![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 21, 17686-17692, May 25, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Departments of
Received for publication, October 5, 2000, and in revised form, March 6, 2001
Activation of vascular endothelial growth factor
receptor-2 (VEGFR-2) plays a critical role in vasculogenesis and
angiogenesis. However, the mechanism by which VEGFR-2 activation
elicits these cellular events is not fully understood. We recently
constructed a chimeric receptor containing the extracellular domain of
human CSF-1R/c-fms, fused with the entire transmembrane and
cytoplasmic domains of murine VEGFR-2 (Rahimi, N., Dayanir, V., and
Lashkari, K. (2000) J. Biol. Chem. 275, 16986-16992).
In this study we used VEGFR-2 chimera (herein named CKR) to elucidate
the signal transduction relay of VEGFR-2 in porcine aortic endothelial
(PAE) cells. Mutation of tyrosines 799 and 1173 individually on CKR
resulted in partial loss of CKR's ability to stimulate cell growth.
Double mutation of these sites caused total loss of CKR's ability to
stimulate cell growth. Interestingly, mutation of these sites had no
effect on the ability of CKR to stimulate cell migration. Further
analysis revealed that tyrosines 799 and 1173 are docking sites for p85 of phosphatidylinositol 3-kinase (PI3K). Pretreatment of cells with wortmannin, an inhibitor of PI3K, and rapamycin, a potent inhibitor of S6 kinase, abrogated CKR-mediated cell growth. However, expression of a dominant negative form of ras (N17ras) and
inhibition of the mitogen-activated protein kinase (MAPK) pathway by
PD98059 did not attenuate CKR-stimulated cell growth. Altogether, these
results demonstrate that activation of VEGFR-2 results in activation of
PI3K and that activation of PI3K/S6kinase pathway, but not Ras/MAPK, is
responsible for VEGFR-2-mediated cell growth.
Vascular endothelial growth factor receptor-1
(VEGFR-11/FLT-1) and VEGFR-2
(FLK-1/KDR) belong to a subfamily of receptor tyrosine kinases
implicated in vasculogenesis and angiogenesis. The important contribution of VEGFR-2 in vasculogenesis and angiogenesis was initially underscored by the observation that homozygous knockout mice
lacking VEGFR-2 exhibited severe deficiency in vessel formation (1).
Furthermore, introduction of either a neutralizing antibody against
VEGF or the dominant negative form of VEGFR-2 was able to block
angiogenesis (2, 3). On the other hand, VEGFR-1 activation alone
appears to play a less significant role in these cellular processes
(4-6).
The mechanism by which VEGFR-2 activation evokes angiogenesis is not
well understood. It is presumed that these events are initiated by
binding of VEGF to VEGFR-2 leading to tyrosine phosphorylation of the
dimerized VEGFR-2 and subsequent phosphorylation of SH2-containing intracellular signaling proteins, including phospholipase C- The reason for the apparent inconsistency in the activation and
association of signaling molecules with VEGFR-2 is not known. It may be
due to the complexity of VEGFR-2-mediated signal transduction relay in
endothelial cells such as expression of VEGFR-1 and neuropilin-1 and
-2, which may modify or antagonize VEGFR-2-mediated signal transduction
and its final biological responses (5, 14, 15). To circumvent these
issues, we have recently constructed a chimeric receptor containing the
extracellular domain of human CSF-1R/c-fms, fused with the
transmembrane and the cytoplasmic domains of murine VEGFR-2. (5). This
model permitted us to dissect the functions of VEGFR-2 in endothelial
cells by selectively stimulating the receptor with CSF-1. In this study
we used this chimeric receptor to elucidate the signal transduction
relay induced by VEGFR-2 in PAE cells. We show that mutation of
tyrosine sites 799 and 1173 individually on CKR result in partial loss
of CKR's ability to stimulate cell growth, whereas double mutation of
these tyrosine sites result in complete loss of CKR ability to
stimulate endothelial cell growth. Mutation of these sites, however,
had no effect on CKR's ability to stimulate cell migration. Further
analysis showed that tyrosines 799 and 1173 are binding sites for p85
of PI3K and that activation of PI3K is responsible for CKR-mediated
endothelial cell growth.
Reagents and Antibodies--
Mouse anti-phosphotyrosine
(PY-20), anti-PLC Cell Lines--
Porcine aortic endothelial (PAE) cells
expressing chimeric CKR and three mutants, CKR/F799, CKR/F1173, and
CKR/F2, were established by a retroviral system as described previously
(5). Briefly, cDNA encoding for CKR, CKR/F799, CKR/F1173, and
CKR/F2 were cloned into retroviral vector, pLNCX2
and transfected into 293GPG cells. Viral supernatants were collected for 7 days, concentrated by centrifugation, and used as previously described (16).
Site-directed Mutagenesis--
The VEGFR-2 chimera (CKR)
was used as a template to construct the mutations. CKR was subcloned
into pGEMT cloning vector, and site-directed mutagenesis was carried
out by using the Stratagene site-directed mutagenesis kit.
Site-directed mutagenesis primers for replacement of tyrosines 799 and
1173 to phenylalanine were CTGAAGACAGGCTTCTTGTCTATTGTC and
CCGGATTTCGTTCGAAAAGG, respectively. The resultant mutations were
verified by sequencing and were subsequently cloned into
pLNCX2 vector by NotI and SalI sites.
Immunoprecipitation and Western Blotting--
PAE cells
expressing CKR and CKR mutants were grown in semi-confluent culture
condition in DMEM containing 10% fetal bovine serum supplemented with
glutamate, penicillin, and streptomycin, and serum-starved overnight in
DMEM. Cells were left either resting or stimulated with 20 ng/ml CSF-1
for 10 min, at 37 °C. Cells were washed twice with H/S buffer (25 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM
Na3VO4) and lysed in lysis (EB) buffer (10 mM Tris-HCl, 10% glycerol, pH 7.4, 5 mM EDTA,
50 mM NaCl, 50 mM NaF, 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, 2 mM
Na3VO4, and 20 µg/ml aprotinin). Proteins
were immunoprecipitated by using appropriate antibodies.
Immunocomplexes were bound to protein A-Sepharose and washed three
times with 1.0 ml of EB. Immunoprecipitates were resolved on a
SDS-polyacrylamide gel electrophoresis gel, and the proteins were
transferred to Immobilon membrane. For Western blot analysis, the
membranes were incubated for 60 min in Block solution containing 10 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 mg/ml bovine serum albumin, 0.05% Tween 20. Membranes then were
incubated in Primary antibodies diluted in Block for another 60 min.
Membrane was washed three times in Western rinse, incubated with
horseradish peroxidase-secondary antibody, washed, and developed with
ECL (PerkinElmer Life Sciences). Finally, membranes were stripped by
incubating them in a stripping buffer containing 6.25 mM
Tris-HCl, pH 6.8, 2% SDS, and 100 mM PI3K Assay--
PI3K activity was measured in immunoprecipitates
using anti-phosphotyrosine antibody (PY20), as previously described
(17). Briefly, immunoprecipitates were washed twice with 25 mM Hepes buffer, pH 7.4, containing 1% Nonidet P-40, two
times with 100 mM Tris-HCl, pH 7.4, 500 mM
LiCl, and 100 mM Na3VO4, and twice with 10 mM Tris-HCl, pH 7.4, 100 mM NaCl, 1 mM EDTA, and 100 mM Na3VO4. Finally, immunoprecipitates were
resuspended in a final volume of 10 µl of assay buffer containing a
mixture of phosphatidylinositol at a final concentration of 0.2 mg/ml,
0.88 mM ATP, and 10 µCi of [ Cell Proliferation--
The proliferation assay was performed as
described before (18). Briefly, cells were plated at 2 × 104 cells/ml in 24-well plates containing DMEM supplemented
with 10% fetal bovine serum, and incubated at 37 °C for 12 h.
Cells were then washed once with phosphate-buffered saline and
serum-starved with DMEM containing 0.1% bovine serum albumin for
30 h. Cells were then given various concentrations of CSF-1 either
immediately or after pretreatment with various concentrations of
PD98059 or wortmannin as indicated in the text. At the last 4 h of
incubation, cells were pulsed with [3H]thymidine (0.2 µCi/ml) and harvested. Results for each group were collected from
four samples. Each experiment was repeated three times, and essentially
the same results were obtained. The data are presented as -fold
increase over control.
Migration Assay--
Migration of PAE cells expressing CKR and
CKR mutants was assessed using the Boyden chamber (Neuro Probe,
Gaithersburg, MD). CSF-1 was diluted in DMEM to a concentration of 5 ng/ml and placed in the bottom wells of the chamber. Polycarbonate
filters with 8-µm pore size (Osmonics Inc., Westboro, MA) were
preincubated in 4 ml of 0.02 N acetic acid containing 400 µl of 3.1 ng/ml, type I collagen (Collagen Biomaterials, Palo Alto,
CA) for 30 min. Membranes were flipped several times during incubation,
washed twice with phosphate-buffered saline, air dried, and placed
between the upper and lower chambers of the Boyden chamber.
Semi-confluent cells were trypsinized and re-suspended in DMEM to make
a concentration of 1.5 × 106 cells/ml, and 50 µl of this suspension was loaded into each upper well. Chambers were
incubated at 37 °C for 8 h. After incubation, the membranes
were removed and fixed and stained with Quick Diff (Dade International,
Miami, FL), washed with water, and mounted on 75- × 50-mm glass slides
(Fisher Scientific, Pittsburgh, PA) bottom side down. The top cell
layer was wiped off with a cotton-tipped applicator leaving only cells
that had crossed through the membrane. Representative areas were
counted at 20× magnification. Twelve wells were used for a given
concentration of test substance in each independent experiment. The
experiment was repeated three times and essentially the same results
were obtained. The data are presented as mean of cells ± S.D.
Construction and Expression of the Tyrosine Mutant VEGFR-2
Chimeras--
To elucidate the signal transduction relay induced by
VEGFR-2 in endothelial cells, we mutated tyrosines 799 and 1173 on the chimeric VEGFR-2 (CKR), either individually or together by replacing them with phenylalanine. These mutants were termed CKR/F799, CKR/F1173, and CKR/F2. Tyrosines 799 and 1173 are located in the juxtamembrane and
C terminus of CKR, respectively (Fig.
1A). CKR and tyrosine mutant
CKRs were expressed in PAE cells using a retroviral system. To avoid
clonal variations, all experiments were performed on pooled
G418-resistant clones rather than on isolated clones.
PAE cells expressing either empty vector (pLNCX2), CKR,
CKR/799, CKR/F1173, and CKR/F2 were lysed, and equal amounts of protein of total cell lysates were subjected to Western blot analysis by using
anti-VEGFR-2 antibody. Fig. 1B shows that all the mutant receptors are expressed at relatively comparable levels. Expression of
CKR in PAE cells is relatively similar to the expression of VEGFR-2 in
primary adrenal microvascular endothelial (ACE) cells (39). To ensure
that all the G418-resistant cells were indeed are positive for CKRs, we
also subjected PAE cells expressing CKR and tyrosine mutant CKRs to
immunohistochemical analysis by using anti-VEGFR-2 antibody. The result
showed that all the G418-resistant cells expressed CKR (data not
shown). Next, we investigated the tyrosine phosphorylation of mutant
receptors in response to CSF-1 stimulation. Serum-starved PAE cells
expressing CKR and various mutant receptors were stimulated with CSF-1
(20 ng/ml) for 10 min, lysed, and immunoprecipitated with anti-VEGFR-2
antibody. The immunoprecipitated proteins were subjected to
anti-phosphotyrosine (pY) Western blot analysis. Fig. 1C
shows that CKR and as well as all mutant receptors were
tyrosine-phosphorylated in a CSF-1-dependent manner,
suggesting that mutant CKRs were active and that replacement of
tyrosines 799 and 1173 to phenylalanine in CKR did not prevent it from
responding to CSF-1 stimulation.
Tyrosines 799 and 1173 of CKR Are Required for CKR-mediated Cell
Growth but Not Cell Migration--
To determine whether tyrosines 799 and 1173 are required for CKR-mediated biological responses in the
endothelial cells, we subjected PAE cells expressing CKR and mutant
CKRs to DNA synthesis and migration assays. As Fig.
2A shows, stimulation of PAE
cells expressing CKR with CSF-1 induced their growth in a
dose-dependent manner. The CSF-1 response in cells
expressing CKR/F799 and CKR/F1173 was partially reduced, specifically
in PAE cells expressing CKR/F799. Notably, CSF-1 response in cells
expressing CKR/F2 was significantly reduced, and treatment of cells
with higher concentrations of CSF-1 also did not augment their growth
stimulation. Also, the ability of tyrosine mutant CKRs to stimulate
cell growth was measured by proliferation assays other than
[3H]thymidine incorporation by using
bromodeoxyuridine-enzyme-linked immunosorbent assay or counting of
cells under microscope by using trypan blue exclusion approach.
Basically, similar results were obtained by using these assays (data
not shown). These results suggest that tyrosines 799 and 1173 both are
required for CKR-mediated cell growth. Surprisingly, CSF-1 stimulation
of cells expressing mutant CKRs caused profound morphological changes
consistent with their differentiation. This effect of CSF-1 was much
more robust at higher concentrations of CSF-1, suggesting that
tyrosines 799 and 1173 may suppress differentiation by either promoting
cell proliferation or by other undetermined
mechanisms.2
Because VEGFR-2 activity is associated with endothelial cell migration
(7), we also examined whether tyrosines 799 and 1173 on CKR was
required for CKR-mediated cell migration. To this end, PAE cells
expressing CKR and mutant CKRs were subjected to migration assay. The
result showed that CSF-1 stimulation of PAE cells expressing CKR and
mutant CKRs resulted in a significant motility response. As Fig.
2B shows, stimulation of PAE cells expressing CKR/F799,
CKR/F1173, and CKR/F2 with CSF-1 resulted in similar migration
responses. Thus, tyrosines 799 and 1173 on VEGFR-2 seem to be more
involved in recruitment and activation signaling molecules concerned
with cell proliferation than they are with cell migration in PAE cells.
Tyrosines 799 and 1173 of CKR Are Required for Activation of PI3K
but Not PLC
It is conceivable that the CKR-mediated PI3K activation is established
by direct interaction between p85 of PI3K and CKR. To test this
possibility, serum-starved PAE cells expressing CKR, CKR/F799,
CKR/F1173, and CKR/F2 were stimulated with CSF-1, and cell lysates were
immunoprecipitated with anti-VEGFR-2 antibody. Protein precipitates
were electrophoresed and subjected to Western blotting using anti-p85
antibody. As shown in Fig. 3B, p85 was recovered from
anti-VEGFR-2 immunoprecipitates of cell lysates derived from cells
expressing CKR but not from those of CKR/F799, CKR/F1173, and CKR/F2. A
long exposure of the blot showed trace evidence of p85 in CKR/F799 and
CKR/F1173 but not in CKR/F2 (data not shown), suggesting that binding
of p85 to CKR is not strong and both tyrosines 799 and 1173 may be
acting as low affinity binding sites for p85. The inability to detect
p85 in cells expressing CKR/F799, CKR/F1173, and CKR/F2 was not simply
due to the absence of CKR itself, because CKR protein was detected
equally in each group (Fig. 3C).
Previously it has been demonstrated that the SH2 domains of p85 are
required for complex formation between p85 and other tyrosine phosphorylated proteins (19). To test the ability of the p85 SH2
domains to bind CKR, cell lysates derived from PAE cells expressing CKR
were examined for their capacity to bind a GST-(N terminus) SH2 and
GST-(C terminus) SH2. The complexed proteins were eluted, and CKR was
detected by immunoblotting with an anti-VEGFR-2 antibody. In a lysate
of CSF-1-stimulated CKR/PAE cells, both GST-SH2-NH2 and
GST-SH2-COOH of p85 formed stable complexes with CKR but not in
non-stimulated cells. In contrast, incubation of the protein extracts
with GST alone did result in any binding to CKR (Fig. 3D).
These data show that p85 binds to CKR in vivo and in
vitro and that tyrosines 799 and 1173 play a role in this
association. p85 binding occurred via both SH2 domains of p85, although
the C-terminal SH2 domain exhibited stronger binding to CKR than that of the N terminus in a pull-down experiment (Fig. 3D). To
analyze the role of the PI3K pathway in this system we evaluated
phosphorylation of Akt, a known downstream target of PI3K. For this
intention, serum-starved cells were stimulated with CSF-1 and total
cell lysates were subjected to an anti-phospho-Akt Western blot
analysis. The result showed that stimulation of cells expressing CKR
results in activation of Akt in a time-dependent manner
(Fig. 3E). Collectively, these results suggest that
stimulation of VEGFR-2 results in PI3K activation and that tyrosines
799 and 1173 of VEGFR-2 are responsible for its association with p85
and activation of p110 of PI3K.
To further characterize activation of signaling molecules by VEGFR-2,
we measured PLC PI3K/S6 Kinase Activation Is Required for CKR-mediated Cell
Growth--
To evaluate the importance of PI3K further in CKR-mediated
cell growth, we used an additional approach by using wortmannin, a
specific inhibitor of PI3K (20). To this end, PAE cells expressing CKR,
were pretreated with different concentrations of wortmannin, stimulated
with CSF-1 and cells subjected to a proliferation assay. Fig.
5A shows that pretreatment of
cells with wortmannin effectively inhibits CSF-1-stimulated cell growth
in a dose-dependent manner. This result combined with the
site-directed mutagenesis data (Fig. 2A) strongly suggests
that PI3K activation plays a key role in VEGFR-2-stimulated endothelial
cell proliferation.
To further identify and define the involvement of PI3K-regulated
pathways in this system in particular, endothelial cell proliferation, we investigated the role of p70 S6 kinase, a downstream target of PI3K.
For this reason, serum-starved PAE cells expressing CKR and tyrosine
mutant CKRs were stimulated with CSF-1, and total cell lysates were
subjected to an anti-phospho-S6 kinase Western blot analysis. The
results showed that CKR is able to stimulate phosphorylation of S6
kinase in a CSF-1-dependent manner. CKR/F799 and CKR/F1173
were partially able to stimulate S6 kinase activation, whereas CKR/F2
completely failed to stimulate S6 kinase phosphorylation in the same
assay condition (Fig. 5B). To establish whether S6 kinase
activity is required for CKR-mediated PAE cell proliferation, serum-starved CKR/PAE cells were pretreated with rapamycin, an inhibitor of RAFT1 and as a consequence downstream target of p70 S6
kinase (21). The result showed that rapamycin effectively blocks
CKR-stimulated PAE cell growth (Fig. 5C), suggesting that the PI3K/S6 kinase pathway is responsible for VEGFR-2-mediated endothelial cell growth. Notably, treatment of PAE cells with rapamycin
without CSF-1 stimulation also partly reduced basal growth of PAE
cells, suggesting that S6 kinase activity is required for normal growth
of PAE cells. This effect of rapamycin does not appear to be due to
high concentration of rapamycin, because at 10-50 ng/ml it inhibited
phosphorylation of S6 kinase approximately by 60-90% (data not
shown). As it is true for most of pharmacological agents,
rapamycin may also effect activation of signaling molecules other than
S6 kinase that might be involved in growth of PAE cells.
Activation Ras/MAPK Pathway Is Not Required for CKR-mediated Cell
Growth--
Next we tested the capability of these mutant receptors to
stimulate MAPK activation. For this purpose, PAE cells expressing CKR
and mutant CKRs were serum-starved, stimulated with CSF-1, and lysed,
and equal amounts of proteins of total cell lysates were subjected to
Western blot analysis using anti-phospho-MAPK antibody. The result
shows that mutant CKRs are able to stimulate MAPK equally as compared
with wild type CKR (Fig. 6A).
In addition, phosphorylation of MAPK by mutant CKRs was not effected at
least up to 30 min of stimulation with CSF-1 (data not shown).
To test whether MAPK activation plays a role in CKR-mediated cell
growth, we subjected PAE cells expressing CKR to proliferation assay in
which cells were pretreated with PD98059, a potent and selective
inhibitor of MAP kinase inhibitor (22). As Fig. 6C shows,
PD98059 treatment of PAE cells expressing CKR did not inhibit CKR-mediated cell proliferation. Collectively, these data suggest that,
although CKR activation results in robust MAPK activation, its activity
may not be required for CKR-mediated cell growth in PAE cells. To
assure that PD98059 at the concentration used in proliferation assay
indeed is inhibiting MAPK activation, we measured MAPK phosphorylation.
As Fig. 6D shows, pretreatment of cells with PD98059 (50 µM) effectively inhibited MAPK phosphorylation. Because
MAPK activation is mainly mediated by Ras, finally we assessed its role
in this process. For this purpose, we transiently overexpressed
N17ras in CKR/PAE cells by a retrovirus system and
subjected the cells to proliferation assay. The result showed
that expression of the dominant negative form of ras
(N17ras) only had a minor effect on the CSF-1-stimulated
cell growth (Fig. 7A). Fig.
7B shows expression of N17ras in CKR/PAE cells.
All together, these results suggest that activation of the Ras/MAPK
pathway is not required for VEGFR-2-mediated PAE cell
proliferation.
Our study demonstrates that mutation of tyrosines 799 and 1173 on
VEGFR-2 abolishes binding of P85 of PI3K to CKR without impairing
CKR's ability to activate PLC A number of groups have investigated the role PLC Thus, it seems that tyrosines 799 and 1173 are novel p85 docking sites
for p85 of PI3K, although they may represent low affinity binding sites
for P85. Amino acid residues surrounding tyrosine 799 (YLSIVM) and 1173 (YIVLPM) of VEGFR-2 do not correspond to conventional
(Y(M/V/I/E)XM) p85 binding sites (29, 30). Although it is
generally believed that SH2 domains of p85 preferentially bind to
receptor tyrosine kinases through this motif, other binding sites for
p85 of PI3K have been described. For instance, p85 binding to the
hepatocyte growth factor receptor family, including c-Met, c-Ron, and
c-Sea is mediated by the YVHV sequence (31, 32). Similarly, it has been
demonstrated that amino acids YVNA on VEGFR-1 is a binding site for p85
(33).
Until now, little evidence existed for the involvement of PI3K in
VEGFR-2-mediated signal transduction and angiogenesis. The possibility
that PI3K may be involved could be inferred only from very indirect
evidence. Initial studies about the activation of PI3K by VEGFR-2
suggested that PI3K is not activated by VEGFR-2 stimulation (7, 8, 11).
However, subsequent studies suggested that VEGF stimulation of
endothelial cells results in activation of PI3K and its activation may
promote endothelial cell survival (12, 13). Furthermore, recently it
has been shown that viral oncogenic PI3K stimulates angiogenesis in the
CAM assay by stimulating VEGF expression (34). During angiogenesis VEGF
induces endothelial cell migration, growth, and differentiation in a
coordinated manner. Our current study suggests that specific activation
of VEGFR-2 in endothelial cells activates a number of signaling
molecules, including PI3K, Akt, PLC Regulation of angiogenesis is the most critical step in the development
of tumors, ocular neovascularization, and in inflammation (37, 38). The
results presented in this work identify tyrosine residues of VEGFR-2
responsible for recruiting and activation of PI3K and its role as a
regulator of endothelial cell growth. These findings are important for
understanding the different roles of signaling molecules and the
different aspects of angiogenesis. Further studies will
delineate the contributions of other signaling molecules to different
cellular processes involved during angiogenesis.
We thank Cyrus Vaziri (Cancer Research Center,
Boston University) for providing the N17ras construct.
*
This work was supported in part by departmental grants from
Research To Prevent Blindness, Inc., the Massachusetts Lions Eye Research Fund Inc., and the American Cancer Society, Massachusetts Division, Inc. (to N. R.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Published, JBC Papers in Press, March 8, 2001, DOI 10.1074/jbc.M009128200
2
V. Dayanir, R. D. Meyer, K. Lashkari, and
N. Rahimi, unpublished data.
The abbreviations used are:
VEGFR, vascular
endothelial growth factor receptor;
PI3K, phosphatidylinositol
3-kinase;
PLC
Identification of Tyrosine Residues in Vascular Endothelial
Growth Factor Receptor-2/FLK-1 Involved in Activation of
Phosphatidylinositol 3-Kinase and Cell Proliferation*
,
Ophthalmology and
Biochemistry, School of Medicine, Boston University,
Boston, Massachusetts 02118 and the § Department of
Ophthalmology, Schepens Eye Research Institute, Harvard Medical School,
Boston, Massachusetts 02114
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1 (PLC
1), Src family tyrosine kinases, and phosphatidylinositol 3-kinase (PI3K), adaptor molecules, SHC, NCK, and Ras
GTPase-activating protein (7-10). The contributions of individual
signaling molecules to various aspects of angiogenesis and the tyrosine
sites on VEGFR-2 that potentially mediate their recruitment and
activation have not been fully investigated. Moreover, the data
presented in the literature is often inconsistent. Waltenberger
et al. (1994), Abedi and Zachary (1997), and Takahashi
et al. (1997) have suggested that stimulation of endothelial
cells with VEGF results in no PI3K activation (7, 8, 11), whereas
others have shown that VEGFR-2 activation does indeed result in PI3K
stimulation, which may stimulate endothelial cell growth and survival
(12, 13).
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
, anti-mouse, and anti-rabbit secondary
antibodies were purchased from Transduction Laboratories (Lexington,
KY). Rabbit anti-MAPK, anti-phospho-MAPK, anti-phospho-S6 kinase and
anti-phospho-AKT antibodies were purchased from New England BioLabs
(Boston, MA). Pan anti-Ras antibody was purchased from Oncogene Science
(Boston, MA). Rabbit anti-phospho-PLC
antibody was purchased from
BIOSOURCE (Camarillo, CA). Rabbit anti-VEGFR-2
antibody was made to amino acids corresponding to kinase insert of
VEGFR-2. Wortmannin and rapamycin were purchased from Sigma Chemical
Co. (St. Louis, MO). PD98059 was purchased from Calbiochem (San Diego,
CA). GST-SH2 fusion proteins of p85 were purchased from Upstate
Biotechnology Inc. (Lake Placid, NY).
-mercaptoethanol,
at 50 °C for 30 min, washed in Western rinse, and reprobed with
antibody of interest.
-32P]ATP.
After 15 min of incubation at 30 °C, the reaction was stopped by
adding 20 µl of 6 N HCl and lipids were extracted by
adding 160 µl of CH3OH:CHCl3 (1:1). The
phospholipids in the organic phase were recovered and spotted onto
silica gel TLC plate (Merk) precoated with 1% sodium tartarate.
Migration was performed in CH3OH:CHCl3:H2O:25%
NH4OH, (45:35:7:3). The TLC plate was dried and autoradiographed.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (31K):
[in a new window]
Fig. 1.
Schematic representation of the construction
of the tyrosine mutant chimera VEGFR-2 and their expression and
activation in PAE cells. The tyrosine residues and amino acids
surrounding 799 and 1173 and replacement of these sites individually or
together to phenylalanine are shown. CKR/F2, double
mutations of 799 and 1173 (A). Semi-confluent PAE cells
expressing pLNCX2, CKR, CKR/F799, CKR/F1173, and CKR/F2
were lysed and blotted with anti-VEGFR-2 antibody (B).
Serum-starved semi-confluent PAE cells expressing CKR and tyrosine
mutant CKRs were either non-stimulated or stimulated with 20 ng/ml
CSF-1, lysed, and immunoprecipitated with anti-VEGFR-2 antibody. The
immunoprecipitated proteins were collected, resolved on
SDS-polyacrylamide gel electrophoresis, transferred to an Immobilon
membrane, and immunoblotted with anti-pY antibody. The same membrane
was reprobed with anti-VEGFR-2 antibody for protein level
(D).

View larger version (34K):
[in a new window]
Fig. 2.
Tyrosines 799 and 1173 are required for
VEGFR-2-mediated cell growth but not cell migration. Serum-starved
PAE cells expressing wild type CKR and tyrosine mutant CKRs were
treated with different concentrations of CSF-1, and DNA synthesis was
measured by [3H]thymidine uptake. The results are
expressed as the mean of (cpm/well) ± S.D. of quadruplicates
(A). The data are expressed as a ratio of stimulated over
non-stimulated samples. The same group of cells was subjected to
migration assay by plating the cells in top wells of a Boyden chamber.
CSF-1 (5 ng/ml) or DMEM medium was placed in the bottom chambers and
incubated at 37 °C for 8 h. Cells that crossed the membrane
were fixed and stained, and one representing field was counted. The
results are expressed as the mean of ± S.D. of 12 wells per each
cell line (B).
1--
To test whether PI3K is activated by CKR and
whether tyrosines 799 and 1173 contribute to its recruitment by
VEGFR-2, we first subjected PAE cells expressing CKR and mutant CKRs to
an in vitro PI3K assay. Stimulation of PAE cells expressing
CKR with CSF-1 resulted in strong activation of PI3K, as judged by PI3P
production. However, PI3P production by CKR/799 and CKR/F1173 was
significantly lower than by CKR. CKR/F2 was unable to stimulate PI3P
production above baseline (Fig.
3A).

View larger version (42K):
[in a new window]
Fig. 3.
Tyrosines 799 and 1173 of VEGFR-2 are
required for PI3K activation and for its association with p85 of
PI3K. Serum-starved PAE cells expressing wild type CKR and
tyrosine mutant CKRs were treated with CSF-1, washed, and lysed, and
cell extracts were normalized for protein and immunoprecipitated with
anti-pY antibody. The immunoprecipitates were washed and subjected to
in vitro PI3K assay. The products of the reaction were
analyzed by thin layer chromatography and visualized by
autoradiography. The origin and position of phosphatidylinositol
3-phosphate (PI3P) are indicated (A).
Serum-starved PAE cells expressing wild type CKR and tyrosine mutant
CKRs were treated with CSF-1 for 10 min, washed, and lysed, and cell
extracts were normalized for protein and immunoprecipitated with
anti-VEGFR-2 antibody. The immunoprecipitates were washed and subjected
to Western blot using anti-p85 antibody (B). The same
membrane was stripped and reprobed with anti-VEGFR-2 antibody
(C). Serum-starved PAE cells expressing wild type CKR and
tyrosine mutant CKRs were stimulated with CSF-1 for 10 min, washed,
lysed, and incubated with Sepharose-bound GST alone, GST-N-SH2-p85, or
GST-C-SH2-p85 fusion proteins. After extensive washing, the
precipitated proteins were subjected to Western blot analysis using
anti-VEGFR-2 antibody (D). Serum-starved PAE cells
expressing wild type CKR were stimulated with CSF-1 for 5-30 min,
washed, and lysed, and cell extracts were normalized for protein level
and subjected to Western blot using anti-phospho-Akt antibody
(E).
1 activation. For this purpose, serum-starved cells
were stimulated with CSF-1 and cell lysates were either immunoprecipitated with an anti-PLC
antibody and then subjected to
anti-phosphotyrosine Western blot analysis, or total cell lysates were
subjected to an anti-phospho-PLC
Western blot analysis. The results
showed that CKR and the mutant CKRs were able to stimulate tyrosine
phosphorylation of PLC
and no appreciable decrease in tyrosine
phosphorylation of PLC
was observed among CKR/F799, CKR/F1173, or
CKR/F2 in two different assays (Fig. 4,
A and C). These results suggest that tyrosines
799 and 1173 are not required for activation of PLC
, and most likely
other tyrosine sites on VEGFR-2 may act as docking sites for this
molecule. Therefore, it appears that mutations of tyrosines 799 and
1173 on VEGFR-2 do not impair the ability of this receptor to activate
PLC
, suggesting that these sites preferentially serve as binding
sites for p85 of PI3K.

View larger version (60K):
[in a new window]
Fig. 4.
Tyrosines 799 and 1173 of VEGFR-2 are not
required for PLC
1 activation.
Serum-starved PAE cells expressing wild type CKR and tyrosine mutant
CKRs were stimulated with CSF-1 for 10 min, washed, and lysed, and cell
extracts were normalized for protein level. Cells were
immunoprecipitated with anti-PLC
1 antibody and subjected to Western
blot using anti-pY antibody (A). Total cell lysates were
subjected to Western blot using anti-phosphoPLC
1 antibody
(C). The same membranes were stripped and reprobed with
anti-PLC
1 antibody (B and D).

View larger version (28K):
[in a new window]
Fig. 5.
Wortmannin and rapamycin inhibit CKR-mediated
cell proliferation. Serum-starved PAE cells expressing wild type
CKR pretreated with different concentrations of wortmannin
(A) or rapamycin (C) and stimulated with 1 ng/ml
CSF-1. DNA synthesis was measured by [3H]thymidine uptake
as described in Fig. 2. The results are expressed as the mean of
(cpm/well) ± S.D. of quadruplicates. The data are expressed as a
ratio of stimulated over non-stimulated samples. Serum-starved PAE
cells expressing wild type CKR and tyrosine mutant CKRs were stimulated
with CSF-1, washed, and lysed, and cell extracts were normalized for
protein level and subjected to Western blot using anti-phospho-S6
kinase (p70) antibody (B).

View larger version (26K):
[in a new window]
Fig. 6.
Activation of MAPK is not essential for
CKR-mediated cell proliferation. Serum-starved PAE cells
expressing wild type CKR and tyrosine mutant CKRs were stimulated with
CSF-1 for 10 min, washed, and lysed, and cell extracts were normalized
for protein level and total cell lysates were subjected to Western blot
using anti-phospho-MAPK antibody (A). The same membrane was
stripped and reprobed with anti-MAPK antibody (B).
Serum-starved PAE cells expressing wild type CKR were pretreated with
different concentrations of PD98059 and stimulated with 1 ng/ml CSF-1,
and DNA synthesis was measured by [3H]thymidine uptake.
The results are expressed as the mean of (cpm/well) ± S.D. of
quadruplicates (C). The data are expressed as a ratio of
stimulated over non-stimulated samples. Serum-starved PAE cells
expressing wild type CKR were pretreated with different concentrations
of PD98059 or left non-treated for 30 min, stimulated with CSF-1 for 10 min, washed, and lysed, and cell extracts were normalized for protein
level and total cell lysates were subjected to Western blot using
anti-phospho-MAPK antibody (D). The same membrane was
stripped and reprobed with anti-MAPK antibody (E).

View larger version (24K):
[in a new window]
Fig. 7.
Activation of the Ras pathway is not
necessary for CKR-mediated cell proliferation. PAE cells
expressing wild type CKR were infected with retrovirus containing
N17ras, cells were serum-starved for 24 h and
stimulated with different concentrations of CSF-1, and DNA synthesis
was measured by [3H]thymidine uptake. The results are
expressed as the mean of (cpm/well) ± S.D. of quadruplicates
(A). The data are expressed as a ratio of stimulated over
non-stimulated samples. PAE cells expressing wild type CKR were
infected with retrovirus-containing N17ras, as described in
A; however, cells were lysed and subjected to Western blot
analysis by using anti-Ras antibody (B).
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
and Ras/MAPK pathways. A single
mutation of 799 and 1173 on CKR partially inhibited PI3K activation and
cell proliferation. Additionally, double mutation of tyrosines 799 and
1173 totally abolished CKR's ability to stimulate PI3K activation and
endothelial cell growth but not cell migration. These results suggest
that distinct signaling pathways are activated by VEGFR-2 and are
responsible for the induction of endothelial cell growth and likely for
VEGF-induced angiogenesis. Consistent with mutant CKRs, pretreatment of
cells with wortmannin, a potent inhibitor of PI3K, blocked CKR's
ability to stimulate cell growth. Activation of PI3K results in PIP3
production, which can activate protein kinase C-
(23), Akt (24), and
stimulation of p70 S6 kinase (25). Our results show that rapamycin, a
potent inhibitor of the S6 kinase pathway (21), abrogates CKR-mediated
cell growth, suggesting that the PI3K/S6 kinase pathway is responsible
for CKR-mediated cell growth. Interestingly, it appears that activation of the PLC
and Ras/MAPK pathways is not involved in
VEGFR-2-stimulated growth of PAE cells. Nonetheless, activation of
these enzymes by CKR strongly suggests that these molecules are likely
to participate in the other VEGF-induced cellular processes such as
cell migration and cell differentiation.
1 in
VEGF-dependent signal relay. The initial observations
suggested that PLC
activation is increased in VEGF-stimulated cells
(8, 9, 26). Subsequent study showed that tyrosine 951 on the human VEGFR-2 is a major binding site for PLC
1 (27). In agreement with
this study, our results demonstrate that tyrosines 799 and 1173 of
mouse VEGFR-2 are not required for PLC
1 activation and likely
tyrosine 951 is the primary binding site for PLC
1. In addition, our
results demonstrate that, although PLC
1 is activated by VEGFR-2, its
activation is not required for VEGF-mediated endothelial cell growth.
Activation of PLC
1 has been shown to stimulate cell growth and
migration in a variety of cellular systems; however, its role in
VEGFR-2-mediated signal transduction and endothelial cell function is
largely unknown. Recently, it has been suggested that inhibition of
PLC
1 by pharmacological methods blocks VEGF-stimulated sinusoidal endothelial cell growth (28). Because sinusoidal cells
express both VEGFR-1 and VEGFR-2, it is difficult to judge the
contributions of each receptor to the observed PLC
1 activation.
1, and MAPK. Altogether, this
suggests that during angiogenesis stimulation of the PI3K/S6 kinase
pathway by VEGFR-2 may influence endothelial cell growth and likely
endothelial cell survival leading to formation of new blood vessels.
Previous studies have suggested that activation of the PI3K/S6 kinase
pathway is essential for serum and fibroblast growth factor-stimulated endothelial cell growth (35, 36), implying that activation of PI3K by a
variety of factors in the endothelial cells serves as a molecular
switch to control cell proliferation.
![]()
ACKNOWLEDGEMENT
![]()
FOOTNOTES
Funded by TUBITAK (the Scientific and Technical Research Council
of Turkey) NATO Science Scholarship and Turkish Education Foundation
Scholarship Programs.
To whom correspondence should be addressed: Depts. of
Ophthalmology and Biochemistry, School of Medicine, Boston University, 715 Albany St.. Rm. L921, Boston, MA 02118. Tel.: 617-638-5011; Fax:
617-638-5337; E-mail: nrahimi@bu.edu.
![]()
ABBREVIATIONS
1, phospholipase-C
1;
VEGF, vascular endothelial
growth factor;
PAE, porcine aortic endothelial cells;
CKR, VEGFR-2
chimera;
MAPK, mitogen-activate protein kinase;
PD98059, a MAPK
inhibitor;
DMEM, Dulbecco's modified Eagle's medium;
ACE, adrenal microvascular endothelial cells;
pY, phosphotyrosine;
GST, glutathione S-transferase;
PI3P, phosphatidylinositol
3-phosphate.
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1.
Shalaby, F.,
Rossant, J.,
Yamaguchi, T. P.,
Gertsentein, M.,
Fu Wu, X.,
Breitman, M. L.,
and Schuh, A. C.
(1995)
Nature
376,
62-66
2.
Millauer, B.,
Shawver, L. K.,
Plate, K. H.,
Risau, W.,
and Ullrich, A.
(1994)
Nature
367,
576-579
3.
Kim, K. J.,
Li, B.,
Winer, J.,
Armanini, M.,
Gillett, N.,
Phillips, H. S.,
and Ferrara, N.
(1993)
Nature
362,
841-844
4.
Fong, G. H.,
Zhang, L.,
Bryce, D. M.,
and Peng, J.
(1999)
Development
126,
3015-3025
5.
Rahimi, N.,
Dayanir, V.,
and Lashkari, K.
(2000)
J. Biol. Chem.
275,
16986-16992
6.
Hiratsuka, S.,
Minowa, O.,
Kuno, J.,
Noda, T.,
and Shibuya, M.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
9349-9354
7.
Waltenberger, J.,
Calaesson-Welsh, L.,
Siegbahn, A.,
Shibuya, M.,
and Heldin, C.-H.
(1994)
J. Biol. Chem.
269,
26988-26995
8.
Takahashi, T.,
and Shibuya, M.
(1997)
Oncogene
4,
2079-2089
9.
Igarashi, K.,
Isohara, T.,
Kato, T.,
Shigeta, K.,
Yamano, T.,
and Uno, I.
(1998)
Biochem. Biophys. Res. Commun.
246,
95-99
10.
Guo, D.,
Jia, Q.,
Song, H. Y.,
Warren, R. S.,
and Donner, D. B.
(1995)
J. Biol. Chem.
270,
6729-6733
11.
Abedi, H.,
and Zachary, I.
(1997)
J. Biol. Chem.
272,
15442-15451
12.
Thakker, G. D.,
Hajjar, D. P.,
Muller, W. A.,
and Rosengart, T. K.
(1999)
J. Biol. Chem.
274,
10002-10007
13.
Gerber, H. P.,
McMurtrey, A.,
Kowalski, J.,
Yan, M.,
Keyt, B. A.,
Dixit, V.,
and Ferrara, N.
(1998)
J. Biol. Chem.
273,
30336-30343
14.
Soker, S.,
Takashima, S.,
Miao, H. Q.,
Neufeld, G.,
and Klagsbrun, M.
(1998)
Cell
92,
735-745
15.
Kendall, R. L.,
Wang, G.,
and Thomas, K. A.
(1996)
Biochem. Biophys. Res. Commun.
226,
324-328
16.
Ory, D. S.,
Neugeboren, B. A.,
and Mulligan, R. C.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
11400-11406
17.
Rahimi, N.,
Tremblay, E.,
and Elliott, B.
(1996)
J. Biol. Chem.
271,
24850-24855
18.
Rahimi, N.,
Hung, W.,
Tremblay, E.,
Saulnier, R.,
and Elliott, B.
(1998)
J. Biol. Chem.
273,
33714-33721
19.
Sonyang, Z.,
Shoelson, S. E.,
Chaudhuri, M.,
Gish, G.,
Pasown, T.,
Roberts, T.,
et al..
(1993)
Cell
72,
767-778
20.
Yano, H.,
Nakanishi, S.,
Kimura, K.,
Hanai, N.,
Saitoh, Y.,
Fukui, Y.,
Nonomura, Y.,
and Matsuda, Y.
(1993)
J. Biol. Chem.
268,
25846-25856
21.
Lane, H. A.,
Fernandez, A.,
Lamb, N. J.,
and Thomas, G.
(1993)
Nature
363,
170-1702
22.
Alessi, D. R.,
Cuenda, A.,
Cohen, P.,
Dudley, D. T.,
and Saltiel, A. R.
(1995)
J. Biol. Chem.
270,
27489-27494
23.
Chou, M. M.,
Hou, W.,
Johnson, J.,
Graham, L. K.,
Lee, M. H.,
Chen, C. S.,
Newton, A. C.,
Schaffhausen, B. S.,
and Toker, A.
(1998)
Curr. Biol.
8,
1069-1077
24.
Stokoe, D.,
Stephens, L. R.,
Copeland, T.,
Gaffney, P. R.,
Reese, C. B.,
Painter, G. F.,
Holmes, A. B.,
McCormick, F.,
and Hawkins, P. T.
(1997)
Science
277,
567-570
25.
Romanelli, A.,
Martin, K. A.,
Toker, A.,
and Blenis, J.
(1999)
Mol. Cell. Biol.
19,
2921-2928
26.
Cunningham, S. A.,
Arrate, M. P.,
Brock, T. A.,
and Waxham, M. N.
(1997)
Biochem. Biophys. Res. Commun.
240,
635-639
27.
Wu, L. W.,
Mayo, L. D.,
Dunbar, J. D.,
Kessler, K. M.,
Baerwald, M. R.,
Jaffe, E. A.,
Wang, D.,
Warren, R. S.,
and Donner, D. B.
(2000)
J. Biol. Chem.
275,
5096-5103
28.
Takahashi, T.,
Ueno, H.,
and Shibuya, M.
(1999)
Oncogene
18,
2221-2230
29.
Rameh, L. E.,
Chen, C. S.,
and Cantley, L. C.
(1995)
Cell
83,
821-830
30.
Carpenter, C. L.,
and Cantley, L. C.
(1996)
Biochim. Biophys. Acta
1288,
M11-M16
31.
Derman, M. P.,
Chen, J. Y.,
Spokes, K. C.,
Songyang, Z.,
and Cantley, L. G.
(1996)
J. Biol. Chem.
271,
4251-4255
32.
Ponzetto, C.,
Bardelli, A.,
Zhen, Z.,
Maina, F.,
dalla Zonca, P.,
Giordano, S.,
Graziani, A.,
Panayotou, G.,
and Comoglio, P. M.
(1994)
Cell
77,
261-271
33.
Cunningham, S. A.,
Waxham, M. N.,
Arrate, P. M.,
and Brock, T. A.
(1995)
J. Biol. Chem.
270,
20254-20257
34.
Jiang, B. H.,
Zheng, J. Z.,
Aoki, M.,
and Vogt, P. K.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
1749-1753
35.
Vinals, F.,
Chambard, J. C.,
and Pouyssegur, J.
(1999)
J. Biol. Chem.
274,
26776-26782
36.
Kanda, S.,
Hodgkin, M. N.,
Woodfield, R. J.,
Wakelam, M. J.,
Thomas, G.,
and Claesson-Welsh, L.
(1997)
J. Biol. Chem.
272,
23347-23353
37.
Risau, W.
(1997)
Nature
386,
671-674
38.
Folkman, J.,
and D'Amore, P.
(1996)
Cell
87,
1153-1155
39.
Rahimi, N.,
and Kazlauskas, A.
(1999)
Mol. Biol. Cell
10,
3401-3407
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
C. R. Schnell, F. Stauffer, P. R. Allegrini, T. O'Reilly, P. M.J. McSheehy, C. Dartois, M. Stumm, R. Cozens, A. Littlewood-Evans, C. Garcia-Echeverria, et al. Effects of the Dual Phosphatidylinositol 3-Kinase/Mammalian Target of Rapamycin Inhibitor NVP-BEZ235 on the Tumor Vasculature: Implications for Clinical Imaging Cancer Res., August 15, 2008; 68(16): 6598 - 6607. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nakamura, N. Patrushev, H. Inomata, D. Mehta, N. Urao, H. W. Kim, M. Razvi, V. Kini, K. Mahadev, B. J. Goldstein, et al. Role of Protein Tyrosine Phosphatase 1B in Vascular Endothelial Growth Factor Signaling and Cell-Cell Adhesions in Endothelial Cells Circ. Res., May 23, 2008; 102(10): 1182 - 1191. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. R. Smith, N. H. James, I. Oakley, A. Wainwright, C. Copley, J. Kendrew, L. M. Womersley, J. M. Jurgensmeier, S. R. Wedge, and S. T. Barry Acute pharmacodynamic and antivascular effects of the vascular endothelial growth factor signaling inhibitor AZD2171 in Calu-6 human lung tumor xenografts Mol. Cancer Ther., August 1, 2007; 6(8): 2198 - 2208. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. K. Bone and M. J. Welham Phosphoinositide 3-kinase signalling regulates early development and developmental haemopoiesis J. Cell Sci., May 15, 2007; 120(10): 1752 - 1762. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Garcia Blanes, M. Oubaha, Y. Rautureau, and J.-P. Gratton Phosphorylation of Tyrosine 801 of Vascular Endothelial Growth Factor Receptor-2 Is Necessary for Akt-dependent Endothelial Nitric-oxide Synthase Activation and Nitric Oxide Release from Endothelial Cells J. Biol. Chem., April 6, 2007; 282(14): 10660 - 10669. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Schalk-Hihi, H.-C. Ma, G. T. Struble, S. Bayoumy, R. Williams, E. Devine, I. P. Petrounia, T. Mezzasalma, L. Zeng, C. Schubert, et al. Protein Engineering of the Colony-stimulating Factor-1 Receptor Kinase Domain for Structural Studies J. Biol. Chem., February 9, 2007; 282(6): 4085 - 4093. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Lin and W. C. Sessa Vascular Endothelial Growth Factor Signaling to Endothelial Nitric Oxide Synthase: More than a FLeeTing Moment Circ. Res., September 29, 2006; 99(7): 666 - 668. [Full Text] [PDF] |
||||
![]() |
M. Dance, A. Montagner, A. Yart, B. Masri, Y. Audigier, B. Perret, J.-P. Salles, and P. Raynal The Adaptor Protein Gab1 Couples the Stimulation of Vascular Endothelial Growth Factor Receptor-2 to the Activation of Phosphoinositide 3-Kinase J. Biol. Chem., August 11, 2006; 281(32): 23285 - 23295. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-B. Liang, L.-J. Ma, T. Naito, Y. Wang, M. Madaio, R. Zent, A. Pozzi, and A. B. Fogo Angiotensin Type 1 Receptor Blocker Restores Podocyte Potential to Promote Glomerular Endothelial Cell Growth J. Am. Soc. Nephrol., July 1, 2006; 17(7): 1886 - 1895. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z.-J. Liu, M. Xiao, K. Balint, A. Soma, C. C. Pinnix, A. J. Capobianco, O. C. Velazquez, and M. Herlyn Inhibition of endothelial cell proliferation by Notch1 signaling is mediated by repressing MAPK and PI3K/Akt pathways and requires MAML1 FASEB J, May 1, 2006; 20(7): 1009 - 1011. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, D. P. Dittmer, C. C. Tomlinson, F. D. Fakhari, and B. Damania Immortalization of Primary Endothelial Cells by the K1 Protein of Kaposi's Sarcoma-Associated Herpesvirus. Cancer Res., April 1, 2006; 66(7): 3658 - 3666. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Meyer, X. Qian, H.-C. Guo, and N. Rahimi Leucine Motif-dependent Tyrosine Autophosphorylation of Type III Receptor Tyrosine Kinases J. Biol. Chem., March 31, 2006; 281(13): 8620 - 8627. [Abstract] [Full Text] [PDF] |
||||