR, VEGFR-2 chimera; MAPK, mitogen-activate protein kinase; PD98059, a MAPK inhibitor; DMEM, Dulbecco's modified Eagle's medium; ACE, adrenal microvascular endothelial cells; pY, phosphotyrosine; GST, glutathione S-transferase; PI3P, phosphatidylinositol 3-phosphate.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Shalaby, F., Rossant, J., Yamaguchi, T. P., Gertsentein, M., Fu Wu, X., Breitman, M. L., and Schuh, A. C. (1995) Nature 376, 62-66
2. Millauer, B., Shawver, L. K., Plate, K. H., Risau, W., and Ullrich, A. (1994) Nature 367, 576-579
3. Kim, K. J., Li, B., Winer, J., Armanini, M., Gillett, N., Phillips, H. S., and Ferrara, N. (1993) Nature 362, 841-844
4. Fong, G. H., Zhang, L., Bryce, D. M., and Peng, J. (1999) Development 126, 3015-3025
5. Rahimi, N., Dayanir, V., and Lashkari, K. (2000) J. Biol. Chem. 275, 16986-16992
6. Hiratsuka, S., Minowa, O., Kuno, J., Noda, T., and Shibuya, M. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 9349-9354
7. Waltenberger, J., Calaesson-Welsh, L., Siegbahn, A., Shibuya, M., and Heldin, C.-H. (1994) J. Biol. Chem. 269, 26988-26995
8. Takahashi, T., and Shibuya, M. (1997) Oncogene 4, 2079-2089
9. Igarashi, K., Isohara, T., Kato, T., Shigeta, K., Yamano, T., and Uno, I. (1998) Biochem. Biophys. Res. Commun. 246, 95-99
10. Guo, D., Jia, Q., Song, H. Y., Warren, R. S., and Donner, D. B. (1995) J. Biol. Chem. 270, 6729-6733
11. Abedi, H., and Zachary, I. (1997) J. Biol. Chem. 272, 15442-15451
12. Thakker, G. D., Hajjar, D. P., Muller, W. A., and Rosengart, T. K. (1999) J. Biol. Chem. 274, 10002-10007
13. Gerber, H. P., McMurtrey, A., Kowalski, J., Yan, M., Keyt, B. A., Dixit, V., and Ferrara, N. (1998) J. Biol. Chem. 273, 30336-30343
14. Soker, S., Takashima, S., Miao, H. Q., Neufeld, G., and Klagsbrun, M. (1998) Cell 92, 735-745
15. Kendall, R. L., Wang, G., and Thomas, K. A. (1996) Biochem. Biophys. Res. Commun. 226, 324-328
16. Ory, D. S., Neugeboren, B. A., and Mulligan, R. C. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 11400-11406
17. Rahimi, N., Tremblay, E., and Elliott, B. (1996) J. Biol. Chem. 271, 24850-24855
18. Rahimi, N., Hung, W., Tremblay, E., Saulnier, R., and Elliott, B. (1998) J. Biol. Chem. 273, 33714-33721
19. Sonyang, Z., Shoelson, S. E., Chaudhuri, M., Gish, G., Pasown, T., Roberts, T., et al.. (1993) Cell 72, 767-778
20. Yano, H., Nakanishi, S., Kimura, K., Hanai, N., Saitoh, Y., Fukui, Y., Nonomura, Y., and Matsuda, Y. (1993) J. Biol. Chem. 268, 25846-25856
21. Lane, H. A., Fernandez, A., Lamb, N. J., and Thomas, G. (1993) Nature 363, 170-1702
22. Alessi, D. R., Cuenda, A., Cohen, P., Dudley, D. T., and Saltiel, A. R. (1995) J. Biol. Chem. 270, 27489-27494
23. Chou, M. M., Hou, W., Johnson, J., Graham, L. K., Lee, M. H., Chen, C. S., Newton, A. C., Schaffhausen, B. S., and Toker, A. (1998) Curr. Biol. 8, 1069-1077
24. Stokoe, D., Stephens, L. R., Copeland, T., Gaffney, P. R., Reese, C. B., Painter, G. F., Holmes, A. B., McCormick, F., and Hawkins, P. T. (1997) Science 277, 567-570
25. Romanelli, A., Martin, K. A., Toker, A., and Blenis, J. (1999) Mol. Cell. Biol. 19, 2921-2928
26. Cunningham, S. A., Arrate, M. P., Brock, T. A., and Waxham, M. N. (1997) Biochem. Biophys. Res. Commun. 240, 635-639
27. Wu, L. W., Mayo, L. D., Dunbar, J. D., Kessler, K. M., Baerwald, M. R., Jaffe, E. A., Wang, D., Warren, R. S., and Donner, D. B. (2000) J. Biol. Chem. 275, 5096-5103
28. Takahashi, T., Ueno, H., and Shibuya, M. (1999) Oncogene 18, 2221-2230
29. Rameh, L. E., Chen, C. S., and Cantley, L. C. (1995) Cell 83, 821-830
30. Carpenter, C. L., and Cantley, L. C. (1996) Biochim. Biophys. Acta 1288, M11-M16
31. Derman, M. P., Chen, J. Y., Spokes, K. C., Songyang, Z., and Cantley, L. G. (1996) J. Biol. Chem. 271, 4251-4255
32. Ponzetto, C., Bardelli, A., Zhen, Z., Maina, F., dalla Zonca, P., Giordano, S., Graziani, A., Panayotou, G., and Comoglio, P. M. (1994) Cell 77, 261-271
33. Cunningham, S. A., Waxham, M. N., Arrate, P. M., and Brock, T. A. (1995) J. Biol. Chem. 270, 20254-20257
34. Jiang, B. H., Zheng, J. Z., Aoki, M., and Vogt, P. K. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 1749-1753
35. Vinals, F., Chambard, J. C., and Pouyssegur, J. (1999) J. Biol. Chem. 274, 26776-26782
36. Kanda, S., Hodgkin, M. N., Woodfield, R. J., Wakelam, M. J., Thomas, G., and Claesson-Welsh, L. (1997) J. Biol. Chem. 272, 23347-23353
37. Risau, W. (1997) Nature 386, 671-674
38. Folkman, J., and D'Amore, P. (1996) Cell 87, 1153-1155
39. Rahimi, N., and Kazlauskas, A. (1999) Mol. Biol. Cell 10, 3401-3407


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
C. R. Schnell, F. Stauffer, P. R. Allegrini, T. O'Reilly, P. M.J. McSheehy, C. Dartois, M. Stumm, R. Cozens, A. Littlewood-Evans, C. Garcia-Echeverria, et al.
Effects of the Dual Phosphatidylinositol 3-Kinase/Mammalian Target of Rapamycin Inhibitor NVP-BEZ235 on the Tumor Vasculature: Implications for Clinical Imaging
Cancer Res., August 15, 2008; 68(16): 6598 - 6607.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Y. Nakamura, N. Patrushev, H. Inomata, D. Mehta, N. Urao, H. W. Kim, M. Razvi, V. Kini, K. Mahadev, B. J. Goldstein, et al.
Role of Protein Tyrosine Phosphatase 1B in Vascular Endothelial Growth Factor Signaling and Cell-Cell Adhesions in Endothelial Cells
Circ. Res., May 23, 2008; 102(10): 1182 - 1191.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
N. R. Smith, N. H. James, I. Oakley, A. Wainwright, C. Copley, J. Kendrew, L. M. Womersley, J. M. Jurgensmeier, S. R. Wedge, and S. T. Barry
Acute pharmacodynamic and antivascular effects of the vascular endothelial growth factor signaling inhibitor AZD2171 in Calu-6 human lung tumor xenografts
Mol. Cancer Ther., August 1, 2007; 6(8): 2198 - 2208.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
H. K. Bone and M. J. Welham
Phosphoinositide 3-kinase signalling regulates early development and developmental haemopoiesis
J. Cell Sci., May 15, 2007; 120(10): 1752 - 1762.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Garcia Blanes, M. Oubaha, Y. Rautureau, and J.-P. Gratton
Phosphorylation of Tyrosine 801 of Vascular Endothelial Growth Factor Receptor-2 Is Necessary for Akt-dependent Endothelial Nitric-oxide Synthase Activation and Nitric Oxide Release from Endothelial Cells
J. Biol. Chem., April 6, 2007; 282(14): 10660 - 10669.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Schalk-Hihi, H.-C. Ma, G. T. Struble, S. Bayoumy, R. Williams, E. Devine, I. P. Petrounia, T. Mezzasalma, L. Zeng, C. Schubert, et al.
Protein Engineering of the Colony-stimulating Factor-1 Receptor Kinase Domain for Structural Studies
J. Biol. Chem., February 9, 2007; 282(6): 4085 - 4093.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. I. Lin and W. C. Sessa
Vascular Endothelial Growth Factor Signaling to Endothelial Nitric Oxide Synthase: More than a FLeeTing Moment
Circ. Res., September 29, 2006; 99(7): 666 - 668.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Dance, A. Montagner, A. Yart, B. Masri, Y. Audigier, B. Perret, J.-P. Salles, and P. Raynal
The Adaptor Protein Gab1 Couples the Stimulation of Vascular Endothelial Growth Factor Receptor-2 to the Activation of Phosphoinositide 3-Kinase
J. Biol. Chem., August 11, 2006; 281(32): 23285 - 23295.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
X.-B. Liang, L.-J. Ma, T. Naito, Y. Wang, M. Madaio, R. Zent, A. Pozzi, and A. B. Fogo
Angiotensin Type 1 Receptor Blocker Restores Podocyte Potential to Promote Glomerular Endothelial Cell Growth
J. Am. Soc. Nephrol., July 1, 2006; 17(7): 1886 - 1895.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
Z.-J. Liu, M. Xiao, K. Balint, A. Soma, C. C. Pinnix, A. J. Capobianco, O. C. Velazquez, and M. Herlyn
Inhibition of endothelial cell proliferation by Notch1 signaling is mediated by repressing MAPK and PI3K/Akt pathways and requires MAML1
FASEB J, May 1, 2006; 20(7): 1009 - 1011.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Wang, D. P. Dittmer, C. C. Tomlinson, F. D. Fakhari, and B. Damania
Immortalization of Primary Endothelial Cells by the K1 Protein of Kaposi's Sarcoma-Associated Herpesvirus.
Cancer Res., April 1, 2006; 66(7): 3658 - 3666.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. D. Meyer, X. Qian, H.-C. Guo, and N. Rahimi
Leucine Motif-dependent Tyrosine Autophosphorylation of Type III Receptor Tyrosine Kinases
J. Biol. Chem., March 31, 2006; 281(13): 8620 - 8627.
[Abstract] [Full Text] [PDF]